Insecticidal formulations based on bacillus megaterium and its metabolites

WO2025114839A3PCT designated stage expired Publication Date: 2025-08-21CÁRDENAS MANRÍQUEZ MARCELA +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/IB2024/061749
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-27
Filing Date
2024-11-23
Publication Date
2025-08-21

AI Technical Summary

Technical Problem

Current microbial biological agro-inputs lack the biological effectiveness of traditional chemical pesticides and can be toxic to other species or impractical for modern application methods like drone use.

Method used

Formulations based on a characterized strain of Bacillus megaterium, producing spores, crystals, primary and secondary metabolites, bioactive substances, and degradative enzymes, which exhibit specific pesticide properties against insects of the order Homoptera, usable in various formulations for in vitro and field applications across different phonological stages and cultivation systems.

Benefits of technology

The formulations demonstrate high effectiveness against Homoptera insects without toxicity to beneficial organisms, offering a broad spectrum of activity across various crops and cultivation systems, and can be applied using various methods including drones.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2024061749_21082025_PF_FP_ABST
    Figure IB2024061749_21082025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides formulations with specific pesticidal activity against insects of the order Homoptera, based on a characterized strain of Bacillus megaterium which produces spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where the bacteria and / or its fermentation products, both intracellular and extracellular are active ingredients, with pesticidal activity both in vitro and when applied in any phenological state of the plant, both to foliage, fruit, stem, root, for various botanical groups such as Bulbs; brassicas; legumes; nightshades; cucurbits; cereals; citrus, berries, forest and leafy vegetables.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] INSECTICIDAL FORMULATIONS BASED ON Bacillus megaterium AND ITS METABOLITES

[0002] Field of the Invention

[0003] The present invention is related to the agribusiness sector. Particularly, the present invention refers to several formulations with pesticidal activity based on bacteria, and their fermentation products, both extracellular and intracellular, which can be primary and secondary metabolites, bioactive substances and enzymes. More specifically, the present invention relates to a characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, where the bacteria and / or its fermentation products, both intracellular and extracellular, have specific pesticide properties against insects of the order Homoptera both in vitro and when applied in any phonological state of the plant, both to foliage, fruit, stem, root, for various botanical groups such as Bulbs; brassicas; legumes; nightshades; cucurbits; cereals; citrus, berries, forestry and leafy vegetables in any growing system, e.g. soil, aeroponics and hydroponics. Included in the present invention is a method for formulating the microbial pesticide based on the optimal concentrations of each active ingredient in the final mixture for liquid formulations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form which, when dissolved in water or vegetable and / or mineral oils, can be applied to the plant by irrigation systems such as drip, pressure ground spray equipment, micro-spray, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0004] Background of the Invention

[0005] Currently, microbial biological agro-inputs are characterized by containing one or more components obtained through fermentation of microorganisms with fertilizing or pesticide activity, mainly due to the zero residuality in soil and in the plant, which allows farmers to access markets with higher added value by complying with increasingly strict international regulations. However, the biological effectiveness of biological pesticides currently on the market has not managed to reach the biological effectiveness of traditional chemical inputs and in some cases, the concentration that must be applied in field conditions could be toxic to other species or is unfeasible in more modern systems, such as the use of drones for example. Thus, biological products with excellent biological effectiveness and competitive power have a large potential market. The formulations described here have these characteristics and do not have a toxic effect against other insects or beneficial organisms, so their ecological value is distinguished. In this sense, in the state of the art there are known some documents that protect biological products based on microorganisms, some of them specifically of the Bacillus genus, most of them describe application as a fertilizer, inoculant, or plant growth promoter, be it root, foliage and / or flowering and / or fruit induction. Which, through the induction of plant growth, improve the response of plants to some insects. For example, Pat. App. Pub. No. US2020347102A1 provides compositions that had an improved capacity to encourage plant growth and / or improve plant health or that showed improved activity against insects, mites, nematodes and / or phytopathogens. The compositions include a) recombinant exosporium-producing Bacillus cells that express a fusion protein comprising: (i) at least one plant growth stimulating protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a plant growth stimulating compound; an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source; and a protein or peptide that protects a plant from a pathogen or pest; and (ii) a targeting sequence that localizes the fusion protein to the exosporium of Bacillus cells; and b) at least one particular strain described herein other than said recombinant Bacillus cells according to the invention, the ability to preferably enhance in a superadditive manner (i) plant growth, plant yield and / or plant health and / or (ii) activity against insects, mites, nematodes and / or phytopathogens. This application is not related to the use of the present invention and moreover, it is a recombinant strain of Bacillus.

[0006] Pat. Pub. No. US 8609936 B2 discloses an isolated polynucleotide encoding an insect inhibitory protein TIC807 or an insect inhibitory protein fragment derived therefrom and its use in an inhibitory composition. The insect inhibitory composition comprises a fluid oil suspension comprising lysed or unlysed bacterial cells, spores or crystals containing one or more of B. thuringiensis crystal proteins, however, any bacterial host cell that expresses the novel nucleic acid segments described herein and produces a crystal protein is contemplated as useful, such as Bacillus spp., including B. megaterium, B. subtilis; B. cereus, Escherichia spp., including E. coli and / or Pseudomonas spp., including P. cepacia, P. aeruginosa and P. fluorescens. Alternatively, the fluid suspension in oil may consist of a combination of one or more of the following compositions: lysed or non-lysed bacterial cells, spores, crystals and / or purified crystalline proteins. This patent differs from the present invention in that it uses Bacillus megaterium but as a host agent for the insect inhibitory protein TIC807 or a fragment thereof, however it does not describe application of Bacillus megaterium or its metabolites as pesticidal agents.

[0007] Pat. Pub. No. MX 384128 B relates to a method for modulating pest infestation in a plant comprising applying to the plant and / or its seeds and / or substrate used to grow said plant a composition comprising: (a) a whole cell broth, supernatant, filtrate, extract or cell fraction from fermentation of Bacillus megaterium strain H491 (NRRL Accession No. B-50769); and (b) at least one of a carrier, diluent, surfactant, or adjuvant. The invention also relates to a method for modulating plant growth comprising contacting said plant with the whole cell broth, supernatant, filtrate, extract or cell fraction from fermentation of Bacillus megaterium strain H491 (NRRL Accession No. B-50769). This patent describes a method for preventing plant infestation by inducing plant growth in a Bacillus megaterium broth and promoting plant growth, and basically differs from the formulations object of the present invention in that they kill the target pests that occur at any phonological stage of the crop, without requiring an application in preparation for sowing.

[0008] In a similar sense, Pat. App. Pub. No. US 2022315885A1 describes a method for decreasing nematode infestation and / or promoting growth in a plant comprising the step of: applying to the plant and / or seeds thereof and / or substrate used to cultivate said plant an effective amount of a whole cell broth collected from the fermentation of Bacillus megaterium strain 0.1142 (NRRL Accession No. B-50769), wherein said Bacillus megaterium strain J142 (NRRL Accession No. B- 50769) comprises a 16S rRNA sequence as set forth in SEQ ID NO. 7; and optionally another substance, wherein said substance is a pesticide and / or a plant growth promoting agent. Basically, this patent differs from the present invention in that, again, it is necessary to grow the plant in the presence of the strain prior to sowing and that the alternative agent is the one that exhibits pesticidal activity and promotes plant growth.

[0009] Thus, the search of the state of the art shows that the formulations object of the present invention have technical advantages over similar technologies found, since none of them directly mentions the application, in vitro or in the field, at any phonological stage of the plant, of formulations based on Bacillus megaterium, and / or its intra or extra cellular fermentation products, spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where the bacteria and / or its fermentation products exhibit in themselves the specific pesticidal activity against the insect pest, without causing toxic effects against beneficial insects, for the entire range of crops described herein. Neither are any of the formulations object of the present invention described in the state of the art nor the method of application in the field at any phonological stage of the crop. Therefore, there is no formulation in the state of the art based on Bacillus megaterium, and / or its fermentation products with insecticidal activity against insects of the order Homoptera in various formulations for in vitro or field application, in any phonological state of the botanical groups Bulbs; brassicas; legumes; solanaceae; cucurbits; cereals; citrus, berries, forestry and leafy vegetables in any cultivation system, whether soil, aeroponics and hydroponics. Nor is there in the state of the art the description of a method for the manufacture of the different formulations or the method of application in vitro and / or in the field.

[0010] Summary of the Invention

[0011] To overcome the deficiencies of the prior art, It is, therefore, an object of the present invention to provide formulations based on a characterized strain of Bacillus megaterium, which is producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, wherein the bacteria and / or their products of fermentation, both intracellular and extracellular, have specific pesticide properties against insects, such as insects considered plagues in crops or insects considered plagues in other environments, e.g. cockroachs. Particularly of the order Homoptera, both in vitro and when applied in any phonological state of the plant, e.g. foliage, fruit, stem, root, for various botanical groups such as Bulbs; brassicas; legumes; nightshades; cucurbits; cereals; citrus, berries, forestry and leafy vegetables in any cultivation system, be it soil, aeroponics and hydroponics.

[0012] A further object of the present invention is to provide a method for preparing formulations based on a characterized strain of B. megaterium based on the optimal concentrations of each active ingredient in the final mixture. In a particular aspect, the formulations of the present invention can be found in liquid form, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or in vegetable and / or mineral oils, they can be applied to the plant by irrigation systems such as drip, pressure terrestrial spraying equipment, micro-sprinkling using drones, nebulization and micronizers. The formulations are highly effective and have no toxicity for other beneficial insects.

[0013] In a particular aspect, the strain of B. megaterium of SEQ ID NO:1 according to the present invention has been isolated and characterized demonstrating the ability to ferment lactose, produce an amine which neutralizes the acid produced by the fermentation of glucose, it has the enzyme tryptophan deaminase, uses glucose through the butylene-glycolic pathway. Moreover, the strain of B. megaterium has the capacity to metabolize gelatin and during the process it has the capacity for fermentation and oxidation.

[0014] Additionally, according to the present invention, it is found that various fractions of intra and extracellular metabolites maintain the pesticidal capacity against insects of the order Homoptera, both in vitro and in cultivation systems such as soil, substrate, aeroponics and hydroponics. These fractions can be, for example, spores, crystals, viable cell-spore-crystal complexes, sugars, fats, proteins, hormones, among others. Specifically, there are different intra and extracellular proteins with pesticidal activity, some specific for aphids, others for midges and some with activity against both genera of insects. On the other hand, there are different fractions of fatty acids and cerides, both intra and extracellular, which have insecticidal activity, some specific for aphids, others for midges and some with activity against both genera of insects.

[0015] Additionally, according to the present invention, the strain has fungicidal activity for the biological control of phytopathogenic fungi. It is capable of strongly inhibiting the growth of Alternaria alternate and Xantomonas' and of sufficiently controlling the moderate growth of Phytophtora capsici and Rhizoctonia Solani.

[0016] These and other objectives are achieved through a series of formulations, which are mainly made up of fermented fractions of a characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances, hormones, degradative enzymes, which are added in special quantities expressed in Colony Forming Units (CFUs) in the case of viable cells, total cells in the case of number of spores, crystal and cell-spore-crystal complex, Absorbance Units (DO) in the case of reducing sugars, metabolites and fermentation products such as sugars, fats and others; micrograms of protein (pg) in the case of proteins, peptide fragments, crystal, enzymes and hormones, which complement the formulation as active ingredients and provide insecticidal / pesticidal activity; and a variety of inert ingredients that are added selectively depending on the type of presentation. The base formulation is a solution in two completely miscible phases, an aqueous one that contains the water-soluble ingredients and cells and an oily one that contains the fat-soluble principles, both phases are easily suspended when shaken.

[0017] In a preferred embodiment, the composition comprises fermentation products of Bacillus megaterium cells as active ingredients in a concentration of at least 5% V / V (at least 1 x 109CFU / L of product); 0.1 % V / V preservatives; sodium alginate at least 1 .2% V / V as a preservative and solubilizing agent; soybean, safflower or palm oil at least 20% V / V as a vehicle for the fatsoluble and adherent fraction in the plant.

[0018] Additional features and advantages of the invention should be more clearly understood by the detailed description of the preferred embodiment thereof, given by means of non-limiting examples with reference to the accompanying drawings, in which:

[0019] Brief description of the drawings of the Invention

[0020] Having described the invention in the above general terms, reference will now be made to the accompanying drawings showing representative embodiments of the present invention, where:

[0021] Figure 1 is an image of the partial sense and antisense sequences of the 16S ribosomal gene, obtained by extraction of genomic DNA, purification and amplification of the 16S ribosomal gene fragment using the polymerase chain reaction (PCR). SEQ ID NO: 1. For this purpose, the oligonucleotides U1 and U2 reported in the literature are used. The sequence of the oligonucleotides is as follows: U1 5'-CCA GCA GCC GCG GTA ATA CG-3' and U2 5'-ATC GG(C / T) TAC CTT GTT ACG ACT TC-3'. The samples are sequenced with the labeled dideoxynucleotide method in the 3130 Genetic Analyzer sequencer (Applied Biosystems). Automated sequencers model 3500 and 3130 Series Genenetic Analyzer from Applied Biosystems, Verity Thermal Cycler for endpoint PCR from Applied Biosystems, NANODRP 1000 spectrophotometer from Thermo Scientific and an Eppendorf centrifugal concentrator were used.

[0022] Figure 2 is the family tree resulting from the sequence comparison of the isolated strain with those in the databases. The Geneius Prime 2019.1 .3 Biomatters Ltd. program and the Blast n algorithm were used to compare the obtained sequences with the database. As can be seen, the phylogenetic closeness with the sequences reported in the Blast n databases indicates a greater similarity with the 16S ribosomal gene of the strain with accession number MG430238, Priestia megaterium CS31. The “hit” of the pairing occurs from base 478 to 1445.

[0023] Figure 3 shows the alignment of partial sequences of the ribosomal gene of the strain of the pesticide isolate object of the present invention and the sequence of the 16S ribosomal gene of the strain Priestia megaterium strain CS31 , in the MG430238 locus of 1446 base pairs. The alignment occurs between base 478 and 1445.

[0024] Figure 4 shows images of biochemical abilities of the isolated strain of Bacillus megaterium object of the present invention.

[0025] Figure 5 shows images of dual confrontations of the isolated strain of Bacillus megaterium object of the present invention against phytopathogenic fungi and pathogenic bacteria.

[0026] Figure 6 is an image showing photographs of in vitro impregnation bioassays of the Bacillus megaterium strain of the present invention. An AmScope brand LED stereo binocular microscope - SE306R-PZ, WF10x and WF20x eyepieces, 20X / 40X / 80X magnification, 2X and 4X objectives, upper and lower LED illumination, black / white reversible phase plate were used. As examples, photographs of bioassays performed with adult insects of the species Bemicia tabaci and Melanaphis sacchari at 72 h of incubation of leaves treated with solutions corresponding to serial dilutions were shown. The negative control refers to treatment with water, the positive control was performed as described in the in vitro bioassay method with imidacloprid at the Lethal Dose 50 (LD50) concentration according to the instructions on the technical sheet attached to the product. The LD50 and Toxic Dose 50 (DT50) treatments correspond to the serial dilutions that were found as Toxic Dose 50 and Lethal Dose 50 through the Probit statistical analysis performed with the StatPlus® package.

[0027] Figure 7 is a process diagram that shows the formulation method of the liquid presentation of the microbial pesticide with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, metabolites, primary, secondary, bioactive substances and degradative enzymes, where both bacteria and / or their fermentation products, both intracellular and extracellular, have activity as an active ingredient. It is a formulation that may be in the form of liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or in vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, pressurized terrestrial spraying equipment, microspray, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0028] Figure 8 is a graph that shows the biological effectiveness in percentage of mortality determined by in vitro impregnation bioassays, the formulations were applied in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes. The graph contains treatment with water as a negative control and a treatment with the commercial pesticide Flonicamid as a positive control. The results of bioassays carried out with adult insects of the species Bemicia tabaci (whitefly) and Melanaphis sacchari (aphid) at 72 h of incubation of leaves treated with solutions corresponding to serial dilutions are presented.

[0029] Figure 9 shows some photographs of the results of biological effectiveness determined by in vitro impregnation bioassays of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the strain characterized by Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes. The image shows treatment with water as a negative control and treatment with the commercial pesticide Flonicamid as a positive control. An AmScope brand LED stereo binocular microscope - SE306R-PZ , WF1 Ox and WF20x eyepieces, 20X / 40X / 80X magnification, 2X and 4X objectives, upper and lower LED illumination, reversible white / black phase plate was used. As examples, photographs of bioassays carried out with adult insects of the species Bemicia tabaci and Melanaphis sacchari at 72 h of incubation of leaves treated with solutions corresponding to serial dilutions are shown.

[0030] Figures 10A and 10B show two graphs: determination of the biological effectiveness in percentage of mortality determined in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes both for the control of whitefly ( Bemisia tabaci) in the tomato crop (Section

[0031] A) and for the control of Cabbage aphid ( Brevicoryne brassicae ) in broccoli cultivation (Section

[0032] B). The results are not shown in percentage of control of the negative control (water) which was 0% nor the result of the percentage of positive control (Commercial product based on the active ingredient Flonicamid) which was 100%.

[0033] Figure 11 is an alternative process diagram to the formulation method of the various formulations of the microbial pesticide, in which cell lysis of the bacteria is carried out to obtain a higher concentration of intracellular metabolites in the fermented mixture. This has biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium , producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both the bacteria and / or their products of fermentation, both intracellular and extracellular, have activity as an active ingredient, it is applied for the formulation of various liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable oils and / or minerals, can be applied to the plant by irrigation systems such as drip, pressure ground spray equipment, microspray, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0034] Figures 12A to 12D show some photographs of the results of the determination of the biological effectiveness of formulations whose fermentation was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth, it is referred demonstratively but not limiting to crystal, spore and any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes. The photographs correspond to field sampling of the validation of the effect of liquid formulations, made from fermented products subjected or not to cell lysis in a Kale crop under open field conditions, with more than 4 Ha of land applied for each treatment, for the control of Brevicoryne brassicaei. Photographs A to D correspond to treatments as follows: Photograph 12A shows the effect of the treatment with a formulation in liquid presentation whose fermentation was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth. Photograph 12B shows the effect of treatment with a formulation in liquid presentation whose fermentation was not subjected to cell lysis. Photograph 10C shows that there is no phytotoxic damage to the crop due to the application of the treatment with the microbial pesticide. The 12D photograph shows the high specificity of the microbial pesticide on insects of the order Homoptera since insects of the species Coccinella septempunctata are observed alive on the same leaf next to the remains of aphid bodies.

[0035] Figure 13 shows the evidence of the aphid infestation in the Kale crop prior to treatment with the liquid formulations of the microbial pesticide object of the present invention and the effect of the formulations to control the infestation. Photographs 13A, 13B and 13C show the aphid infestation prior to treatment. Photographs 13D and 13E show the completely controlled Kale culture after the third application of the liquid formulations, made from fermentation subjected to cell lysis or not, object of the present invention.

[0036] Figures 14 and 15 show graphs and an image with photographs of results of the determination of the biological effectiveness as a pesticide of the formulations based on intracellular and extracellular fractions of fermentation based on the Bacillus megaterium strain of the present invention in a greenhouse, in tomato cultivation for the control of the Bemicia tabaci pest, respectively.

[0037] Figure 16 is the image of the 12% acrylamide gel electrophoresis of the total proteins of the four fractions F1 , F2, F3 and F4, corresponding to fractions 1 , 2, 3 and 4, respectively. The molecular mass (MW) marker shows the reference of the size of the proteins with respect to the distance in reference to the origin. Fraction F1 corresponds to total proteins, intra and extracellular, soluble, insoluble and corresponding to the spore. Fraction F2 corresponds to intracellular proteins and proteins insoluble in water. Fraction F3 corresponds to proteins and / or peptides that make up the parasporal crystal. Fraction 4 corresponds to extracellular proteins.

[0038] Figure 17 shows a Venn diagram that allows to visualize those proteins / peptides that showed greater potency in the bioassays against Bermicia tabaci and Melanaphis sacchari. The image shows in the pink set those proteins that have the highest potency against Bermicia tabaci, while in the green set those that showed the highest potency against Melanaphis sacchari. Finally, the proteins shown at the intersection of the two sets, those proteins with a high potency, which are effective against both genera of insects. In both cases, it is intracellular or extracellular proteins greater than 0.22 iM (Fraction 2) that showed the highest effectiveness, some proteins from Fraction 4, which contains water-soluble extracellular proteins showed higher potency than others, some proteins / peptides showed a high potency against both genera of insects, they were also mainly contained in fractions F2 and F4. Finally, a protein contained in fraction 1 , which represents all the proteins contained in the entire fermented product had a high potency against Melanaphis sacchari.

[0039] Figure 18 shows the two-dimensional electrophoretic pattern of sample Fraction 1. A molecular size label was used whose reference sizes are shown on the left and the different isoelectric points with reference to Lysozyme in MW are shown at the top.

[0040] Figure 19 shows the two-dimensional electrophoretic pattern of the sample Fraction 2. A molecular size label was used, the reference sizes of which are shown on the left and the different isoelectric points with reference to Lysozyme in MW are shown on the top.

[0041] Figure 20 shows the two-dimensional electrophoretic pattern of the sample Fraction 3. A molecular size label was used, the reference sizes of which are shown on the left and the different isoelectric points with reference to Lysozyme in MW are shown on the top.

[0042] Figure 21 shows the two-dimensional electrophoretic pattern of the sample Fraction 4. A molecular size label was used, the reference sizes of which are shown on the left and the different isoelectric points with reference to Lysozyme in MW are shown on the top.

[0043] Figure 22 shows the spots that were selected for identification by MALDI-TOF gas-mass spectrometry and the spectra compared against the database for Bacillus megaterium. Of the 18 samples selected, 6 samples showed high specificity as pesticides against whiteflies, 6 samples showed high specificity as pesticides against aphids, and 6 samples showed broad effectiveness against both whiteflies and aphids. The molecular sizes and isoelectric focusing of the 18 samples are shown in Table 12.

[0044] Figure 23 shows the spectra obtained for each of the 18 spot samples corresponding to the identified Protein / peptides.

[0045] Detailed description of the Invention

[0046] The present invention will now be described with respect to certain drawings, images, graphs and examples, but the invention is not limited thereto but only to the claims. The drawings, images, graphs and examples are schematic only and not limiting.

[0047] Furthermore, the terms first, second, third and like in the description and claims are used to distinguish between like elements and not necessarily to describe a sequence, whether temporal, spatial, in classification or otherwise. It is to be understood that the terms used herein are interchangeable under appropriate circumstances and that operation is possible in sequences other than those described or illustrated herein. Likewise, method steps described or claimed in a particular sequence may be understood to operate in a different sequence. It is to be noted that the term "comprising" as used in the claims is not to be construed as being restricted to the means listed below; it does not exclude other elements or steps. Therefore, it should be interpreted as specifying the presence of the indicated features, integers, steps or components referred to, but not excluding the presence or addition of one or more other features, integers, steps or components, or groups thereof. Therefore, the scope of the expression "a composition comprising A and B" should not be limited to compositions consisting solely of components A and B. It means that, with respect to the present invention, the only relevant components of the composition are A and B.

[0048] Reference throughout this specification to "an embodiment" or "an aspect" means that a particular feature, structure or characteristic described in relation to the embodiment or aspect is included in at least one embodiment or aspect of the present invention. Therefore, occurrences of the phrases "in an embodiment" or "in an aspect" in various places throughout this specification do not necessarily refer to the same embodiment or aspect but may refer to different embodiments or aspects. Furthermore, particular features, structures or characteristics of any embodiment or aspect of the invention may be combined in any suitable manner with any other particular feature, structure or characteristic of another embodiment or aspect of the invention, as would be apparent to one of ordinary skill in the art from this invention, in one or more embodiments or aspects.

[0049] Similarly, it should be appreciated that in the description various features of the invention are sometimes grouped into a single embodiment, figure, or description thereof in order to simplify the disclosure and to aid in the understanding of one or more of the various inventive aspects. This method of disclosure, however, should not be construed as reflecting an intent that the claimed invention requires more features than are expressly recited in each claim. Furthermore, the description of any individual drawing or aspect should not necessarily be considered as an embodiment of the invention. Rather, as the following claims reflect, inventive aspects are found in less than all of the features of a single embodiment described above. Therefore, the claims following the detailed description are expressly incorporated into this detailed description, with each claim standing alone as a separate embodiment of this invention.

[0050] Furthermore, although some embodiments described herein include some features included in other embodiments, combinations of features from different embodiments are intended to be within the scope of the invention and form still other embodiments, as will be understood by those skilled in the art. For example, in the following claims, any of the claimed embodiments may be used in any combination.

[0051] In the description provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practiced without these specific details. In other instances, well-known methods, structures, and techniques have not been shown in detail so as not to obscure the understanding of this disclosure. In the discussion of the invention, unless otherwise indicated, the disclosure of alternative values for the upper or lower limit of the allowable range of a parameter, together with an indication that one of said values is more preferred than the other, should be construed as an implied statement that each intermediate value of said parameter, lying between the most preferred and least preferred of said alternatives, is itself preferred to said less preferred value and also to each value lying between said less preferred value and said intermediate value.

[0052] The use of the term “at least one” may mean only one in certain circumstances. The use of the term “any” may mean “all” and / or “each” in certain circumstances.

[0053] The principles of the invention will now be described by a detailed description of at least one example relating to relevant features.

[0054] EXAMPLES

[0055] EXAMPLE 1. ISOLATION AND MOLECULAR IDENTIFICATION OF THE ISOLATE

[0056] With reference to the microorganism that makes up the formulation object of this invention, it is a strain isolated from soil as follows. The strain is an isolate from soil, isolated using a pasteurization protocol to obtain cells of the Bacillus genus . For this purpose, the 30 cm depth of the A horizon is used, which contains the greatest abundance of intermediates of the nitrogen and carbon cycle, as well as the greatest abundance of microorganisms and where the main soil processes take place. The soil is dried and sieved with a 40 mesh. The soil is processed by thermal shock at 80°C for 15 min and subsequently incubated at 0°C with sodium acetate. It is subsequently incubated and kept viable in nutrient agar. Its growth temperature in medium is 30°C. The identity at the genus and species level of the isolates is obtained by comparing the sequences of the 16S ribosomal gene with the sequences available in the NCBI databases and the Geneious Prime program. Deoxyribonucleic Acid (DNA) is extracted using a kit called QUIAGEN ® GENOME, according to the manufacturer's instructions and the sequence of the 16S ribosomal gene is obtained by means of the polymerase chain reaction (PCR) in a service laboratory. For this purpose, the oligonucleotides U1 and U2 reported in the literature are used. The sequence of the Oligonucleotides is as follows: U1 5'-CCA GCA GCC GCG GTA ATA CG-3' and U2 5'-ATC GG(C / T) TAC CTT GTT ACG ACT TC-3'. The samples are sequenced with the labeled dideoxynucleotide method on the 3130 Genetic Analyzer sequencer (Applied Biosystems). Automated sequencers model 3500 and 3130 Series Genenetic Analyzer from Applied Biosystems, Verity Thermocycler for endpoint PCR from Applied Biosystems, NANODRP 1000 spectrophotometer from Thermo Scientific and an Eppendorf centrifugal concentrator were used. The sequence of each strain is compared using the blastn program and the Genius® program is used to achieve greater similarity. The sequence that gives a similarity of 100% or close to it and the error closest to 0 is selected. With reference to Figure 1 , the partial sense and antisense sequences obtained by amplification of the 16 S ribosomal gene are presented. The sequence comparison shows that the pesticide strain object of the present invention has an identity of 99.3 % and 0 E value (error) with the sequence of the 16S ribosomal gene of the Priestia megaterium strain CS31 , at the MG430238 locus of 1446 base pairs. The alignment is between base 478 and 1445.

[0057] Referring to Figure 2, the family tree of the sequence comparison is shown. It was performed with the Geneious Prime program, using the Geneious tree builder tool, which performs a sequence alignment to build a phylogenetic distance matrix, using a global alignment type with “free end gaps”, at 93% similarity, with a Tamura-Nei type genetic distance model and a “neighbor-joining” phylogenetic tree construction method without “outgroup”. The phylogenetic tree constructed by comparing the 30 phylogenetically closest sequences is shown.

[0058] Referring to Figure 3, the alignment of partial sequences of the ribosomal gene of the strain of the pesticide isolate object of the present invention and the sequence of the 16S ribosomal gene of the strain Priestia megaterium strain CS31 , at the MG430238 locus of 1446 base pairs, is shown. The alignment is between base 478 and 1445.

[0059] EXAMPLE 2. BIOCHEMICAL SKILLS AND SUBSTRATE FERMENTATION OF THE Bacillus mec / aterium STRAIN

[0060] The present invention describes the biochemical ability of the isolated Bacillus megaterium strain to metabolize various substrates. These characteristics are used to design appropriate culture media for the production of various primary and secondary metabolites of biotechnological interest, such as proteins, crystals, enzymes, hormones, carbohydrates, peptides, among others. For this purpose, miniaturized Biomereux ® API type tests were carried out. The results of substrate fermentation are shown in Table 1.

[0061] Based on the API results, it is concluded that the Bacillus megaterium strain of the present invention can ferment various carbohydrates, produces an amine which neutralizes the acid produced by the fermentation of glucose, has the enzyme tryptophan deaminase, uses glucose through the butylene-glycolic pathway, has the ability to metabolize the gelatin and during the process it has the capacity for fermentation and oxidation.

[0062] Table 1 Additionally, tests were carried out to determine the strain's ability to fix atmospheric nitrogen, nitrogen fixation in culture medium, production of Indoleacetic Acid, production of siderophores, among others. This type of analysis allows, in addition to characterizing the strain, proves for applications as a biorational product in addition to biological pest control, such as biofertilizer, soil improver, inoculant and biofungicide. With reference to the methods used to evaluate each of the biochemical abilities that characterize the isolated strain of Bacillus megaterium object of the present invention, they were carried out as follows.

[0063] The Bacillus megaterium strain of the present invention has catalase activity, an enzyme responsible for catalyzing the decomposition of hydrogen peroxide into water and oxygen. This test is common to all aerobic and facultative anaerobic bacteria, including the Bacillus genus, and is commonly used to differentiate between other common soil bacteria. To determine catalase activity, a hoe is taken from a fresh culture of the bacteria in nutrient medium no more than 24 hours old and placed on a slide, to which 30% hydrogen peroxide is added. The formation of bubbles indicates a positive result. A drop of distilled water is used as a negative control, and a hoe from a culture under the conditions described above of a reference strain of Bacillus thutingiensis from the ATCC is used as a positive control. Likewise, the Bacillus megaterium strain of the present invention has the ability to fix atmospheric nitrogen and inorganic nitrogen added to the substrate, which allows it to provide crops with part of the nitrogen needs, converting it from a gaseous or inorganic form to a bioavailable form in the soil. This ability gives crops a delay in aging and increases the ability to carry out photosynthesis. To determine the ability to fix nitrogen, a nutrient solution is prepared based on 0.5 g / L of K2HPO4, 0.2 g / L of MgSC * 7H2O, 0.1 g / L NaCI, 0.5 g / L of yeast extract, 0.015 g I L FeCh * 6H2O, 5 g / L of malic acid, 4.8 g / L KOH which is added to agar and the pH is adjusted to 7 with KOH. The medium thus prepared is sterilized and 15 mL of a sterile Congo red solution at a concentration of 2.5 g / L is added. This culture medium is used to prepare petri dishes which are inoculated by extension with different dilutions of a fresh culture of no more than 24 h of the Bacillus megaterium strain object of the present invention. After 7 days of growth at 37°C, a discoloration of the medium is observed, indicating the fixation of the added nitrogen. The negative control is inoculated with sterile distilled water and the positive control with a reference strain from the ATCC with proven ability to fix nitrogen.

[0064] Likewise, the Bacillus megaterium strain of the present invention has the ability to fix atmospheric nitrogen and inorganic nitrogen added to the substrate, which allows it to provide crops with part of the nitrogen needs, converting it from a gaseous or inorganic form to a bioavailable form in the soil. This ability gives crops a delay in aging and increases the ability to carry out photosynthesis. To determine the ability to fix nitrogen, a nutrient solution is prepared based on 0.5 g / L of K2HPO4, 0.2 g / L of MgSC * 7H2O, 0.1 g / L NaCI, 0.5 g / L of yeast extract, 0.015 g / L FeCh * 6H2O, 5 g / L of malic acid, 4.8 g / L KOH which is added to agar and the pH is adjusted to 7 with KOH. The medium thus prepared is sterilized and 15 mL of a sterile Congo red solution at a concentration of 2.5 g / L is added. This culture medium is used to prepare petri dishes which are inoculated by extension with different dilutions of a fresh culture of no more than 24 h of the Bacillus megaterium strain object of the present invention. After 7 days of growth at 37°C, a discoloration of the medium is observed, indicating the fixation of the added nitrogen. The negative control is inoculated with sterile distilled water and the positive control with an ATCC reference strain with proven ability to fix nitrogen.

[0065] In addition, the Bacillus megaterium strain of the present invention has the ability to produce Indole Acetic Acid and other plant growth-promoting hormones such as auxin, cytokinin and gibberellin. These hormones induce an increase in the number, length and thickness of the roots and the number of root hairs, thereby achieving a greater uptake of nutrients and water, and the crop becoming more firmly attached to the substrate or soil. This has an increase in the growth and yield of the crop, as well as protection against adverse conditions such as drought. The production of Indole Acetic Acid was determined as follows: a sterile solution containing 23 g / L of Luria Bertani culture medium added with 1 g / L of L-tryptophan is prepared. The isolated strain of Bacillus megaterium object of the present invention is inoculated and incubated at 28 °C for 24- 48 h with shaking at 120 to 150 rpm. 10 of the fermented product are taken and the supernatant is obtained by centrifugation at 10,000 rpm for 10 min. 1 mL of the supernatant is mixed with 2 mL of Salkowski reagent, which contains 2 mL of concentrated sulfuric acid with 1 mL of 0.5 M ferric chloride and incubated at room temperature for 30 minutes in the dark. A pink to reddish color is indicative of the presence of IAA, while a straw yellow color is negative. The positive control is prepared by adding 1 mg of IAA in 2 mL of Salkowski reagent and the negative control is prepared with 1 mL of water in 2 mL of Salkowski reagent.

[0066] In addition, the isolated strain of Bacillus megaterium object of the present invention produces proteases, alpha-amylase, phytase and esterase, which gives it the ability to efficiently degrade biomolecules present in the substrate, leaving easily assimilated nutrients available in the soil for the use of the crop, in addition to the fact that bacteria with these abilities can grow in solid, complex substrates, as well as carry out more efficiently processes of colonization, invasion and adaptation to its niche, so it would have a greater possibility of persisting and adapting in adverse conditions in the soil. Likewise, it is known that microorganisms that possess these enzymes are capable of breaking the cell wall of pathogenic microorganisms, protecting the crop from diseases caused by fungi and disease-causing bacteria. The protease activity was determined by the following method. Preparing Petri dishes with agar containing 2% skimmed milk powder or 1% casein, and inoculate a 1 cm diameter punch of a fresh culture of the isolated strain of Bacillus megaterium, object of the present invention, no more than 24 h old. Incubating for at least 7 days at 37°C and the presence of discoloration of the circumference of the inoculum indicates hydrolysis of casein, due to the presence of extracellular proteases. Sterile distilled water is used as a negative control and a 0.1 % commercial protease solution is used as a positive control.

[0067] On the other hand, the isolated strain of Bacillus megaterium, object of the present invention, produces alkaline phosphatase, which gives it the ability to solubilize phosphorus from the soil and increase its bioavailability for crops. Specifically, phosphatases catalyze the hydrolysis of H3PO4 esters and anhydrides, and are responsible for the mineralization of organic phosphorus in the soil and the release of inorganic phosphorus necessary for microorganisms and plants. They are classified as acid phosphatases (E.C. 3.1 .3.2) and alkaline phosphatases (E.C. 3.1 .3.1 ). The acidic ones are produced by microorganisms and higher plants, while the alkaline ones are produced mainly by microorganisms. In particular, the isolate can solubilize and mineralize organic and inorganic forms of phosphorus; through the activity of alkaline phosphatase and the release of organic acids that increase the mobilization and availability of this element for plant nutrition. The determination of phosphate solubilizing activity is carried out as follows. A solution of 0.5 g / L of (NH4)SO4, 0.2 g / L of KCL, 0.3 g / L of MgSO4* 7H2O, 0.004 g / L of MnSO4* H2O, 0.002 g / L of FeSO4* H2O, 0.2 g / L of NaCI, 10 g / L of glucose, 0.5 g / L of yeast extract, 5 g / L of Ca3(PO4)2, 16 g / L of agar and 0.1 g / L of bromocresol purple is prepared. Petri dishes are prepared with this medium and inoculated with serial dilutions of the isolated strain of Bacillus megaterium object of the present invention, incubated for 9 days at 370C. The discoloration of the medium is a positive indicator of the enzymatic activity.

[0068] Finally, the isolated strain of Bacillus megaterium object of the present invention has the ability to solubilize elemental forms of sulfur, iron and zinc, useful for crop nutrition and as microelements required to carry out a variety of biochemical reactions. Sulfur has functions that serve the plant as a defense and detoxification system. Sulfur is important in the protection of cells, since it prevents dehydration by heat and drought and also plays a role in protecting cells from cold damage. In addition, it has been reported that the application of sulfur and iron is very effective for the control of diseases such as Phytophtora, Alternaria or Phytium in various crops. This complements the ability of the isolate to have antifungal activity, since it is capable of strongly inhibiting the growth of Alternaria alternate and Clavibacter; of sufficiently controlling the growth of Phytophtora capsici, and Rhizoctonia Solani in dual confrontation experiments in vitro. Iron solubilization is determined by siderophores production, which are extracellular molecules responsible for converting iron from a chemically insoluble to a soluble form. For this purpose, a mixture containing 85.5 piL of HCI / L, 27 mg of FeCl3*6H2O and 100 ml / L of 10 mM HCI with 1 .21 g / L of CAS and 1 .82 g / L of hexadecyl trimethyl ammonium bromide (HDTMA) is prepared. On the other hand, a solution 2 is prepared containing 40.32 g / L of PIPES buffer, 0.4 g / L of KH2PO4, 0.66 g / L of NaCI and 1.33 g / L of NH4CI, the pH is adjusted to 6.8 with 50% KOH. A solution 3 is also prepared containing 28.57 g / L of glucose, 28.57 g / L of mannitol, 7.04 g / L of MgSO4*7H2O, 0.15 g / L of CaCI2, 0.016 g / L of MnSO4*H2O, 0.02 g / L of H3BO3, 0.0005 g / L of CuSO4*5H2O, 0.017 g / L of ZnSO4*7H2O, 0.014 g / L of Na2Mo04 and a solution 4 containing 100 g / L of CAS amino acids in distilled water. All solutions are mixed and Petri dishes are prepared with this medium. The Petri dishes are inoculated with a 1 cm diameter punch of a culture of no more than 24 h of the isolated strain of Bacillus megaterium object of the present invention. It is incubated at 37 ° C for 5 days and the formation of an orange to brown halo indicates the activity of siderophores produced by the bacteria. As a negative control, sterile distilled water is placed in the Petri dishes and as a positive control a 0.1 % soluble iron solution. While, the zinc solubilization activity is carried out as follows. A solution containing 10 g / L of glucose, 5 g / L of yeast extract, 0.5 g / L of K2HPO4, 0.5 g / L of MgSC * 7H2O, 0.5 g / L of (NFU^SC , 0.5 g / L of zinc phosphate or zinc oxide and 20 g / L of agar is prepared, the pH is adjusted between 6.8-7.2 and Petri dishes are made with this mixture. The plates are inoculated with serial dilutions of a fresh culture of no more than 24 h of the isolated strain of Bacillus megaterium object of the present invention. It is incubated at 30°C for 7 days and the result is positive if a dark grey halo is formed, as an indicator of the release of zinc-solubilizing organic acids into the medium.

[0069] Referring to Figure 4, images of the biochemical abilities of the isolated strain of Bacillus megaterium object of the present invention are shown.

[0070] On the other hand, as regards the activity to control the growth of phytopathogenic fungi (biofungicide), the method to evaluate this activity is as follows. The strains of phytopathogenic fungi are isolated from soil contaminated with the fungi. For this purpose, the 30 cm depth of the A horizon is used, which contains the greatest abundance of spores and mycelium, as well as the greatest abundance of microorganisms and where the main soil processes take place. The soil is dried and sieved with a 40 mesh. The soil is processed by adding 250 mL of sterile 1 X PBS phosphate buffer solution for every 50 g of soil. The mixture is shaken in a reciprocal shaker for 2 h at room temperature. After this time, the mixture is filtered on Whatman 50 paper and the filtrate is kept at 4 °C until it is processed. 1 ml of serial dilutions of the filtrate are inoculated by inversion on a petri dish with Nutrient agar, potato dextrose agar (PDA) and Saboreau agar. The developed colonies are isolated by extension on a petri dish until axenic cultures are obtained. Each isolate is then processed for genomic DNA extraction using the Qiagen Quick-DNA™ Fungal / Bacterial Miniprep Kit and following the manufacturer's instructions. Then, the internal transcribed spacer region ITS1 and ITS4 comprising the 5.8S ribosomal gene is amplified to obtain the sense and antisense sequences of each of the phytopathogenic fungal isolates. For this purpose, the ITS1 and ITS4 oligonucleotides reported in the literature are used. The sequence of the oligonucleotides is as follows: ITS1 5'TCCGTAGGTGAACCTGCGG 3' and ITS4 5'TCCTCCGCTTATTGATATGC 3'. The samples are sequenced with the Sanger dideoxynucleotide method labeled in the 3130 Genetic Analyzer sequencer (Applied Biosystems). Automated sequencers model 3500 and 3130 Series Genenetic Analyzer from the Applied Biosystems brand were used, and the Verity Thermocycler for endpoint PCR from the Applied Biosystems brand. The sequence of each isolate is compared using the blastn program and the Genius® program is used to achieve greater similarity in the identity of the genus and species of the microorganism. The sequence that gives a similarity of 100% or close to it and the error closest to 0 is selected. As for the fungicidal or fungistatic ability, as well as bactericidal or bacteriostatic, in the case of bacteria that cause diseases in crops, such as clavibacter, it is carried out by means of dual confrontations, in culture plates on nutrient agar. In all cases, a 1 cm diameter punch is taken from a fresh culture of the fungus to be confronted no more than one week old and a punch is taken from a fresh culture on a nutrient agar petri plate no more than 24 hours old of the isolated strain of Bacillus megaterium that is the object of the present invention. Both punches are placed one at an opposite end to the other and are incubated at 28 °C for 7 days. A strong fungicidal activity is considered when the bacteria completely prevents the growth of the phytopathogenic fungus, even growing on the mushroom punch, invading its space and possibly hydrolyzing its cell wall to obtain nutrients from its fruiting body. Meanwhile, a fungistatic activity is considered when the bacteria allows a certain growth of the fungus, but not beyond 50% of the culture medium, from the end where the mushroom punch was inoculated. The bacteria, on the other hand, grows most of the time up to 50% of the space of the petri dish that corresponds to the end where the punch of the bacterial culture of the isolated strain of Bacillus megaterium object of the present invention was inoculated. Usually, a space free of growth of both microorganisms, fungus and bacteria, is maintained close to half of the Petri dish. In addition, the bactericidal or bacteriostatic activity of the isolated strain of Bacillus megaterium object of the present invention was evaluated by means of dual confrontations of the isolate against three different isolates of clavibacter.

[0071] The isolated strain of Bacillus megaterium object of the present invention shows activity as a fungicide and bactericide since it is capable of strongly inhibiting the growth of Alternaria alternata and Clavibacter, and fungistatic, since it has the ability to sufficiently control the growth of 8 different isolates of Phytophtora and Rhizoctonia Solani in dual confrontation experiments in vitro. Additionally, the isolated strain of Bacillus megaterium object of the present invention shows fungistatic activity against the phytopathogenic fungi Colletotrichum cobbittiense, Dactylonectria alcacerensis, Colletotrichum coccodes, Clonostachys rosea f. catenulata, Exserohilum turcicum and Epicoccum sherrardiae.

[0072] With reference to Figure 5, images of dual confrontations of the isolated strain of Bacillus megaterium object of the present invention against phytopathogenic fungi and pathogenic bacteria are shown.

[0073] EXAMPLE 3. In vitro PESTICIDAL ACTIVITY OF THE Bacillus megaterium STRAIN

[0074] In relation to the pesticide activity of the Bacillus megaterium strain that is the object of the present invention, said ability was evaluated through experiments called impregnation bioassays. The method consists of 5 steps, the first being the collection and maintenance of the target insect breeding stock, which are not sensitive or resistant to chemical or microbial pesticides and which functions as insect input for the bioassays. For this purpose, it is necessary to promote the reproduction of at least 5 generations of the different genera of insects, each one in the appropriate conditions of temperature, humidity and amount of light and food, whether food from a diet developed in the laboratory or well-fed with plants from various botanical groups according to the requirement of the target insect. In the case of feeding on plants, the plants must be harvested in conditions free of pests and insecticides that could generate false positives in the test. In reference to the second step of the Bioassay method, at least ten larvae are selected in the appropriate step of development for each genus of insect. In the case of the pesticide based on the Bacillus megaterium strain of the present invention, insects from the genera belonging to Hemiptera were used in the adult state, larvae of Plutella xylostella in the third instar and Spodoptera frugiperda must be in the adult step of development. On the other hand, leaves from the appropriate botanical group are selected to feed each genus of insect, whole leaves are preferred, for some crops, the distal portions. The leaves are washed and disinfected, cut to the size of the box. In reference to the third step of the bioassay method, ten serial dilutions are prepared based on ten, prepared from an initial solution of the microbial pesticide to be analyzed. The initial solution is made at a concentration of 0.1 g / ml (w / v or v / v). Water is used as a negative control, and one or more commercial products available on the market are used as a positive control. At least three leaves are immersed individually, for 10 seconds, in the serial dilution solutions of each treatment and placed on Petri dishes with bacteriological agar to a depth of 3-4 mm, to keep the leaf adhered to the bottom of the box. A napkin disk moistened with water is placed between the leaf and the agar. In reference to the fourth step of the bioassay method, ten larvae or adults of the target insects in the appropriate phonological step are placed on the leaf, such that 30 larvae are used for each treatment. The Petri dish lid is placed, and the Petri dishes are kept in an area where they are not exposed to direct light and in the same environmental conditions as the breeding stock. Mortality and toxicity are monitored every 24 hours until 72 hours. Larvae that are unable to make coordinated movement away from gentle stimulation with a searching pin or fine pointed forceps to the posterior segment of the body should be considered dead (combination of dead and severely affected). Anti-feeding effects (percentage of damage to leaf or larval growth) can also be recorded as additional information. In reference to the fifth step of the bioassay method, a PROBIT statistical analysis of mortality is carried out using the Statplus® software which performs a linear regression with the accumulated mortality data between the concentrations tested, from 0% to 100% mortality and predicts, with an error less than 0.05%, the lethal dose 50 and toxic dose 50. These data are important for various purposes: 1 ) Knowing the genus of insects that are controlled by the strain of Bacillus megaterium of the present invention and that will be considered for studies at the formulation and experimental field level; 2) Knowing the Minimum Effective Dose of the active ingredient, which the microbial pesticide formulations based on the Bacillus megaterium strain of the present invention must contain in order to maintain an effectiveness of at least 50% mortality, required by the Mexican regulations of the Federal Commission for the Protection against Sanitary Risks. 3) Establishing the 50% Lethal Dose (LD50) as a baseline to select formulations with biological effectiveness in vitro and in the experimental field. 4) Knowing the effectiveness and potency of the microbial pesticide based on the Bacillus megaterium strain of the present invention compared to commercial products available on the market.

[0075] Referring to Figure 6, an image is shown with photographs of some examples of insects that the Bacillus megaterium strain of the present invention can control in an in vitro bioassay experiment at LD50 and T50, for the examples of insects Bemicia tabaci and Melanaphis sacchari.

[0076] EXAMPLE 4. OPTIMIZATION OF FERMENTATION PARAMETERS AND DESIGN OF CULTURE MEDIA FOR THE STRAIN OF Bacillus megaterium.

[0077] In relation to the manufacturing process of various formulations of a microbial pesticide with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and enzymes, degradative, where both the bacteria and / or their fermentation products, both intracellular and extracellular, have activity as the active ingredient of said formulation, integrates two main steps, a first step is the Fermentation of the bacteria where all the active ingredients are generated. A second step of the manufacturing process is the formulation of the various liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, pressure ground spraying equipment, micro-sprinkling, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0078] In relation to the first step of the manufacturing process of the microbial pesticide, it was necessary to establish the optimal operating conditions of the fermentation step for the production in liquid medium of both the Bacillus megaterium strain , as well as derivatives, i.e., spores, crystals, and primary / secondary metabolites, bioactive substances and degradative enzymes, where both bacteria and / or their fermentation products, both intracellular and extracellular, are the object of the present invention. For this purpose, a method of scaling and optimization of parameters at different levels was followed, that is, the design and optimization of culture media and establishing the optimal operating conditions at the 2L flask level, at the 20L reactor level and at the 200L reactor level. The main response variable for optimization at each level was the biological effectiveness of the active ingredients in the fermented, measured by in vitro impregnation bioassays. Some other response variables were also measured as criteria to evaluate the success of the optimization, such as the number of Colony Forming Units; the total number of cells; the concentration of spores; the concentration of crystals; Optical density of cell- free fermentation as an indirect method of determining extracellular metabolites; the concentration of total protein and the concentration of reducing sugars, among others.

[0079] Regarding the design of culture media, commercial culture media were tested with and without mineral salts, and culture media were designed with various substrates such as carbon, nitrogen and mineral sources, according to the results obtained in example 2 of the present invention. Table 2 shows, in a demonstrative but non-limiting manner, some examples of culture media that showed high cell productivity with a corresponding high biological effectiveness in vitro. The optimal culture media for the growth of the Bacillus megaterium strain, as well as its intracellular and extracellular components object of the present invention, achieved cell yields of up to 1 x 1011CFU with a biological effectiveness for Bemicia tabacci of 97% and Melanaphis sacchari c! 92% lethal dose measured by in vitro impregnation bioassays. This percentage does not vary significantly (with a=0.05 in an analysis of variance and means comparison test) for the three different levels of volume scaling described in this example. It should be noted that the geometry of the 20 L and 200 L reactors is exact to scale in height and diameter.

[0080] Table 2

[0081] On the other hand, in relation to the optimal operating conditions for the three levels of fermentation scaling for the production of cells of the Bacillus megaterium strain, as well as its intracellular and extracellular components object of the present invention, the medium of optimal cultivation mentioned in this example and one operating variable was modified at a time, at three experimental levels, high, medium and low. For this purpose, a multifactorial experimental design was used. With respect to the optimization results at the three experimental levels of 2 L flask, 20 L reactor and 200 L reactor of operating volumes for the fermentation of cells of the Bacillus megaterium strain, as well as its intracellular and extracellular components object of the present invention, are shown in table 3. This table shows the ranges of operating values for each variable where V of E (L) represents the Escalation Volume, that is, total volume of the fermenter; V of O represents the Operating Volume (L); A represents the amount of air supplied to the reactor / h in psi; T represents Temperature in °C; CFU the number of colony-forming units (viable cells) at the end of fermentation; pH is reported as the average value at which fermentation is maintained; OD represents Optical Density and refers to all extracellular components soluble or insoluble in the culture medium; Prot refers to the concentration of total extracellular protein, that is, measured only in the culture medium in mg / L; AR refers to the concentration of reducing sugars at the end of fermentation in the culture medium and finally, the % of intracellular components is reported, which is quantified by a stain called malachite green staining, which is a staining of cells fixed in a slide that allows differentiation between spores, crystals and total cells. The fermentation time varies depending on the culture medium selected and ranges between 8 and 48 hours of fermentation.

[0082] Table 3

[0083] With reference to the first step of the manufacturing process of the microbial pesticide, the optimal operating conditions of the fermentation step were established for the production in liquid medium of both the Bacillus megaterium strain and its derivatives, i.e. spores, crystals, primary metabolites, secondary substances, bioactive substances and degradative enzymes, where both bacteria and / or their fermentation products, both intracellular and extracellular of the present invention.

[0084] EXAMPLE 5. DESIGN OF FORMULATIONS WITH PROVEN BIOLOGICAL EFFECTIVENESS In vitro and IN EXPERIMENTAL FIELD

[0085] In relation to a second step of the manufacturing process of various formulations of a microbial pesticide with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium , producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both bacteria and / or their fermentation products, both intracellular and extracellular, have activity as an active ingredient, it is a formulation of various liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, pressurized terrestrial spraying equipment, micro-spray, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters. For this purpose, various formulations were designed with components that do not present biological activity as active ingredients. However, the components of the formulations do have a positive effect on some physical, chemical and preservative characteristics of the formulations, by favoring dissolubility in water, impregnation and adhesion to the different botanical groups of crops and shelf life in warehouse conditions, among others.

[0086] In relation to the formulation method of the various forms, the composition of some ingredients for the formulation in liquid presentation is shown as an example, in a demonstrative but nonlimiting manner, in Table 4. With respect to Table 4, for the formulations that are provided as a demonstrative example, the appropriate amount of fermentation is selected to adjust to the necessary amount of active ingredients of both the Bacillus megaterium strain, as well as spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both the bacteria and / or their fermentation products, both intracellular and extracellular, are the object of the present invention. For this purpose, the concentration of said active ingredients in the fermented product is determined in the first instance, by determining Colony Forming Units (CFU), Optical Density (OD), total cells, concentration of spores, concentration of crystals, concentration of vegetative cells, protein concentration, sugar concentration, total lipid concentration. The amount of fermentation is then adjusted in a determined volume of water to set the concentration of active ingredients as required for the type of presentation of the formulation. With respect to the concentrations of the inert ingredients of the formulations of the various liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant in any of the systems previously described in this example, one to four preservatives are selected, without exceeding a maximum concentration of 0.05% and one to three different adherents, depending on the type of presentation.

[0087] Table 4

[0088] With reference to Figure 7 is a process diagram that shows the formulation method of the liquid presentation of the microbial pesticide with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both bacteria and / or their fermentation products, both intracellular and extracellular, having activity as an active ingredient, applicable for the formulation of various liquid presentations, wettable powder, granules and dispersible granule, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, pressurized terrestrial spraying equipment, microspray, nebulization , micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0089] With respect to the studies to determine the biological effectiveness of formulations in liquid presentation described in table 4, in vitro studies were carried out through impregnation bioassays and in an experimental field. For this purpose, 1 L of each formulation was diluted in the appropriate volume of water to resemble the dose of 1 L / Ha. In reference to the in vitro biological effectiveness studies using impregnation bioassays, it is described in example 3 of the present application.

[0090] With reference to the results of the biological effectiveness studies determined in vitro of liquid formulations described in Table 4, it was found that there is no significant difference in the biological effectiveness between the different formulations. The percentage effectiveness results of formulations, determined in vitro, reached a maximum of 80%. These results are usual for pesticide products made from microorganisms, 100% biological effectiveness is not achieved, so at least 3 applications are recommended between a period of 7 to 10 days between applications when used in the field. With respect to Figure 8, it is a graph that shows the biological effectiveness in percentage of mortality determined through in vitro impregnation bioassays , the formulations were applied in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium , producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes. The graph contains treatment with water as a negative control and a treatment with the commercial pesticide Flonicamid as a positive control.

[0091] With reference to Figure 9 is an image that shows some photographs of the results of biological effectiveness determined through in vitro impregnation bioassays of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based of the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites and any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes. The image shows treatment with water as a negative control and treatment with the commercial pesticide Flonicamid as a positive control.

[0092] With respect to the determination of biological effectiveness in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, metabolites primary, secondary, bioactive substances and degradative enzymes for the control of whitefly Bemisia tabacci) in tomato cultivation. The test was carried out on the cultivation of tomato (Solanum lycopersicum) Lubino variety, in the vegetative growth step, under agricultural conditions protected, located in the municipality of Texcoco, State of Mexico. The coordinates of the study were: 19°29'32.3"N 98°52'24.0"W. Ten different formulations of the product formulated at a dose of 1 L / ha, an absolute control (without application) and a commercial control (commercial pesticide Flonicamid) were evaluated at the dose recommended by the supplier. In total there were ten treatments with four repetitions each, distributed in a completely randomized block design. Each experimental unit was made up of 15 m2of surface (3 furrows 1 m wide x 5 m long). The surface of each treatment was 60 m2. The total surface area of the studio is 660 m2. The entire experimental unit was considered a useful plot. The evaluation was focused on monitoring the pest infestation. From each experimental unit, 10 leaflets were randomly selected and the total number of live nymphs per leaflet was counted. With the data from live nymphs, an analysis of variance and means comparison test were performed with the Tukey method (a=0.05). For the statistical analysis, the R v 4.0.2 program was used. An analysis was carried out for each evaluation date. Previous sampling was carried out to estimate the initial infestation of the pest; Subsequently, the control efficacy was evaluated at 7, 14 and 21 days after the first application (dd1 a) of the treatments.

[0093] • Number of live nymphs. From each experimental unit, 10 leaflets were selected at random. For each one, the number of live B. tabaci nymphs was counted. Per treatment, 40 leaflets were sampled to determine the pest infestation.

[0094] • Phytotoxicity: The possible phytotoxic effects caused by the application were assessed and described with the help of the EWRS (European Weed Research Society) scoring scale.

[0095] The recorded variables were subjected to an analysis of variance and a comparison of means test to order the biological effectiveness of the treatments (Tukey, a= 0.05). An analysis was done for each evaluation. The percentage of effectiveness of the treatments for the control of whitefly in tomato was obtained with the Abbott formula: 100

[0096] Wherein: IT= infestation in the absolute control it= infestation in the treatment

[0097] With respect to the results of the determination of biological effectiveness in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes for the control of whitefly Bemisia tabaci) in the tomato crop. It was found that the doses evaluated did not register a phytotoxic effect in the tomato crop. On the other hand, the percentage of biological effectiveness of all the formulations evaluated is between 50% and 80%, given that biological pesticide products do not exhibit 100% effectiveness like a conventional chemical product, the results for all formulations are successful, since they would comply with the Mexican regulations NOM-032-SAG / FITO-2014 to be considered in the control of whitefly in tomato cultivation. It should be noted that these results are preliminary because they are applied at an experimental field level in a randomized block design. Subsequently, field results under real conditions are described. On the other hand, with respect to the determination of biological effectiveness in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, which produces spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes for the control of Cabbage aphid (Brevicoryne brassicae) in a commercial crop of broccoli (Brassica oleracea var. italica) Imperial variety, the study was carried out in the municipality of Quecholac, Puebla. The coordinates of the study were: N 18°56'45.07" W 97°38'54.26". Ten different formulations of the product formulated at a dose of 1 L / ha, an absolute control (without application) and a commercial control (commercial pesticide Flonicamid) were evaluated at the dose recommended by the supplier. In total there were ten treatments with four repetitions each, distributed in a completely randomized block design. Each experimental unit was made up of 20 m2of surface (5 furrows 0.8 m wide x 5 m long). The surface of each treatment was 80 m2. The study area was 880 m2. Three applications of the test element were carried out. The first application was carried out at the time when the first live individuals of the pest were detected at the experimental site. The second and third application was carried out three and seven days after the first application, respectively. The applications were foliar, using a motorized backpack equipped with a previously calibrated full cone nozzle. Water consumption was 350 L / ha. An evaluation was carried out prior to the first application of the treatments and three efficacy evaluations at 3, 7 and 10 days after the first application (dd1 a). During the development of the study, the number of living individuals was evaluated. A sample of 10 plants was taken per experimental unit and the total number of live individuals per leaf was counted, which gave a total of 40 leaves per treatment. The recorded variable was subjected to an analysis of variance and a comparison of means test to determine the biological effectiveness of the treatments (Tukey = 0.05). Likewise, the possible phytotoxic effects caused by the application were evaluated, assessed and described with the help of the EWRS (European Weed Research Society) scoring scale. The percentage of effectiveness of the treatments for the control of whitefly in tomato was obtained with the Abbott formula, previously described.

[0098] With respect to the results of the determination of biological effectiveness in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes for the control of Cabbage aphid (Brevicoryne brassicae) in a commercial crop of broccoli ( Brassica oleracea var. italica ) Imperial variety It was found that the doses evaluated did not register a phytotoxic effect on the tomato crop. On the other hand, the percentage of biological effectiveness of some formulations evaluated is between 50% and 80%, again, given that biological pesticide products do not exhibit 100% effectiveness like a conventional chemical product, the results for all of the formulations are successful, since they would comply with the Mexican regulations NOM-032-SAG / FITO-2014. Some formulations did not show results greater than 50% biological effectiveness as they had shown in vitro, so a procedure was carried out to increase the concentration of intracellular metabolites in the fermented for some formulations. It should be noted that these results are preliminary because they are applied at an experimental field level in a randomized block design. Subsequently, results are shown with an effectiveness greater than 80% of control for aphids both in the greenhouse and in the open field under real conditions.

[0099] With reference to Figure 10 is a figure that shows two graphs: the determination of the biological effectiveness in percentage of mortality determined in the experimental field of the formulations in liquid presentation of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium , producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes both for the control of Cabbage aphid (Brevicoryne brassicae) in tomato cultivation (Section A) and for the control of Cabbage aphid (Brevicoryne brassicae) in broccoli cultivation (Section B). The results are not shown in percentage of control of the negative control (water), which was 0%, nor the result of the percentage of positive control (Flonicamid), which was 100%.

[0100] EXAMPLE 6. DESIGN OF FORMULATIONS BASED ON LYSED CELLS TO INCREASE THE CONCENTRATION OF INTRACELLULAR ACTIVE INGREDIENTS AND DETERMINATION OF THEIR BIOLOGICAL EFFECTIVENESS IN AN EXPERIMENTAL FIELD

[0101] With reference to liquid presentation formulations that did not achieve more than 50% of biological effectiveness in the experimental field through a randomized block design, it was decided to perform cell lysis in the fermented broth to increase the concentration of intracellular metabolites in the fermented culture medium, we refer to crystal, spore and any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes. In addition, the effect of the presence of the metabolites on the potency and biological effectiveness of the insecticide was verified in the open field, in crops with more than 4 Ha of land, as a demonstrative but not limiting example, crops that belong to the botanical groups such as brassicas; legumes; cereals and leafy vegetables. For this purpose, sodium dodecyl sulfate was used, which is an anionic detergent that solubilizes lipids and proteins, and destabilizes the structure of the cell membrane and sucrose, which causes a destabilization of the cellular structure through the transient change in osmotic pressure. To carry out cell lysis, experiments were made in a temperature range between 30eC and 40 °C in a time range between 1 and 5 hours, depending on the concentration of viable cells of the fermented product in question. After that time, the lysis reaction was stopped by keeping the mixture at 4 °C overnight. Subsequently, the same formulation process was followed. Regarding the process diagram including the cell lysis step as an alternative formulation option, it is shown in Figure 11. The formulation method of the liquid presentation of the microbial pesticide with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium is shown. The strain was subjected to cell lysis to obtain intracellular metabolites in the fermented broth to increase the concentration of intracellular metabolites in the already fermented culture medium, we refer to crystal, spore and any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes. The fermented broth also contains any other option of crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, non-lysed bacteria and their extracellular fermentation products that have activity as an active ingredient. This diagram applies to the formulation of the various liquid presentations, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, pressure ground spraying equipment, micro-sprinkling, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0102] With respect to the determination of the biological effectiveness of formulations whose fermentation was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth, we refer demonstratively but not limited to crystal, spore and any other primary, secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes, was verified in the first instance. The increase in the concentration of such primary metabolites was verified by determining the number of viable cells (CFU), number of total cells, protein concentration, lipid concentration, reducing sugar concentration, amount of free crystal and in cells, number of spores and any other metabolite was determined by increasing the OD (Compared before cell lysis and after it). The presence of the active ingredients obtained by cell lysis and their effect on the potency and biological effectiveness of the insecticide was validated in studies of insecticidal biological effectiveness in the open field, in crops with more than 4 Ha of land, as an example, demonstrative but not limiting, crops that belong to botanical groups such as brassicas; legumes; cereals and leafy vegetables. For this purpose, three doses were used for each crop, high, medium and low doses, and they were applied by low-pressure terrestrial spraying on the foliage of the crop. The high dose corresponds to 2 L / Ha, the medium dose to 1 L / Ha and the low dose to 0.5 L / Ha diluted in 1200 L of water. The application procedure, sampling days, data analysis and phytotoxicity verification were those reported for biological effectiveness studies in random blocks, with the difference in the amount of land applied for each dose (4 Ha for each dose). The results were analyzed by performing an analysis of variance and comparison of means test with an a=0.05 using the SAS ® statistical package. The effectiveness of the formulations for the control of aphids and whiteflies in various crops of the botanical groups already mentioned was monitored.

[0103] With respect to the results of the determination of the biological effectiveness of formulations whose fermentation was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth, we refer demonstratively but not limited to crystal, spore and any other primary and secondary metabolites, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes, the results are shown in Table 5. The results correspond to a 24-h fermentation in the culture medium and optimal operating conditions for a 20 L reactor with Operating Volume of 12 L. Bacillus megaterium produces crystalline bodies adjacent to the spore during sporulation. Various forms of crystals have been reported in bibliographic references, but no work related to the activity of the spores and / or crystals of this bacteria as a biological control agent for Homoptera has been reported. The pesticide activity of intracellular metabolites of the bacteria to control insects of the order Homoptera has not been reported so far. In reference to the results of Table 5, a greater amount of spore and crystal was obtained in the case of fermentation subjected to cell lysis and the effect of this treatment increased the biological effectiveness in the field of the formulations in any of the presentations described in this application, for the brassicase botanical groups; legumes; cereals and leafy vegetables.

[0104] Table 5

[0105] With respect to Figures 12A 12D, it is an image that shows some photographs of the results of the determination of the biological effectiveness of formulations whose fermentation was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth, we refer demonstratively but not limited to crystal, spore and any other primary and secondary metabolite, peptides, proteins, lipids, carbohydrates, bioactive substances and intracellular degradative enzymes. The photographs correspond to field sampling of the validation of the effect of the presence of the metabolites on the potency and biological effectiveness of the insecticide in the open field, in crops with more than 4 Ha of land, as a demonstrative but not limiting example, crops that belong to botanical groups such as leafy vegetables for the control of Brevicoryne brassicae. The field was completely infested with the pest, with 95% infestation with the various steps of development of the pest. Monitoring the effect of both formulations, both those formulated based on fermentation subjected to cell lysis and the formulations without treatment for cell lysis, showed high biological effectiveness for the control of aphids (Aphis spp.) in Kale cultivation from the second application, achieving control of approximately 85% of insect death in both cases. The monitoring results were analyzed using an analysis of variance and a comparison test of means to determine the biological effectiveness of the treatments (Tukey, = 0.05) and no significant difference was found. With respect to Figure 12A, the effect of treatment with a formulation in liquid presentation is shown, the fermentation of which was subjected to cell lysis to obtain the intracellular metabolites in the fermented broth. It can be observed in a crop leaf exposed to the formulation that there are practically no living individuals left and that the treatment has dehydrated the dead individuals, resembling a “desiccation” effect on the bodies of the insects. In the same photograph you can see some mummified insects, having previously been parasitized by other insects, since this event occurred prior to the treatment, the mummified insects remained intact during the treatment. Since these insects are dead and only contain the already dried cover, they did not suffer damage from the insecticide that is the object of the present invention. Since insects of the order Homoptera feed by sucking plant sap through their stylet, we assume that the biological control effect is through contact and absorption through the cuticle or dermis of the insect and not by feeding. On the other hand, with respect to Figure 12B, the effect of treatment with a formulation in liquid presentation is shown, the fermentation of which was not subjected to cell lysis, so it contains a high concentration of total cells containing intracellular metabolites, spores, crystals and / or any another type of active ingredient, in addition to a high percentage of viable cells. In the photograph it is observed an effect similar to the treatment with formulations whose fermentation was subjected to cell lysis (12A), both in the effect on the dead individuals, and in the amount of live insects that could remain as a remnant after the first application. Similar to photograph 12A, the “desiccation” effect occurs in all individuals that were alive, except insects previously parasitized by other insects. Furthermore, given that the number of dead individuals in both treatments is similar, it is considered that both fractions of active ingredients, both intracellular and extracellular, and the presence of viable cells are required for the “optimal” effect of biological control in the field. As for photograph 12C, it shows that there is no phytotoxic damage to the crop due to the application of treatment with the microbial pesticide (the same effect was observed for formulations in any of the presentations object of the present invention, made from exposed fermentates or not to cell lysis). On the other hand, regarding the 12D photograph, the HIGH SPECIFICITY of the pesticide for insects of the order Homoptera is observed, since on the same sheet there are the “desiccated” bodies of the individuals killed as a result of the treatment with the microbial pesticide (The same effect was observed for formulations in any of the presentations object of the present invention, made from fermented products exposed or not to cell lysis) and live ladybugs (Coccinella septempunctata) are observed on the same leaf next to the remains of bodies. In summary, the conclusions of this figure are very important facts to demonstrate the biological effect of the microbial pesticide object of the present invention. The type of highly specific lethal effect on the target Homoptera insects is demonstrated, it is demonstrated that the effect of both fractions, both all possible intracellular and extracellular and viable cells are required to achieve an “optimal” effect for biological control in Homoptera field in open field conditions, achieved from the first application. It is demonstrated that it is necessary for the Homoptera insect to be in contact with the treated plant or with any of the formulations made from the microbial pesticide that are the object of the present invention, and that the effect of the formulations that are the object of the present invention is through contact with the cuticle or dermis of the insect, or by absorption thereof.

[0106] With respect to Figure 13, evidence is presented of the infestation of aphids (Aphis spp.) in the Kale crop prior to treatment with the liquid formulations of the microbial pesticide object of the present invention, made with fermented, exposed or not to cell lysis. Photographs 13A, 13B and 13C show the infestation of aphids (Aphis spp.) prior to treatment. Photographs 13D and 13E show the completely controlled Kale culture after the third application of the liquid formulations, made from fermentation subjected to cell lysis or not, object of the present invention. A lush Kale crop field is observed, without phytotoxic damage, with complete control of the pest and with high productivity. Therefore, we conclude that the treatment with three applications of the formulation of the pesticide product object of the present invention prevents the subsequent infestation of Homoptera in crops of the botanical groups described as the object of the present invention. EXAMPLE 7. DETERMINATION OF THE PESTICIDE ACTIVITY OF VARIOUS FRACTIONS OF THE FERMENTED STRAIN Bacillus megaterium IN A GREENHOUSE

[0107] In relation to the determination of the biological effectiveness as a pesticide of the formulations based on intracellular and extracellular fractions of fermentation based on the Bacillus megaterium strain of the present invention in a greenhouse, in tomato cultivation for the control of the Bemicia tabaci pest, it was used a method that allowed separating both fractions and evaluating their biological effectiveness in a productive greenhouse. For this purpose, once the optimal culture medium, the optimal operating conditions at the 20 L reactor level and the optimal formulations in the field for the control of insects of the order Homoptera were selected, a fermentation was carried out under optimal operating conditions and collected the fermented. This was centrifuged at 14,000 rpm for ten minutes, in order to generate a pellet of cells, spores and crystals. The supernatant was separated from the pellet using a 0.2 micron diameter filtration system. The pellet was called the intracellular fraction, which contained cells-spores-crystals, and the supernatant was called the extracellular fraction. The response variables described in Example 4 of the present disclosure were determined and both fractions were resuspended in sterile water at the appropriate active ingredient concentration for the final formulation in liquid presentation. The formulations of both fractions were applied to 35 tomato plants Solarium lycopersicum) grown in greenhouse conditions in September 2020 in the City of Cortazar Guanajuato (Latitude: 20.4828, Longitude: -100.961 20° 28' 58” North, 100° 57' 40” West). The greenhouse conditions were between 20 and 25 °C, relative humidity of 60 to 65%, soil with a siliceous-clayey texture and rich in organic matter, with salinity of 2.5 dS / m in saturated extract, with traditional fertilization and irrigation for crop cultivation tomato in the greenhouse. It was considered to have at least 35 treated plants to have an analysis of variance and comparison of means test with an a=0.05. The two applications with a separation of 8 days using a pressure sprinkler trying to cover both the beam and the underside of the plant. A count of the number of healthy and dry nymphs of Bemicia tabaci was carried out at the beginning of treatment to establish the initial number of infestation in the plants. Three counts and two applications were carried out. The counts were carried out the same day prior to the application of the treatments.

[0108] With reference to the treatments applied to each plant for the determination of the biological effectiveness as a pesticide of the formulations based on intracellular and extracellular fractions of fermentation based on the Bacillus megaterium strain of the present invention in a greenhouse, in tomato cultivation for the pest control Bemicia tabaci are described in Table 6. The results were compared by performing an analysis of variance and comparison of means test with a=0.05 using the SAS ® statistical package .

[0109] Table 6

[0110] With reference to the results of biological effectiveness of the intracellular and extracellular fractions of the fermented and the unfractionated fermented of the optimal formulation of the microbial pesticide based on the Bacillus megaterium strain of the present invention, no statistically significant difference was found between the treatments of those formulated based on intracellular and extracellular fractions tested in the method described in this example. Both controlled the proliferation of the pest and caused death with an effectiveness of 99.74% for the formulation with extracellular fraction and 99.85% for the intracellular formulation. No significant difference was found in the biological effectiveness of the liquid formulation based on either of the two fractions with respect to the liquid formulation of the unfractionated fermentation, neither in biological effectiveness, nor in potency, nor in response time. For this reason, it was decided to use the fermentation not separated into fractions for the final formulation of the microbial pesticide product based on the Bacillus megaterium strain of the present invention. With reference to Figure 14 and 15, these are the graphs and an image with photographs of the results of the determination of the biological effectiveness as a pesticide of the formulations based on intracellular and extracellular fractions of fermented bacteria based on the Bacillus megaterium strain of the present invention in a greenhouse, in tomato cultivation for the control of the Bemicia tabaci pest, respectively. Furthermore, a proximal analysis of the components that have activity as active ingredients of both fractions was carried out and it was found that there are water-soluble ingredients with biological activity in the supernatant fraction, and that their effectiveness is very similar in magnitude to the biological effectiveness of the intracellular active ingredients such as spores, crystals, the same viable cells and fat-soluble active ingredients collected in the intra-cellular fraction of the present separation method. Likewise, it was found that both fractions are important to exhibit a biological effectiveness comparable to that of the fermentation not separated by the method described in this example.

[0111] EXAMPLE 8. DETERMINATION OF THE PESTICIDAL ACTIVITY OF THE VARIOUS PRESENTATIONS AND IN VARIOUS BOTANICAL GROUPS

[0112] In relation to the validation of the biological effectiveness as a pesticide of the formulations in various presentations and in various botanical groups, studies of insecticidal biological effectiveness were carried out in the open field, in crops with more than 4 Ha of land for the control of aphids Aphis spp.) and whiteflies. The characteristics of these studies are shown in Table 7. The crops in which the biological effectiveness validation studies were carried out, belonging to the botanical groups object of the present invention, are presented. For this purpose, three doses were used for each crop, high, medium and low doses, and they were applied by high-pressure terrestrial spraying on the foliage of the crop. The high dose corresponds to 2 L / Ha, the medium dose to 1 L / Ha and the low dose to 0.5 L / Ha diluted in 1200 L of water. An absolute control (without application) and a commercial control diluted according to the recommendations in the product technical sheet were also used. The surface area of each treatment was 4 Ha for each dose of each treatment in each botanical group. The first application was carried out at the time when the first live individuals of the pest were detected at the experimental site. The second and third application was carried out three and seven days after the first application, respectively. The applications were foliar. An evaluation was carried out prior to the first application of the treatments and three efficacy evaluations at 3, 7 and 10 days after the first application (dd1 a). During the development of the study, the number of living individuals was evaluated. A sample of 10 plants was taken per experimental unit and the total number of live individuals per leaf was counted, which gave a total of 40 leaves per treatment. The recorded variable was subjected to an analysis of variance and a comparison of means test to determine the biological effectiveness of the treatments (Tukey, = 0.05). Likewise, the possible phytotoxic effects caused by the application were evaluated, assessed and described with the help of the EWRS (European Weed Research Society) scoring scale. The percentage of effectiveness of the treatments for the control of whitefly in tomato was obtained with the Abbott formula.

[0113] The results were analyzed by performing an analysis of variance and comparison of means test with an a=0.05 using the SAS ® statistical package . The effectiveness of the formulations for the control of aphids (Aphis spp.) and whiteflies in various crops of the botanical groups already mentioned was monitored.

[0114] Table 7

[0115] With respect to the results of the validation of biological effectiveness in the experimental field of the formulations in various presentations of the microbial pesticide, with biological activity and effectiveness as a pesticide against insects of the order Homoptera based on the characterized strain of Bacillus megaterium, which produces spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes for the control of Cabbage aphid (Brevicoryne brassicae) and whitefly (Bemicia tabaci) it was found that the doses evaluated did not register a phytotoxic effect in all the crops of the botanical groups used in the studies. On the other hand, the percentage of biological effectiveness of some formulations evaluated at the high and medium doses are between 50% and 79%, for all crops of the botanical groups studied. Again, given that biological pesticide products do not exhibit 100% effectiveness like a conventional chemical product, the results for all formulations are successful, since they would comply with Mexican regulations NOM-032-SAG / FITO-2014. Some low-dose formulations did not show results greater than 50% biological effectiveness. For this reason, this dose is not recommended for controlling insects of the order Homoptera in open-air crops. The results are shown in Table 8. Table 8

[0116] EXAMPLE 9. DETERMINATION OF ACUTE DERMAL, INHALATORY AND ORAL TOXICITY OF LIQUID FORMULATIONS OF THE PESTICIDE IN MOUSE

[0117] With respect to the determination of the degree of toxicity of the formulations in liquid presentation object of the present invention, toxicity studies were carried out by inhalation, oral and dermal routes, in the certified laboratory for Toxicological analysis of CIATEJ, Mexico and in accordance with its protocols, validated before the Federal Commission for Protection against health risks of Mexico (COFEPRIS).

[0118] With respect to the procedure for determining toxicity by inhalation, the sample of the liquid presentation object of the present invention was subjected to an acute toxicity study by inhalation in male and female rats, in accordance with method 403 established by the Organization for Economic Cooperation and Development in September 2009 (OECD). The limit test was used at 5.36 mg / L with a mass mean aerodynamic diameter (MMAD) of 3.72 microns and a geometric standard deviation (og) of 1.56 by exposing three male rats and three female rats to a concentration gravimetric (real) of 5.36mg / L for 4 hours.

[0119] In relation to the procedure for determining oral toxicity, the sample of the liquid presentation object of the present invention was subjected to an acute oral toxicity study in female mice, in accordance with method 425 of 2008, established by the Organization for Economic Cooperation and Development in October 2008 (OECD). The limit test was applied with a dose of 2000 mg / kg body weight.

[0120] With respect to the procedure for determining oral toxicity, the sample of the liquid presentation object of the present invention was subjected to an acute toxicity study by the dermal route in female rats, in accordance with method 402 established by the Organization for the Economic Cooperation and Development in October 2017 (OECD).

[0121] An initial dose of 200 mg / kg body weight was applied to two animals, subsequently a dose of 1000 mg / kg was applied to two more animals and finally a dose of 2000 mg / kg was applied to two other animals.

[0122] Regarding the validation of zero toxicity of the microbial pesticide for humans and other animal species, it was found that the acute inhalation toxicity test, the result of which was 100% survival and no manifest toxicity in the limit test with a concentration of 5.36 mg / L., the formulations evaluated do not present acute inhalation toxicity, with an LC50 value >5.36 mg / L. Classified category 5 based on the “GHS”. On the other hand, regarding the results of the acute oral toxicity test, which resulted in 100% survival and no manifest toxicity in the limit test with a dose of 2000 mg / kg, the evaluated formulations do not present significant acute oral toxicity with an LD50 >2000 mg / kg. Classified category 5 based on the “GHS”. Finally, regarding the acute dermal toxicity test, the result of which was a 100% survival and no manifest toxicity in the limit test with a dose of 2000 mg / kg, the formulations evaluated do not present acute dermal toxicity, with a LD50 value >2000 mg / kg. Classified category 5 based on the “GHS”.

[0123] EXAMPLE 10. CHARACTERIZATION OF INTRA AND EXTRACELLULAR METABOLITES WITH PESTICIDAL ACTIVITY PRODUCED BY THE Bacillus megaterium STRAIN. PROTEINS AND PEPTIDES.

[0124] In relation to the biochemical characterization of the metabolites with biological activity and effectiveness as a pesticide against insects of the order Homoptera produced by the isolated strain of Bacillus megaterium, which can be spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both the bacteria and / or their fermentation products, both intracellular and extracellular, based on which the diversity of formulations object of the present invention can be formulated, their fractionation (separation into intracellular and extracellular fractions), purification, quantification, determination of the specific biological effectiveness by impregnation bioassays and identification were carried out. Regarding the procedure for extracting proteins and peptides, it is carried out as follows, a liquid fermentation is obtained in a 20L reactor containing an operating volume of 10 L, with 9 L of the standard culture medium, Luria broth, under optimal temperature and agitation conditions (250 rpm in a propeller-type shaker, 1 atm of aeration, 28eC, for 24 h of fermentation). A 20 pL sample is taken to determine total cells by counting in a Neubauer chamber and 1 ml of sample is taken to count Colony Forming Units (CFU). 2.82 x 1013as total cells and 3.87 x 1012cell / mL CFU were obtained from this fermented product. Regarding the methodology for analyzing intracellular, extracellular, water-soluble or non-water-soluble metabolites, specifically proteins and / or peptides, 4 different fractions are obtained. The first is the total fermentation that contains cells and supernatant, therefore, it contains all the metabolites produced by the isolate in the culture medium and standard conditions. On the other hand, a sample of the fermentation is centrifuged at 14,000 rpm at 4eC for 3 min. The supernatant is filtered with a sterile 0.22 m nitrocellulose membrane, Millipore brand. The filtrate forms fraction 4, which contains extracellular and water-soluble biomolecules. 300 mL of cold acetone is added to fraction 4 for every 100 mL of fraction 4. It is mixed and the proteins and peptides are allowed to precipitate overnight at - 20eC. The next day, the mixture is centrifuged for 1 h at 14,000 rpm at 4eC and the pellet is resuspended in 10 mL of lysis buffer containing 0.1 M Tris-HCI pH 7.5, 0.05 M EDTA, 0.1 M NaCI, 0.5% sodium dodecyl sulfate (SDS) in water and 1 mL of a MERK brand protease inhibitor cocktail and boiled for 10 minutes to obtain the total protein in the fraction. On the other hand, the pellet remaining from the centrifugation separation is combined with the pellet from the membrane filtration process. The pellet contains the intracellular metabolites and the fraction of extracellular metabolites larger than 0.22 pm. The pellet is resuspended in 10 mL of sterile 1X PBS phosphate buffer by gentle agitation with a Genie II vortex at agitation speed level 2. The suspension contains cells and extracellular metabolites larger than 0.22 pm. Two 5 mL aliquots of this solution are separated. To one aliquot, 10 mL of lysis buffer containing 0.1 M Tris-HCI pH 7.5, 0.05 M EDTA, 0.1 M NaCI, 0.5% sodium dodecyl sulfate (SDS) in water and 1 mL of a MERK brand protease inhibitor cocktail is added and incubated for 10 minutes at boiling point. In this way, the intracellular metabolites are obtained, also containing the crystal proteins and the metabolite fraction greater than 0.22 pm. This suspension is called Fraction 2. To the other aliquot, 10 ml of a spore solubilization buffer containing 50 mM Tris Base pH 8.5, 25 mM EDTA, 1% SDS, 50 mM Dithiothreitol (DTT) as a reducing agent and 1 ml of MERK brand protease inhibitor is added. It is incubated at 65eC for 1 h to solubilise the proteins that make up the parasporal crystal. This fraction is called Fraction 3. It is then incubated for 10 minutes at boiling point to obtain all the total proteins in the fraction. Regarding the method for the quantification of total proteins contained in each fraction, it is developed using the Lowry method. To do this, 1 ml of reagent C containing 49 mL of a 2% sodium carbonate solution with 0.1 N sodium hydroxide and 1 mL of the 0.5% CUSO4*5H2O solution with 1 % sodium potassium tartrate is placed in a test tube and 200 pL of each fraction are added. It is mixed and left to stand for 10 minutes at room temperature. 100 piL of 2N folin reagent is added. Mix using a vortex mixer at maximum speed for one minute and let stand for 30 minutes at room temperature. Measure the absorbance in a UNICO brand visible light spectrophotometer at 590 nm. Water is used as reagent blank. A standard curve is prepared with different concentrations of bovine serum albumin, and an equation is generated to calculate the protein concentration of the fraction samples. The protein concentration obtained in each fraction is shown in Table 9.

[0125] Table 9

[0126] Regarding the quantity and molecular mass of the proteins contained in each fraction obtained, the procedure for their visualization and identification is as follows. A 12% acrylamide-bis acrylamide gel is prepared, and 5 pg of each fraction are placed in a lane. 1 pL of the Precision Plus Protein TM Dual Color standard from Biorad is used as a molecular weight marker. The separation is allowed in a Biorad electrophoresis chamber with 1 X TBE running buffer (Tris- Borate-EDTA) at a differential of 100 V for 3 h to 5 h. The gel is then stained with coomassie blue G250 (colloidal), which is compatible with mass spectrometry. Referring to Figure 16, this is the image of the 12% acrylamide gel electrophoresis of the total proteins from the four fractions obtained by the aforementioned procedure, F1 , F2, F3 and F4 correspond to fractions 1 , 2, 3 and 4, respectively. The molecular mass (MW) marker shows the reference of the size of the proteins with respect to the distance in reference to the origin. The four fractions show differential protein patterns. Fraction F1 , corresponding to total, intra and extracellular, soluble, insoluble and spore proteins. Proteins with molecular sizes ranging from 150 kD to 10 kD peptides were identified. Referring to fraction F2, corresponding to intracellular proteins and water-insoluble proteins, a molecular size pattern similar to Fraction F1 was obtained, but with a greater abundance of proteins and peptides between 75 and 10 kDa. Proteins of approximately 200 kD, 150 kD, 130 kD and 100 kD are observed. Fractions 3 and 4 show differential patterns of protein and peptide content and abundance. Fraction F3, corresponding to proteins and / or peptides that make up the parasporal crystal, molecules of approximately 100 kD, 75 kD, 68 kD, 42 kD, 40 kD, 37 kD, 35 kD, 32 kD, 28 kD, 25 kD, 20 kD are identified, with the most abundant proteins / peptides of 40kD, 35 kD, 32 kD, 28 kD, and 25 kD in concentration. Regarding the proteins / peptides of Fraction 4, corresponding to extracellular proteins, proteins of 75 kD, 68 kD, 40 kD, 38 kD, and 35 kD are identified, a 28 kD protein, a 24 kD protein, and a 20 kD protein are distinguished in abundance. Regarding the summary of all the differential proteins of each fraction that could be visualized by electrophoresis in 12% acrylamide gel stained with coomassie blue, it is presented in Table 11 . In the present invention, each one of these bands identified in the gels and in the tables as metabolites with possible insecticidal activity should be considered as an object of protection. With reference to the biological activity of the proteins / peptides obtained in electrophoresis in 12% acrylamide, as active ingredients with insecidal activity against whitefly and aphid by means of in vitro impregnation bioassays, the methodology is as follows. The bands obtained from each gel of each fraction are cut from the acrylamide gel using a scalpel, then extracted from the acrylamide matrix by adding 3 times the volume of the gel of sterile double-distilled water, heated to 37eC and using vortex at high speed for 30 seconds, until the gel melts. Samples are centrifuged at 14,000 rpm for 30 minutes and then placed in a sterile Eppendorf tube. The extracted gel samples are destained by adding 1 mL of a 100 mM ammonium bicarbonate solution for 15 minutes at room temperature. The samples are centrifuged at 14,000 rpm for 10 minutes and incubated again twice with the ammonium bicarbonate solution. At the end of the last wash, the proteins / peptides are resuspended in 100 piL of sterile distilled water. 1 iL of each sample of the excised and purified band from the gel is taken to quantify protein by the Bradford method previously described. The volume of each of the samples is then adjusted to adjust the amount of protein to a concentration of 10 p.g / mL. Samples of Fraction 1 , Fraction 2 and Fraction 4 were used as controls, as well as sterile distilled water as an absolute witness. Samples of Fractions 1 , 2 and 4 were also adjusted to a total protein concentration of 10 p.g / mL. Ten-fold serial dilutions were prepared with sterile distilled water as a diluent. Each dilution was applied by impregnation to previously washed and disinfected broccoli leaves, following the 5-step protocol for impregnation bioassays described in Example 3 of the present invention. The results of the impregnation bioassays are analyzed according to step 5 described in example 3 of the present invention by means of PROBIT statistical analysis of accumulated mortality under the conditions tested from 0% to 100% mortality with an error less than 0.05%, the lethal dose 50 and the toxic dose 50. These analyses allow to establish the efficacy and potency of each extracted protein / peptide as an active ingredient of the microbial pesticide object of the present invention for aphids and whiteflies (Bermicia tabaci and Melanaphis sacchari). Regarding the summary of all the differential proteins of each fraction that could be visualized by electrophoresis in 12% acrylamide gel stained with coomassie blue, the calculation of its approximate molecular mass and its biological effectiveness as a metabolite as an active ingredient with biological effectiveness as an insecticide against aphids and whiteflies is presented in Table 11 .

[0127] Table 1 1

[0128] Protein

[0129] With reference to the biological effectiveness of the isolated proteins or peptides determined by calculating the Lethal Dose 50 (LD50), it is evident that the proteins tested generally have a greater potency against Melanaphis sacchari than against Bermicia tabaci with a difference of up to 7 orders of magnitude, so that the metabolites of peptide nature, enzymes or peptides, produced by the Bacillis megaterium strain object of the present invention control the Melanaphis genus at a lower concentration.

[0130] With reference to the comparison of the biological effectiveness of the proteins / peptides analyzed, Figure 17 shows a Venn diagram that allows to visualize those proteins / peptides that showed greater potency in the bioassays against Bermicia tabaci and Melanaphis sacchari. In both cases, intracellular or extracellular proteins greater than 0.22 iM (Fraction 2) showed greater effectiveness, 71.62 kD, 44.13 kD, 63.51 kD for Bermicia tabaci, 54.05 kDa, 48.74 kD, 39.10 kD and 24.33 kD for Melanaphis sacchari. On the other hand, some proteins in Fraction 4, which contains water-soluble extracellular proteins, showed greater potency than others, 23.75 kDa, 72.98 kD and 64.86 kD for Bermicia tabaci, and 26.71 kDa for Melanaphis sacchari. Additionally, some proteins / peptides showed high potency against both genera of insects, they were also mainly contained in fractions F2 and F4, 141 .66 kD, 68.92 kD, 23 kD and 42.19 kD and 20.62 kD respectively. Finally, a protein of 26.95 Kd contained in fraction 1 , which represents all the proteins contained in the entire fermented had a high potency against Melanaphis sacchari. Although the proteins described in Figure 17 would be the active ingredients that exert greater insecticidal effectiveness, all the proteins identified in Table 1 1 should be protected by the present invention. As well as all those identified and described in Table 12 and Figures 18 to 21.

[0131] With reference to the separation of proteins in two-dimensional acrylamide electrophoresis and isoelectric gradient, the methodology is as follows. 350 pg of each sample is used and resuspended in 215 pL of denaturing buffer containing 8 M urea, 2 M Thiourea, 4% CHAPS, 2% triton X 100 and 50 mM DTT and applied on a 1 1 cm polyacrylamide gel strip with a pH immobilizing gradient (IPG BIORAD) of a range of 3-10 for 10 minutes, at room temperature, in a rehydration tray (Immobiline DryStrip Reswelling Tray, BIORAD). The strips are then coated with mineral oil and the tray is transferred to the PROTEAN i12 IEF Cell isoelectric focusing unit (BioRad) for active rehydration for 12 h at 20eC, followed by 5 focusing steps: 250 V for 30 min (fast), 10000 V for 2 h (gradient), 10000 V (fast), and 1000 V hold, up to a cumulative voltage of 45-47 kVh.

[0132] After isoelectric focusing, the IPG strips are removed from the tray, the mineral oil is removed, and the strips are incubated with an equilibration buffer containing 1.5 M Tris-HCI pH 8.8, 6 M urea, 30% v / v glycerol, and 5% w / v SDS 2% DTT. The strips are incubated in this solution for 15 minutes with shaking and at room temperature. The incubation is repeated twice and then incubated with an alkylation buffer containing 1.5 M Tris-HCI pH 8.8, 6 M urea, 30% v / v glycerol and 5% w / v SDS 2.5% iodoacetamide, for 15 minutes with shaking and at room temperature, the incubation is repeated twice more, and then a brief wash with 1X SDS protein running buffer is performed. The strips are now ready to carry out the second dimension. The preparation and running conditions of the 2D gels are carried out as described below, for the 11 cm strips the SE600 VERTICAL UNIT electrophoresis system (GE-HEALTHCARE) is used, using 12% SDS- PAGE acrylamide gels of 16 x 15 cm. To prepare acrylamide gels, three solutions are prepared: the first is a concentrated solution of 30% (w / v) acrylamide and 0.8% (w / v) bis-acrylamide in double-distilled water. The second is a solution of 1.5 M Tris-HCI pH 8.8, 10% (w / v) SDS in double-distilled water, which is added to the first to obtain the concentration of the resolving gel, whose function is to separate proteins by molecular weight. The third is a solution of 0.5 M Tris- HCI, pH 6.8, 10% (w / v) SDS in double-distilled water, which is added to the first to obtain the concentrating gel, whose function is to rapidly concentrate the proteins coming from the IPG strips. 0.05% APS and 0.005% TEMED are also added as catalysts for the polymerization reaction. The solutions are transferred to the polymerization chamber of the SE600 VERTICAL UNIT system (GE-HEALTHCARE), each IPG strip is placed on the surface of a gel, avoiding bubbles being trapped between the strip and the gel surface, or between the gel and the base glass. To fix the gels and avoid protein losses when they migrate from the strip to the gel, a 0.5% (w / v) agarose solution in SDS-PAGE running buffer with traces of bromophenol blue is added. Electrophoresis is performed at 25eC with a constant voltage of 50 V for 22 hours at room temperature in SDS-PAGE running buffer. After electrophoresis, the gels are incubated in a staining solution containing 8% w / v ammonium sulphate, 2% phosphoric acid, 20% ethanol and 0.08% Coomassie Blue G-250 for at least 16 hours at room temperature. Finally, the gels are destained with double-distilled water until the appropriate contrast is achieved for stain identification. A calibrated Biorad GS-900 densitometer system is used to digitalize images of the two-dimensional gels and perform densitometric analysis.

[0133] Referring to Figures 18, 19, 20 and 21 are the 2D gel images of Fraction 1 , Fraction 2, Fraction 3 and Fraction 4, respectively.

[0134] Figure 18 shows the 2D electrophoretic pattern of sample Fraction 1. The 2D pattern is shown where proteins between 15-150 kDa and between 4.5-9 isoelectric point are highlighted, this pattern is well resolved in the range of isoelectric points of proteins pH 3-10, as well as by molecular weight. On the other hand, Figure 19 shows the 2D electrophoretic pattern of the sample Fraction 2. The 2D pattern is very similar to the pattern of Fraction 1 and highlights very strong changes in the decrease of proteins of 25 kDa, as well as in the quadrant less than 25 kDa and between 8.5-9 of isoelectric point, it is a well resolved and reproducible pattern of proteins of pH 3-10, as well as by molecular weight. In turn, Figure 20 shows the 2D electrophoretic pattern of the sample Fraction 3. The figure shows the 2D pattern very similar to the pattern in figures 17 and 18, highlighting very strong changes in the decrease of proteins less than 25 kDa, as well as in the quadrant less than 25 kDa and between 5-9 of isoelectric point, it is a well resolved and reproducible pattern of proteins of pH 3-10, as well as by molecular weight. Finally, Figure 21 shows the 2D electrophoretic pattern of sample Fraction 4. The figure shows a 2D pattern very similar to the pattern in the previous figures, highlighting very strong changes in the increase of 25 kDa proteins, especially those with an isoelectric point of 6-7. It is a well-resolved and reproducible pattern of proteins with a pH of 3-10, as well as by molecular weight. As for the summary of the total spots visible in the 2D electrophoresis gels of each fraction, it is shown in Table 12.

[0135] With respect to the differential spots between each fraction, the summary is shown in Table 13. In the present invention, each of these spots identified in the table as metabolites with possible insecticidal activity should be considered as an object of protection, in addition to all those proteins that are not reported in the list but can be observed by means of image analysis software by performing greater contrast.

[0136] Table 12

[0137]

[0138] Table 12 (cont.)

[0139] 5 Table 12 (cont.)

[0140]

[0141] 5 Table 13

[0142]

[0143] Table 13 (cont.)

[0144] Table 13 (cont.)

[0145]

[0146] Table 13 (cont.)

[0147]

[0148] Table 13 (cont.)

[0149] With reference to the identity of the proteins / peptides that showed a higher biological effectiveness as active ingredient of the microbial pesticide object of the present invention, 18 spots were processed for further analysis and identification by MALDI-TOF technique. Of these 18 samples, 6 samples showed a high specificity as pesticide against whitefly, 6 samples showed a high specificity as pesticide against aphid and 6 samples showed a broad effectiveness against both whitefly and aphid. The molecular sizes and isoelectric focusing of the 18 samples are shown in Figure 22.

[0150] With reference to the method for purification and identification of the proteins / peptides as active ingredients as microbial pesticide against aphid and whitefly, it is as follows. The “spots” corresponding to 18 samples with the highest biological effectiveness as microbial pesticides from gels are excised and placed in 1.5 mL Eppendorf tubes. Subsequently, 3 times the volume of sterile double-distilled water is added to the gel, heated to 37eC and vortexed at high speed for 30 seconds until the gel melts. The samples are centrifuged at 14,000 rpm for 30 minutes and then placed in a sterile Eppendorf tube. The extracted gel samples are destained by adding 1 mL of a 100 mM solution of ammonium bicarbonate for 15 minutes at room temperature. The samples are centrifuged at 14,000 rpm for 10 minutes and incubated again twice with the ammonium bicarbonate solution. At the end of the last wash, the samples are reduced by adding 50 mM dithiothreitol and incubated for 45 minutes. They are then alkylated by adding a 30 mM iodoacetamide solution and incubating for 2 hours. The samples are then centrifuged at 14,000 rpm for 10 minutes and the supernatant is discarded. The pellet is resuspended in a 100 mM ammonium bicarbonate solution and vortexed vigorously until resuspended. The process is repeated 3 times. The samples are then completely dehydrated with 100% acetonitrile and taken to dryness. The digestion of proteins contained in the spots is carried out by incubating them with 30 pL of modified porcine trypsin, at a concentration of 20 ng / pL for 18 hours at 37 °C. The peptides from the previous digestion were extracted with 50% (v / v) acetonitrile and 0.01 % (v / v) formic acid, then taken to complete dryness, dissolved again in 10 pL of 0.01% (v / v) formic acid, desalted and concentrated by Ziptip C18 and deposited and dried in a 0.6 mL Eppendorf tube and in this way they are preserved for analysis by mass spectrometry.

[0151] Protein mass spectrometry is widely used in literature references to analyze biological samples, for proteomic research, and for clinical and biotechnological applications. Mass spectrometry is used to quantitatively identify and characterize proteins based on their structure, post- translational modifications, and interactions. Mass spectrometry is a tool used to determine the masses of different compounds in a sample, such as different proteins or peptides. It consists of three steps, ionization, which can be performed in a matrix laser desorption ionization (MALDI), separation of ions by their mass and charge using an electrical separation field such as TOF, and identification by mass spectrometry, measuring the mass / charge ratio of the ions obtained in the cleavage of each molecule and comparing this information against a database. In the mass spectrometry spectrum the y-axis represents the abundance and each peak represents a different m / z ratio and intensity. Calibration of the LTQ-Orbitrap Velos instrument is performed using a mixed-ion positive ion calibration solution (Pierce LTQ ESI). Tryptic peptides generated by in-gel digestion of each sample are analyzed by an LC-MS system (Ultimate 3000 Dionex - LTQ orbitrap velos) using a homemade C18 capillary column. Peptides are separated using a gradient from 0% to 90% solvent B (solvents used were water in line “A” and acetonitrile in line “B”, both with 0.1% formic acid), over 120 min, maintaining a flow rate of 300 nL / min. All spectra are acquired positively. The acquisition method was built with dynamic exclusion set to a maximum of 500 ions and 70 s for the exclusion duration. Full scan MS spectra from m / z 400 to 1600 are acquired on the Orbitrap with a resolving power of 60,000, isolation width of 3.0 Da, 35 arbitrary normalized collision energy units. CID (collision-induced activation) and HCD (high-energy collision activation) are alternately used for fragmentation. Regarding the computer analysis of the fragments obtained by Masses, it is as follows: each of the .raw type files is subjected to a search in the Proteome discoverer 1.4 program for the identity of the proteins using the uniprot-Bacillus megaterium database, fragment tolerance 0.60 Da, parental tolerance 20 ppm, fixed modifications carbamidomethyl (C) and variable modifications deamidation (N,Q) and oxidation (M) . Regarding the identity of the 18 proteins / peptides analyzed, Table 14 shows the most probable identity according to the alignment of amino acid sequences, as well as the molecular mass shown.

[0152] Table 14

[0153] EXAMPLE 11 . CHARACTERIZATION OF INTRA AND EXTRACELLULAR METABOLITES WITH PESTICIDAL ACTIVITY PRODUCED BY THE Bacillus megaterium STRAIN. LIPIDS, CERIDES AND LIPOPROTEINS. In relation to the biochemical characterization of the metabolites with biological activity and effectiveness as a pesticide against insects of the order Homoptera produced by the isolated strain of Bacillus megaterium, which can be spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where both the bacteria and / or their fermentation products, both intracellular and extracellular, based on which the diversity of formulations object of the present invention can be formulated, purification, quantification, determination of the specific biological effectiveness by impregnation bioassays and identification were carried out. Regarding the procedure for extracting lipids, cerides and lipoproteins, it is carried out as follows, a liquid fermentation is obtained in a 20L reactor containing an operating volume of 10 L, with 9 L of the standard culture medium, Luria broth, under optimal temperature and agitation conditions (250 rpm in a propeller-type agitator, 1 atm of aeration, 28eC, for 24 h of fermentation). A 20 piL sample is taken to determine total cells by counting in a Neubauer chamber and 1 ml of sample is taken to count Colony Forming Units (CFU). 2.82 x 1013 as total cells and 3.87 x 1012 cell / mL CFU were obtained from this fermented product. Lipid extraction was performed using the Fatty Acid Extraction Kit, Low Standard Sigma-Aldrich® (MAK174). To this end, 150 pL of the fermented Bacillus megatherium were taken and placed in a glass tube with a Teflon stopper. 20 fermentation samples were processed in this manner. 3 mL of the Extraction Solvent (MAK174A) were added to each tube containing the fermentation sample, the sample was covered and vortexed at maximum speed for a few seconds to break the cell membrane and collect all intra- and extracellular metabolites. Next, 350 pL of the Aqueous Buffer (MAK174B) were added to the tube to complete a final volume of 500 pL of aqueous phase, and the sample was mixed by vortexing at maximum stirring speed for a few seconds. The contents of each tube are emptied into each of the syringes containing a filter provided by the commercial package supplier, the syringes are placed in a new bakelite tube and the contents of the syringe are forced through the membrane by pressure from the syringe plunger.

[0154] The content of the 20 tubes is collected in two glass test tubes with Teflon stoppers and left to stand for 20 minutes for complete separation of the two phases, aqueous and organic. Since the following compounds have been reported in the bibliographical references as lipid metabolites present in the Bacillus genus, they were used as standards for the identification of these metabolites in Bacillus megaterium, object of the present invention. The standards are: Surfactin, Iturina A, Poly [(R)-3-hydroxybutiric acid], 3-hydroxypropionic acid, (-)-methyl-(R)-3- hydroxyvalerate, Methyl-3-hydroxyhexanoate, p-hydroxyaluric acid, DL-p-hydroxymyristic acid. On the other hand, a lipid transesterification process is carried out for its subsequent analysis by gas-mass chromatography and the comparison of the spectra obtained against those of various standards. The transesterification process is as follows: lipid samples from the organic and aqueous phases are placed in 75 mL glass vials and frozen with liquid nitrogen until visually completely frozen. They are lyophilized in a LABCONCO® brand FreeZone2.5 equipment under high vacuum conditions (approximately 0.133 mbar) and with a cold trap at -52°C, until completely dry. The lyophilized samples are suspended in a 1 % v / v solution in methanol. Then, 0.5 times the volume of hexane is added and they are heated in a water bath for 3 hours at 70°C. Then, 0.5 V of hexane is added again and resuspended. Then, 0.25 V of a 5% NaCI solution is added. The fractions are resuspended and centrifuged at 500 g for 5 minutes. The organic phase of each fraction is collected and lyophilized under the conditions previously described. A Perkin-Elmer brand chromatograph model: Clarius SQ8 is used, with the GCMS analytical technique, an Agilent Technologies Inc. HP-5MS 30 m x 0.25 mm x 0.25 piM capillary column is used. The chromatographic method is as follows: 100 ° C for 1 min; increase of 20 ° C / min up to 300 ° C until completing 30 min. An injector temperature of 300eC is used. The sample is injected with a 1 |iL volume autosampler. The carrier gas is He, maca Infra, ultra high purity (99.99%), with a carrier gas flow of 1 mL / min. The transfer line temperature is 2502C and the ionization chamber temperature is 200eC. The mass analyzer is a SQD (single quadrupole) and a filament turn-on delay of 2 minutes. The mass range is 30 to 600 m / z and the calibration standard used is PFTBA. Figure 23 shows the chromatograms of the two total lipid fractions compared to the chromatograms of the standards. Table 15 presents the identity of the lipids identified according to the standards used in the organic and inorganic phase samples.

[0155] Table 15

[0156] On the other hand, in order to perform a fractionation based on the polarity of the lipids, cerides and lipoproteins contained in the fermented Bacillus megaterium strain object of the present invention, a column chromatography is performed with different organic solvents and binary mixtures 25:75, 50:50 and 75:25 of the solvents. For this purpose, a Kimble® brand Teflon chromatography column with a height of 43 cm and a radius of 1.9 cm is used and it is packed with microcrystalline cellulose as a stationary phase. The height of the stationary phase is 30 cm. The column is activated by passing the lowest polarity solvent through the column, then the total lipid sample is placed (which contains both the organic phase and the inorganic phase obtained as previously described in this section), the order in which the solvents are applied to obtain the different fractions is: petroleum ether, hexane, benzene, chloroform, ethanol, methanol and water, as well as their respective binary mixtures. At least four fractions of each solvent and binary mixture are obtained with a volume of 60 ml and a column retention time of 37.5 minutes. Once all the fractions have been obtained from the column chromatography, they are concentrated using a rotary evaporator brand ICA MODEL RV at 150 rpm and a temperature of 62 °C, until concentrating to a volume of 10 mL.

[0157] With respect to the analysis of the biological effectiveness of the lipid fractions obtained by column chromatography with different solvents, the method is performed by impregnation bioassays on chili leaves for whitefly and broccoli for aphids. The bioassays for both insects were performed as described in example 10 of the present application, with the difference that serial dilutions based on ten are made from the concentrated solution of the extract up to the dilution 1 in 1 ,000000. The results of the calculation of the lethal doses 50 (LD50) are shown in Table 16. With respect to the biological effectiveness of lipid fractions obtained by column chromatography with different solvents and determined by impregnation bioassays, it was found that the fractions are capable of controlling the Melanaphis genus with greater potency than the Bermicia genus with a difference of two to three orders of magnitude. The fractions that showed the greatest potency against Bermicia tabaci and Melanaphis sacchari are mixtures of petroleum ether:hexane, ethanokmethanol and chloroform for Melanaphis sacchari and hexane:benzene and chloroforrmethanol for Bermicia tabaci.

[0158] The metabolites present in these fractions, such as lipids, cerides and lipoproteins produced by the isolated strain of Bacillus megatrium subject of this application, have an excellent biochemical ability to control Homoptera.

[0159] Table 16

[0160]

[0161] On the other hand, to identify whether the standards analyzed in the total lipid sample are present in the fractions of column chromatography with different solvents, the fractions that showed greater biological effectiveness as metabolites that could be considered as active ingredients in formulations for the biological control of aphids and midges are selected and analyzed by mass gas chromatography. The transesterified and lyophilized fractions are sent to an analysis laboratory to perform gas chromatography. The equipment, method and standards of the lipid fractions are those previously described in this example.

[0162] All lipids, cerids and / or lipoproteins identified in this document are subject to protection due to their possible effectiveness as an active ingredient with insecticide activity against whiteflies and aphids. It is clear that any lipid, cerid and / or lipoprotein not mentioned in this document will be covered by the biological activity analysis of the fractions obtained and containing them. Due to the robustness of all the evidence in the examples presented in the present application, it should be evident to a person skilled in the art that any modification in the fermentation methods, purification of fractions, cells, spores and / or crystals, lipids, proteins, fats, hormones, peptides, primary or secondary metabolites and in general of any active ingredient that is produced by the bacterium Bacillus megaterium, as well as any type of encapsulation and / or microencapsulation method to increase its biological effectiveness, whether in vitro, in a greenhouse or other protected agriculture system, in an experimental field or in open field cultivation, as well as any modification in the formulation and / or presentations and applications described in the present invention, and / or any other modality in the application for control of insects of the order Homoptera in any other botanical group is evident in the present invention.

[0163] In summary, formulations with pesticidal activity made from a characterized strain of Bacillus megaterium, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, where the bacteria and / or its fermentation products, both intracellular and extracellular, have specific pesticidal properties against insects of the order Homoptera both in vitro and when applied at any phonological stage of the plant, both to foliage, fruit, stem, root, for various botanical groups such as Bulbs; brassicas; legumes; solanaceae; cucurbits; cereals; citrus, berries, forestry and leafy vegetables in any cultivation system, whether soil, aeroponics and hydroponics. As for the method to formulate the microbial pesticide based on the optimal concentrations of each active ingredient in the final mixture for the various presentations, it may include a cell lysis stage to increase the concentration of spores, crystals, proteins, peptides, lipids, degradative enzymes and intracellular bioactive substances for the control of aphids (Aphis spp.). This stage is recommended for formulations directed to leafy vegetables, so that the insecticide can penetrate the structures of the plant where the leaves are very folded and can reach insects that hide in these sections. For the rest of the botanical groups object of the present invention, the method could not include the cell lysis stage without affecting the performance of the pesticide at any level of application, in vitro, in a greenhouse or other protected agriculture system, in an experimental field or in open field cultivation in general, for the control of insects of the order Homoptera. As for the various presentations of the pesticide object of the present invention, the following are described in a demonstrative but non-limiting manner: liquid, wettable powder, granules and dispersible granules, suspension, microencapsulation, and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip, ground pressure spraying equipment, microspraying, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0164] As for the botanical groups in which the pesticide object of the present invention has biological effectiveness for the control of insects of the order Homoptera, evidence is presented in a demonstrative but non-limiting manner, the botanical groups Bulbs; brassicas; legumes; solanaceae; cucurbits; cereals; citrus, berries, forestry and leafy vegetables in any cultivation system, whether soil, aeroponics or hydroponics when applied at any phonological stage of the plant, to foliage, fruit, stem, root. As for the optimal dose of the pesticide object of the present invention, to correct an infestation of insects of the order Homoptera in any botanical group object of the present invention, the average dose of 1 L / Ha of crop is recommended at any level and for any system of application to the plant such as irrigation systems such as drip, ground pressure spraying equipment, microspraying, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters. At least three applications are recommended with a maximum interval of 7 to 10 days between each application, although it could vary depending on the level of infestation of the crop. As for the optimal dose of the pesticide object of the present invention, to prevent an infestation of insects of the order Homoptera in any botanical group object of the present invention, the average dose of 1 L / Ha of crop is recommended at any level and for any plant application system such as irrigation systems such as drip, ground pressure spraying equipment, microspraying, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters. At least three applications are recommended with a maximum difference of 15 days between each application. As long as a dose for infestation already present in the crop has not been previously applied.

[0165] As for the method of applying the pesticide to the crop, it has been demonstrated, through the diversity of examples, that it works for any plant application system such as irrigation systems such as drip, ground pressure spraying equipment, microspraying, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters.

[0166] As for the biological effect of the pesticide of the present invention, there is evidence that it is through contact or absorption by the cuticle or dermis of the insect and that the pesticide is required to remain adhered to the crop to fulfill its function. Likewise, it has been demonstrated that both the viable cells of the Bacillus megaterium strain, producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, and / or its fermentation products, both intracellular and extracellular, have specific pesticidal properties against insects of the order Homoptera at any level, in vitro, greenhouse or other protected agriculture system, in experimental field or in open field cultivation in general.

[0167] As regards the specificity against insects of the order Homoptera, it has been shown to be highly specific, without affecting other species of insects, plants, animals or humans.

[0168] In accordance with the present invention, it will be evident to those skilled in the art that, although in the preferred embodiment the formulation is liquid, in alternative embodiments said formulation may be wettable powder, granules and dispersible granules, suspension, microencapsulation, microspheres, gel or aerosol and any other form such that, when dissolved in water or vegetable and / or mineral oils, it can be applied to the plant by irrigation systems such as drip irrigation, ground pressure spraying equipment, microspraying, nebulization, micronizers or with aerial equipment such as drones, airplanes and helicopters, without departing from the scope of the present invention. In accordance with the present invention, it will be evident to experts that, although the preferred use of the formulation is for both preventive and corrective control of insects of the order Homoptera in soil cultivation systems in alternative cultivation system modalities, said formulation can be for any other cultivation system, be it aeroponics, hydroponics, cell culture, protected culture, micropropagation, etc., when applied at any phonological stage of the plant, both to foliage, fruit, stem, root without departing from the scope of the present invention.

[0169] In accordance with the present invention, it will be evident to experts that, although the preferred embodiment of the present invention is for botanical groups such as Bulbs; brassicas; legumes; solanaceae; cucurbits; cereals; citrus, berries, forestry and leafy vegetables, in alternative modalities said formulation can be directed to other botanical groups such as pome trees, stone fruits, nuts, spices, sapotaceae, ornamentals, pastures established in pastures and cacti.

[0170] In accordance with the present invention, it will be apparent to those skilled in the art that, although the preferred embodiment of the present invention is a method for obtaining biomass from the Bacillus megaterium bacteria strain in liquid fermentation in a flask and bioreactor independently, in the optimal culture media object of the present invention, in alternative embodiments said fermentation may be in solid, submerged, fluidized bed, immobilized column and any other type of fermentation modalities without departing from the scope of the present invention.

[0171] In accordance with the present invention, it will be apparent to those skilled in the art that, although the preferred embodiment of the present formulations is with active ingredients from the Bacillus megaterium cell itself and producer of spores, crystals, proteins, peptides, lipids, degradative enzymes and intracellular bioactive substances, primary and secondary metabolites, where the bacteria and / or its fermentation products, both intracellular and extracellular, have specific pesticidal properties against insects of the order Homoptera, and preservatives; and cell lysis with sodium dodecyl sulfate and sucrose; and microencapsulation with sodium alginate; and dispersants; and adhesives such as soybean, safflower and / or sunflower oil; and commercial silicone as an antifoam, in alternative modalities said formulation can be integrated by other ingredients with the same or complementary function, without departing from the scope of the present invention.

[0172] Since various aspects of various embodiments of this invention have been described, it should be noted that various alterations, modifications and improvements may be made by those skilled in the art. Such alterations, modifications and improvements are intended to be part of this description and are intended to be within the spirit and scope of the invention. Accordingly, the above description and drawings, images as well as figures are by way of example only. Many modifications and other embodiments of the invention will be apparent to those skilled in the art to which this invention belongs who has the benefit of the teachings presented in the foregoing description. Therefore, it should be understood that the invention is not limited to the specific embodiments described and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are used herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

Claims

CLAIMS1. A pesticide formulation to control and prevent a specific infestation against insects of the order Homoptera, characterized in that it comprises: fermented fractions of Bacillus megaterium strain of SEQ ID NO: 1 as active ingredients at a concentration of at least 5% V / V wherein the fermented fractions include intracellular and extracellular fractions, wherein the B. megaterium is producer of spores, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes that have pesticidal activity; and one or more suitable additives or excipients.

2. The pesticide formulation according to claim 1 , characterized in that the metabolites comprise proteins and peptides that make up the parasporal crystal with molecules, wherein said proteins and peptides have the following features:

3. The pesticide formulation according to claim 2, characterized in that the proteins have the following sequences and molecular weight:(R)FLEQQNQVLQTH(W) 65 kDa(R)SLDLDSIIAEVK(A) 65 kDa(K)APVLSDSScK(S) 24 kDa(-)IFEcVFScDIEK(E) 4 kDa(K)WFNADTFFDFDK(S) 21 kDaAFLPGSLVDVRPVR 42 kDa(K)RIALFLLTNVAVVVVLGIVASLLGVnR(Y) 31 kDa(K)AEAESLYQSK(Y) 65 kDa(K)INLLDKMDFTK(A) 40 kDa(K)ALIGITNPVNTTVAIAAEVLK(K) 33 kDa(R)VqGLLLFLASIILAqlLLVLKK(K) 35 kDa(R)IVAQLGQGVYR(T) 131 kDa(K)APVLSDSScK(S) 24 kDa(K)AEAESLYQSK(Y) 65 kDa(R)LIDmGEEIGLATVYR(V) 17 kDa4. The pesticide formulation according to claim 1 , characterized in that the metabolites comprise lipids, cerides and lipoproteins.

5. The pesticide formulation according to claim 1 characterized in that it comprises both viable cells of the spore-producing strain, crystals, primary and secondary metabolites, bioactive substances and degradative enzymes, wherein the bacteria and / or its fermentation products, both intracellular and extracellular are considered as active ingredients.

6. The pesticide formulation according to claim 1 , characterized in that the Bacillus megaterium strain produces Indole Acetic Acid and other plant growth-promoting hormones such as auxin, cytokinin and gibberellin; as well as proteases, alpha-amylase, phytase and esterase, which gives it the ability to efficiently degrade biomolecules present in the substrate, leaving easily assimilated nutrients available in the soil for the use of the crop.

7. The pesticide formulation according to claim 1 , characterized in that it is in the form of a liquid, wettable powder, granules, dispersible granules, suspension, microcapsules and any other form such that, when dissolved in water or vegetable and / or mineral oils, can be applied to the plant by irrigation, sprinkling systems or aerial equipment.

8. The pesticide formulation according to claim 3, characterized in that the irrigation systems and aerial equipment are selected from drip, pressure ground spray equipment, microspray, nebulization, micronizers, drones, airplanes and helicopters.

9. The pesticide formulation according to claim 1 , characterized in that it is applied to the plant or any plant species in any phonological state, both to foliage, fruit, stem, root, for various botanical groups such as Bulbs; brassicas; legumes; nightshades; cucurbits; cereals; citrus fruits, berries, forest and leafy vegetables, pome trees, stone fruits, nuts, spices, sapotaceae, ornamentals, grasslands established in pastures and cacti.

10. The pesticide formulation according to claim 1 , further characterized in that it can be applied in any cultivation system such as soil, aeroponics and hydroponics, greenhouse or other protected agriculture system, in an experimental field or in open field cultivation.

11. The pesticide formulation according to claim 1 characterized in that it acts through contact or absorption through the cuticle or dermis of insects of the order Homoptera, without affecting other insects, plants, animals or humans.

12. The pesticide formulation characterized in that inhibits and controls the presence of Cabbage aphid (Brevicoryne brassicae), Cabbage aphid (Brevicoryne brassicae) and whiteflies.

13. A method for manufacturing a pesticide formulation according to claim 1 , characterized in that it comprises the following steps:Mixing the fermented product diluted with preservatives;- Microencapsulate;Mixing with dispersant;Mixing with adherent;Mixing with antifoam; andFilling14. The method according to claim 8, characterized in that prior to the microencapsulation step there may be a cell lysis step to obtain a higher concentration of intracellular metabolites in the fermentation mixture.

Citation Information

Patent Citations

  • Application of Weissella mesenteroides in adsorption of metal lead

    CN115975856A

  • Bacillus megaterium bioactive compositions and metabolites

    US20200267991A1