Mir-211 and ACSL4 as therapeutic agents for childhood cancer medulloblastomas

Abstract

Nanoparticles comprising miR-211 and their use for treating brain cancers, such as medulloblastomas, including pediatric medulloblastomas, are disclosed.

Description

miR-211 AND ACSL4 AS THERAPEUTIC AGENTS FOR CHILDHOOD CANCER MEDULLOBLASTOMAS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Patent Application No. 63 / 604,971 filed on December 1, 2023, which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. The XML copy, created on November 27, 2024, is named “JHU_40881_601_SequenceListing.xml” and is 16,032 bytes in size. BACKGROUND

[0003] Brain tumors are the second most common pediatric malignant tumor and the leading cause of cancer‐related morbidity and mortality in childhood. Among these brain tumors, medulloblastoma (MB) is one of the most frequent malignant brain cancers and accounts for 20% of pediatric intracranial embryonal tumors. Northcott et al., 2019; Ostrom et al., 2018. High‐throughput analyses have identified four principal molecular groups of MB: WNT‐activated, SHH-activated, Group 3, and Group 4 MBs. Northcott et al., 2017; Louis et al., 2016. The subgroups differ not only in underlying genetic alterations, but also in clinical features and treatment. Louis et al., 2016; Rusert et al., 2020; Northcott et al., 2012.

[0004] Patients diagnosed in the non-WNT subgroups are predicted to have worse overall survival rates. Although advances in surgery and adjuvant therapies have increased long-term survival rates, approximately 30% of the MB patients eventually deteriorate with recurrence and metastasis. Gajjar and Robinson, 2014; von Bueren et al., 2016. Because of the highly toxic side effects of radiation and chemotherapy, surviving children have a lower quality of life. Therefore, it is urgent to better understand the cellular and molecular biology of the MB to explain pathogenesis and progression for developing effective treatment. SUMMARY

[0005] In some aspects, the presently disclosed subject matter provides a method for treating a brain cancer in a subject in need of treatment thereof, the method comprising administering to the subject a therapeutically effective amount of miR-211.1 40881.601_P16966-03

[0006] In certain aspects, the miR-211 is associated with a nanoparticle. In particular aspects, the nanoparticle comprises a dendrimer nanoparticle. In more particular aspects, the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer. In yet more particular aspects, the PAMAM dendrimer has a generation number from G1 to G10. In certain aspects, dendrimer is PAMAM G6-OH.

[0007] In certain aspects, the nanoparticle further comprises a fluorescent dye. In particular aspects, the fluorescent dye is Cy5.

[0008] In particular aspects, the miR-211 comprises a dendrimer nanoparticle having the following structure: ;

[0010] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

[0011] y is 1;

[0012] miR-211 is an miRNA as described herein;

[0013] D is a dendrimer as described herein; and

[0014] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent.

[0015] In certain aspects, the brain cancer comprises a medulloblastoma. In particular aspects, the medulloblastoma is selected from a WNT‐activated, an SHH-activated, a Group 3, and a Group 4 medulloblastoma.

[0016] In certain aspects, the subject is selected from an adult patient and a pediatric patient. In particular aspects, the pediatric patient has an age ranging from newborn to about 21 years.

[0017] In certain aspects, the administering the therapeutically effective amount of miR-211 results in one or more of reducing cancer cell proliferation, inducing apoptosis of one or more cancer cells, inhibiting tumor growth, and reducing tumor size.

[0018] In certain aspects, administering the therapeutically effective amount of miR-211 targets a gene selected from long-chain-fatty-acid—CoA ligase 4 (ACSL4), serine incorporator 3 protein (SERINC3), and RAB22A.

[0019] In other aspects, the presently disclosed subject matter provides a composition comprising miR-211 and a dendrimer nanoparticle. In certain aspects, the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer. In particular aspects, the PAMAM dendrimer has a2 40881.601_P16966-03generation number from G1 to G10. In more particular aspects, the dendrimer is PAMAM G6-OH.

[0020] In certain aspects, the nanoparticle further comprises a fluorescent dye. In particular aspects, the fluorescent dye is Cy5.

[0021] In certain aspects, the miR-211 comprises a dendrimer nanoparticle having the following structure: ;

[0023] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

[0024] y is 1;

[0025] miR-211 is an miRNA as described herein;

[0026] D is a dendrimer as described herein; and

[0027] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent.

[0028] Certain aspects of the presently disclosed subject matter having been stated hereinabove, which are addressed in whole or in part by the presently disclosed subject matter, other aspects will become evident as the description proceeds when taken in connection with the accompanying Examples and Figures as best described herein below. BRIEF DESCRIPTION OF THE FIGURES

[0029] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0030] Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying Figures, which are not necessarily drawn to scale, and wherein:

[0031] FIG. 1A, FIG. 1B, FIG. 1C, FIG. 1D, FIG. 1E, FIG. 1F and FIG. 1G show miR-211 is a metabolic regulator in MB cells. (FIG. 1A) Global metabolic network analysis of differentially abundant metabolites in MB expressing miR-211 or vector only (V / O) cells. FDR-corrected p-value shown. (FIG.1B) Quantitative analysis of intermediates for essential amino acid (EAA) and glutamine metabolism in D425 cells expressing miR-211 compared with control. (FIG.1C) Oxygen consumption rate (OCR) was analyzed using the Seahorse XF analyzer in D425 vector only (V / O) or miR-2113 40881.601_P16966-03overexpressing cells. (FIG.1D) Basal OCR were measured at three time points, followed by sequential injections of the ATP synthase inhibitor oligomycin, the uncoupler FCCP, the complex I inhibitor rotenone, and the complex III inhibitor antimycin A. (FIG. 1E) The effect of miR-211 overexpression on the mitochondrial content of human D425 cells by MitoTracker Red staining. Red, MitoTracker; Blue, Hoechst 33258. Scale bars, 100 μm. (FIG.1F) Ratio of mitochondrial gene ND1 and lipoprotein lipase (LPL) to genomic β-actin in D425 vector only (V / O) or miR-211 overexpressing cells. (FIG. 1G) Caspase 3 / 7 activities were detected in D425 vector only (V / O) or miR-211 overexpressing cells. Data, mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, NS, nonsignificant;

[0032] FIG. 2A, FIG. 2B, and FIG. 2D show that miR-211 is associated with a metabolicshift in MB cells. (FIG. 2A) Unsupervised hierarchical clustering analysis of D425, CHLA01 and DAOY cells expressing miR-211 global metabolome profiles. (FIG.2B Heat map of the 20 differential metabolites in D425 cells expressing vector only (V / O) or miR-211. (FIG. 2C) Pathway enrichment analysis related to the differential metabolites of D425. Color intensity (yellow to red) reflects increasing statistical significance. The graph was obtained by plotting on the x-axis the −log10 of p- values from pathway enrichment analysis and on the y-axis the pathway impact values derived from pathway topology analysis. (FIG. 2D) Quantitative analysis of intermediates for glycolysis and the tricarboxylic acid (TCA) cycle in D425 cells expressing miR-211 compared with control;

[0033] FIG. 3A and FIG. 3B demonstrate that miR-211 is associated with the energetic phenotypic shift in MB cells. (FIG. 3A) Metabolic phenotype profiles in D425 cells representing changes in metabolic phenotype in response to miR-211 stress. (FIG. 3B) The basal ECAR / OCR ratios of D425 expressing V / O or miR-211 cells are shown as a bar graph (n = 9). Data, mean ± SD. *P < 0.05, **, P < 0.01 ***, P < 0.001;

[0034] FIG.4A and FIG. 4B are (FIG.4A) fold change and (FIG.4B) optical density measurements (absorbance) at 490 nm for dendrimer-MiR-211 particles;

[0035] FIG. 5A and FIG. 5B demonstrates miR-211 expression in medulloblastoma cell lines (FIG. 5A) and PDX (FIG. 5B);

[0036] FIG. 6A, FIG. 6B, FIG. 6C, FIG. 6D and FIG. 6E, demonstrates the effects of miR-211 expression on the proliferation, apoptosis, and invasion of MB cells. (FIG. 6A) Expression of miR- 211 in MB cells expressing vector only (V / O) or miR-211 was detected by qRT-PCR. (FIG. 6B) The effect of miR-211 overexpression on the viability of human MB cells by the MTS assay. (FIG. 6C) Stable MB cells expressing vector only or miR-211 were subjected to soft agar and colony formation analysis. (FIG. 5D) Apoptosis was determined by Annexin V / PI assays in MB cells expressing vector4 40881.601_P16966-03only (V / O) or miR-211. (FIG. 6E) The effect of miR-211 overexpression on the invasive potential of human MBs cells in transwell assays. Data, mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001;

[0037] FIG. 7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG. 7E, FIG. 7F, FIG. 7G, and FIG. 7H shows that miR-211 inhibits MB progression by targeting ACSL4 expression (FIG. 7A) Volcano plot of differentially expressed genes in MB expressing miR-211 or vector only (V / O) cells. (FIG. 7B) Venn diagram revealing the overlap of potential target genes based on miR-211 targets identified in the TargetScan database and the RNA-seq data of downregulated genes from MB cells. (FIG. 7C) Expression levels of potential miR-211 targets ACSL4, RAB22A, and SERINC3 in MB cells expressing vector only (V / O) or miR-211 were validated by qRT-PCR. (FIG. 7D) Relative protein levels of ACSL4, RAB22A, and SERINC3 were detected by western blotting after miR-211 overexpression in MB cells. (FIG.7E) Luciferase activity assay for targeting sequences of the wild or mutant ACSL43′- UTR by miR-211 in D425 cells. (FIG. 7F) D425 expressing miR-211 or vector only (V / O) cells were transiently transfected with ACSL4 plasmid, and lysates were applied to qRT-PCR and western blot. (FIG. 7G) Cell viability was determined by MTS assays in D425 cells overexpressing miR-211 with and without introduction of ACSL4 plasmid. (FIG. 7H) Cell invasive potential was determined by transwell assays in D425 cells overexpressing miR-211 with and without introduction of ACSL4 plasmid. Data, mean ± SD. ***P < 0.001, NS, nonsignificant;

[0038] FIG.8A, FIG.8B and FIG.8C demonstrates that miR-211 inhibits the tumorigenicity of MB cells. (FIG. 8A) MB cells expressing vector only (V / O) or miR-211 were stably transfected with a renilla luciferase expressing construct and implanted into the cerebella of NOD-SCID mice. Tumor formation was assessed weekly after tumor implantation by bioluminescent signal detection with the IVIS platform. (FIG. 8B) Quantification of total photon counts from mice implanted with MB cells expressing V / O or miR-211. (FIG. 8C) Fluorescent staining of Ki-67 and TUNEL in the D425 xenografts on day 35 after intracranial injection. Images in the lower column are the magnified images within the white boxes found in the middle column. Nuclei are stained with DAPI (blue). Scale bars, 100 μm. Data, mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001;

[0039] FIG. 9 illustrates the use of miR-211 as a therapeutic agent in MBS;

[0040] FIG. 10 illustrates a representative drug delivery system (DDS) using an EPR effect;

[0041] FIG. 11 illustrates a representative in vivo therapeutic approach of miR-211;

[0042] FIG. 12 is the normalized expression relative to cancer group for a MAGIC cohort (miR- 211);

[0043] FIG. 13A, FIG. 13B, FIG. 13C, and FIG. 13D show DNA methyltransferase (DNMT)5 40881.601_P16966-03inhibitor increased miR-211 expression and inhibited proliferation in MB cells. (FIG. 13A) TRPM1 and miR-211 promoter sequences were predicted using UCSC. The position of the CpG island was determined using the MethPrimer. A CpG island existed in the 2000 bp upstream sequences of the transcription start site of TRPM1. (FIG.13B) IC50 of DNMT inhibitor 5-Aza-dC in D425 cells. (FIG. 13C) Expression level of TRPM1 and miR-211 in D425 cells after 5-Aza-dC treatment was detected by qRT-PCR. (FIG. 13D) The effect of 5-Aza-dC on the proliferation of human MB cells by MTS assays. Data, mean ± SD. *P < 0.05, ***P < 0.001, NS, non-significant;

[0044] FIG.14A is a heatmap showing expression with V / O-1, V / O-2, V / O-3, miR-211-1, MiR-211- 2, and miR-211-3 and fold change and normalized count with different proteins;

[0045] FIG. 15 is a diagram showing the miR-211 signaling pathway in melanoblasts, Ray and Perera, 2021 (prior art);

[0046] FIG.16 is a drawing showing childhood cancer medulloblastoma, Northcott, 2017 (prior art);

[0047] FIG. 17 is a table showing the top 10 D4245 target KEGG pathways;

[0048] FIG. 18A, FIG. 18B and FIG. 18C show that miR-211 expression is downregulated in MB. (FIG.18A) a Violin plot showing distribution of normalized expression of miR-211 in the 4 molecular subgroups (WNT: 11, SHH: 250, Group 3: 219, Group 4: 326) of MB patients from the MAGIC cohort (n = 806). (FIG. 18B) Heatmap of differential miRNA expression in six MB cell lines (SHH: DAOY and ONS-76, Group 3: D341 and D425, Group 4: CHLA-01-MED and CHLA-01R-MED). Gene expression data were obtained using human small RNA-seq. Expression values shown are z-scores. (FIG. 18C) Normalized expression of miR-211 in the MB anti-oncomiR lines from small RNA-seq;

[0049] FIG.19 illustrates representative images of CISH for miR-211-positive in normal cerebellum tissue (left panel). Scatter plot showing miR-211 staining score in normal cerebellum and different MB subgroups (right panel). Magnification ×400. Arrowhead, miR-211-positive cells. Data, mean ± SD. **P < 0.01, ***P < 0.001;

[0050] FIG. 20A, FIG. 20B, FIG. 20C, FIG. 20D and FIG. 20E show the synthesis and anti-tumor effect of nanoparticles-miR-211 conjugates in MB cells. (FIG.20A) Schematic diagram of lipid-based (lipid), polymeric (dendrimer), or inorganic (cerium oxide)-miR-211 conjugate synthesis. (FIG. 20B) Expression of miR-211 in D425 cells treated with nanoparticle-miR-211 conjugates at different concentrations as time points by qRT-PCR. (FIG. 20C) The effect of 1 μM CNP-, dendrimer-, LNP- miR-211 on the viability of D425 cells by MTS assays. (FIG. 20D) Percentages of early and late apoptotic cells were determined by Annexin V / PI assays in D425 cells treated with 1 μM CNP-, dendrimer-, and LNP-miR-211 conjugates. (FIG. 20E) The effect of 1 μM CNP-, dendrimer-, LNP-6 40881.601_P16966-03miR-211 conjugates on the invasion of D425 cells in transwell assays. Data, mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, NS, nonsignificant;

[0051] FIG. 21A, FIG. 21B, and FIG. 21C show the expression of miR-211 and miR-204 in MB subtypes in the MAGIC cohort. (FIG. 21A) Normalized expression of miR-204 in the 4 molecular subgroups (WNT: 11, SHH: 250, Group 3: 219, Group 4: 326) of MB patients classified in the MAGIC cohort (n = 806). (FIG.21B) Violin plot showing normalized expression of miR-211 in the 12 subtypes of MB patients classified in the MAGIC cohort (n = 806). (FIG.21C) Violin plot showing normalized expression of miR-204 in the 12 subtypes of MB patients classified in the MAGIC cohort (n = 806). Data, mean ± SD. **P < 0.01, ***P < 0.001;

[0052] FIG.22A and FIG.22B show the expression of miR211's host gene TRPM1 is downregulated in MB. (FIG. 22A) Boxplot showing distribution of normalized expression of TRPM1 in the 4 molecular subgroups (WNT: 18, SHH: 46, Group 3: 45, Group 4: 66) of MB in the ICGC dataset (n = 175). (FIG. 22B) Boxplot distributions of expression levels of TRPM1 in the 3 molecular subgroups (SHH: 4, Group 3: 4, Group 4: 4) of MB in the 12 PDX RNA-seq;

[0053] FIG. 23A and FIG. 23B miR-211 inhibits the tumorigenicity of MB cells. (FIG. 23A) Fluorescent staining of Ki-67 and TUNEL in CHLA01 xenografts on day 42 after intracranial injection. Quantification of Ki-67 and TUNEL-positive cells is shown. (FIG. 23B) Fluorescent staining of Ki-67 and TUNEL in DAOY xenografts on day 35 after intracranial injection. Images are at a magnification of ×10 with a 10× zoom and at a magnification of ×40 with no zoom. Nuclei are stained with DAPI (blue). Scale bars, 100 μm. Data, mean ± SD. **P < 0.01;

[0054] FIG. 24A, FIG. 24B, and FIG. 24C demonstrate that miR-211 inhibits MB progression by targeting ACSL4 expression. (FIG.24A) CHLA01 or DAOY cells expressing miR-211 or vector only (V / O) were transiently transfected with ACSL4 plasmid, and lysates were applied to qRT-PCR and western blotting. (FIG.24B) Cell proliferation was determined by MTS assays in CHLA01 or DAOY cells overexpressing miR-211 with and without introduction of ACSL4 plasmid. (FIG. 24C) Cell invasive potential was determined by transwell assays in CHLA01 or DAOY cells overexpressing miR-211 with and without introduction of ACSL4 plasmid. Data, mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001;

[0055] FIG. 25A, FIG. 25B, FIG. 25C, and FIG. 25D show lipidomic analysis of MB cells overexpressing miR-211. (FIG 25A) D425, CHLA01 and DAOY cells expressing miR-211 are characterized by common metabolic process alterations according to KEGG pathway analysis using RNA-seq data. (FIG. 25B) Principal component analyses (PCA) in global lipidomic profiling of MB7 40881.601_P16966-03cells with or without miR-211 overexpression. (FIG. 25C) Fatty acid metabolism of different carbon chain lengths was detected upon miR-211 expression in MB cells. (FIG. 25D) The degree of lipid saturation was detected upon miR-211 expression in MB cells;

[0056] FIG. 26A, FIG. 26B, FIG. 26C, FIG. 26D, FIG. 26E, and FIG. 26F show the synthesis and characterization of Cy5-Dendrimer-miR-211 and synthetic intermediates. (FIG. 26A) High- performance liquid chromatography (HPLC) traces of Cy5-Dendrimer-miR-211 at 220, 260, and 650 nm. (FIG. 26B) Gel electrophoresis of naked miR-211 and Cy5-Dendrimer-miR-211 on 10% TBE- Urea. The Cy5-Dendrimer-miR-211 band is retained around the 150 bp marker (~90 kDa). (FIG.26C) Matrix-assisted laser desorption / ionization-time of flight (MALDI-TOF) mass spectrometry (MS) of miR-211. (FIG.26D) MALDI-TOF / MS spectrum of Cy5-Dendrimer-miR-211. (FIG.26E) Schematic of Dendrimer-miR-211 synthesis. The sulfhydryl group in 5ʹ-modified miR-211 was reacted (thiol exchange reaction in PBS at RT, 12 h) with Cy5-Dendrimer-PEG4-SPDP (upper panel) to obtain the final product Cy5-Dendrimer-miR-211 (lower panel). (FIG. 26F) D425 cells were treated with Cy5- Dendrimer-miR-211 conjugates starting from 0.02 μM to 1 μM for 24 h. Cy5 signaling was detected by flow cytometry Cy5 channel. Dendrimer without Cy5 labeling was used as a control;

[0057] FIG.27 shows the intracellular uptake of lipid nanoparticles-miR-211 conjugates in MB cells. D425 cells were treated with LNP-miR-211 conjugates starting from 0.01 μM to 1 μM. Lipid nanoparticle was labeled with DiD dye and miR-211 was labeled with Cy3 dye. DiD and Cy3 signaling was detected by flow cytometry Cy5 and Cy3 channel, respectively, at different time point. LNP with DiD labeling was used as a control; and

[0058] FIG. 28A, FIG. 28B, and FIG. 28C demonstrate the effect of low concentrations of nanoparticle-miR-211 conjugates on MB cell proliferation. (FIG. 28A) The effect of 0.02, 0.05, 0.1, or 0.5 μM lipid nanoparticle-miR-211 (LNP-miR-211) on the proliferation of D425 cells by MTS assays. (FIG. 28B) The effect of 0.02, 0.25, or 0.5 μM Dendrimer-miR-211 (D-miR-211) on the proliferation of D425 cells by MTS assays. (FIG. 28C) The effect of 0.02 μM cerium oxide nanoparticle-miR-211 (CNP-miR-211) on the proliferation of D425 cells by MTS assays. Data, mean ± SD. **P < 0.01, NS, non-significant. DETAILED DESCRIPTION

[0059] The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying Figures, in which some, but not all embodiments of the inventions are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may8 40881.601_P16966-03be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated Figures. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims.

[0060] In some embodiments, the presently disclosed subject matter provides a method for treating a brain cancer or brain tumor in a subject in need of treatment thereof, the method comprising administering to the subject a therapeutically effective amount of miR-211.

[0061] miR-211 has been previously identified as a biomarker for melanoma, see, e.g., WO2009099905 for Molecular Signatures and Biomarkers Associated with Melanoma and Methods of Use Thereof, to Perera, published August 13, 2009, and WO2012051165 for miR-211 Expression and Related Pathways in Human Melanoma, to Perera and Mazar, published September 19, 2012, each of which is incorporated herein by reference in its entirety. miR-211 has the nucleotide sequence of UUCCCUUUGUCAUCCUUCGCCU SEQ ID: NO 1 (hsa-mIR-211).

[0062] The term “tumor,” as used herein, refers to an abnormal mass of tissue that results when cells divide more than they should or do not die when they should. In the context of the present disclosure, the term tumor may refer to tumor cells and tumor-associated stromal cells. Tumors may be benign and non-cancerous if they do not invade nearby tissue or spread to other parts of the organism. In contrast, the terms “malignant tumor,” “cancer,” and “cancer cells” may be used interchangeably herein to refer to a tumor comprising cells that divide uncontrollably and can invade nearby tissues. Cancer cells also can spread or “metastasize” to other parts of the body through the blood and lymph systems. The terms “primary tumor” or “primary cancer” refer to an original, or first, tumor in the body. The term “metastasis,” as used herein, refers to the process by which cancer spreads from the location at which it first arose as a primary tumor to distant locations in the body. The terms “metastatic cancer” and “metastatic tumor” refer to the cancer or tumor resulting from the spread of a primary tumor. It will be appreciated that cancer cells of a primary tumor can metastasize through the blood or lymph systems.

[0063] In certain embodiments, the tumor comprises a medulloblastoma. In particular embodiments, the medulloblastoma is selected from a WNT‐activated, an SHH-activated, a Group 3, and a Group 49 40881.601_P16966-03medulloblastoma.

[0064] Brain tumors generally can be categorized as: primary, starting in the brain; metastatic, starting in other parts of the body and spreading to the brain; benign, slow-growing; non-cancerous. Benign tumors can still be difficult to treat if they are growing in or around certain structures of the brain; and malignant or cancerous. Unlike benign tumors that tend to stay contained, malignant tumors can be very aggressive. They grow rapidly and can spread to areas near the original tumor and to other areas in the brain.

[0065] As provided hereinabove, medulloblastomas are malignant brain tumors, which account for about 15 percent of brain tumors in children. Medulloblastomas form in the cerebellum and occur primarily in children between the ages of 4 and 9, affecting boys more frequently than girls. Medulloblastomas can spread (metastasize) along the spinal cord and typically require surgery in addition to other treatments.

[0066] In certain embodiments, the subject is an adult. As used herein, an “adult” is a human having an age greater than about 18 years old. In some embodiments, the adult is between 18-50 years old. In other embodiments, the adult is between about 50-100 years old. In other embodiments, the adult is between about 50-75 years old. In other embodiments, the adult is between about 75-85 years old.

[0067] In particular embodiments, the subject is a pediatric patient. A pediatric patient can have an age from newborn to about 21 years old. In some embodiments, the pediatric patient is between about 4-9 years old.

[0068] Additional therapies that can be used in combination with the presently disclosed miR-211 therapy include, but are not limited to, surgery, radiation, including proton therapy, and chemotherapy.

[0069] In certain embodiments, the miR-211 is associated with a nanoparticle. In particular embodiments, the nanoparticle comprises a dendrimer nanoparticle.

[0070] As used herein, the term “dendrimer” refers to repeatedly branched nano-sized macromolecules characterized by a symmetrical (and in some embodiments nonsymmetrical), well- defined three-dimensional shape. Dendrimers grow three-dimensionally by the addition of shells of branched molecules to a central core. The cores are spacious and various chemical units can be attached to points on the exterior of the central core. Dendrimers have been described extensively (Tomalia (1994). Advanced Materials 6:529-539; Donald A. Tomalia, Adel M. Naylor, William A. Goddard III (1990). Angew, Chem. Int. Ed. Engl, 29: 138-175; each of which is incorporated herein by reference in its entireties).

[0071] Dendrimers can be synthesized as spherical structures typically ranging from 1 to 2010 40881.601_P16966-03nanometers in diameter. In certain embodiments, the dendrimers provided herein have a diameter of from about 1 nm to about 20 nm, such as from about 1 nm to about 8 nm or from about 12 nm to about 20 nm. In certain embodiments, the dendrimer has a diameter of less than or equal to 20 nm, less than or equal to 19 nm, less than or equal to 18 nm, less than or equal to 17 nm, less than or equal to 16 nm, or less than or equal to 15 nm. Diameter may be measured by methods known within the art, such as (but not limited to) dynamic light scattering and electron microscopy.

[0072] Dendrimers are identified by a generation number (Gn) and each complete synthesis reaction results in a new dendrimer generation. Molecular weight and the number of terminal (e.g., surface) groups increase exponentially as a function of generation number (e.g., the number of layers) of the dendrimer. Further description of dendrimers can be found in U.S. Patent 9,345,781, WO WO2009 / 046446, and U.S. Patent Application Publication No. 2017 / 0043027, all of which are incorporated by reference herein in their entirety.

[0073] In some embodiments, the dendrimer comprises a PAMAM dendrimer. As used herein, the term “PAMAM dendrimer” refers to poly(amidoamine) dendrimer, which may contain different cores, with amidoamine building blocks. The method for making them is known to those of skill in the art and generally, involves a two-step iterative reaction sequence that produces concentric shells (generations) of dendritic β-alanine units around a central initiator core. This PAMAM core-shell architecture grows linearly in diameter as a function of added shells (generations). Meanwhile, the surface groups amplify exponentially at each generation according to dendritic-branching mathematics. An exemplary surface group for the disclosed dendrimers is a -OH group. The dendrimers can be generations Gl-10 with 5 different core types and 10 functional surface groups. The dendrimer may be of G2 to G10 in range, such as G2 to G6 or G4 to G5, with mixtures of different G levels also possible. In certain embodiments, the PAMAM dendrimer is a G4 or a G6 dendrimer with hydroxyl surface groups.

[0074] More particularly, International PCT patent application publication no. WO2016025741 for Selective Dendrimer Delivery to Brain Tumors to Mangraviti et al. (hereinafter Mangraviti et al.), published February 18, 2016, which is incorporated herein by reference in its entirety, describes a composition comprising poly(amidoamine) (PAMAM) hydroxyl-terminated dendrimers covalently linked to or complexed with at least one therapeutic agent for the treatment or alleviation of one or more symptoms of a brain tumor.

[0075] In representative embodiments described by Mangraviti et al, the composition contains one or more ethylene diamine-core poly(amidoamine) (PAMAM) hydroxyl-terminated generation-4, 5, 6,11 40881.601_P16966-037, 8, 9, or 10 (G4-10-OH) dendrimers. The G6 dendrimers demonstrated unexpectedly high uptake, and uniform distribution in to the entire brain tumor. The dendrimers provided a means for selective delivery through the blood brain barrier ("BBB") of, for example, therapeutic agents. In certain embodiments, dendrimer is PAMAM G6-OH.

[0076] The dendrimers may be administered alone by intravenous injection, or as part of a multi- prong therapy with radiation and / or surgery. The dendrimer composition is preferably administered systemically, most preferably via intravenous injection. The composition may be administered prior to or immediately after surgery, radiation, or both. The composition may be designed for treatment of specific types of tumors, such as medulloblastomas.

[0077] In certain embodiments, the dendrimer has a particle size ranging from about 5 nm to about 50 nm, including about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nm. In particular embodiments, the particle size has a range from about 5 nm to about 10 nm, including about 5, 6, 7, 8, 9, and 10 nm. In even more particular embodiments, the radiolabeled dendrimer has a particle size of about 7 nm.

[0078] In certain embodiments, the nanoparticle further comprises a fluorescent dye. In particular embodiments, the fluorescent dye is Cy5.

[0079] In particular embodiments, the miR-211 comprises a dendrimer nanoparticle having the following structure: ;

[0081] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

[0082] y is 1;

[0083] miR-211 is an miRNA as described herein;

[0084] D is a dendrimer as described herein; and

[0085] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent.

[0086] In certain embodiments, the administering the therapeutically effective amount of miR-211 results in one or more of reducing cancer cell proliferation, inducing apoptosis of one or more cancer cells, inhibiting tumor growth, and reducing tumor size.12 40881.601_P16966-03

[0087] In certain embodiments, administering the therapeutically effective amount of miR-211 targets a gene selected from long-chain-fatty-acid—CoA ligase 4 (ACSL4), serine incorporator 3 protein (SERINC3), and RAB22A.

[0088] In other embodiments, the presently disclosed subject matter provides a composition comprising miR-211 and a dendrimer nanoparticle. In certain embodiments, the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer. In particular embodiments, the PAMAM dendrimer has a generation number from G1 to G10. In more particular embodiments, the dendrimer is PAMAM G6- OH.

[0089] In certain embodiments, the nanoparticle further comprises a fluorescent dye. In more certain embodiments, the fluorescent dye comprises a fluorescent dye that emits in the near infrared spectral region. In particular embodiments, the fluorescent dye is selected from the group consisting of a polymethine dye, a coumarin dye, a xanthene dye, and a boron-dipyrromethene (BODIPY) dye.

[0090] In certain embodiments, the polymethine dye is selected from the group consisting of a carbocyanine dye, an indocarbocyanine dye, an oxacarbocyanine dye, a thiacarbocyanine dye, and a merocyanine dye. In certain embodiments, the xanthene dye is selected from the group consisting of a fluorescein dye and a coumarin dye. In particular embodiments, the fluorescent dye is selected from the group consisting of: BODIPY FL, BODIPY R6G, BODIPY TR, BODIPY TMR, BODIPY 493 / 503, BODIPY 530 / 550, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591,BODIPY 630 / 650, and BODIPY 650 / 665; Cy3, Cy3.5, Cy5, Cy5.5, Cy7, and Cy7.5; VivoTag-645, VivoTag-680, VivoTag-S680, VivoTag-S750, VivoTag-800; Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, Alexa Fluor 750, and AlexaFluor790; Dy677, Dy676, Dy682, Dy752, Dy780; DyLight 350, DyLight 405, DyLight 488, DyLight 547, DyLight 550, DyLight 594, DyLight 633, DyLight 647, DyLight 650, DyLight 680, DyLight 755, and DyLight 800; HiLyte Fluor 405, HiLyte Fluor 488, HiLyte Fluor 532, HiLyte Fluor 555, HiLyte^^ Fluor 594, HiLyte Fluor 647, HiLyte Fluor 680, HiLyte Fluor 750; IR800 (Dimethyl{4-[1,5,5-tris(4- dimethylaminophenyl)-2,4-pentadienylidene]-2,5-cyclohexadien-1-ylidene}ammonium perchlorate), IRDye 650, IRDye 680RD, IRDye 680LT, IRDye 700, IRDye 700DX, IRDye 750, IRDye 800, IRDye 800CW, IRDye 800RS; and ADS1065A, ADS1075A, ADS775MI, ADS775MP, ADS775PI, ADS775PP, ADS780HO, ADS780WS, ADS785WS, ADS790WS, ADS795WS, ADS798SM, ADS800AT, ADS815EI, ADS830AT, ADS830WS, ADS832WS, ADS845MC, and ADS920MC.

[0091] In more particular embodiments, the optical dye is selected from:13 40881.601_P16966-03;; ; ; 6-03;; and

[0092] In particular embodiments, the fluorescent dye is Cy5.

[0093] In certain embodiments, the miR-211 comprises a dendrimer nanoparticle having the following structure: ;03

[0094] wherein:

[0095] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10;

[0096] y is 1;

[0097] miR-211 is an miRNA as described herein;

[0098] D is a dendrimer as described herein; and

[0099] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent. [000100] As used herein, the term “treating” can include reversing, alleviating, inhibiting the progression of, preventing or reducing the likelihood of the disease, disorder, or condition to which such term applies, or one or more symptoms or manifestations of such disease, disorder or condition. Preventing refers to causing a disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such, not to occur. Accordingly, the presently disclosed compositions can be administered prophylactically to prevent or reduce the incidence or recurrence of the disease, disorder, or condition. [000101] As used herein, the term “inhibit” or “inhibits” means to decrease, suppress, attenuate, diminish, arrest, or stabilize an activity of an agent, e.g., an enzyme, associated with a disease or a disease-related pathway or the development or progression of a disease, disorder, or condition, e.g., a brain cancer, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or even 100% compared to an untreated control subject, cell, biological pathway, or biological activity. [000102] The “subject” treated by the presently disclosed methods in their many embodiments is desirably a human subject, although it is to be understood that the methods described herein are effective with respect to all vertebrate species, which are intended to be included in the term “subject.” Accordingly, a “subject” can include a human subject for medical purposes, such as for the treatment of an existing condition or disease or the prophylactic treatment for preventing the onset of a condition or disease, or an animal subject for medical, veterinary purposes, or developmental purposes. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects. Further, a “subject” can include a patient afflicted with or suspected of being afflicted with a condition or disease. Thus, the terms “subject” and “patient” are16 40881.601_P16966-03used interchangeably herein. The term “subject” also refers to an organism, tissue, cell, or collection of cells from a subject. [000103] In general, the “effective amount” of an active agent refers to the amount necessary to elicit the desired biological response. As will be appreciated by those of ordinary skill in this art, the effective amount of an agent may vary depending on such factors as the desired biological endpoint, the agent to be delivered, the makeup of the pharmaceutical composition, the target tissue, and the like. [000104] The term “combination” is used in its broadest sense and means that a subject is administered at least two agents, more particularly an miR-211 composition described herein and at least one other therapeutic agent, such as a chemotherapeutic agent. More particularly, the term “in combination” refers to the concomitant administration of two (or more) active agents for the treatment of a, e.g., single disease state. As used herein, the active agents may be combined and administered in a single dosage form, may be administered as separate dosage forms at the same time, or may be administered as separate dosage forms that are administered alternately or sequentially on the same or separate days. In one embodiment of the presently disclosed subject matter, the active agents are combined and administered in a single dosage form. In another embodiment, the active agents are administered in separate dosage forms (e.g., wherein it is desirable to vary the amount of one but not the other). The single dosage form may include additional active agents for the treatment of the disease state. [000105] Further, the miR-211 compositions described herein can be administered alone or in combination with adjuvants that enhance stability of the compositions alone or in combination with one or more therapeutic agents, facilitate administration of pharmaceutical compositions containing them in certain embodiments, provide increased dissolution or n dispersion, increase inhibitory activity, provide adjunct therapy, and the like, including other active ingredients. Advantageously, such combination therapies utilize lower dosages of the conventional therapeutics, thus avoiding possible toxicity and adverse side effects incurred when those agents are used as monotherapies. [000106] The timing of administration of an miR-211 composition described herein and at least one additional therapeutic agent can be varied so long as the beneficial effects of the combination of these agents are achieved. Accordingly, the phrase “in combination with” refers to the administration of a miR-211 composition described herein and at least one additional therapeutic agent either simultaneously, sequentially, or a combination thereof. Therefore, a subject administered a combination of a miR-211 composition described herein and at least one additional therapeutic agent17 40881.601_P16966-03can receive a miR-211 composition and at least one additional therapeutic agent at the same time (i.e., simultaneously) or at different times (i.e., sequentially, in either order, on the same day or on different days), so long as the effect of the combination of both agents is achieved in the subject. [000107] When administered sequentially, the agents can be administered within 1, 5, 10, 30, 60, 120, 180, 240 minutes or longer of one another. In other embodiments, agents administered sequentially, can be administered within 1, 5, 10, 15, 20 or more days of one another. Where the miR- 211 composition described herein and at least one additional therapeutic agent are administered simultaneously, they can be administered to the subject as separate pharmaceutical compositions, each comprising either an miR-211 composition or at least one additional therapeutic agent, or they can be administered to a subject as a single pharmaceutical composition comprising both agents. [000108] When administered in combination, the effective concentration of each of the agents to elicit a particular biological response may be less than the effective concentration of each agent when administered alone, thereby allowing a reduction in the dose of one or more of the agents relative to the dose that would be needed if the agent was administered as a single agent. The effects of multiple agents may, but need not be, additive or synergistic. The agents may be administered multiple times. [000109] In some embodiments, when administered in combination, the two or more agents can have a synergistic effect. As used herein, the terms “synergy,” “synergistic,” “synergistically” and derivations thereof, such as in a “synergistic effect” or a “synergistic combination” or a “synergistic composition” refer to circumstances under which the biological activity of a combination of an miR- 211 composition described herein and at least one additional therapeutic agent is greater than the sum of the biological activities of the respective agents when administered individually. [000110] Synergy can be expressed in terms of a “Synergy Index (SI),” which generally can be determined by the method described by F. C. Kull et al., Applied Microbiology 9, 538 (1961), from the ratio determined by: [000111] Qa / QA + Qb / QB = Synergy Index (SI) [000112] wherein: [000113] QAis the concentration of a component A, acting alone, which produced an end point in relation to component A; [000114] Qa is the concentration of component A, in a mixture, which produced an end point; [000115] QBis the concentration of a component B, acting alone, which produced an end point in relation to component B; and [000116] Qb is the concentration of component B, in a mixture, which produced an end point.18 40881.601_P16966-03[000117] Generally, when the sum of Qa / QAand Qb / QBis greater than one, antagonism is indicated. When the sum is equal to one, additivity is indicated. When the sum is less than one, synergism is demonstrated. The lower the SI, the greater the synergy shown by that particular mixture. Thus, a “synergistic combination” has an activity higher that what can be expected based on the observed activities of the individual components when used alone. Further, a “synergistically effective amount” of a component refers to the amount of the component necessary to elicit a synergistic effect in, for example, another therapeutic agent present in the composition. [000118] Following long-standing patent law convention, the terms “a,” “an,” and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a subject” includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth. [000119] Throughout this specification and the claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items. [000120] For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about” even though the term “about” may not expressly appear with the value, amount or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and / or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term “about,” when referring to a value can be meant to encompass variations of, in some embodiments, ± 100% in some embodiments ± 50%, in some embodiments ± 20%, in some embodiments ± 10%, in some embodiments ± 5%, in some embodiments ±1%, in some embodiments ± 0.5%, and in some embodiments ± 0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions. [000121] Further, the term “about” when used in connection with one or more numbers or19 40881.601_P16966-03numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range. [000122] For reasons of completeness, various aspects of the disclosure are set out in the following numbered clauses: [000123] Clause 1. A method for treating a brain cancer in a subject in need of treatment thereof, the method comprising administering to the subject a therapeutically effective amount of miR- 211. [000124] Clause 2. The method of clause 1, wherein the miR-211 is associated with a nanoparticle. [000125] Clause 3. The method of clause 2, wherein the nanoparticle comprises a dendrimer nanoparticle. [000126] Clause 4. The method of clause 3, wherein the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer. [000127] Clause 5. The method of clause 4, wherein the PAMAM dendrimer has a generation number from G1 to G10. [000128] Clause 6. The method of clause 5, wherein the dendrimer is PAMAM G6-OH. [000129] Clause 7. The method of any one of clauses 2-6, wherein the nanoparticle further comprises a fluorescent dye. [000130] Clause 8. The method of clause 6, wherein the fluorescent dye is Cy5. [000131] Clause 9. The method of any one of clauses 1-8, wherein the miR-211 comprises a dendrimer nanoparticle having the following structure: [000132] Clause 10. The method of any one of clauses 1-9, wherein the brain cancer comprises a medulloblastoma. ;03[000134] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; [000135] y is 1; [000136] miR-211 is an miRNA as described herein; [000137] D is a dendrimer as described herein; and [000138] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent. [000139] Clause 11. The method of clause 10, wherein the medulloblastoma is selected from a WNT‐activated, an SHH-activated, a Group 3, and a Group 4 medulloblastoma. [000140] Clause 12. The method of any one of clauses 1-11, wherein the subject is selected from an adult patient and a pediatric patient. [000141] Clause 13. The method of clause 12, wherein the pediatric patient has an age ranging from newborn to about 21 years. [000142] Clause 14. The method any one of clauses 1-13, wherein the administering the therapeutically effective amount of miR-211 results in one or more of reducing cancer cell proliferation, inducing apoptosis of one or more cancer cells, inhibiting tumor growth, and reducing tumor size. [000143] Clause 15. The method of any one of clauses 1-14, wherein administering the therapeutically effective amount of miR-211 targets a gene selected from long-chain-fatty-acid—CoA ligase 4 (ACSL4), serine incorporator 3 protein (SERINC3), and RAB22A. [000144] Clause 16. A composition comprising miR-211 and a dendrimer nanoparticle. [000145] Clause 17. The composition of clause 16, wherein the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer. [000146] Clause 18. The composition of clause 17, wherein the PAMAM dendrimer has a generation number from G1 to G10. [000147] Clause 19. The composition of clause 19, wherein the dendrimer is PAMAM G6-OH. [000148] Clause 20. The composition of any one of clauses 16-19, wherein the nanoparticle further comprises a fluorescent dye. [000149] Clause 21. The composition of clause 20, wherein the fluorescent dye is Cy5. [000150] Clause 22. The composition of any of clauses 16-21, wherein the miR-211 comprises a dendrimer nanoparticle having the following structure:21 40881.601_P16966-03; [000152] x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; [000153] y is 1; [000154] miR-211 is an miRNA as described herein; [000155] D is a dendrimer as described herein; and [000156] I is an imaging agent, e.g., a fluorescent dye, which can be present or absent. EXAMPLES [000157] The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compositions of the disclosure by other methods. EXAMPLE 1: microRNA 211 Acts as a Potential Therapeutic Agent by Regulating ACSL4 in Group III Medulloblastomas in Children Overview [000158] Medulloblastoma (MB) is a central nervous system (CNS) tumor that predominantly affects children and always requires aggressive therapy. Affected individuals, however, often suffer from treatment-related side-effects and treatment-resistant recurrences associated with high morbidity and mortality rates are common. Four major molecular MB subgroups have been identified: wingless- type (Wnt)-activated, sonic hedgehog (Shh)-activated, group III (G3), and group IV (G4) MBs. MBs develop through various genetic, epigenetic, and non-coding (nc)RNA-related mechanisms, with the role of ncRNAs, particularly microRNAs, in MB tumor growth being poorly defined.22 40881.601_P16966-03[000159] The presently disclosed subject matter, in part, identified that miR-211 is significantly downregulated in all medulloblastoma subgroups, underscoring its important role as a therapeutic agent. miR-211 ectopic expression in G3 MB cells significantly reduced cell proliferation and 3D colony formation and induced apoptosis. In vivo, miR-211 force-expression in G3 MB cells injected into mouse cerebellum produce smaller tumors than those derived from parental cells. [000160] More particularly, in some embodiments, the presently disclosed subject matter uses a potential therapeutic avenue by applying dendrimer-coated miR-211 via retroorbital and tail-vein injection to inhibit the tumor growth. The presently disclosed subject matter also identified that long- chain-fatty-acid—CoA ligase 4 (ACSL4) and Serine incorporator 3 protein (SERINC3) are common miR-211 target genes for all three medulloblastomas. The presently disclosed subject matter further demonstrates that ACSL4 influences ferroptosis that results in tumor reduction. These results provide a pre-clinical foundation for further therapeutic testing. Background [000161] The human genome is known to encode an abundance of non-protein-coding transcripts. These non-coding RNAs are reported as important as proteins in regulating cellular function and identity. microRNAs (miRNAs) are one potential source of a therapeutic strategies. miRNAs are small (18-24 nt) non-coding RNAs that post-transcriptionally regulate the expression of several mRNA targets. Deregulation of miRNAs expression has a crucial impact on the control of various biological processes, such as cell growth, motility, apoptosis, metabolism and homeostasis, contributing to the development of cancer. Lin and Gregory, 2015; Di Leva et al., 2014. [000162] This phenomenon also has been observed in development of MB, where genetic changes and chromosomal deletions or amplifications are involved in miRNA deregulation. Rusert et al., 2020; Leichter et al., 2017; Wang et al., 2018. Large-scale expression profiling and deep-sequencing approaches have revealed that miRNAs play pivotal roles in MB progression. Cho et al., 2011; Kumar et al., 2018. [000163] Notably, miR-211 is a brain-enriched miRNA that plays a crucial role in neuron differentiation and activity. Bekenstein et al., 2017; Fan et al., 2016. It has been reported that miR- 211 plays an important role in cancer progression, but the results vary in different cancers. Some studies reported that miR-211 functions as an oncomiR in melanoma, Lee et al., 2021, and colorectal cancer, Cai et al., 2012, but as a tumor suppressor microRNA in others cancers, such as breast cancer, Chen et al., 2017, and glioma. Zhang et al., 2017. [000164] In addition, miR-204, a highly homologous miRNA with the same seed sequence as the23 40881.601_P16966-03mature miR-211, has been reported to be of great value as a risk stratification marker in groups G3 and G4 MB. Bharambe et al., 2019. However, they are encoded from different chromosomal loci (miR-204 on 9q21.12 and miR-211 on 15q13.3). From each chromosomal loci (miR-204 on 9q21.12 and miR-211 on 15q13.3) containing the miR, TRPM3 and TRPM1 are encoded respectively, explaining the high structural similarity of the two miRs. This observation implies that miR-211 may drive cancer cells in the same way as miR-204. Nevertheless, to the best of our knowledge, the molecular mechanism of miR-211 in the regulation and malignant phenotypes of MB is unknown. [000165] The energy metabolic pathway is largely differentiated between cancer and normal cells. Cancer cells can alter major energy supply and consumption pathways to support the increased energy demands of cancer growth and survival. A hallmark of tumor cells during malignant growth is an increase in aerobic glycolysis activity, Lunt et al., 2011, which has been proposed as a target for anticancer therapy. Glycolytic ATP generation is crucial for cancer cells because glycolysis bifurcates into anabolic pathways producing essential nucleotides, lipids, and amino acids for proliferation. Vander Heiden et al., 2019. [000166] The presently disclosed subject matter, in part, explores the molecular mechanisms underlying the function of miR-211 in MB. Materials and Methods [000167] Human normal cerebellum (BioChain, Newark, CA), MB cell lines, and patient-derived xenografts (PDXs) were isolated for RNA. The cell lines DAOY, ONS76, D341, D458, D283, MB002, and HDMB03 were maintained in the Wechsler-Reya and Raabe labs. The PDXs DMB006, DMB012, RCMB28, RCMB32, RCMB38, RCMB40, RCMB45, and RCMB51 were established in the Wechsler-Reya lab; MED211FH, MED511FH, and MED1712FH were established in the J. Olson lab at Fred Hutchinson Cancer Research Center; BT-084 was created in the T. Milde lab at the German Cancer Research Center (DKFZ) and MB002 was created by Y.J. Cho lab at Oregon Health and Sciences University; all PDXs were maintained in the Wechsler-Reya lab. Cell lines and cell culture [000168] Human MB cell lines (D425, D458, and DAOY cells) were purchased from the American Type Culture Collection (ATCC; Manassas, VA). STR profiling and mycoplasma testing are performed on all cell lines. DAOY cells were cultured in Dulbecco Modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco), 1% sodium pyruvate, nonessential amino acids and penicillin / streptomycin. D425 and D458 cells were cultured in DMEM / F12 with 10% FBS and 1% penicillin / streptomycin. Cells were grown in a humidified incubator at 37°C in 5% CO2. The24 40881.601_P16966-03culture medium was replaced at an interval of 3 to 4 days. The cells were gently blow or trypsinize (0.05%, Gibco) for subculture. Cell transfection [000169] miR-211 mimics, mimic negative control (miR-NC) were purchased from Dharmacon. DAOY and D425 cells were inoculated into six-well plates at a density of 5×105 cells / mL and incubated at 37°C with 5% CO2 for 24 hours. All mimics were transfected at 20 nM for 48 h using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. The transfection efficiency was determined by quantitative real-time PCR (qPCR). Quantitative real-time PCR [000170] Total RNA was purified using the Direct-zol RNA Miniprep kit (Zymo Research) according to the manufacturer’s instructions. RNA yields were measured using a NanoDrop 8000 spectrophotometer (Thermo Scientific). For miRNA, total RNA of 10 ng was reversely transcribed to cDNA. qRT-PCR analysis was performed using TaqMan Universal Master Mix assays (Applied Biosystems). TaqMan primer probes were used for miR-211 quantification. RNU48 primer probes was used as controls. For mRNA, Total RNA of 500 ng was reversely transcribed using the High- Capacity cDNA Reverse Transcription Kits (Invitrogen). Then quantitative PCR was performed using SYBR Green Master Mix assays. Total DNA was isolated using the Quick DNA Miniprep kit (Zymo Research) according to the manufacturer’s protocol. qRT-PCR analysis was performed using 100 ng mitochondrial and genomic DNA. Cell proliferation assay [000171] DAOY and D425 cells were harvested in the logarithmic phase and trypsinized with 0.05% trypsin. For the cell proliferation assay, cells were cultured in 96-well plates for different time. MTS solution of 20 µL (Promega) was added to each wells. Two hours later, the absorbance value (optical density value) of each well was measured at a 490 nm wavelength on the EnVision 2105 microplate reader (PerkinElmer). Clonogenic and soft agar colony formation assays [000172] For the clonogenic assay, DAOY cells were seeded in 6-well plates at a density of 2 × 103cells / well approximately 14 days later. Afterward, cells were fixed with 4% paraformaldehyde and were stained with 0.5% crystal violet solution. For soft agar colony formation assay, D425 cells were suspended in the growth medium that contained 0.6% agar and 1 × 103cells were plated in 24-well plates (1 mL / well) on the top of a layer of growth medium that contained 1.2% agar (1.5 mL / well). The agar was added with growth medium coupled with FBS (20%). The cells were incubated for two25 40881.601_P16966-03weeks at 37 ℃, then the formation of viable colonies was observed using Cytation 1 cell imaging reader (BioTek). Colony number was determined using the Image Pro Plus (Media Cybernetics). Cell apoptosis assay [000173] Apoptotic cells was analyzed using afluorescein isothiocyanate (FITC) Annexin V Apoptosis Detection Kit (BD Bioscience) following the manufacturer’s protocol. Briefly, cells were collected, washed and stained with FITC-annexin V and propidium iodide (PI), and then cell apoptosis was detected by CytoFLEX LX flow cytometry (Beckman Coulter), and data were quantified using CytExpert 2.4 software. Invasion and wound healing assays [000174] For the transwell invasion assay, the cells were resuspended in 100 μL medium free of serum and plated in upper chamber with 1 × 105cells / well. Complete medium of 600 μL were added into lower chamber. After 48 hours incubation in the incubator at 37 °C, 4% paraformaldehyde were used to fix the cells that invaded the lower chamber, followed by washing in PBS and staining with 0.5% crystal violet solution. For the wound healing assay, DAOY cells were seeded into a 6-well plate at 2 × 105cells / well. The tip of a 200 μL pipette was used to scratch the monolayers after the cells reached 100% confluence, and the culture was continued in the FBS-free medium. Subsequently, the wound healing was determined at 24 hours using the ECLIPSE Ts2 inverted microscope (Nikon), and scratch area was analyzed using ImageJ software. MitoTracker Red CM-H2XRos assay [000175] Mitochondria in live cells was determined using the MitoTracker Red CM-H2XRos probe (Invitrogen). Briefly, 105cells were spotted onto glass slides, placed into 6-well plates, and allowed to adhere for 2 hours. These slides were then covered in complete medium, and the cells were incubated overnight with 5% CO2at 37 °C. Afterward, the intensity of red fluorescence produced by cells incubated with the 500 nM MitoTracker probe in the dark for 30 min. The slides were washed in PBS and were incubated in Hoechst 33258 (2 μg / mL) for 10 min. The slides were scanned on a Nikon Ts2-FL fluorescence microscope (Nikon). Seahorse assay [000176] The mitochondrial activity of D425 cells was detected using the Seahorse Assay (Agilent) according to the manufacturer’s instructions. 1.5 × 104cells were plated per well into an XFe96 cell culture microplate coated with Poly-D-Lysine (Sigma-Aldrich). The OCR (oxygen consumption rate) and ECAR (extracellular acidification rate) were determined using an XFe96 extracellular flow analyzer. The values of OCR and ECAR were measured every 7 min. After 15 min,26 40881.601_P16966-03basal measurements were injected with solutions of 5 μM Oligomycin, 1 μM trifluorocarbonylcyanide phenylhydrazone (FCCP), followed by 0.5 μM rotenone-antimycin A. OCR and ECAR data were analyzed was according to the Seahorse XFe96 protocol. Targeted metabolomics [000177] MB cells, including 106DAOY and D425 with vector only or ectopic miR-211 cells were collected and subjected to targeted metabolomics. In brief, D425 with vector only or ectopic miR-211 cells were centrifuged and flash-frozen in liquid nitrogen. DAOY with vector only or ectopic miR- 211 cells were rinsed with PBS, and scraped in 0.45 mL 50% methanol containing 20 μM L-norvaline (Sigma N7627). Cell pallets and scraped cell solution was stored in dry ice and delivered to the metabolomics core facility at Sanford Burnham Prebys Medical Discovery Institute (SBP). Samples were thawed on ice, vortexed, and protein concentrations were determined followed by preparation for analysis according to the Core’s solvent extraction methods. Metabolomic analysis was performed using liquid chromatography mass spectroscopy (LC / MS-MS). Metabolites were identified by accurate mass search and MS / MS spectral match using an in-house standard MS / MS library. All cell samples were analyzed in triplicate. Animal experiments [000178] All mouse studies were approved and performed according to the policies and regulations of the Johns Hopkins University Animal Care and Use Committee. The NOD-SCID nude mice were obtained from Jackson Laboratory (Bar Harbor), aged at 4-6 weeks and maintained under specific pathogen free (SPF) condition in the animal care facility. Cells that had been engineered to stably express empty vector or miR-211 were infected with lentiviruses carrying renilla luciferase construct. Cerebellar coordinates were -2 mm from lambda, +1 mm laterally, and 1.5 mm deep. Tumor growth was evaluated by weekly intraperitoneal injection of Viviren (50 μg / mouse in PBS, Promega). After the injection 10-15 min, bioluminescence imaging was captured with an in vivo spectral imaging system (IVIS Lumina II, Xenogen). Tumor collection was performed after the euthanization of mouse on day 28-35. Statistical analysis [000179] All data were presented as mean ± SD. GraphPad Prism and SPSS 17.0 was used for statistical analysis. Student t-test was carried out to analyze the difference between 2 groups. Kruskal– Wallis analysis was used to evaluate the differences between more than 2 groups. P<0.05 indicated statistical significance. RNA samples27 40881.601_P16966-03[000180] RNA was isolated from normal human cerebellum cells (BioChain, Newark, CA), MB cell lines, and patient-derived xenografts (PDXs). The DAOY, ONS-76, D341, D458, D283, and HDMB03 cell lines were kind donations from the Wechsler-Reya and Raabe labs, while DMB006, DMB012, RCMB28, RCMB32, RCMB38, RCMB40, RCMB45, and RCMB51 PDXs were from the Wechsler-Reya lab and MED511FH and MED1712FH from the Olson lab (Fred Hutchinson Cancer Research Center). Small RNA sequencing [000181] Small RNA was isolated and purified from MB cells using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol and DNase digestion using the RNase-Free DNase Set (Qiagen). Purified RNA was eluted in 30 μL nuclease-free water (70°C) and quantified with the Qubit RNA HS. Libraries were constructed using the NEXTFLEX Small RNA Sequencing Kit V4 (PerkinElmer, Waltham, MA) following the manufacturer’s protocol. Size selection and cleanup of 145-160 nucleotide fragments were carried out using Cleanup Beads (PerkinElmer). The quality of DNA libraries was evaluated using the KAPA library qualification kit (Roche, Basel, Switzerland) and Agilent 4200 TapeStation (Agilent Technologies, Santa Clara, CA). Libraries were normalized to 2 nM and pooled libraries subjected to 75-nucleotide deep sequencing using the Illumina NextSeq 550 platform to obtain a minimum of 5 million reads per library. Small RNA-seq reads were checked for quality using FastQC. Low quality reads were trimmed using TrimGalore. Reads shorted than 16 base pairs were discarded from further analysis. Reads were aligned to reference genome (hg38 gencode v42) using STAR aligner (v2.7.1a) with 10 maximum multiple mapping allowed. Read counts were obtained using featureCounts tool using General Feature Format (gff) from mirbase database. Counts per million (CPM) normalization was performed using edgeR package in R. Visualization of heatmap and volcano plots was performed using ComplexHeatMap and EnhancedVolcano packages in R respectively. Chromogenic in situ hybridization (CISH) [000182] Chromogenic in situ hybridization (CISH) for hsa-miR-211-5p was carried out using miRNAscope HD Assay Red (ACD Bio, Newark, CA) according to the manufacturer's instructions. Four μm-thick formalin-fixed paraffin-embedded (FFPE) tissue sections of cerebellum and MB tissue microarrays were rehydrated, treated with hydrogen peroxide and target retrieval solution, followed by Protease III incubation. SR-has-miR-211-5p-S1 probe (ACD) was then added for 2 h at 40°C within the HybEZ Humidifying system. Signal amplification Amp1-6 was applied sequentially and incubated for 15 or 30 min. Fast red working solution was added for 10 min to detect the red signal. Samples28 40881.601_P16966-03were then counterstained with hematoxylin and mounted with EcoMount. Whole slide images were obtained at 40× using the Aperio VERSA system (Leica Microsystems, Wetzlar, Germany). Tissue sections were examined under a standard brightfield microscope at 40× magnification and scored semi-quantitatively according to the estimated number of punctate dots present within each cell boundary (score 0, no staining or less than 1 dot / cell; score 1, 2–10 dots / cell; score 2, 11–20 dots / cell, and score 3, >20 dots / cell). Ki-67 and TUNEL [000183] All 5 µm sections were dried for 30 min at 60°C. After removing paraffin and rehydrating the sections, antigen retrieval was performed by heating slides for 10 min with 0.1 M citrate buffer (pH 6.0). Tissue sections were blocked with 5% bovine serum albumin (BSA) and incubated with a rabbit anti-Ki-67 antibody (Abcam, Cambridge, UK) at 1:200 dilution in PBS for 1 h at room temperature. Then, goat anti-rabbit Alexa Fluor 546 (Invitrogen) was applied with DAPI, each incubated for 30 min at room temperature. [000184] Apoptosis was quantified using the fluorescein terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling assay using the deadEnd fluorometric TUNEL system (Promega). FFPE tissues sections were cut and rehydrated in gradient ethanol before permeabilization with proteinase K and covering with an equilibration buffer for 10 min at room temperature. Slides were incubated with TdT working solution at 37°C for 1 h and the reaction stopped with 2X SSC. Vectashield with DAPI counterstaining was applied to the slides, and fluorescence was detected by confocal fluorescence microscopy. Bulk RNA sequencing [000185] Libraries were constructed using the TruSeq Stranded Total RNA Library Prep Gold kit following the manufacturer’s protocol (Illumina) from the total RNA extracted from MB cells. The quality of DNA libraries was evaluated using the KAPA library qualification kit (Roche) and Agilent 2100 Bioanalyzer (Agilent Technologies). Libraries were normalized to 2 nM and pooled libraries subjected to 75-nucleotide deep sequencing using the Illumina NextSeq 550 system to obtain a minimum of 36 million reads per library. Reads were aligned to the reference human genome hg38 using STAR aligner. Expression quantification was performed using RSEM algorithm. Data were normalized by variance-stabilizing transformation using DESeq2 software, which considers the RNA- seq data size of each sample. Reporter assay [000186] TargetScan was used to predict possible miR-211 binding sites for ACSL4. The complete29 40881.601_P16966-033'-untranslated region (UTR) for human ACSL4 was acquired by PCR from D425 genomic DNA as a template using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA). The ACSL43'-UTR sequence was cloned into pmirGLO dual-luciferase vector (Promega) between XbaI and PmeI sites, and miR-211 target site mutants were generated by site-directed mutagenesis using a Q5 site-directed mutagenesis kit (New England Biolabs). All ACSL43'-UTR wild (WT) and mutant type (MUT) vectors were confirmed by Sanger sequencing. [000187] 105D425 cells were seeded into 48-well plates and co-transfected with the pmirGLO vector carrying ACSL43'-UTR-WT or MUT with mimic negative controls or hsa-miR-211 mimics using Lipofectamine 3000 (Invitrogen), respectively. After 48 h of co-transfection, firefly and renilla luciferase activities were measured using the Dual-Glo luciferase assay (Promega) and the EnVision 2105 microplate reader (PerkinElmer). Western blotting [000188] Cells were lysed on ice using RIPA buffer (Thermo Fisher Scientific) with a cocktail of proteinase inhibitors. Protein lysates were electrophoresed on 10% SDS polyacrylamide gels before transfer to PVDF membranes (MilliporeSigma, Burlington, MA). Membranes were blocked with 5% skimmed milk and incubated with primary antibodies: anti-ACSL4 (Abcam, ab155282), anti-RAB22A (Proteintech, Rosemont, IL; 12125-1-AP), anti-SERINC3 (LSBio, Lynnwood, WA; LS-C386356), or anti-GAPDH (GeneTex, Irvine, CA; GTX100118) overnight at 4°C. Subsequently, goat anti-rabbit HRP antibodies (1:5000, Bio-Rad) were applied for 1 h at room temperature. After washing with 1% TBST, membranes were developed with enhanced chemiluminescence (SuperSignal West Pico PLUS) solution (Thermo Fisher Scientific) and exposed to a ChemiDoc imaging system (Bio-Rad, Hercules, CA). Data were analyzed using ImageJ software (NIH). Untargeted lipidomics and metabolomics [000189] Cell samples were extracted using the modified Folch biphasic extraction procedure, Lees et al. 1959. Briefly, for metabolomics, 20 μL of the standard internal mixture was added to cell pellets of 10 million cells. Protein was quantified for all samples for pre-normalization. Ice-cold methanol (80%) was used for global metabolome extraction. The supernatant was collected after centrifugation, transferred to a new tube, and dried under nitrogen. The dried sample was reconstituted in 0.1% formic acid in water (70 μl). [000190] For lipidomics, 20 μl of 10× diluted standard internal mixture (stock solution of 50 ppm, w:v) was added. Samples were extracted using ice-cold 4:2:1 chloroform:methanol: water (v:v:v), and the organic phase was collected, dried under nitrogen flow, and reconstituted in 75 μl isopropanol plus30 40881.601_P16966-031 μl injection standard mixture (100 ppm, w:v) for global lipidome extraction. Metabolomics and lipidomics samples were run separately, and, for each sequence, solvent blanks, extraction blanks (without internal standards), neat quality controls (blanks with internal standards), and pooled sample quality controls were also prepared for evaluation of extraction and data collection efficiency. High- performance liquid chromatography and high-resolution tandem mass spectrometry (LC-HRMS / MS) were used for data collection. Chromatographic separation was achieved using reverse-phase chromatography (Thermo Scientific Dionex UltiMate 3000 RS UHLPC system; Thermo Fisher Scientific) with an Ace C18-PFP column (100 × 2.1 mm, 2 μmol / L) for metabolomics and with an Acquity UPLC BEH C18 column (Waters, Milford, MA) maintained at 30°C (2.1 × 100 mm, 1.7 μmol / L particle size) for lipidomics. In the case of metabolomics, the gradient consisted of solvent A (0.1% FA in H2O) and solvent B (acetonitrile), both with ten mmol / L ammonium formate and 0.1% formic acid. The flow rate was 350 μl / min. The column temperature was maintained at 25°C. In the case of lipidomics, the gradient consisted of solvent A (60:40 acetonitrile:water) and solvent B (90:8:2 isopropanol:aceto nitrile:water), both with 10 mmol / L ammonium formate and 0.1% formic acid. The flow rate was 500 μL / min. The column temperature was maintained at 50°C. Samples were analyzed in positive and negative electrospray ionization on a Thermo Scientific Q Exactive Orbitrap Mass Spectrometer (Thermo Fisher Scientific). Data-dependent (ddMS2-top5) MS / MS data were obtained on pooled samples per group for identification purposes. In addition, full-scan data were acquired for all the samples without MS / MS for comparing metabolite or lipid intensities across groups. CNP-miR-211 synthesis and characterization [000191] The cerium oxide nanoparticles (CNPs) were synthesized using wet-chemical hydrolysis method at room temperature, Neal et al. 2021. The 5 mM of cerium nitrate hexahydrate with a purity of 99.999% was dissolved in 48 ml of deionized water followed by the addition of 2 ml of hydrogen peroxide to the cerium solution. The solution was continuously mixed for 5 min. After the addition of hydrogen peroxide, the solution turned yellow and gradually became white after eight weeks of aging at room temperature. The fully aged nanoparticles were used for conjugation process. For the miR- 211 conjugation with CNPs, initially, 270 µl of DMSO was taken in a 2 ml centrifuge tube, and then 30 µl of CNPs (5 mM) added to it, Fu et al. 2022, El Ghzaoui et al. 2022. The OH group on the CNPs surface was activated using 30 µl of CDI (500 mM) solution. After shaking the mixture for 1 h, 150 µl of miR-211 (200 µM) was added to the activated CNPs solution. The solution was mixed thoroughly by pipetting, and then 3790 µl of sodium borate buffer (10 mM, pH 8.5) was added. The solution was shaken at room temperature for 3 h. Following shaking, the solution was transferred into31 40881.601_P16966-03a 50 ml dialysis tube and dialyzed against RNase free water at 4 °C for 20 h to remove the free miR- 211 and DMSO solvent. The RNase free water was replaced after 2 h of starting the dialysis process. After dialysis, the samples were collected and stored at -20 °C until further use. Following the manufacturer's protocol, the amount of miR-211 loaded on CNPs was quantified using the molecular probe Quant-iT microRNA assay kit (Invitrogen). Cellular uptake of the nanoparticle-miR-211 [000192] We seeded D425 cells in six-well plates at a density of 5 × 105cells per well and then added fresh medium containing LNP-, dendrimer-, or dendrimer-miR-211 complexes at different concentrations in each well. After 12-96 h incubation, cells were collected and washed twice with PBS. The cellular uptake of nanoparticle-miR-211 complexes was acquired with an CytoFLEX LX flow cytometry (Beckman Coulter). The Cy3 fluorescence intensity of cells was detected, and data were quantified using CytExpert 2.4 software. Cells treated for 12-96 h were harvested for RNA extraction. Results miR-211 expression is downregulated in medulloblastoma [000193] To investigate the role of miR-211 in the initiation and progression of human medulloblastoma (MB), we first studied the expression of miR-211 in the MAGIC cohort of 806 bulk RNA-seq samples (WNT: 11, SHH: 250, Group 3: 219, Group 4: 326) and revealed low miR-211 expression mainly in SHH and Group 4 MB subgroups (FIG. 18A). [000194] Considering that the miR-204 as a marker was downregulated in different MB subgroups, these two miRNAs were near-identical, the expression patterns across subtypes shows low expression in SHH MB. miR-211 expression was low in almost all four molecular subgroups (WNT, SHH, G3 and G4) of MB. Next, we performed small RNA sequencing in SHH, G3, and G4 MB cell lines (SHH: DAOY and ONS-76; Group 3: D341 and D425; Group 4: CHLA-01-MED and CHLA- 01R-MED) (FIG. 18B and FIG. 18C) which showed distinct small RNA expression profiles in the different molecular subgroups and low miR-211 expression in SHH samples, medium expression in G4 samples, and high expression in G3 samples, mirroring the expression patterns seen in clinical samples. By qRT-PCR, in cell lines (FIG.5A) and patient-derived xenografts (PDXs) (FIG.5B), miR- 211 levels were consistently and significantly lower than in normal cerebellum samples. To confirm miRNA expression in clinical tissue samples, we developed an RNA-CISH assay to detect miR-211 in patient tissues (n=55; WNT: 1, SHH: 29, Group 3: 9, Group 4: 16) and normal cerebellum (n=1) (FIG. 19), which confirmed that miR-211 was expressed in scattered cells of the normal cerebellum32 40881.601_P16966-03but not in MB samples, mirroring expression in cell lines, PDXs, and clinical samples. Interestingly, recent studies, Hovestadt et al. 2019, in single-cell sequencing have demonstrated cells of origin of different subgroups of MB, and we postulate that this could be the reason for different levels of miR- 211 seen in different subgroups. miR-211 acts as a tumor suppressor in vitro and in vivo [000195] To test the hypothesis that miR-211 acts as a tumor suppressor in MB as in some other cancers, Levy et al. 2010, Qin et al. 2020, Quan et al. 2017, we first introduced synthetic miR-211 under a constitutive promoter into three MB cell lines representing SHH, G3, and G4 MBs (DAOY, D425, and CHLA-01-MED, respectively), as confirmed by qRT-PCR analysis (FIG. 6A). Cell viability assays revealed that miR-211 suppressed the viability (FIG. 6B) and colony formation (FIG. 6C) of all three MB cell lines. Flow cytometry analysis revealed increased apoptosis of D425, CHLA01, and DAOY cells after miR-211 overexpression (FIG. 6D), with the highest early apoptosis (>20%) seen in G3 MB (D425) and SHH (DAOY) cell lines. In a transwell invasion assay, miR-211 overexpression suppressed MB cell invasion (FIG. 6E), especially in SHH subgroup cells. Therefore, miR-211 may act as a tumor suppressor in MB. [000196] To test whether miR-211 suppresses tumorigenicity in mice in vivo, we transplanted D425, CHLA01, and DAOY parental cells and the corresponding miR-211-overexpressing cells intracranially to establish cerebellar xenografts. In vivo imaging (IVIS platform) showed that cells overexpressing miR-211 produced significantly smaller tumors than their parental counterparts (FIG. 8A), decreasing tumor volumes by 30-fold (FIG. 8B). Furthermore, higher miR-211 expression was associated with reduced in vivo proliferation according to Ki67 expression and increased apoptosis by TUNEL (FIG. 8C), suggesting that miR-211 acts as a potent tumor suppressor in MB. ACSL4 is a miR-211 target gene that reprograms lipid metabolism [000197] To identify miR-211 target genes that might inhibit tumor growth in vitro and in vivo, we sequenced parental MB cells and corresponding miR-211-overexpressing cells. miR-211 overexpression downregulated 1,736 transcripts in D425 cells, 447 transcripts in CHLA01 cells, and 2,346 transcripts DAOY cells relative to their respective vector-only parental cells (FIG. 7A). By predicting miR-211 targets in genes downregulated in all three cell lines, we identified three candidate miR-211 targets (FIG. 7B): acyl-CoA synthetase long-chain family member 4 (ACSL4), Ras-related protein (RAB22A), and serine incorporator 3 (SERINC3). The mRNA and protein expression levels of ACSL4, RAB22A, and SERINC3 are illustrated in FIG. 7C and 7D. [000198] Of these putative miR-211 targets, the long-chain acyl-CoA synthetases (ACSLs)33 40881.601_P16966-03regulate the balance between anabolic and catabolic pathways. Given this potentially global effect on cellular function, and that miR-211 has previously been implicated in metabolic regulation, Mazar et al. 2010, Sahoo t al. 2019, Spiegelman et al. 2019, Zeng et al. 2023, we chose to investigate ACSL4 further. Acyl-CoA synthetase long-chain family member 4 (ACSL4) encodes one of five ACSL isoforms and is unique in that it is present primarily in peroxisomes and mitochondria-associated membranes, Watkins et al. 2012. ACSL4 is dysregulated in many human cancers, with complex pleiotropic roles depending on the tumor type and its microenvironment, Hou et al.2022. For instance, in hepatocellular carcinoma (HCC), Qin et al. 2020, Grube et al. 2022, ACSL4 is oncogenic, while in lung and gastric cancer it has a tumor suppressive function, Ye et al, 2016, Zhang et al. 2021. [000199] We therefore sought to establish whether ACSL4 was a direct target of miR-211 in MB, as shown previously in HCC, Qin et al. 2020. Interrogation of the TargetScan database identified ACSL4 as a high confidence downstream target of miR-211, with the 3′-UTR of ACSL4 containing three putative miR-211-binding sites (FIG. 7E). We designed six mutations of the ACSL4 3′-UTR fused to the 3’ end of a luciferase mRNA and addressed by transfection whether mutations abolished miR-211 targeting activity. miR-211 mimics significantly reduced luciferase activity for ACSL43′- UTR-WT and increased luciferase activity for ACSL43′-UTR-Sub2 or Del2, suggesting that miR-211 binds within the ACSL43′-UTR (FIG. 7E). The other two miR-211 seed sequences (NT 663-670 and NT 1561-1567) did not alter luciferase activity and, therefore, only mutations in the miR-211 recognition site NT 1153-1160 mediated miR-211 binding to the ACSL43′-UTR. Molecular dynamics (MD) simulation further modeled a complex of human Argonaute2-miR-211 paired with the ACSL4 target sequence, which revealed stable base pairing between the miR-211 seed and the corresponding 3’-UTR site (NT 1153-1160). [000200] Next, we hypothesized that ACSL4 re-expression would overcome miR-211-associated phenotypes. To test the hypothesis, we overexpressed ACSL4 in MB cells expressing miR-211 (FIG. 7F) and, as expected, found that ACSL4 reversed miR‐211-driven changes in cell viability and invasion (FIG. 7G and 7H), increasing both to control or even greater levels. miR-211 functions as an anti-oncomiR in medulloblastoma [000201] To test the hypothesis that miR-211 is an anti-oncomiR whose elevated expression in MB cells deters tumor proliferation and invasion, effects of miR-211 on cellular proliferation, apoptosis, and invasion of MB cells were examined in subsequent experiments. The three MB cell lines, DAOY, D425 and CHLA01, were stably transfected with either a negative control vector-only (V / O) or a miR-211 expression vector (miR-211). Quantitative RT-PCR analysis showed that miR-34 40881.601_P16966-03211 was effectively overexpressed and its expression level increased > 750-fold compared to cells transfected with V / O. MTS assays revealed that the proliferation of MB cells was suppressed by miR- 211. Soft agar colony formation and clonogenic assays were used to verify the effect of miR-211 on long-term viability in vitro. The soft agar colony formation assay showed a significant decrease in colony counts when the D425 cells were overexpressed of miR-211 and the clonogenic capability possessed by DAOY cells was markedly decreased upon miR-211 overexpression, suggesting that miR-211 suppresses the growth of MB cells. Cell apoptosis was further assessed via flow cytometry. The cell apoptosis analysis showed the number of apoptotic cells in DAOY, D425 and CHLA01 cells were significantly increased after miR-211 overexpression , indicating the miR-211 induced MB cell apoptosis progression. Since cancer cell invasion and migration are essential for tumor malignancy, we investigated how miR-211 expression affects the mobility of MB cells. In the transwell invasion assay, overexpression of miR-211 suppressed MB cells invasion. These results suggest that miR-211 might act as an anti-oncomiR in MB progression. miR-211 is a global metabolic regulator in MB [000202] The reprogramming of energy metabolism is a hallmark of tumor cells during malignant growth, Hanahan et al.2011, with the Warburg effect (increased glucose uptake and preferential lactate production) and glutamine addiction, Still et al.2017, Vazquez et al.2016, features of a pro-malignant phenotype. Cancer cells must alter major energy supply and consumption pathways to support the increased energy demands of cancer growth and survival. Indeed, analysis of the metabolite profiles of MB tissues and cerebrospinal fluid (CSF) samples from MB patients revealed abnormal levels of several cancer-specific lipids and essential amino acids (EAA) in MB, Bennett et al. 2018, Lee et al. 2022. In addition to lipogenesis, a key aspect of metabolic reprogramming in MB includes a switch to aerobic glycolysis by neural progenitor cells, Tech et al. 2022, and several studies have shown that disruption of lipogenesis or glycolysis restricts MB growth, perhaps synergistically Fan et al. 2021, Tech et al. 2017. [000203] To explore the role of miR-211 as a metabolic regulator in MBs, we performed untargeted metabolic profiling in parental and miR-211-overexpressing cells (FIG. 2A). Global metabolic network analysis identified that miR-211 overexpression enriched several metabolic pathways including those affecting amino acids, oxidation-reduction, energy metabolism, nucleotides, mitochondria-associated networks such as carnitine, and lipid peroxidation (FIG. 1A). Targeted metabolomic analysis identified 41 metabolites, including 20 significantly upregulated metabolites (P ≤ 0.05), in D425 cells expressing miR-211 (FIG. 2B). Using hierarchical enrichment analysis of35 40881.601_P16966-03targeted metabolites to identify dysregulated metabolic pathways, we found that miR-211 preferentially affected pathways associated with amino acid metabolism, including pathways for phenylalanine, tyrosine, and tryptophan biosynthesis and for alanine, aspartate, and glutamate metabolism (FIG. 2C). Essential amino acids (EAAs) not only provide fundamental building blocks for macromolecular biosynthesis but serve as signaling molecules to induce signaling pathway activation, and tumor cells frequently use EAAs to suppress malignant progression Bonfili et al.2017, Ishak et al. 2020. Compared with controls, D425 cells overexpressing miR-211 exhibited increased demand for six of the eight EAAs (FIG. 1B). Notably, the three EAAs (cysteine, glycine, and glutamate) of glutathione increased significantly, indicating upregulation of glutathione metabolism. Glutamate, proline, and GABA, but not glutamine, were upregulated in D425 cells overexpressing miR-211 (FIG. 1B). Tricarboxylic acid (TCA) and glycolysis intermediates increased, but not significantly (FIG. 2D). [000204] D425 cells therefore demonstrated a predominantly glycolytic phenotype while miR-211 overexpression induced an energetic phenotype based on metabolite profiling. Following this, bioenergetics analysis data revealed that miR-211 significantly increased the overall mitochondrial oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of MB cells (FIG. 1C & FIG. 2E). Overall miR-211 overexpression shifted mitochondrial energy derivation toward oxidative phosphorylation (FIG. 2F), although the ECAR / OCR ratio was slightly lower in miR-211- overexpressing cells (FIG.2G). We calculated OCR indexes of basal respiration, ATP production, and maximal respiration, and found a dramatic increase in these indexes in D425 cells overexpressing miR-211 (FIG. 1D). Therefore, miR-211 appears to protect cells from the metabolic adaptations to stress conditions (Warburg effect) that favor cancer progression. [000205] Mitochondria, as the primary source of cellular ATP and other crucial metabolites, could represent a target for miR-211-driven inhibition of MB progression via effects on cell bioenergetics, Solaini et al. 2011. The mitochondria of MB cells overexpressing miR-211 were increased in number (FIG. 1E). There was a significant increase in mitochondrion-specific gene ND1, while nuclear LPL DNA levels were the same, indicating miR-211 increased the number of mitochondrial genomes (FIG. 1F). Mitochondria play a vital role in apoptosis, and a greater mitochondrial content impacts apoptotic protein expression to cause cell death, Marquez-Jurado et al. 2018. We found that miR-211 overexpression induced caspase 3 / 7 protein activity in D425 cells (FIG. 1G), suggesting that the increased mitochondrial numbers in D425 cells overexpressing miR-211 may lower the apoptotic threshold, again contributing to tumor suppression.36 40881.601_P16966-03Nanoparticle-coated miR-211 has anti-tumor effects in MB [000206] The tumor suppressive effects of miR-211 make it an ideal candidate therapeutic. Nevertheless, administering naked miRNAs in vivo is challenging due to a lack of tissue specificity, a short circulatory half-life, and potential off-target effects. However, nanoparticles, by shielding the miRNAs from the microenvironment and protecting against degradation, have been used to conjugate or encapsulate miRNAs, with some success Blanco et al. 2015. Therefore, to pave the way for using miR-211 as a therapeutic agent, we synthesized three types of nanoparticles to load miR-211 as cargo: lipid-based (lipid), polymeric (dendrimer), or inorganic (cerium oxide) nanoparticles, and applied them to MB cells (FIG. 20A). Nanoparticles were fluorescent dye-labeled to track their intracellular uptake in D425 cells. Treatment with as little as 0.02 μM miR-211-carrying nanoparticles increased miR-211 intracellular level, with maximal expression was observed at 1 μM (at least 1,400-fold over nanoparticles alone). miR-211 levels peaked at 24 h (CNP- and dendrimer-miR-211) or 48 h (LNP- miR-211) and then gradually decreased in a time-dependent manner. Nevertheless, levels remained higher at 48 h (CNP- and dendrimer-miR-211) or 96 h (LNP-miR-211) in treated cells than in nanoparticle alone control cells (FIG. 20B). Although intracellular miR-211 levels were increased after treatment with 0.02 μM nanoparticle-miR-211 conjugates, a potent inhibitory effect on cell viability was not observed until concentrations reached 1 μM (FIG. 20C). Functional studies also revealed an increase in apoptotic cells and a decrease in invasive cells in D425 cells after 1 μM nanoparticle-miR-211 conjugate treatment (FIG. 20D and FIG. 20E). These results suggest that treatment with nanoparticle-miR-211 conjugates leads to a robust anti-tumor effect in MB cells. In vivo nanoparticle delivery and evaluating its efficacy is an ongoing future study in our laboratory. EXAMPLE 2 [000207] List of Primers for qPCR Gene Official full Primers37 40881.601_P16966-03oncogene Reverse: TGCTACAAAGCGGCCAAAAC family (SEQ ID NO: 5)38 40881.601_P16966-03REFERENCES [000208] All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents form part of the common general knowledge in the art. [000209] Northcott PA, Robinson GW, Kratz CP, Mabbott DJ, Pomeroy SL, Clifford SC, Rutkowski S, Ellison DW, Malkin D, Taylor MD, Gajjar A, Pfister SM. Medulloblastoma. Nat Rev Dis Primers. 2019, 5: 11. [000210] Ostrom QT, Gittleman H, Truitt G, Boscia A, Kruchko C, Barnholtz-Sloan JS. CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011-2015. Neuro Oncol. 2018, 20(suppl_4): iv1–iv86. [000211] Northcott PA, Buchhalter I, Morrissy AS, Hovestadt V, Weischenfeldt J, Ehrenberger T, Gröbner S, Segura-Wang M, Zichner T, Rudneva VA, Warnatz HJ, Sidiropoulos N, Phillips AH, Schumacher S, Kleinheinz K, Waszak SM, Erkek S, Jones DTW, Worst BC, Kool M, Zapatka M, Jäger N, Chavez L, Hutter B, Bieg M, Paramasivam N, Heinold M, Gu Z, Ishaque N, Jäger-Schmidt C, Imbusch CD, Jugold A, Hübschmann D, Risch T, Amstislavskiy V, Gonzalez FGR, Weber UD, Wolf S, Robinson GW, Zhou X, Wu G, Finkelstein D, Liu Y, Cavalli FMG, Luu B, Ramaswamy V, Wu X, Koster J, Ryzhova M, Cho YJ, Pomeroy SL, Herold-Mende C, Schuhmann M, Ebinger M, Liau LM, Mora J, McLendon RE, Jabado N, Kumabe T, Chuah E, Ma Y, Moore RA, Mungall AJ, Mungall KL, Thiessen N, Tse K, Wong T, Jones SJM, Witt O, Milde T, Von Deimling A, Capper D, Korshunov A, Yaspo ML, Kriwacki R, Gajjar A, Zhang J, Beroukhim R, Fraenkel E, Korbel JO, Brors B, Schlesner M, Eils R, Marra MA, Pfister SM, Taylor MD, Lichter P. The whole-genome landscape of medulloblastoma subtypes. Nature. 2017, 547: 311–7. [000212] Louis DN, Perry A, Reifenberger G, von Deimling A, Figarella-Branger D, Cavenee WK, Ohgaki H, Wiestler OD, Kleihues P, Ellison DW. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathol. 2016, 131: 803–20. [000213] Rusert JM, Juarez EF, Brabetz S, Jensen J, Garancher A, Chau LQ, Tacheva-Grigorova39 40881.601_P16966-03SK, Wahab S, Udaka YT, Finlay D, Seker-Cin H, Reardon B, Gröbner S, Serrano J, Ecker J, Qi L, Kogiso M, Du Y, Baxter PA, Henderson JJ, Berens ME, Vuori K, Milde T, Cho YJ, Li XN, Olson JM, Reyes I, Snuderl M, Wong TC, Dimmock DP, Nahas SA, Malicki D, Crawford JR, Levy ML, Van Allen EM, Pfister SM, Tamayo P, Kool M, Mesirov JP, Wechsler-Reya RJ. Functional precision medicine identifies new therapeutic candidates for medulloblastoma. Cancer Res. 2020, 80: 5393– 407. [000214] Northcott PA, Korshunov A, Pfister SM, Taylor MD. The clinical implications of medulloblastoma subgroups. Nat Rev Neurol. 2012, 8: 340–51. [000215] Gajjar AJ, Robinson GW. Medulloblastoma-translating discoveries from the bench to the bedside. Nat. Rev. Clin. Oncol. 2014, 11: 714–22. [000216] von Bueren AO, Kortmann RD, von Hoff K, Friedrich C, Mynarek M, Müller K, Goschzik T, Zur Mühlen A, Gerber N, Warmuth-Metz M, Soerensen N, Deinlein F, Benesch M, Zwiener I, Kwiecien R, Faldum A, Bode U, Fleischhack G, Hovestadt V, Kool M, Jones D, Northcott P, Kuehl J, Pfister S, Pietsch T, Rutkowski S. Treatment of children and adolescents With metastatic medulloblastoma and prognostic relevance of clinical and biologic parameters. J Clin Oncol. 2016, 34: 4151–60. [000217] Lin S, Gregory RI. MicroRNA biogenesis pathways in cancer. Nat Rev Cancer. 2015, 15: 321–33. [000218] Di Leva G, Garofalo M, Croce CM. MicroRNAs in cancer. Annu Rev Pathol. 2014, 9: 287–314. [000219] Leichter AL, Sullivan MJ, Eccles MR, Chatterjee A. MicroRNA expression patterns and signalling pathways in the development and progression of childhood solid tumours. Mol Cancer. 2017, 16: 15. [000220] Wang X, Holgado BL, Ramaswamy V, Mack S, Zayne K, Remke M, Wu X, Garzia L, Daniels C, Kenney AM, Taylor MD. miR on the wall, who's the most malignant medulloblastoma miR of them all? Neuro Oncol. 2018, 20: 313–323. [000221] Cho YJ, Tsherniak A, Tamayo P, Santagata S, Ligon A, Greulich H, Berhoukim R, Amani V, Goumnerova L, Eberhart CG, Lau CC, Olson JM, Gilbertson RJ, Gajjar A, Delattre O, Kool M, Ligon K, Meyerson M, Mesirov JP, Pomeroy SL. Integrative genomic analysis of medulloblastoma identifies a molecular subgroup that drives poor clinical outcome. J Clin Oncol. 2011, 29: 1424–30. [000222] Kumar V, Kumar V, Chaudhary AK, Coulter DW, McGuire T, Mahato RI. Impact of miRNA-mRNA profiling and their correlation on medulloblastoma tumorigenesis. Mol Ther Nucleic40 40881.601_P16966-03Acids. 2018, 12: 490–503. [000223] Bekenstein U, Mishra N, Milikovsky DZ, Hanin G, Zelig D, Sheintuch L, Berson A, Greenberg DS, Friedman A, Soreq H. Dynamic changes in murine forebrain miR-211 expression associate with cholinergic imbalances and epileptiform activity. Proc Natl Acad Sci U S A.2017, 114: E4996–E5005. [000224] Fan C, Wu Q, Ye X, Luo H, Yan D, Xiong Y, Zhu H, Diao Y, Zhang W, Wan J. Role of miR-211 in neuronal differentiation and viability: implications to pathogenesis of Alzheimer’s disease. Front Aging Neurosci. 2016, 8: 166. [000225] Lee B, Sahoo A, Sawada J, Marchica J, Sahoo S, Layng FIAL, Finlay D, Mazar J, Joshi P, Komatsu M, Vuori K, de Jong PR, Ray A, Perera RJ. MicroRNA-211 Modulates the DUSP6-ERK5 Signaling Axis to Promote BRAFV600E-Driven Melanoma Growth In Vivo and BRAF / MEK Inhibitor Resistance. J Invest Dermatol. 2021, 141: 385-394. [000226] Cai C, Ashktorab H, Pang X, Zhao Y, Sha W, Liu Y, Gu X. MicroRNA-211 expression promotes colorectal cancer cell growth in vitro and in vivo by targeting tumor suppressor CHD5. PLoS One. 2012, 7: e29750. [000227] Chen LL, Zhang ZJ, Yi ZB, Li JJ. MicroRNA-211-5p suppresses tumour cell proliferation, invasion, migration and metastasis in triple-negative breast cancer by directly targeting SETBP1. Br J Cancer 2017, 117: 78-88. [000228] Zhang J, Lv J, Zhang F, Che H, Liao Q, Huang W, Li S, Li Y: MicroRNA-211 expression is down-regulated and associated with poor prognosis in human glioma. J Neurooncol 2017, 133: 553- 559. [000229] Bharambe HS, Paul R, Panwalkar P, Jalali R, Sridhar E, Gupta T, Moiyadi A, Shetty P, Kazi S, Deogharkar A, Masurkar S, Yogi K, Kunder R, Gadewal N, Goel A, Goel N, Chinnaswamy G, Ramaswamy V, Shirsat NV. Downregulation of miR-204 expression defines a highly aggressive subset of Group 3 / Group 4 medulloblastomas. Acta Neuropathol Commun. 2019, 7: 52. [000230] Lunt SY, Vander Heiden MG. Aerobic Glycolysis: Meeting the Metabolic Requirements of Cell Proliferation. Annu Rev Cell Dev Biol. 2011, 27: 441–64. [000231] Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 2009, 324: 1029–33. [000232] Cavalli FMG, Remke M, Rampasek L, Peacock J, Shih DJH, Luu B, Garzia L, Torchia J, Nor C, Morrissy AS, Agnihotri S, Thompson YY, Kuzan-Fischer CM, Farooq H, Isaev K, Daniels C, Cho BK, Kim SK, Wang KC, Lee JY, Grajkowska WA, Perek-Polnik M, Vasiljevic A, Faure-Conter41 40881.601_P16966-03C, Jouvet A, Giannini C, Nageswara Rao AA, Li KKW, Ng HK, Eberhart CG, Pollack IF, Hamilton RL, Gillespie GY, Olson JM, Leary S, Weiss WA, Lach B, Chambless LB, Thompson RC, Cooper MK, Vibhakar R, Hauser P, van Veelen MC, Kros JM, French PJ, Ra YS, Kumabe T, López-Aguilar E, Zitterbart K, Sterba J, Finocchiaro G, Massimino M, Van Meir EG, Osuka S, Shofuda T, Klekner A, Zollo M, Leonard JR, Rubin JB, Jabado N, Albrecht S, Mora J, Van Meter TE, Jung S, Moore AS, Hallahan AR, Chan JA, Tirapelli DPC, Carlotti CG, Fouladi M, Pimentel J, Faria CC, Saad AG, Massimi L, Liau LM, Wheeler H, Nakamura H, Elbabaa SK, Perezpeña-Diazconti M, Chico Ponce de León F, Robinson S, Zapotocky M, Lassaletta A, Huang A, Hawkins CE, Tabori U, Bouffet E, Bartels U, Dirks PB, Rutka JT, Bader GD, Reimand J, Goldenberg A, Ramaswamy V, Taylor MD. Intertumoral Heterogeneity within Medulloblastoma Subgroups. Cancer Cell. 2017, 31: 737–54.e6. [000233] Hattori A, Tsunoda M, Konuma T, Kobayashi M, Nagy T, Glushka J, Tayyari F, McSkimming D, Kannan N, Tojo A, Edison AS, Ito T. Cancer progression by reprogrammed BCAA metabolism in myeloid leukaemia. Nature. 2017, 545: 500–4. [000234] Yue M, Jiang J, Gao P, Liu H, Qing G. Oncogenic MYC activates a feedforward regulatory loop promoting essential amino acid metabolism and tumorigenesis. Cell Rep. 2017, 21: 3819–32. [000235] Hovestadt V, Smith KS, Bihannic L, Filbin MG, Shaw ML, Baumgartner A, DeWitt JC, Groves A, Mayr L, Weisman HR, et al. Resolving medulloblastoma cellular architecture by single- cell genomics. Nature. 2019;572:74-79. [000236] Levy C, Khaled M, Iliopoulos D, Janas MM, Schubert S, Pinner S, Chen P-H, Li S, Fletcher AL, Yokoyama S. Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Mol Cell. 2010;40:841-849. [000237] Qin X, Zhang J, Lin Y, Sun X-m, Zhang J-n, Cheng Z-q. Identification of MiR-211-5p as a tumor suppressor by targeting ACSL4 in Hepatocellular Carcinoma. J Transl Med.2020;18:1-13. [000238] Quan J, Pan X, He T, Lin C, Lai Y, Chen P, Zhang Z, Yang S, Wang T, Lai Y. Tumor suppressor miR-211-5p is associated with cellular migration, proliferation and apoptosis in renal cell carcinoma. Exp Ther Med. 2018;15:4019-4028. [000239] Mazar J, DeYoung K, Khaitan D, Meister E, Almodovar A, Goydos J, Ray A, Perera RJ. The regulation of miRNA-211 expression and its role in melanoma cell invasiveness. PLoS One. 2010;5:e13779. [000240] Sahoo A, Sahoo SK, Joshi P, Lee B, Perera RJ. MicroRNA-211 Loss Promotes Metabolic Vulnerability and BRAF Inhibitor Sensitivity in Melanoma. J Invest Dermatol. 201942 40881.601_P16966-03[000241] Spiegelman VS, Elcheva IA. Metabo-miR: miR-211 regulates mitochondrial energy metabolism in vitiligo. J Invest Dermatol. 2017;137:1828-1830. [000242] Zeng B, Chen Y, Chen H, Zhao Q, Sun Z, Liu D, Li X, Zhang Y, Wang J, Xing HR. Exosomal miR-211-5p regulates glucose metabolism, pyroptosis, and immune microenvironment of melanoma through GNA15. Pharmacol Res. 2023;188:106660. [000243] Watkins PA, Ellis JM. Peroxisomal acyl-CoA synthetases. Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease. 2012;1822:1411-1420. [000244] Hou J, Jiang C, Wen X, Li C, Xiong S, Yue T, Long P, Shi J, Zhang Z. ACSL4 as a potential target and biomarker for anticancer: From molecular mechanisms to clinical therapeutics. Front Pharmacol. 2022;13:949863. [000245] Grube J, Woitok MM, Mohs A, Erschfeld S, Lynen C, Trautwein C, Otto T. ACSL4- dependent ferroptosis does not represent a tumor-suppressive mechanism but ACSL4 rather promotes liver cancer progression. Cell Death Dis. 2022;13:704. [000246] Ye X, Zhang Y, Wang X, Li Y, Gao Y. Tumor‐suppressive functions of long‐chain acyl‐ CoA synthetase 4 in gastric cancer. IUBMB life. 2016;68:320-327. [000247] Zhang Y, Li S, Li F, Lv C, Yang Q-k. High-fat diet impairs ferroptosis and promotes cancer invasiveness via downregulating tumor suppressor ACSL4 in lung adenocarcinoma. Biol Direct. 2021;16:1-13. [000248] Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell.2011;144:646- 674. [000249] Vazquez A, Kamphorst JJ, Markert EK, Schug ZT, Tardito S, Gottlieb E. Cancer metabolism at a glance. J Cell Sci. 2016;129:3367-3373. [000250] Bennett CD, Kohe SE, Gill SK, Davies NP, Wilson M, Storer LCD, Ritzmann T, Paine SML, Scott IS, Nicklaus-Wollenteit I, et al. Tissue metabolite profiles for the characterisation of paediatric cerebellar tumours. Sci Rep. 2018;8:11992. doi: 10.1038 / s41598-018-30342-8 [000251] Lee B, Mahmud I, Pokhrel R, Murad R, Yuan M, Stapleton S, Bettegowda C, Jallo G, Eberhart CG, Garrett T. Medulloblastoma cerebrospinal fluid reveals metabolites and lipids indicative of hypoxia and cancer-specific RNAs. Acta neuropathologica communications. 2022;10:25. [000252] Tech K, Deshmukh M, Gershon TR. Adaptations of energy metabolism during cerebellar neurogenesis are co-opted in medulloblastoma. Cancer Lett. 2015;356:268-272. doi: 10.1016 / j.canlet.2014.02.017 [000253] Fan Q, Gong T, Zheng C, Ng JM, Chen J, Myers C, Hensley H, Curran T, Yang Z-j.43 40881.601_P16966-03Statins repress hedgehog signaling in medulloblastoma with no bone toxicities. Oncogene. 2021;40:2258-2272. [000254] Tech K, Tikunov AP, Farooq H, Morrissy AS, Meidinger J, Fish T, Green SC, Liu H, Li Y, Mungall AJ, et al. Pyruvate Kinase Inhibits Proliferation during Postnatal Cerebellar Neurogenesis and Suppresses Medulloblastoma Formation. Cancer Res. 2017;77:3217-3230. doi: 10.1158 / 0008- 5472.CAN-16-3304 [000255] Bonfili L, Cecarini V, Cuccioloni M, Angeletti M, Flati V, Corsetti G, Pasini E, Dioguardi FS, Eleuteri AM. Essential amino acid mixtures drive cancer cells to apoptosis through proteasome inhibition and autophagy activation. The FEBS journal. 2017;284:1726-1737. [000256] Ishak Gabra MB, Yang Y, Li H, Senapati P, Hanse EA, Lowman XH, Tran TQ, Zhang L, Doan LT, Xu X, et al. Dietary glutamine supplementation suppresses epigenetically-activated oncogenic pathways to inhibit melanoma tumour growth. Nat Commun. 2020;11:3326. doi: 10.1038 / s41467-020-17181-w [000257] Solaini G, Sgarbi G, Baracca A. Oxidative phosphorylation in cancer cells. Biochimica et Biophysica Acta (BBA)-Bioenergetics. 2011;1807:534-542. [000258] Marquez-Jurado S, Diaz-Colunga J, das Neves RP, Martinez-Lorente A, Almazan F, Guantes R, Iborra FJ. Mitochondrial levels determine variability in cell death by modulating apoptotic gene expression. Nat Commun. 2018;9:389. doi: 10.1038 / s41467-017-02787-4 [000259] Blanco E, Shen H, Ferrari M. Principles of nanoparticle design for overcoming biological barriers to drug delivery. Nat Biotechnol. 2015;33:941-951. [000260] Lees M, Folch J, Stanley GH, Carr S. A simple procedure for the preparation of brain sulphatides. J Neurochem. 1959;4:9-18. doi: 10.1111 / j.1471-4159.1959.tb13169.x [000261] Neal CJ, Sakthivel TS, Fu Y, Seal S. Aging of Nanoscale Cerium Oxide in a Peroxide Environment: Its Influence on the Redox, Surface, and Dispersion Character. The Journal of Physical Chemistry C. 2021;125:27323-27334. doi: 10.1021 / acs.jpcc.1c06279 [000262] Fu Y, Kolanthai E, Neal CJ, Kumar U, Zgheib C, Liechty KW, Seal S. Engineered Faceted Cerium Oxide Nanoparticles for Therapeutic miRNA Delivery. Nanomaterials (Basel). 2022;12. doi: 10.3390 / nano12244389 [000263] El Ghzaoui C, Neal CJ, Kolanthai E, Fu Y, Kumar U, Hu J, Zgheib C, Liechty KW, Seal S. Assessing the bio-stability of microRNA-146a conjugated nanoparticles via electroanalysis. Nanoscale Adv. 2022;5:191-207. doi: 10.1039 / d2na00600f [000264] Although the foregoing subject matter has been described in some detail by way of44 40881.601_P16966-03illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.45 40881.601_P16966-03

Claims

THAT WHICH IS CLAIMED:

1. A method for treating a brain cancer in a subject in need of treatment thereof, the method comprising administering to the subject a therapeutically effective amount of miR-211.

2. The method of claim 1, wherein the miR-211 is associated with a nanoparticle.

3. The method of claim 2, wherein the nanoparticle comprises a dendrimer nanoparticle.

4. The method of claim 3, wherein the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer.

5. The method of claim 4, wherein the PAMAM dendrimer has a generation number from G1 to G10.

6. The method of claim 5, wherein the dendrimer is PAMAM G6-OH.

7. The method of any one of claims 2-6, wherein the nanoparticle further comprises a fluorescent dye.

8. The method of claim 6, wherein the fluorescent dye is Cy5.

9. The method of any one of claims 1-8, wherein the miR-211 comprises a dendrimer nanoparticle having the following structure:

10. The method of any one of claims 1-9, wherein the brain cancer comprises a medulloblastoma. ;40881.611_P16966-02wherein: x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; y is 1; miR-211 is an miRNA as described herein; D is a dendrimer as described herein; and I is an imaging agent, e.g., a fluorescent dye, which can be present or absent.

11. The method of claim 10, wherein the medulloblastoma is selected from a WNT‐activated, an SHH-activated, a Group 3, and a Group 4 medulloblastoma.

12. The method of any one of claims 1-11, wherein the subject is selected from an adult patient and a pediatric patient.

13. The method of claim 12, wherein the pediatric patient has an age ranging from newborn to about 21 years.

14. The method any one of claims 1-13, wherein the administering the therapeutically effective amount of miR-211 results in one or more of reducing cancer cell proliferation, inducing apoptosis of one or more cancer cells, inhibiting tumor growth, and reducing tumor size.

15. The method of any one of claims 1-14, wherein administering the therapeutically effective amount of miR-211 targets a gene selected from long-chain-fatty-acid—CoA ligase 4 (ACSL4), serine incorporator 3 protein (SERINC3), and RAB22A.

16. A composition comprising miR-211 and a dendrimer nanoparticle.

17. The composition of claim 16, wherein the dendrimer comprises a poly(amidoamine) (PAMAM) dendrimer.

18. The composition of claim 17, wherein the PAMAM dendrimer has a generation number from 40881.611_P16966-02G1 to G10.

19. The composition of claim 19, wherein the dendrimer is PAMAM G6-OH.

20. The composition of any one of claims 16-19, wherein the nanoparticle further comprises a fluorescent dye.

21. The composition of claim 20, wherein the fluorescent dye is Cy5.

22. The composition of any of claims 16-21, wherein the miR-211 comprises a dendrimer nanoparticle having the following structure: ;x is an integer selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; y is 1; miR-211 is an miRNA as described herein; D is a dendrimer as described herein; and I is an imaging agent, e.g., a fluorescent dye, which can be present or absent. 40881.611_P16966-02

Images