Fusion protein activated by blue light and use thereof

Abstract

The present invention relates to a fusion protein optogenetically activated by blue light, and a use thereof, wherein the fusion protein comprises: an extracellular domain of rhodopsin; a transmembrane domain of rhodopsin; and an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the transmembrane domain. Specifically, the invention relates to a fusion protein that is activated by blue light, phosphorylates extracellular signal-regulated kinases (ERKs), inhibits apoptosis, and induces programmed necrosis.

Description

Fusion proteins activated by blue light and their uses

[0001] The present invention relates to a fusion protein activated by blue light and its use, and more particularly, to a fusion protein that is optogenetically activated by light irradiation by combining the extracellular domain and cell membrane domain of rhodopsin and the intracellular domain of a G-protein coupled estrogen receptor (GPER), and its use.

[0002] Estrogen receptors belong to the nuclear receptor superfamily, which uses estrogen as a ligand, and are classified into two types: nuclear or intracellular receptors and G-protein coupled estrogen receptors (GPERs). Among them, GPER is a seven-membered transmembrane G-protein coupled receptor (GPCR) that binds 17-beta estradiol (E2), a type of steroid sex hormone. GPERs are mainly expressed in tissues such as the reproductive organs, brain, and heart, and are known to be involved in cell growth, differentiation, proliferation, inflammation suppression, angiogenesis, immune regulation, and neurotransmission.

[0003] GPCRs have seven transmembrane helices connected by three extracellular loops and three intracellular loops. The N-terminus, transmembrane regions 1–7, and extracellular loops 1–3 are generally involved in ligand binding and receptor activation, whereas intracellular loops 1–3 and the C-terminus contain residues involved in downstream signal transduction. GPCRs signal through heterotrimeric G proteins composed of four major groups of Ga subunits (Gas, Gai, Gaq, and Ga12) and a pair of b and r subunits.

[0004] When activated, GPER regulates estrogen signaling within cells and participates in various physiological processes. Recently, GPER activation has been shown to halt cancer cell growth and make tumors more immunogenic.

[0005] Rhodopsin is a visual receptor present in retinal rod cells. It can absorb visible light and is a type of G protein-coupled receptor (GPCR) that is a transmembrane receptor that crosses the membrane seven times. Rhodopsin is composed of opsin, a membrane protein anchored to the rod cell receptor membrane, and retinal, which functions to absorb light.

[0006] Optogenetics, which means "genetic alteration" (genetics) through light (opto), is a biological technique that regulates or monitors cell and tissue activity by expressing light-regulated ion channels in cells or organisms. While various studies utilizing optogenetics have been conducted, research on applying it to estrogen receptors remains limited.

[0007] Conventional methods for activating GPER involve treating with ligands G1 or E2. However, activation by ligand binding has the disadvantage that there is a time delay in the ligand binding to the receptor by diffusion after treatment, and it is impossible to achieve spatial precision, such as activation at the individual cell level.

[0008] Against this background, the inventors of the present invention confirmed that when the extracellular domain and cell membrane domain of rhodopsin and the intracellular domain of GPER were molecularly fused to produce a fusion protein, OptoGPER, activation occurred with blue light, thereby completing the present invention.

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] Republic of Korea Patent Publication No. 10-2023-0052831 (April 20, 2023)

[0012] Republic of Korea Patent Publication No. 10-2023-0126401 (August 30, 2023)

[0013] [Non-patent literature]

[0014] Natale CA et al, Cell Mol Gastroenterol Hepatol. 2020;10(4):868-880.e1

[0015] An object of the present invention is to provide a fusion protein that is optogenetically activated by blue light, the fusion protein comprising an extracellular domain of rhodopsin; a membrane domain of rhodopsin; and an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the membrane domain.

[0016] Another object of the present invention is to provide a polynucleotide encoding the above fusion protein.

[0017] Another object of the present invention is to provide a recombinant vector comprising the polynucleotide.

[0018] Another object of the present invention is to provide a method for producing a fusion protein activated by blue light, comprising the steps of: treating a cell with the vector; and irradiating the cell with blue light to induce photoactivation.

[0019] Another object of the present invention is to provide a composition comprising the fusion protein or a polynucleotide encoding the same, and for regulating the activity of the fusion protein by blue light irradiation.

[0020] To achieve the above object, the present invention provides a fusion protein that is optogenetically activated by blue light, comprising an extracellular domain of rhodopsin; a membrane domain of rhodopsin; and an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the membrane domain.

[0021] The present invention also provides a polynucleotide encoding the fusion protein.

[0022] The present invention also provides a recombinant vector comprising the polynucleotide.

[0023] The present invention also provides a method for producing a fusion protein activated by blue light, comprising the steps of: treating a cell with the vector; and irradiating the cell with blue light to induce photoactivation.

[0024] The present invention also provides a composition comprising the fusion protein or a polynucleotide encoding the same, and for regulating the activity of the fusion protein by blue light irradiation.

[0025] A fusion protein that is optogenetically activated by blue light, comprising an extracellular domain of rhodopsin according to the present invention; a membrane domain of rhodopsin; and an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the membrane domain, is the first GPER that is activated by optogenetics, and has the effect of being activated by blue light, phosphorylating extracellular signal-regulated kinase (ERK), inhibiting apoptosis, and inducing programmed cell death (necroptosis). In addition, the fusion protein can implement various GPER activation patterns that are not possible with general ligand treatment, and thus can induce various responses of downstream signaling pathways, which can be helpful in interpreting phenomena occurring in physiological or disease states. Therefore, the above fusion protein can be widely used for the prevention and treatment of diseases dependent on or mediated by estrogen receptors, such as cancer and menopause.

[0026] Figure 1 is a schematic diagram of an OptoGPER according to the present invention.

[0027] Figure 2 shows a schematic diagram of the virus treatment and light-induced experiments to confirm the activation of OptoGPER.

[0028] Figure 3 is a bar graph showing the experimental results of qRT-PCR that confirmed the induction of mRNA activation of c-FOS, PTGS2, CTGF, and EGR1 genes by OptoGPER and G1 ligand.

[0029] Figure 4 is a bar graph showing the experimental results of qRT-PCR that confirmed the induction of mRNA expression of MMP2 and COL12A1 genes by the activation pattern of OptoGPER.

[0030] Figure 5 shows the results of a Western blot experiment confirming the induction of downstream protein activation by OptoGPER and G1 ligand.

[0031] Figure 6 shows the results of an experiment confirming phosphorylation of ERK according to activation of OptoGPER using an ERK-KTR sensor.

[0032] Figure 7 shows a schematic diagram of an experiment analyzing transcriptome profiles over time when OptoGPER was activated.

[0033] Figure 8 shows the change in expression of the GPER gene set according to the time of activating OptoGPER.

[0034] Figure 9 shows OptoGPER bulk-RNA seq clustering.

[0035] Figure 10 shows the results of gene ontology analysis of the G1 gene set.

[0036] Figure 11 shows the expression changes of cellular response to TNF and negative apoptosis GO intersection genes.

[0037] Figure 12 shows clustering according to optoGPER-induced expression genes in the TCGA-CESE dataset.

[0038] Figure 13 shows the GO analysis results according to clusters of TCGA-CESE samples.

[0039] Figures 14A to 14C show the experimental results of cell death following simultaneous activation of OptoGPER and OptoFAS using bar graphs and confocal imaging.

[0040] Figures 14D to 14F show the experimental results of cell death following simultaneous activation of OptoGPER and optoRIPK3 using bar graphs and confocal imaging.

[0041] Figures 14G to 14J show the experimental results of cell death following simultaneous activation of OptoGPER and OptoMLKL using bar graphs and confocal imaging.

[0042] Figure 15 shows a prediction modeling of the binding of GPER and RIPK3 (receptor-interacting Serine / Threonine protein kinase 3).

[0043] Figure 16 shows the results of an immunoprecipitation experiment confirming GPER-RIPK3 binding through immunoprecipitation.

[0044] Figure 17 shows the results of analyzing cell death types using a Caspase-3 biosensor.

[0045] Figure 18 shows the results of Western blot analysis confirming the activation of downstream pathway factors according to OptoRIPK3 alone and optoGPER co-activation.

[0046] Figure 19 shows the results of confirming the secretion of DAMPs according to the activation of OptoRIPK3 alone and optoGPER together using a cytokine array.

[0047] Figure 20 shows confocal imaging of the acceleration of HMGB1 release following OptoRIPK3 alone and optoGPER co-activation.

[0048] Figure 21 shows an overview and results of RNA-seq analysis of simultaneous activation of OptoRIPK3 and optoGPER.

[0049] Figure 22 shows the results of GO analysis targeting DEGs when GPER and RIPK3 are simultaneously activated.

[0050] Figures 23a and 23b show the results of GSEA analysis when GPER and RIPK3 are simultaneously activated.

[0051] Figures 24a to 26b show the mapping of activation pathway factors on the Necroptosis KEGG pathway by time zone when OptoRIPK3 and optoGPER are simultaneously activated.

[0052] Figure 27 is a schematic diagram showing the induction of expression of programmed cell death pathway factors through OptoGPER.

[0053] Hereinafter, the present invention will be described in detail.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0055] When the present invention says that a component or a step "includes", this does not mean that other components or other steps are excluded, but rather that other components or other steps may be further included, unless specifically stated otherwise.

[0056] In the present invention, the term "administration" means a method of causing at least partial localization to a desired site of an object or placing a given substance into an object. Administration can be carried out by any method known in the art.

[0057] In the present invention, the term "polynucleotide" may have any three-dimensional structure and may perform any known or unknown function. The polynucleotide has a meaning that comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and the basic structural unit, nucleotide, includes not only natural nucleotides but also analogs with modified sugar or base moieties. The sequence of the polynucleotide may be modified, and the modifications include additions, deletions, non-conservative substitutions, or conservative substitutions of nucleotides.

[0058] In the present invention, the term "vector" is understood as a nucleic acid means comprising a nucleotide sequence that can be introduced into a host cell and recombined and inserted into the host cell genome, or can be autonomously replicated as an episome. The vector includes linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors, and analogs thereof.

[0059] In the present invention, the term "fusion protein" means a protein in which another protein is linked to the N-terminus or C-terminus of the original target protein sequence or in which another amino acid sequence is added.

[0060] The present invention provides a fusion protein that is optogenetically activated by blue light, comprising an extracellular domain of rhodopsin; a membrane domain of rhodopsin; and an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the membrane domain.

[0061] The above domain refers to a protein domain, which refers to the part or region necessary for a protein to perform a specific task. Protein domains are composed of amino acids of various lengths, ranging from 25 to 500, and are composed of secondary structures such as alpha-helices, beta-sheets, beta-turns, and random coils.

[0062] The above ectodomain refers to the part of a protein or other biological molecule that interacts with the extracellular environment, and is mainly located on the cell surface.

[0063] The above cell membrane domain is a portion located within the cell membrane and may be involved in biological processes such as substances moving through the cell membrane or signal transmission.

[0064] The intracellular domain is a portion located inside the cell and may include proteins or other molecules related to signal transmission and intracellular material exchange within the cell.

[0065] The above fusion protein can be encoded by the base sequence of SEQ ID NO: 1:

[0066]

[0067] The above fusion protein has a wavelength of 350 to 500 nm and a wavelength of 500 to 1500 Uw / cm 2 It can be activated by irradiating with blue light having an intensity of 1 to 10 days, preferably with a wavelength of 400 to 500 nm and a intensity of 700 to 1300 Uw / cm 2 It can be activated by exposure to blue light of any intensity for 1 to 7 days, but is not limited thereto.

[0068] Additionally, the blue light may be irradiated for 0.1 to 10 hours, preferably irradiated for 0.1 to 8 hours, but is not limited thereto.

[0069] The above fusion protein can increase mRNA expression of any one or more genes selected from the group consisting of c-FOS, PTGS2, CTGF, EGR1, MMP2, and COL12A1, the expression of which is increased by activated GPER, but is not limited thereto.

[0070] The fusion protein may further comprise a fluorescent protein. The fluorescent protein may be, but is not limited to, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), far-red fluorescent protein, or a tetracysteine ​​motif.

[0071] The above fusion protein can phosphorylate extracellular signal-regulated kinase (ERK).

[0072] The above-mentioned extracellular signal-regulated kinase is a type of mitogen-activated protein kinase (MAPK). MAPK is a type of serine / threonine protein kinase that plays a crucial role in the intracellular signal transduction system in response to various external stimuli and is involved in the regulation of the expression of many genes. MAPK is classified into ERK1, ERK2, and SAPKs (stress-activated kinases). SAPKs can also be referred to as JNKs (c-Jun N-terminal kinases).

[0073] The above fusion protein can inhibit apoptosis and induce programmed cell death (necroptosis).

[0074] Apoptosis is a cell death pathway regulated by the activity of cysteine ​​proteases known as caspases, and may also be referred to as programmed cell death or apoptosis.

[0075] Programmed cell necrosis (necroptosis) involves RIPK1, RIPK3, and MLKL proteins, which are sequentially activated and form a large complex called necrosome, and cause cell membrane fragmentation by MLKL, inducing cell death without protein degradation or oxidation. Recently, when RIPK3 knockout was performed in mice, it was confirmed that the neuronal damage in acute pancreatitis, ischemia-reperfusion injury, systemic inflammatory response syndrome, terminal ileum necrosis, retinal detachment, inflammatory bowel disease, atherosclerosis, and Goucher disease was improved compared to the wild type, revealing that the phenomenon of programmed cell necrosis is related to various immune diseases and diseases related to cell tissue damage.

[0076] The above programmed necroptosis can be achieved through binding to RIPK3, but is not limited thereto.

[0077] The present invention also provides a polynucleotide encoding the fusion protein.

[0078] The present invention also provides a recombinant vector comprising the polynucleotide.

[0079] The above vector components may generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, a robustness factor element, a promoter, and a transcription termination sequence.

[0080] The above vector may be at least one virus selected from the group consisting of adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, modified vaccinia virus ankara (MVA), herpes simplex virus, and baculovirus, and is preferably an adenovirus, but is not limited thereto.

[0081] The present invention also provides a method for producing a fusion protein activated by blue light, comprising the steps of treating a cell with the vector; and irradiating the cell with blue light to induce photoactivation.

[0082] The present invention also provides a composition comprising a fusion protein or a polynucleotide encoding the same, and for regulating the activity of the fusion protein by blue light irradiation.

[0083] The above composition can inhibit apoptosis and induce programmed cell death (necroptosis), but is not limited thereto.

[0084] The composition may additionally include a pharmaceutically acceptable carrier for administration. The pharmaceutically acceptable carrier may be any non-toxic material suitable for delivery to a patient. Examples of such carriers include distilled water, alcohol, fats, waxes, and inert solids. Pharmaceutically acceptable adjuvants (buffers, dispersants) may also be included in the pharmaceutical composition.

[0085] Specifically, the pharmaceutical composition may be prepared as a parenteral formulation according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Here, "pharmaceutically acceptable" means that the carrier does not inhibit the activity of the active ingredient and does not exhibit toxicity exceeding the tolerable level of the intended subject.

[0086] When the above pharmaceutical composition is prepared as a parenteral formulation, it can be formulated into the form of injections, transdermal administration, nasal inhalation, and suppositories using a suitable carrier according to a method known in the art. When formulated as an injection, suitable carriers include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof, and preferably, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, sterile water for injection, and isotonic solutions such as 5% dextrose can be used.

[0087] The compositions, methods, and uses of the present invention can be administered to a subject in need thereof in a sufficient or effective amount. An "effective amount" or "sufficient amount" refers to an amount, alone or in combination with one or more other therapeutic compositions, protocols, or treatment regimens, in a single or multiple doses to provide benefit to the subject or to provide the expected or desired result in the subject for any period of time. The dosage form may vary depending on factors such as the formulation method, the mode of administration, the patient's age, weight, sex, pathological condition, time of administration, route of administration, excretion rate, and responsiveness.

[0088]

[0089] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0090]

[0091] 1. Development of OptoGPER and confirmation of optogenetic activation

[0092] 1-1. Development of OptoGPER

[0093] As shown in Fig. 1, optoGPER (SEQ ID NO: 1) is based on the DNA base sequence of rhodopsin, with the intracellular loop and C-terminus replaced with the DNA base sequence constituting the intracellular domain of GPER:

[0094]

[0095]

[0096] For visualization during cell imaging using a microscope, OptoGPER-EGFP and OptoGPER-miRFP were produced by tagging the C-terminus of OptoGPER with fluorescent proteins EGFP (enhanced green fluorescent protein) and miRFP (monomeric infrared fluorescent protein).

[0097] To this end, EGFP and miRFP were amplified by PCR from CMV-EGFP-N1 and CMV-miRFP670-N1 vectors, digested with NotI / XbaI restriction enzymes (New England Biolabs), and inserted behind the optoGPER sequence using the Gibson assembly cloning method (New England Biolabs). Primers used were as follows.

[0098]

[0099] Base sequence sequence number Forward primer 5' GGTTGCCCCCGCCGCGGCCGCCATGGTGAGCAAGG 3'2 Reverse primer 5' CGAACCGCGGGCCCTCTAGATTACTTGTACAGCTCGTCCATGC 3'3

[0100]

[0101] To produce OptoGPER in the form of adeno-associated virus (AAV) to be processed into cells, an HA tag was inserted into the C-terminus of OptoGPER to produce OptoGPER-HA. In the AAV-CMV-DIO-optoFGFR1-HA vector, DIO-optoFGFR1-HA was removed using XbaI / HindIII restriction enzymes (New England Biolabs) and replaced with optoGPER-HA and EGFP amplified by PCR, respectively, to produce AAV-CMV-optoGPER-HA and AAV-CMV-EGFP.

[0102]

[0103] Base sequence Sequence number Primer used to construct OptoGPER-HA Forward primer 5' GTAAAGCTTGCCACCATGAATGGGACC 3'4 Reverse primer 5'gtaACCGGTttaAGCATAATCTGGAACATCATATGGATAacctccGGCGGGGGCAACCTGTGAA 3'5 Primer used to construct AAV-CMV-optoGPER-HA and AAV-CMV-EGFP Forward primer 5' GTATCTAGAGCCACCATGAATGGGACCGAGG 3'6 Reverse primer 5' GTAAAGCTTTTACTTGTACAGCTCGTCCATGCCG 3'7 EGFP Forward primer 5' GTATCTAGAGCCACCATGGTGAGCAAGGGC 3'8 Reverse primer 5' GTAAAGCTTTTACTTGTACAGCTCGTCCATGCCG 3'9

[0104]

[0105] 1-2. Confirmation of mRNA expression induction by OptoGPER activation

[0106] We conducted experiments to determine whether the fabricated optoGPER could induce downstream signaling pathway activation following GPER activation, leading to increased mRNA expression of several factors known to be well-inducible. For the experiment, HeLa cells were treated with the AAV-CMV-optoGPER-HA virus, and after 4 days of culture, photoactivation was induced using a blue light LED. In addition, after AAV-CMV-EGFP virus treatment and culture, G1 ligand was simultaneously treated to induce ligand-induced GPER activation, and the results were compared with optoGPER (Fig. 2).

[0107]

[0108] HeLa cells were maintained in DMEM (Gibco) containing 10% fetal bovine serum (FBS), 1% penicillin and streptomycin, at 37°C, 5% CO2 in a humidified atmosphere. Experiments were performed by seeding 2x10 cells in 6-well plates. 5AAV-CMV-optoGPER-EGFP and AAV-CMV-EGFP were transduced one day later as busy as a dog. For more than 24 hours, the medium was changed to a humidified environment containing DMEM (Cat. No. LM 001-10, Welgene) without phenol red, 10% fetal bovine serum (FBS) stripped with dextran-coated charcoal (charcoal, dextran coated / Sigma, C6241-5G), 1% penicillin and streptomycin, 37°C, 5% CO2. Four days after transduction, 488 nm blue light was applied at 919.43 uW / cm 2 Light stimulation was applied at different intensity levels and run for 0, 0.25, 0.5, 1, 2, and 4 h. G1 (Tocris, 3577) was treated at a concentration of 100 nM.

[0109] AAV was produced using a three-plasmid co-transfection system. Briefly, the transfer plasmid (containing the transgene expression cassette), the packaging plasmid (pRC-DJ / 8), and the helper plasmid (pHelper) were diluted 1:1:2 in Opti-MEM (Cat. No. 31985-070, Gibco). Polyethyleneimine (PEI) was added to the solution to create a 2.5:1 DNA (μg) / PEI (ng). After incubation at room temperature for 15 minutes, the solution was dispensed into 15 cm dishes containing HEK293T cells grown to 75–80% confluency. The culture medium was completely replaced 4 hours after transfection. Cells were harvested 60–72 hours after transfection and centrifuged at 3300 g. The pellet was resuspended in 14 ml of lysis buffer (50 mM tris-Cl (pH 8.0), 150 mM NaCl, and 2 mM MgCl2) for 20 min at 4°C and mixed with 10% sodium deoxycholate (final concentration, 0.5%) and benzonase (final concentration, 50 U / ml). Each lysate was incubated at 37°C for 30 min, frozen and thawed 3–4 times, and centrifuged at 12,000 g for 30 min at 4°C. The supernatant was loaded onto an iodixanol gradient layer and ultracentrifuged at 69,000 rpm for 1 h at 4°C. The 40% iodixanol fraction was extracted, washed four times with cold PBS in 100,000 molecular weight cut-off Amicon tubes, and concentrated by centrifugation at 3000 g to obtain a volume of 150 to 200 μl.

[0110] To transduce cells using AAV, viral concentrates were added to plates and incubated at 37°C. After 24 hours, all cells were replaced with maintenance medium. A multiplicity of infection (MOI) of 5,000 to 40,000 was used for transduction.

[0111]

[0112] We examined the mRNA expression levels of c-FOS, PTGS2, CTGF, and EGR1 genes, known to be increased by activated GPER, using qRT-PCR. Although the expression and levels of target genes over time differed between the group treated with 100 nM G1 and the group stimulated with light by optoGPER, an overall increasing trend was observed in both groups (Fig. 3).

[0113]

[0114] Additionally, to analyze the difference in the induction of downstream signaling pathways of OptoGPER according to the photoactivation pattern, NIH3T3 cells were transduced with OptoGPER using AAV, and continuous light stimulation or pulsed light stimulation (1 s light stimulation followed by 9 s rest) was applied. The expression levels of MMP2 and COL12A1 mRNA were confirmed by qRT-PCR (Table 3).

[0115]

[0116] Base sequence Sequence number MMP2 Reverse primer 5' TATTCTGGTCAAGATCACCTGTCTG 3'10 Forward primer 5' CTGAAGGACACACTAAAGAAGATGC 3'11 COL12A1 Reverse primer 5' TATCCAAGAACTGGAGAAGGTGAAG 3'12 Forward primer 5' GCTGTTTATGAAGATGGAGATGGTG 3'13

[0117]

[0118] The duration of continuous (Cons) and pulsed (Puls) light stimulation was 1, 3, 6, and 12 hours, and the light intensity was 919.43 μW / cm 2It was used consistently. When continuous light stimulation was given, the mRNA expression levels of MMP2 and COL12A1 decreased at 3 hours but recovered to normal levels at 12 hours, whereas pulsed light stimulation was able to continuously suppress the expression levels of the two types of mRNA from 1 to 3 hours after light stimulation (Fig. 4).

[0119]

[0120] 1-3. mRNA extraction and qRT-PCR experimental methods

[0121] RNA was extracted using the RNeasy Plus mini kit (Cat. No. 74134, QIAGEN) according to the manufacturer's instructions. cDNA was synthesized from the extracted RNA and performed using the GoScript Reverse Transcription System (Cat. No. A5001, Promega) according to the manufacturer's instructions. qRT-PCR was performed using GoTaq qPCR Master Mix (Cat. No. A6002, Promega) according to the manufacturer's instructions, using FrameStar 0.1 ml 96-well qPCR plates (Cat. No. NJ904, Takara) with a Thermal Cycler Dice Real-Time System III (Takara). The mRNA expression level of the target gene was normalized to the expression level of GAPDH mRNA and analyzed using the comparative Ct method (ΔΔCt). P-values ​​were analyzed in Prism and one-way ANOVA was used. ( * < 0.05, ** <0.01, *** <0.001, **** <0.0001) The error bars were set by calculating the standard deviation of the average value of the values ​​repeated three times. The primers used are as follows.

[0122]

[0123] Base Sequence Sequence Number EGR1 Reverse Primer 5' Cgctaacccctctgtctactatt 3'14 Forward Primer 5' gactggtagctggtattgaggg 3'15 CTGF(ccn2) Reverse Primer 5' cccaaaatctccaagcctatcaa 3'16 Forward Primer 5' ccacagaatttagctcggtatgt 3'17 PTGS2 Reverse Primer 5' attcccttccttcgaaatgcaat 3'18 Forward Primer 5' cattgtaagttggtggactgtca 3'19 CFOS Reverse Primer 5' gttgtgaagaccatgacaggag 3'20 Forward Primer 5' ccatcttattcctttcccttcgg 3'21

[0124]

[0125] 1-4. Confirmation of induction of downstream signaling pathway protein activation by OptoGPER activation

[0126] A group of cervical cancer (HeLa) cells transduced with AAV-CMV-optoGPER-HA were given light stimulation at different times, and a group of HeLa cells transduced with AAV-shortEF1a-EGFP were treated with 100 nM G1 at different times, and the level of protein expression was confirmed by Western blotting. Looking at phosphorylated ERK (extracellular signal-regulated kinase), in the case of optoGPER, it was confirmed that it gradually increased from 30 minutes, decreased at 2 hours, and increased again at 4 hours. It was confirmed that the light treated with G1 also increased at 30 minutes, decreased at 1 hour, and increased again at 2 hours (Fig. 5).

[0127]

[0128] 1-5. Detailed methods for protein extraction and Western blot experiments

[0129] Cell lysates were obtained using cell lysis buffer (Cell Signaling Technology, Massachusetts, USA) with a protease / phosphatase inhibitor cocktail (Cell Signaling Technology). Protein concentrations were assessed using the Bradford protein assay kit (Thermo Fisher Scientific, Massachusetts, USA). Equal amounts of protein were then separated using 4–12% Bis-Tris gradient gels (Thermo Fisher Scientific) with MOPS running buffer (Thermo Fisher Scientific) according to the manufacturer's instructions. The separated proteins were transferred to polyvinylidene difluoride membranes. After blocking with skim milk or 5% BSA, the membranes were incubated with the appropriate primary antibodies and HRP-conjugated secondary antibodies according to the manufacturer's instructions. After washing, the membranes were imaged using chemiluminescence (iBright CL1000, Thermo Fisher Scientific). Information on the antibodies used is as follows: anti-pMLKL (Abcam), anti-MLKL (Cell Signaling Technology), anti-HA (Cell Signaling Technology), anti-AKT (Cell Signaling Technology), anti-ERK (Cell Signaling Technology), anti-pAKT (S473) (Cell Signaling Technology), anti-pERK (T202 / Y204) (Cell Signaling Technology), and anti-beta actin (GeneTex).

[0130]

[0131] In addition, activation of pERK (phospho-ERK) was confirmed through real-time confocal imaging. KTR (kinase translocation reporter) is a suitable method for studying kinase activity and location, and is a genetically encoded fluorescent sensor that is converted to a cytoplasmic location when phosphorylated. When ERK is phosphorylated, Elk1 (ETS transcription factor Elk-1), a substrate of extracellular signal-regulated kinase (ERK), binds to the ERK-KTR sensor present in the nucleus. The sensor moves to the cytoplasm through a nuclear localization signal (NLS) and a nuclear export signal (NES) regulated by phosphorylation, and fluorescence is detected in the cytoplasm. When optoGPER was activated, phosphorylation of ERK was confirmed by ERK-KTR, and an increase in ERK phosphorylation was confirmed after 1 hour (Fig. 6).

[0132]

[0133] 2. Analysis of transcriptome changes according to OptoGPER activation time

[0134] 2-1. Transcriptome changes according to OptoGPER activity in cell lines

[0135] Bulk RNA sequencing was used to analyze the integrative changes in the transcriptome profile following OptoGPER activation. HeLa cells were seeded and transduced with AAV-CMV-optoGPER-EGFP the following day. Four days later, they were exposed to light at different time points and then flash frozen in liquid nitrogen. The prepared samples were used to prepare a sequencing library using TruSeq stranded RNA (illumine) and subjected to NovaSeq6000 sequencing (100 bp paired-end, 6 Gb) (Macrogen, Figure 7).

[0136]

[0137] In RNA-seq data acquired after OptoGPER1 activation, gene enrichment scores were quantified using a set of genes known to be upregulated by GPER1 activation (PTGS2, CCN1, EGR1, FOS, CCN2, CCND1), and an increase over time was confirmed (Fig. 8).

[0138]

[0139] The top 450 genes that show expression changes over time after OptoGPER1 activation can be divided into three gene sets by applying the Euclid clustering method. G1 is a group that shows an increase over time from 0 to 4 hours, G2 is a group that shows an increase from 0 to 2 hours and then a decrease in expression at 4 hours, and G3 is a group that shows a continuous increase in expression and then a decrease in expression at 4 hours (Fig. 9). Among these, gene ontology analysis was performed on the genes constituting G1, and the expression of apoptosis suppressor genes (GO: 0043066) and genes expressed in response to tumor necrosis factor (TNF) (GO: 0071356) was found to be increased (Fig. 10).

[0140]

[0141] Additionally, when examining the expression changes according to optoGPER activation of 10 genes corresponding to the intersection of Cellular response to TNF (GO:0071356) and Negative Apoptosis (GO:0043066) in Figure 9 through RNA-seq data, we can confirm that they show an increase over time (Figure 11). The red line represents a nonlinear expression pattern fitted to a natural spline.

[0142]

[0143] 2-2. Confirmation of transcriptome changes according to GPER activity in public databases

[0144] To determine whether the changes in transcriptome expression induced by optoGPER activation in cell lines also occur in actual patient samples, we analyzed 200 cases of Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma (CESC) from the TCGA database. Using the top 450 genes expressed upon optoGPER activation in HeLa, we plotted the results as a heatmap using the Euclidean distance method and the k-means algorithm, confirming that all cases were largely divided into two clusters (Fig. 12).

[0145]

[0146] Among these, Cluster-2 showed a statistically significant increase in the expression of the G1 gene set confirmed in Figure 8 compared to Cluster-1, which can be inferred that GPER activation occurred in the tumor samples of the group. In addition, samples included in cluster-2 also showed a statistically significant increase in the expression of GO terms of “positive regulation of inflammatory response” (GO:0050729), “negative regulation of apoptosis process” (GO:0043066), and “necroptotic process” (GO:0070266), which is consistent with or similar to the types of GO increased in G1 shown in Figure 9 (Figure 13). Statistical differences were confirmed by Student t-test ( ** P<0.05) was used to investigate.

[0147]

[0148] 3. Analysis of the effect of GPER on the cell death pathway

[0149] 3-1. Analysis of the effect of GPER activity according to the type of cell death

[0150] From HeLa cell line experiments and TCGA database analysis, it was confirmed that GPER activation induces the expression of genes related to the inhibition of apoptosis and increases the expression of genes related to cellular response to TNF activation. When TNF ligands bind, cells can induce factors related to cell proliferation through NF-kB activation depending on the situation, or conversely, different forms of cell death, such as apoptosis and necroptosis, can occur (Webster JD, Vucic D. Front Cell Dev Biol 2020). To confirm how GPER activation affects the apoptosis and necrosis pathways, respectively, an experimental method that can specifically induce apoptosis and necrosis was needed. Therefore, using OptoFAS, a previously published optogenetic apoptosis-inducing system (Kim et al., Sci Adv 2020), and OptoRIPK3 and OptoMLKL, an optogenetic necrosis-inducing system (Shkarina et al., J Cell Biol 2022; Taslimi et al., Cell Death Discovery 2023), we transfected cells with OptoGPER, and confirmed the apoptosis morphology according to optogenetic activation by real-time confocal imaging, followed by quantitative analysis (Fig. 14).

[0151] When optoFAS was photoactivated alone, approximately 80% of cancer cells were inducible to apoptosis within 8 hours. Conversely, co-activation of optoGPER with optoFAS resulted in a statistically significant reduction in apoptosis (Figures 13A to 13C). This finding is consistent with the observation of negative apoptotic process activity in the RNA-seq analysis of optoGPER, suggesting that signaling pathway activation following GPER activation influences the apoptotic pathway.

[0152] Activation of receptor-interacting serine / threonine protein kinase 3 (RIPK3), a necrotic cell death pathway factor, using optoRIPK3 can be observed to induce cell death. Interestingly, simultaneous activation of OptoGPER accelerated cell death, with statistically significantly faster cell death induction between 0 and 4 hours (Figs. 13D and 13F).

[0153] On the other hand, in the case of MLKL, which is a factor in the same necrosis pathway and a downstream factor of RIPK3, there was no difference in the degree of programmed cell necrosis induction between the case of optoMLKL alone and the case of simultaneous activation with optoGPER (Figs. 13G to 13I). When G1, a ligand that can activate GPER while inducing each type of cell death, was treated, a similar result was observed as with optoGPER. In summary, it was confirmed that when cell death is induced, the simultaneous activation of GPER suppresses the apoptotic cell death pathway, accelerates the programmed cell necrosis pathway, and is particularly involved in the activation step of RIPK3.

[0154] This can also be inferred from the protein binding prediction results using Alphafold (https: / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb), and the results of predicting the protein interaction and structure of GPER and RIPK3 using PyMOL and pLDDT software predicted that the C-terminal part of GPER binds to RIPK3, and Y142 and L145 of GPER were shown to be the parts that interact with RIPK3 (Fig. 15).

[0155]

[0156] Furthermore, co-immunoprecipitation confirmed direct binding between GPER and RIPK3 (Fig. 16). This suggests that direct structural binding between GPER and RIPK3 promotes RIPK3 activation.

[0157]

[0158] 3-2. Detailed protocol for immunoprecipitation experiments

[0159] HEK293T cells were transfected with CMV-optoGPER-HA and CMV-optoRIPK3-EGFP using Lipofectamine LTX reagent (Invitrogen, 15338-030) according to the manufacturer's instructions. At the same time, the cells were cultured in DMEM (Cat. LM 001-10, Wellgene) without phenol red, 10% fetal bovine serum (FBS) stripped with dextran-coated charcoal (charcoal, dextran coated / Sigma, C6241-5G), 1% penicillin and streptomycin, and a humidified atmosphere containing 5% CO2 at 37°C. One day later, 488 nm / 919.43 Uw / cm 2Light stimulation was applied for 1 hour at 100 nm. Cell lysates were prepared using IP lysis buffer (Thermo Fisher Scientific) with a protease / phosphatase inhibitor cocktail (Cell Signaling Technology). For immunoprecipitation of hemagglutinin (HA)-conjugated GPER1 protein and its interacting molecules, equal amounts of protein from the cell lysates were incubated with anti-HA agarose (Thermo Fisher Scientific) for 4 hours. After washing and elution, the purified proteins were subjected to Western blot analysis using anti-GFP (Santa Cruz Biotechnology, Texas, USA) and anti-HA (Cell Signaling Technology).

[0160]

[0161] 3-3. Confirmation of increased activity of the programmed cell death pathway following simultaneous activation of GPER and RIPK3.

[0162] The above results show that when GPER and RIPK3 are simultaneously activated, the combination of GPER and RIPK3 induces rapid activation of RIPK3 and accelerates the programmed cell death pathway. First, we confirmed that the accelerated cell death observed when optoGPER and optoRIPK3 were activated together was not apoptosis. The caspase 3 biosensor is a FRET-based sensor that is affected by the action of caspase 3 in cells and changes from green fluorescence to red fluorescence. When apoptosis was induced using OptoFAS, a reaction that changes to red fluorescence as cells die was detected, but when optoRIPK3 was activated alone or together with optoGPER to induce apoptosis, it was confirmed that red fluorescence was not detected in the cells (Fig. 17).

[0163]

[0164] In addition, experiments using Western blots confirmed that when optoRIPK3 alone or when optoGPER was simultaneously induced, the phosphorylation of RIPK3 increased from 1 hour of activation. When optoGPER and optoRIPK3 were simultaneously activated, it was confirmed that MLKL, a downstream factor of the RIPK3 pathway, was activated, resulting in a faster and stronger increase in p-MLKL compared to when optoRIPK3 was activated alone (Fig. 18).

[0165]

[0166] 3-4. Detailed protocol for Western blot experiments

[0167] Cell lysates were obtained using cell lysis buffer (Cell Signaling Technology, Massachusetts, USA) with a protease / phosphatase inhibitor cocktail (Cell Signaling Technology). Protein concentration was assessed using the Bradford protein assay kit (Thermo Fisher Scientific, Massachusetts, USA). Equal amounts of protein were then separated using 4–12% Bis-Tris gradient gels (Thermo Fisher Scientific) with MOPS running buffer (Thermo Fisher Scientific) according to the manufacturer's instructions. The separated proteins were transferred to polyvinylidene difluoride membranes. After blocking with skim milk or 5% BSA, the membranes were incubated with the appropriate primary antibodies and HRP-conjugated secondary antibodies according to the manufacturer's instructions. After washing, the membranes were imaged using chemiluminescence (iBright CL1000, Thermo Fisher Scientific). The antibodies used were as follows: anti-pMLKL (Abcam), anti-MLKL (Cell Signaling Technology), anti-HA (Cell Signaling Technology), anti-AKT (Cell Signaling Technology), anti-ERK (Cell Signaling Technology), anti-pAKT(S473) (Cell Signaling Technology), anti-pERK(T202 / Y204) (Cell Signaling Technology), anti-beta actin (GeneTex).

[0168]

[0169] When the programmed cell death pathway is activated and cell damage occurs, substances such as cytokines called damage-associated molecular patterns (DAMPs) are secreted extracellularly. When a cytokine array was performed, it was found that when optoGPER was also activated (G+R), relatively more cytokines were secreted compared to when optoRIPK3 was induced alone (R), and IL-8 was the representative cytokine activated (Fig. 19).

[0170]

[0171] 3-5. Detailed experimental protocol for cytokine array experiments

[0172] After 4 h of light stimulation, the cell supernatant was centrifuged to remove debris and cells and filtered through a 0.25 μm syringe filter. Cytokine arrays were analyzed using the Proteome Profiler Human XLCytokine Assay Kit (R&D Systems, ARY022B) according to the manufacturer's instructions. Spot quantification was performed using the ImageJ plugin Protein Array Analyser.

[0173]

[0174] Furthermore, as one of the DAMPs, the HMGB1 protein, which is located in the nucleus, is secreted into the cytoplasm during apoptosis. When real-time confocal imaging was performed using a vector (construct) that tagged HMGB1 with GFP to visually confirm its intracellular movement, it was confirmed that the movement of HMGB1 from the nucleus to the cytoplasm was accelerated when optoRIPK3 and optoGPER were simultaneously activated (Fig. 20).

[0175]

[0176] Through the above experimental results, it was confirmed that when GPER activation is added to the programmed cell death pathway starting from the activity of RIPK3, the programmed cell death pathway activity is accelerated.

[0177]

[0178] 4. Integrated transcriptome analysis of the effect of GPER on RIPK3 activation.

[0179] 4-1. RNA-seq analysis

[0180] To more comprehensively analyze the effect of GPER on RIPK3 activation, we performed transcriptome analysis through mRNA expression changes upon activation of optoRIPK3 alone and upon simultaneous activation of optoRIPK3 and optoGPER using total RNA-seq. Compared to activation of optoRIPK3 alone, simultaneous activation of optoGPER and optoRIPK3 showed significantly different patterns of gene expression over time (0.5, 1, and 2 h) (Fig. 21). The heatmap shows the enhanced gene levels for genes that were significantly increased (p-value < 0.05 and logFC > 0.2) upon combined activation (GPER / RIPK3) compared to optoRIPK3 activation at the indicated time points. After adjusting the gene expression levels at the indicated time points to the baseline (0 h) expression level, logFC and p-value were calculated. RNA-seq was prepared as a sequencing library using TruSeq stranded RNA (illumine) as in the previous experiment, and NovaSeq6000 Sequencing (100 bp pair-end, 6 Gb) was performed (Macrogen).

[0181]

[0182] 4-2. GO Analysis

[0183] When the biological process (BP) of the GO was analyzed for the differentially expressed genes (DEG) when optoRIPK3 and optoGPER were simultaneously activated compared to when optoRIPK3 was activated alone, genes related to elements required for increased intracellular activity, such as response to organophosphorus and response to cAMP, were increased at 0.5 hours. In addition, at 1 hour, the expression of genes related to the cellular response to stress was increased, which could be used to infer the activation of the programmed cell death pathway. In addition, changes in the expression of genes related to cell proliferation, such as the cell cycle process and DNA replication, were also observed. After 2 hours of activation, we were able to confirm an increase in the activity of factors related to the mitochondrial pathway, which is included in the programmed cell necrosis sub-pathway, and processes related to changes in protein levels, such as protein assembly (Fig. 22).

[0184]

[0185] 4-3. GSEA Analysis

[0186] In addition, when GSEA analysis was performed using the HALLMARK and REACTOME gene sets, TNFa signaling was statistically significantly increased at 30 minutes and 1 hour when optoGPER was also activated compared to samples in which only optoRIPK3 was activated, and at 2 hours, an increase in diseases of programmed cell death and estrogen-dependent gene expression was confirmed (Fig. 23).

[0187]

[0188] 4-4. Programmed Cell Necrosis KEGG Pathway Activation Pathway Factor Map

[0189] When RNA-seq results after simultaneous activation of optoRIPK3 and optoGPER were applied to various factors of the programmed cell necrosis KEGG pathway map, relative activation of various programmed cell necrosis pathway factors was observed at various time points (0.5, 1, and 2 hours) (Fig. 24).

[0190] Based on the above results, it can be concluded that GPER activation induces rapid programmed necrotic cell death by interacting with RIPK3 in cells where the programmed necrosis pathway has started, thereby increasing the expression of various programmed necrosis pathway factors.

[0191]

[0192] The present invention is an invention carried out through the following tasks.

[0193]

[0194] [National Research and Development Project Supporting This Invention]

[0195] [Project ID]1711191473

[0196] [Assignment Number] 2021R1A4A1031856

[0197] [Ministry Name] Ministry of Science and ICT

[0198] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0199] [Research Project Name] Group Research Support

[0200] [Research Project Name] Immunogenic Cell Death Program Laboratory

[0201] [Contribution rate] 1 / 2

[0202] [Name of Project Performing Organization] Ajou University

[0203] Research Period: June 1, 2021 - February 29, 2024

[0204]

[0205] [National Research and Development Project Supporting This Invention]

[0206] [Project ID]1711192406

[0207] [Assignment Number] 2022R1C1C1007289

[0208] [Ministry Name] Ministry of Science and ICT

[0209] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0210] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)

[0211] [Research Project Name] Optogenetic Stimulation in Patient-Derived Composite Pancreatic Cancer Organoid Model

[0212] Cancer microenvironment signaling through modulation of steroid receptor activity

[0213] Analysis and treatment target discovery

[0214] [Contribution rate] 1 / 2

[0215] [Name of Project Performing Organization] Ajou University

[0216] [Research Period] March 1, 2022 - February 28, 2025

Claims

1. Extracellular domain of rhodopsin; The membrane domain of rhodopsin; and Comprising an intracellular domain of a G-protein coupled estrogen receptor (GPER) bound to the cell membrane domain, A fusion protein that is optogenetically activated by blue light.

2. In the first paragraph, the fusion protein is a fusion protein encoded by the base sequence of sequence number 1.

3. In the first paragraph, the fusion protein has a wavelength of 350 to 500 nm and a light intensity of 500 to 1500 Uw / cm. 2 A fusion protein that is activated by exposure to blue light of high intensity for 1 to 10 days.

4. In the first paragraph, the fusion protein is a fusion protein that increases the mRNA expression of at least one gene selected from the group consisting of c-FOS, PTGS2, CTGF, EGR1, MMP2, and COL12A1.

5. In the first paragraph, the fusion protein is a fusion protein that phosphorylates extracellular signal-regulated kinase (ERK).

6. In the first paragraph, the fusion protein is a fusion protein that inhibits apoptosis and induces programmed necroptosis.

7. A fusion protein in clause 6, wherein the programmed necroptosis is achieved through binding to RIPK3.

8. A polynucleotide encoding a fusion protein according to paragraph 1.

9. A recombinant vector comprising the polynucleotide of clause 8.

10. A recombinant vector according to claim 9, wherein the vector is at least one virus selected from the group consisting of adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, modified vaccinia virus ankara (MVA), herpes simplex virus, and baculovirus.

11. A step of treating cells with the vector of clause 9; and A step of inducing photoactivation by irradiating the above cells with blue light; A method for producing a fusion protein activated by blue light, comprising:

12. In the 11th paragraph, the fusion protein has a wavelength of 350 to 500 nm and a power of 500 to 1500 uW / cm. 2 A manufacturing method that is activated by irradiating blue light with a high intensity for 1 to 10 days.

13. A composition comprising the fusion protein of clause 1 or a polynucleotide encoding the same, and for regulating the activity of the fusion protein by blue light irradiation.

14. In claim 13, the composition inhibits apoptosis and induces programmed necroptosis.

Images