Method for predicting long-term weight loss after bariatric surgery

By employing hsa-miR-365b-5p and hsa-miR-222-5p as biomarkers, the challenge of predicting long-term weight loss after bariatric surgery is addressed, facilitating personalized treatment decisions and optimizing surgical outcomes.

WO2025120247A1PCT designated stage expired Publication Date: 2025-06-12SERVICIO ANDALUZ DE SALUD (SAS) +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/ES2024/070760
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-04
Filing Date
2024-12-03
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Current methods lack effective biomarkers to predict long-term weight loss outcomes after bariatric surgery in morbidly obese patients, leading to variable surgical responses and associated healthcare costs.

Method used

Identification and utilization of two specific microRNAs, hsa-miR-365b-5p and hsa-miR-222-5p, as serum biomarkers to predict long-term response to bariatric surgery by differentiating between good responders and non-responders.

Benefits of technology

These biomarkers enable the prediction of long-term weight loss outcomes after bariatric surgery, allowing for personalized treatment recommendations and reducing unnecessary invasive interventions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure IMGF000020_0001
    Figure IMGF000020_0001
  • Figure IMGF000013_0001
    Figure IMGF000013_0001
Patent Text Reader

Abstract

The present invention relates to the use of the biomarkers hsa-miR-222-5p and hsa-miR-365b-5p in a method based on a function for predicting the long-term response to a bariatric surgery intervention in morbidly obese patients.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Method for predicting long-term weight loss after bariatric surgery

[0002] DESCRIPTION

[0003] FIELD OF INVENTION

[0004] The present invention is within the field of biomedicine and biotechnology, and relates to the use of biomarkers for predicting the response to bariatric surgery in patients with morbid obesity.

[0005] BACKGROUND OF THE INVENTION

[0006] Morbid obesity represents a growing global epidemic and a public health challenge, as it is associated with serious adverse consequences for human health and is linked to the leading causes of death. Obesity is part of the metabolic syndrome and is a known risk factor, indicating a predisposition to various diseases, particularly cardiovascular disease, type 2 diabetes mellitus, sleep apnea, stroke, and osteoarthritis, as well as some forms of cancer and dermatological and gastrointestinal disorders.

[0007] Many conservative therapies (diet, exercise, and drug therapy) have shown rather limited efficacy in terms of weight loss and comorbidity control. Bariatric surgery has been considered the most effective therapeutic approach for morbid obesity, as it induces weight loss and controls associated comorbidities. However, there is some disagreement regarding this, as 5–20% of patients do not achieve long-term weight loss.

[0008] Given that this is a major public health problem, which also leads to the development of multiple associated pathologies, the identification of new serum biomarkers related to the success / failure of weight loss strategies using bariatric surgery would lead to a reduction in the number of unindicated invasive interventions, with the consequent reduction in healthcare costs, and would lead us towards personalized medicine.

[0009] miRNAs have been described as important players in various biological processes occurring during the development of obesity, such as inflammation, adipogenesis, adipocyte differentiation, metabolic integration, fat metabolism, and insulin sensitivity. Therefore, circulating miRNAs offer the possibility of rapidly determining, using minimally invasive methods, differences in response to a treatment or intervention based on the individual's profile.

[0010] miRNAs are small, endogenous non-coding RNAs, approximately 18–25 nucleotides in length, capable of modulating the expression of complementary messenger RNAs. They negatively regulate (inhibit) gene expression either by inhibiting translation or cleaving messenger RNAs. Therefore, miRNAs are post-transcriptional regulators that bind to complementary sequences of mRNA transcripts, pairing with the untranslated region (3'-UTR), generally resulting in translational repression or target degradation, resulting in gene silencing.

[0011] They are involved in the regulation of most molecular processes, and there is consistent scientific evidence of their relationship with various metabolic processes. Circulating miRNAs can be detected in the bloodstream, where they exhibit high stability and reproducibility. Circulating miRNAs can provide clinical information about pathophysiological conditions, enabling early diagnosis and the study of the progression of various diseases. Therefore, they are proposed as potential biomarkers.

[0012] Under a standard nomenclature system, experimentally confirmed miRNAs are named as follows: the prefix "mir", followed by a hyphen and a number. The uncapitalized "mir-" refers to the pre-miRNA, while an uppercase "m¡R-" refers to the mature form. miRNAs with almost identical sequences (except for one or two nucleotides) are annotated with an additional lowercase letter, e.g., m¡R-99a. Pre-miRNAs that lead to 100% identical mature miRNAs but are located at different locations in the genome are indicated with an additional hyphen-number suffix. Species of origin may be designated by a three-letter prefix, with hsa being the one corresponding to a human miRNA (Homo sapiens). In the context of this document, where all individualized miRNAs are human miRNAs, the "hsa-" prefix is ​​sometimes omitted.When two mature miRNAs originate from opposite arms of the same pre-miRNA, they are denoted by a -3p or -5p suffix, such as m¡R-142-3p. When relative expression levels are known, an asterisk after the name indicates a miRNA expressed at low levels relative to the miRNA on the opposite arm of a hairpin. miRNA sequences can be accessed at http: / / www.mirbase.org.

[0013] To date, the use of these circulating miRNAs has been proposed as prognostic and diagnostic biomarkers of obesity in both adults and children [1, 2, 3, 4] and it has also been observed how some of these biomarkers alter their expression levels in patients who have undergone bariatric surgery with respect to pre-surgery values ​​[5].

[0014] However, to date, no biomarker has been identified that can predict the outcome of an individual with morbid obesity after undergoing bariatric surgery, nor predict long-term weight loss.

[0015] BRIEF DESCRIPTION OF THE INVENTION

[0016] In the present invention, 2 miRNAs have been located, hsa-m¡R-365b-5p and hsa-m¡R-222-5p, which, in combination, act as serum biomarkers to predict the response of patients with morbid obesity susceptible to undergoing bariatric surgery for weight loss, since they are differentially expressed in good responders and non-responders in the long term (5-8 years).

[0017] Therefore, thanks to these biomarkers, it is possible to identify individuals with morbid obesity who are good candidates for bariatric surgery, as it is possible to predict the long-term response to this procedure, measured as weight loss. This could also translate into not recommending bariatric surgery in those patients with morbid obesity who are determined not to be good candidates for this type of surgery, and exploring other noninvasive treatment options for them or adjusting their treatment once it has begun.

[0018] A first aspect of the invention relates to the use of the serum biomarkers hsa-m¡R-365b-5p (SEQ ID NO: 1) and hsa-m¡R-222-5p (SEQ ID NO: 2) isolated from a subject with morbid obesity, to predict or prognosticate the long-term response to bariatric surgery measured as weight loss. The term "marker, biomarker or biological marker" is used to designate a substance used as an indicator of a biological state. It must be able to be objectively measured and evaluated as an indicator of a normal biological process, pathogenic state or response to pharmacological treatment. More specifically, in the present invention, the biomarkers hsa-m¡R-365b-5p and hsa-m¡R-222-5p are quantified. The determination of the markers can be done by any means known to those skilled in the art.

[0019] In this specification, the terms “hsa-m¡R-365b-5p” and “hsa-m¡R-222-5p” refer to circulating miRNAs in serum that allow rapid determination, using minimally invasive methods, of differences in the response to a treatment or intervention based on the subject's profile. This marker is determined as the number of readings of hsa-m¡R-365b-5p and hsa-m¡R-222-5p, for which, in the present invention, miRNA extraction, cDNA synthesis and quantification techniques known to those skilled in the art have been used.

[0020] The miRNA hsa-m¡R-365b-5p has the nucleotide sequence SEQ ID NO: 1: AGGGACUUUCAGGGCAGCUGU.

[0021] The miRNA hsa-m¡R-222-5p has the nucleotide sequence SEQ ID NO: 2: CUCAGUAGCCAGUGUAGAUCCU

[0022] The term “subject” as used here refers to a human being.

[0023] The term "obese" or "obesity" as described in the present invention is a preventable chronic disease of multifactorial origin characterized by excessive accumulation of fat or general hypertrophy of adipose tissue in the body, that is, an increase in the natural reserve of energy stored in the form of body fat. The World Health Organization (WHO) defines obesity as a condition when the body mass index (BMI) is equal to or greater than 30 kg / m 2 .

[0024] The term "morbid obesity," "severe obesity," or "class III obesity" refers to obesity characterized by a GFR of 40 or greater, or a GFR of 35 or greater in the presence of at least one other significant disease or severe disability and handicap due to excess weight. It refers to a preventable, multifactorial chronic disease characterized by excessive fat accumulation or general hypertrophy of adipose tissue in the body—that is, an increase in the natural reserve of energy stored in the form of body fat.

[0025] In the present invention, "prognosis" refers to the expected course of a disease and refers to the assessment of the probability that a subject suffers from a disease, as well as the assessment of its onset, stage of development, evolution, or regression, and / or the prognosis of the course of the disease in the future.

[0026] In the present invention, "long-term" is understood as a sufficient period after bariatric surgery to observe the final results in patients. Long-term is defined as a period of approximately 5 to 8 years after the procedure.

[0027] The term "bariatric surgery", as described in the present invention, refers to the set of surgical procedures used to treat obesity, seeking to reduce body weight and as an alternative to treatment with other non-surgical means. The objective of bariatric surgery is to reduce energy intake and the formation of body fat without stimulating the consumption of that already formed, under two principles: the restriction or reduction of food ingested (metabolically controlling food consumption, without altering appetite) and modifying its absorption, so that in this way caloric intake is adequate for gastroesophageal reduction without directly affecting body metabolism. Included among the procedures carried out within bariatric surgery are techniques such as gastric bypass or sleeve gastrectomy.

[0028] In the present invention, “weight loss” is measured by “% weight loss (%WL)” which in turn is defined as: preoperative weight - weight at the time of evaluation

[0029] % PEP = 100 x — - - - — - - - - 5 preoperative weight - weight corresponding to a BMI = 25 Kg / m

[0030] Preoperative weight is the subject's weight immediately prior to bariatric surgery.

[0031] Weight at the time of assessment is the subject's weight at a time point following bariatric surgery. In the present invention, this time point is defined as long-term, meaning long-term as 5-8 years after surgery. Weight corresponding to a BMI of 25 kg / m 2 It is a theoretical value to be calculated based on the height of each subject, so as to determine the weight at which the subject would have a BMI = 25 kg / m 2 .

[0032] The “Body Mass Index (BMI)” is a mathematical ratio that associates the mass and height of a subject calculated as weight / height 2 .

[0033] Weight loss was considered insufficient when %PEP<50% in analogy with the Reinhold criteria [6], modified by Christou et al. [7],

[0034] According to this, a good response (BR) to bariatric surgery is established as a %PEP greater than 50%, and a no response (NoR) is established as a %PEP equal to or less than 50%.

[0035] Likewise, good responders (OM-BR) are defined as those subjects with a %PEP greater than 50%, and non-responders (OM-NoR) are those subjects with a %PEP equal to or less than 50%.

[0036] A second aspect of the invention relates to the method of obtaining useful data, hereinafter the first method of the invention, to predict or prognose the long-term response to bariatric surgery in a subject with morbid obesity, which comprises: a) quantifying the expression levels of the biomarkers hsa-m¡R-365b-5p and hsa-m¡R-222-5p in a biological sample isolated from a subject.

[0037] A "biological sample," as defined herein, is a small portion of a subject that is representative of the whole and may consist of a biopsy or a body fluid sample. Biopsies are small pieces of tissue and may be fresh, frozen, or fixed, such as formalin-fixed and paraffin-embedded (FFPE). Body fluid samples may be blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid samples and may likewise be fresh, frozen, or fixed. Samples may be removed surgically, by extraction (i.e., with hypodermic or other needles), by microdissection, or by laser capture. The sample should contain any biological material suitable for detecting the desired marker, biomarker, or biomarkers; therefore, said sample should advantageously comprise material from the subject's cells.In a preferred embodiment of this aspect of the invention, the biological sample isolated in step a) is serum.

[0038] In another preferred embodiment, the first method of the invention further comprises: b) applying the function of formula (I): p_ + e“(-0-477 - (2.71 xn° readings hsa-m¡R-mir222-5p) + (1.69 xn° readings hsa-m¡R-365b-5p))}

[0039] Formula (I)

[0040] Where P is the predicted probability of presenting a good long-term response (BR) after bariatric surgery in patients with morbid obesity.

[0041] The term "function, probability function, or P function" refers to a type of analysis used to predict the outcome of a categorical variable (a variable that can take on a limited number of categories) based on the independent or predictor variables. Among other things, it is useful for modeling the probability of an event occurring as a function of other factors.

[0042] The term "quantify" as used in the description refers to, but is not limited to, the determination of the absolute or relative amount of the markers, their concentration in blood, as well as any other value or parameter related to them or that can be derived from them. Such values ​​or parameters include signal intensity values ​​obtained from any of the physical or chemical properties of said expression products obtained by direct measurement. Additionally, such values ​​or parameters include all those obtained by indirect measurement, for example, any of the measurement systems described elsewhere in this document. Steps a) and / or b) of the methods described above may be fully or partially automated, for example, by means of robotic sensor equipment for quantification in step a) or the application of the function in step b).

[0043] In another preferred embodiment of this aspect of the invention, the expression level of one or more miRNAs is measured by microarray expression profiling, PCR, reverse transcriptase PCR, real-time reverse transcriptase PCR, quantitative real-time PCR, end-point PCR, multiplex end-point PCR, cold PCR, ice cold PCR, mass spectrometry, in situ hybridization (ISH), multiplex in situ hybridization, or nucleic acid sequencing. Other techniques could be, but are not limited to, RT combined with LAMP, or some new technique such as LASH (ligase-assisted sandwich hybridization (LASH).

[0044] A third aspect of the invention relates to a method for predicting or prognosticating a good long-term response after bariatric surgery in subjects with morbid obesity, comprising steps a) and b) as described in the present invention, hereinafter the second method of the invention, which further comprises: c) assigning the subject from step a) to the group of subjects that will present a good response to bariatric surgery, or good responders, when the P value is less than 0.174.

[0045] We define good responders (OM-BR) as those subjects who present a %PEP greater than 50%.

[0046] The result of the calculation in step (b) is a probability obtained from the ROC curve, which gives us information on the ability to predict or forecast adequate long-term weight loss (5-8 years) after bariatric surgery in patients with morbid obesity with a certain specificity and sensitivity, obtained from data from 33 patients with morbid obesity.

[0047] Thus, the invention provides a method for classifying a human subject into one of two groups, wherein group 1 comprises the subjects that can be identified by the method according to the first aspect of the invention, and group 2 represents the remaining subjects. In this regard, the method of the invention further comprises recommending bariatric surgery when the subject belongs to the group of good responders of step c).

[0048] A fourth aspect of the invention relates to a kit, hereinafter the kit of the invention, comprising primers and / or probes capable of hybridizing with SEQ ID NO:1 and SEQ ID NO:2, means for detecting said hybridization and quantifying the expression levels of said sequences.

[0049] The “primers” are oligonucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with the sequences complementary to SEQ ID NO: 1 and SEQ ID NO: 2. The oligonucleotides may have modifications in some of their nucleotides, such as, for example, nucleotides that have one of their atoms with a radioactive isotope, normally 32P or tritium, immunologically labeled nucleotides, such as with a digoxigenin molecule, and / or immobilized on a membrane.

[0050] The “probes” are polynucleotide sequences of between 30 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, even much more preferably at least 98%, and particularly 100%, with the sequences complementary to SEQ ID NO:1 and SEQ ID NO:2.

[0051] Preferably, the means for detecting said hybridization and quantifying the expression levels of said sequences comprise a miRNA extraction kit, or a thermal cycler for cDNA synthesis, or the basic reagents for performing a real-time quantitative PCR to quantify SEQ ID NO:1 and SEQ ID NO:2, or any of their combinations.

[0052] In a preferred embodiment, the kit of the invention further comprises a serum collector. Furthermore, the kit may include all the necessary supports and containers for its implementation and optimization, such as buffers, contamination prevention agents, etc. Preferably, the kit also comprises instructions for carrying out the methods of the invention.

[0053] A fifth aspect of the invention relates to the use of the kit or device as described in the present invention to predict or forecast the response of a subject with long-term morbid obesity (5-8 years) to an intervention by bariatric surgery measured as weight loss.

[0054] A sixth aspect of the invention relates to a computer program comprising program instructions for causing a computer to carry out the method according to any of the methods described in the present invention.

[0055] In particular, the invention encompasses computer programs arranged on or within a carrier. The carrier may be any entity or device capable of supporting the program. When the program is embodied in a signal that can be transported directly by a cable or other device or medium, the carrier may be constituted by said cable or other device or medium. As a variable, the carrier could be an integrated circuit on which the program is embedded, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.

[0056] A seventh aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of causing a computer to perform the steps of any of the methods described in the present invention.

[0057] For example, programs could be embedded in a storage medium, such as a ROM, CD-ROM, or semiconductor ROM, a USB flash drive, or a magnetic recording medium, such as a floppy disk or hard disk. Alternatively, programs could be supported by a transmissible carrier signal. For example, this could be an electrical or optical signal that could be transported via electrical or optical cable, by radio, or by any other means.

[0058] An eighth aspect of the invention relates to a transmissible signal comprising program instructions capable of causing a computer to carry out the steps of any of the methods described in the present invention.

[0059] Throughout the description and claims, the word "comprise" and its variants are not intended to exclude other technical features, additives, components, or steps. For those skilled in the art, other objects, advantages, and features of the invention will be apparent in part from the description and in part from the practice of the invention. The following examples and drawings are provided for illustrative purposes only and are not intended to limit the scope of the present invention.

[0060] Figure 1. ROC curve obtained with the data of the number of readings of hsa-m¡R-365b-5p (AUC of 0.248), hsa-m¡R-222-5p (AUC of 0.670) and the combination hsa-m¡R-365b-5p - hsa-m¡R-222-5p (AUC of 0.874).

[0061] DETAILED DESCRIPTION OF THE INVENTION

[0062] The study was conducted in a total of 33 patients with morbid obesity (MO) (body mass index (BMI >40 kg / m 2 , or >35 kg / m 2with associated comorbidities) undergoing bariatric surgery, who were divided into two groups:

[0063] -18 patients with morbid obesity considered good responders to bariatric surgery (OM-BR).

[0064] -15 patients with morbid obesity considered non-responders to bariatric surgery (OM-NoR).

[0065] To categorize them into these groups, the % weight loss (%PEP) was evaluated as: preoperative weight - weight at the time of evaluation

[0066] % PEP = 100 x - - - - — - - - - 5 preoperative weight - weight corresponding to a BMI = 25 Kg / m

[0067] BMI was determined as weight / height 2 .

[0068] Weight loss was considered insufficient when the %WL<50% in analogy with the Reinhold criteria [6], modified by Christou et al. [7], Based on this, the criteria considered to be considered as good responders (GR) or non-responders (NRR) to bariatric surgery were:

[0069] -Patients with %PEP>50% were considered good responders (OM-BR).

[0070] -Patients with %PEP <50% were considered non-responders (OM-NoR). Table 1. Patient characteristics.

[0071] BMI: body mass index (kg / m 2 ).

[0072] The average time after the intervention before the second BMI measurement is taken is 6.4 years, with an interval of 5-8 years.

[0073] All patients included in the study had a blood sample collected prior to the bacterial surgery, which was centrifuged to obtain the serum and stored at -80°C in the Biobank of the Virgen de la Victoria University Hospital in Malaga.

[0074] Extraction and identification of miRNAs

[0075] The initial serum samples belonged to a group of morbidly obese patients who had previously undergone two types of surgery, gastric bypass or sleeve gastrectomy as treatment.

[0076] Total miRNA-enriched RNA was extracted from 200 µl of serum using the Maxwell® 16 miRNA Tissue Kit (Promega, Madison, WI). An aliquot was used to perform ultrasequencing of miRNA libraries to analyze the miRNA expression pattern by NGS. Total RNA concentration was measured using the Qubit® RNA Assay Kit on the Qubit® 3.0 Fluorometer (Thermo Fisher Scientific Inc, Waltham, MA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit with the Agilent Bioanalyzer 2100 System (Agilent Technologies, Santa Clara, CA). For sequencing, small RNA transcripts were converted into barcoded cDNA libraries using 400–500 ng of RNA per sample as input material for the small RNA library. Sequencing libraries were generated using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (NEB, MA) following the manufacturer's instructions.Individual libraries prepared with unique indices were pooled and subjected to Illumina sequencing, going through cluster generation in 1x50-75 bp sequencing by synthesis on the NextSeq 550 (Illumina Inc., San Diego, CA).

[0077] Sample quality was analyzed using FastQC 0.11.9. To obtain clean miRNA reads, raw read data were processed to remove all primers using cutadapt 3.4 on the Illumina adapters. These files were then aligned using bowtie2 (v 2.2.0) with the human reference sequence from the UCSC GRCh38 assembly (http: / / genome.ucsc.edu) to find which sequences matched the genome. Alignments were then searched for coding regions of the human genome using htseq 0.11.1. Transcripts corresponding to miRNAs were then counted and selected, removing the remaining transcripts, to perform statistical analysis and divide miRNA streams into good responders (OM-BR) and non-responders (OMnoR).

[0078] To avoid data bias, the following corrections were applied: filtering by expression level of at least 10 reads in each gene per group to eliminate non-expressed genes, a correction factor to equalize the number of reads in each sample using the trimmed mean of the M values ​​(TMM) and logarithmic normalization of the counts per million (logCPM) of counts per million (logCPM). In this way, a list of miRNAs that are differentially expressed between both groups (OM-BR and OM-noR) was obtained with a p-value less than 0.05 between both groups (OM-BR and OM-noR), using the Mann-Whitney test. These grouped miRNAs were identified using the biomaRt package, in R software version 4.1.0.

[0079] Using the list of differentially expressed miRNAs, Spearman correlation analysis was performed to select those associated with %PEP. This new list was subjected to logistic regression studies to select those most closely associated with %PEP, with the miRNAs hsa-m¡R-222-5p and hsa-m¡R-365b-5p being selected as biomarkers.

[0080] Predictive capacity of hsa-m¡R-222-5p and hsa-m¡R-365b-5p expression levels to distinguish between OM-BR vs. OM-NoR patients.

[0081] First, the % weight loss (%WL) is assessed as preoperative weight - weight at the time of assessment

[0082] % PEP = 100 x - - - - - - - - - 5 preoperative weight - weight corresponding to a BMI = 25 Kg / m

[0083] The criteria considered to be considered as good responders or non-responders to bahatric surgery were:

[0084] -Patients with %PEP>50% were considered good responders (OM-BR).

[0085] -Patients with %PEP<50% were considered non-responders (OM-NoR).

[0086] When comparing the mean number of readings, significant differences were found between OM-R vs. OM-NoR patients in the number of hsa-m¡R-365b-5p readings. Table 2. Mean number of hsa-m¡R-222-5p and hsa-m¡R-365b-5p readings in the serum of patients with morbid obesity before bariatric surgery, depending on whether they are considered good responders or non-responders 5-8 years after undergoing bariatric surgery.

[0087] ROC curves

[0088] We performed different ROC curves to compare the ability of hsa-m¡R-222-5p and hsa-m¡R-365b-5p or their combination to distinguish between OM-BR vs. OM-NoR patients (Figure 1, Table 3).

[0089] The ROC curve obtained with the data of the number of readings of hsa-m¡R-365b-5p, hsa-m¡R-222-5p and the combination of the number of readings of hsa-m¡R-365b-5p - hsa-m¡R- 222-5p is shown in Figure 1. As can be seen in the graph, the diagnostic value, represented as the area under the curve (AUC), for the number of readings of hsa-m¡R-222-5p is 0.670 and that of hsa-m¡R-365b-5p is 0.248. By combining these two variables, number of readings of hsa-m¡R-365b-5p - hsa-m¡R-222.5p, a prediction model with greater discrimination is obtained, since AUC values ​​of 0.874 are reached, which within the interpretation of the ROC curves would be established as a very good diagnostic test.

[0090] Table 3. Area under the curve of the predictive capacity of the biomarkers hsa-m¡R-222-5p and hsa-m¡R-365b-5p or their combination, to distinguish between OM-BR vs. OM-NoR patients. With the data obtained from the ROC curve, the hsa-m¡R-365b-5p - hsa-m¡R-222-5p combination was selected as the best to predict the response (OM-BR vs. OM-NoR) of patients with morbid obesity to bariatric surgery.

[0091] Predictive capacity of the combination of hsa-m¡R-222-5p and hsa-m¡R-365b-5p to distinguish between OM-BR vs. OM-NoR patients.

[0092] With the combined data of the number of readings of hsa-m¡R-222-5p and hsa-m¡R-365b-5p prior to bariatric surgery determined by Next Generation Sequencing (NGS), the P value was obtained for each patient from the following equation: p_ + e“( -0-477 - (2.71 x number of readings hsa-m¡R-mir222-5p) + (1.69 x number of readings hsa-m¡R-365b-5p))}

[0093] Formula (I) where P is the predicted probability of a good response measured as long-term weight loss (5-8 years) after bariatric surgery in patients with morbid obesity, and number of hsa-m¡R-222-5p and hsa-m¡R-365b-5p readings is the number of hsa-m¡R-222-5p and hsa-m¡R-365b-5p readings prior to surgery that are obtained as previously specified.

[0094] The cutoff point with the highest sensitivity and specificity was 0.174. Based on this cutoff point (0.174), the following results were obtained (Table 4):

[0095] Table 4. Predicted probability combining the number of hsa-m¡R-222-5p and hsa-m¡R-365b-.5p readings (Formula I) and verification of results with the actual distribution of patients with morbid obesity based on the percentage of weight loss (%PEP) in the long term (5-8 years) after undergoing bariatric surgery. OM-BR: good responders (%PEP>50%); OM-NoR: non-responders (%PEP<50%)).

[0096] Table 5. Predictive capacity of the formula I equation combining the expression levels of hsa-m¡R-222-5p and hsa-m¡R-365b-5p measured as number of readings.

[0097] The algorithmic method with the greatest sensitivity and specificity is therefore the one that combines hsa-m¡R-222-5p and hsa-m¡R-365b-5p, with formula I: p_ + e“( -0-477 - (2.71 xn° readings hsa-m¡R-mir222-5p) + (1.69 xn° readings hsa-m¡R-365b-5p))}

[0098] The cut-off point determined for this algorithm is 0.174, so a value of P<0.174 would show those patients with morbid obesity in whom a good response occurs, measured as long-term weight loss (5-8 years) after a surgical intervention using gynecologic surgery, with a positive predictive value and a specificity of 100%.

[0099] References

[0100] 1. Alejandra Ortiz-Dosal, Patricia Rodil-García & Luis A. Salazar-

[0101] Olivo (2019) Circulating microRNAs ¡n human obesity: a systematic review, Biomarkers, 24:6, 499-509, DOI: 10.1080 / 1354750X.2019.1606279

[0102] 2. Maligianni, Ioanna, Christos Yapijakis, Flora Bacopoulou, and George Chrousos. 2021. “The Potential Role of Exosomes in Child and Adolescent Obesity” Children s, no. 3: 196. https: / / doi.org / 10.3390 / children8030196 3. Rico-Flórez Andrés Carlos, Solis-Toro Daniel, Arboleda Maria Ana, Hoyos-Quintero Ángela, Bravo-Solarte Diego, Salazar Blanca, Garcia Harry, Ortega Guillermo José, Suaréz- Ortegón Fabián Milton, Arboleda-Franco Santiago and Escudero Mosquera Mildrey*. Expression of Circulating MicroRNAs Associated with Obesity and Their Relationships with Biochemical Parameters and Health-related Physical Fitness in Children 6 to 10 Years Old in Cali, Colombia, MicroRNA 2023; 12 (1). https: / / dx.doi.org / 10.2174 / 2211536612666221205144321.

[0103] 4. ES2461016A1. Method for the diagnosis and / or prognosis of morbid obesity.

[0104] 5. Langi G, Szczerbinski L, Kretowski A. Meta-Analysis of Differential miRNA Expression after Bariatric Surgery. J Clin Med. 2019 Aug 15;8(8):1220. doi: 10.3390 / jcm8081220. PMID: 31443156; PMCID: PMC6723285.

[0105] 6. Reinhold RB. Critical analysis of long term weight loss following gastric bypass. Surg Gynecol Obstet. 1982 Sep;155(3):385-94. PMID: 7051382.

[0106] 7. Marshall JC, Cook DJ, Christou NV, Bernard GR, Sprung CL, Sibbald WJ. Multiple organ dysfunction score: a reliable descriptor of a complex clinical outcome. Grit Care Med. 1995 Oct;23(10):1638-52. doi: 10.1097 / 00003246-199510000-00007. PMID: 7587228.

Claims

CLAIMS 1. Use of the biomarkers hsa-m¡R-222-5p (SEQ ID NO:1) and hsa-m¡R-365b-5p (SEQ ID NO:2) isolated from a subject with morbid obesity to predict or prognose the response to long-term bariatric surgery measured as a percentage of weight loss.

2. A method for obtaining data useful for predicting or prognosticating the long-term response to bariatric surgery in a subject with morbid obesity, comprising: a) quantifying the expression levels of the biomarkers hsa-m¡R-222-5p and hsa-m¡R-365b-5p in a biological sample previously isolated from the subject, and b) applying the function of formula (I):

3. The method according to the preceding claim wherein the biological sample isolated in step a) is serum.

4. A method for predicting or prognosticating the long-term response to bariatric surgery in a subject with morbid obesity, comprising steps a) and b) according to any of claims 2-3, further comprising: c) assigning the subject in step a) to the group of subjects that will present a good response to bariatric surgery, a percentage of weight loss greater than 50% being considered a good response, when the P value is less than 0.

174.

5. A kit consisting of primers and / or probes capable of hybridizing simultaneously or sequentially with SEQ ID NO:1 and SEQ ID NO:2, means for detecting said hybridization and means for quantifying the expression levels of said sequences.

6. The kit according to the preceding claim, which also comprises a miRNA extraction kit, or a thermal cycler for cDNA synthesis, or the basic reagents for performing a real-time quantitative PCR to quantify SEQ ID NO:1 and SEQ ID NO:2, or any of their combinations.

7. In vitro use of the kit or device comprising primers and / or probes capable of hybridizing simultaneously or sequentially with SEQ ID NO:1 and SEQ ID NO:2, means for detecting said hybridization and means for quantifying the expression levels of said sequences to predict or forecast the long-term response to bariatric surgery measured as weight loss.

8. In vitro use of the kit or device according to the preceding claim, which also comprises a miRNA extraction kit, or a thermal cycler for cDNA synthesis, or the basic reagents for performing a real-time quantitative PCR to quantify SEQ ID NO:1 and SEQ ID NO:2, or any of their combinations.

Citation Information

Patent Citations

  • Biomarkers of colorectal cancer

    WO2019144183A1

  • Method and kit for the classification of thyroid nodules

    WO2019161472A1

  • Uterine endometrial fluid for prediction of success in fertility treatment

    WO2020154706A1