Circularized RNAS and methods of making the same
By employing hybridization regions and a one-pot dephosphorylation/ligation workflow, the challenges of producing circular RNAs are addressed, resulting in high yields and efficient production of functional circRNAs suitable for therapeutic applications.
Patent Information
- Application Number
- PCT/US2024/058479
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-04
- Filing Date
- 2024-12-04
- Publication Date
- 2025-06-12
AI Technical Summary
Current methods for producing circular RNAs (circRNAs) are limited by challenges such as the use of self-splicing introns, which can lead to synthesis difficulties and immunogenicity issues, as well as inefficient transcription and low RNA yields.
The use of hybridization regions to improve end annealing for ligation of large RNAs, allowing for the production of high yields of functional circRNAs through a one-pot dephosphorylation/ligation workflow, and enabling the incorporation of chemically modified nucleotides.
This approach simplifies both ligation and purification workflows, allows for the efficient production of large amounts of coding circRNA, and supports the use of modified nucleotides, making it suitable for commercial-scale production.
Smart Images

Figure US2024058479_12062025_PF_FP_ABST
Abstract
Description
CIRCULARIZED RNAS AND METHODS OF MAKING THE SAMECROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 606,074 filed on December 4, 2023, the entirety of which is incorporated herein by reference.BACKGROUND
[0002] The past decade has seen large technological progress in the use of synthetic RNA vectors technology as a therapeutic modality. However, to fully realize the potential of proteinencoding RNA therapeutics beyond vaccine applications, there is still much progress to be made on further improvements to the properties of the RNA molecule itself.SUMMARY
[0003] The present disclosure identifies certain advantages to RNA (also referred to herein as polyribonucleotides) as therapeutics. In particular, the present disclosure provides the recognition that that circular RNAs (circRNA) can be particularly useful for as therapeutic agents. CircRNA has certain characteristics that can be beneficial for use in cells, tissues, and subjects. For example, circRNA can be more resistant to exonuclease degradation than linear RNA molecules. Nonetheless, methods for producing circRNA suitable for delivery to cells, tissues, and subjects, which could leverage these benefits, has remained a challenge.
[0004] Prior research has shown that circRNA can be manufactured through the use of selfsplicing introns. See, e.g., Wesselhoeft, Kowalski, & Anderson, Nat Comm, 2018, which is incorporated herein by reference in its entirety. However, there are disadvantages to using selfsplicing introns for manufacturing. For example, the relatively large size of active intron sequences can make synthesis of the RNA template challenging. In addition, stringent sequence and RNA structure requirements associated with circRNA can severely restrict the use of chemically modified nucleotides when using self-splicing introns. One possible solution to overcome these limitations is to avoid using modified nucleotides in circRNA; however, while this solution may address the manufacturing concern, it leads to a different set of challenges associated with the immunogenicity of unmodified circRNA. Also, manufacturing circRNAusing self-splicing introns can create splicing byproducts that must be purified away from the main bioactive product prior to use to minimize any unintended effects associated with such byproducts. Reports regarding the immunostimulatory potential of circRNA products point to the possibility that unmodified circRNA has the same limitations as unmodified linear RNA due to excessive immune response and blunted protein expression. See, e.g., Chen, et al., Mol Cell 2017, which is incorporated herein by reference in its entirety.
[0005] In addition to the self-splicing intron approach, intramolecular ligation of a ssRNA can be achieved by a series of enzymatic reactions following the synthesis of the RNA.
[0006] A study describing the use of RNA Ligase from the bacteriophage T4 for synthesizing circular RNA was reported almost three decades ago (Beaudry and Perreault, 1995). The circularization utilized T4 RNA Ligase, with previous dephosphorylation-phosphorylation steps, each followed by RNA precipitation steps. Although the method was successful, the gel extraction process for isolation of the circular RNA fraction was a laborious and hard to standardize process for circular RNA isolation.
[0007] Another prior method for producing circRNA used complementary ends that form an 11- nucleotide stem loop to manufacture small (<250 nucleotides) noncoding circRNA miRNA sponges by end ligation. Breuer, et al., Mol. Ther. Nucleic, 2022, which is incorporated herein by reference in its entirety. In order to produce monophosphate bearing RNAs for ligation, these methods performed in vitro transcription with a lOx molar excess of guanosine monophosphate (GMP). Use of a 1 Ox molar excess of GMP produces an RNA pool that predominantly has monophosphate ends for ligation by biasing initiation with GMP. However, as is demonstrated by their long incubation time for RNA synthesis, transcription under these conditions is highly inefficient due to T7 RNA polymerase substrate preferences. Guanosine triphosphate GTP is a more efficient substrate for transcription initiation and elongation than GMP due to critical interactions with the triphosphate group of the nucleotide. As a result, use of GMP can lead to undesirable side products, e.g., transcripts initiated with GTP that do not have a monophosphate for ligation and truncated products due to transcription stalling. Temiakov, et al., Cell 2004, which is incorporated herein by reference in its entirety. Further, while in vitro transcription with a lOx molar excess of GMP may be a viable process for production of small amounts of small miRNA sponges, inefficient transcription and low RNA yields make the method poorly suitedfor large scale production of circRNAs. This is in part because transcription errors should be minimized in order to produce the larger circRNAs and maintain their functionality.
[0008] Other prior methods that use T4 RNA ligase to circularize RNAs involve the use of a DNA oligo splints that base pair with both the 5' and 3' end of the same RNA molecule. Stark, et al., RNA 2006, which is incorporated herein by reference in its entirety. Use of a DNA splint is meant to accomplish the goal of favoring intramolecular ligation of a single RNA into a covalently closed circle, rather than intermolecular ligation of two or more individual RNAs into a concatemer. However, that approach adds complexities to the reaction set-up because accommodating the DNA splint requires incorporation of complicated and expensive chemical modifications to the DNA oligo itself for optimal efficiency. While important RNA nucleotide modifications can be incorporated simply through in vitro transcription, DNA oligo modification must be done via often complex and typically expensive chemical synthesis methods. The additional modifications to the DNA oligo itself add further complexity to the purification of the ligated RNAs.
[0009] Recently, another group reported the use of 5' Pyrophosphohydrolase, RppH, and T4 RNA Ligase I enzymes to generate a monophosphate RNA molecule and a subsequent intramolecular ligation step, respectively, for circular RNA synthesis (Carmona, 2019). The method was applied to generate different sets of circular RNAs that encoded different reporter proteins as well as a therapeutic protein. Whereas the described method provided a simplified process for the dephosphorylation step, the multiple individual enzymatic treatments required an RNA clean up step after each reaction, and consequently an increased risk of sample loss and / or contamination, increased time of sample generation and potentially more cost expensive.
[0010] The present disclosure provides methods that address the limitations of prior methods. Methods provided herein utilize hybridization regions that reduce non-specific base-pairing, which improves end annealing for ligation of large RNAs. The provided methods can produce large amounts of coding circRNA quickly and efficiently. Furthermore, methods provided herein provide the possibility of a one-pot dephosphorylation / ligase (e.g., co-transcriptional) workflow that minimizes RNA autohydrolysis with large RNA, therefore producing higher yields of functional circRNA. The present disclosure also provides that increased yields can be achieved with the use higher concentration enzymes in methods provided herein. Methods provided herein also favor intramolecular ligation, particularly via the use of the described hybridization regions.Methods provided herein also simplify both ligation and purification workflows. In some embodiments, methods described herein may be sequence agnostic and / or structure agnostic. For example, in some embodiments, methods described herein provide for delivery of longer RNA sequences and / or sequences comprising modified nucleotides. The combination of these advantages allows the provided methods to be performed simply and in a cost-effective manner, particularly when manufacturing chemically modified circRNA at commercial scales.
[0011] Among other things, the present disclosure provides a polyribonucleotide. In some embodiments, a polyribonucleotide comprises a 5’ end comprising a 5 ’-most nucleotide, a 3’ end comprising a 3 ’-most nucleotide a first hybridization region, and a second hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is a reverse complement of a ribonucleotide sequence of a first hybridization region.
[0012] In some embodiments, a first hybridization region is 10 to 50 nucleotides in length. In some embodiments, a first hybridization region is 20 to 40 nucleotides in length. In some embodiments, a first hybridization region is 25 to 35 nucleotides in length.
[0013] In some embodiments, a ribonucleotide sequence of a first hybridization region has a specific G-C content. In some embodiments, a first hybridization region has a G-C content of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%.
[0014] In some embodiments, a ribonucleotide sequence of a first hybridization region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14. In some embodiments, a first hybridization region comprises a ribonucleotide sequence of SEQ ID NO: 14.
[0015] In some embodiments, a 5 '-most nucleotide of a polyribonucleotide comprises a 5' triphosphate, 5' diphosphate, or a 5' monophosphate. In some embodiments, a 5 '-most nucleotide of a polyribonucleotide comprises a 5' monophosphate. In some embodiments, a 3'- most nucleotide of a polyribonucleotide comprises a 3' hydroxyl.
[0016] In some embodiments, there are a specific number of nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide. In some embodiments, there are no more than 25 nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide.
[0017] In some embodiments, a second hybridization region is 10 to 50 nucleotides in length. In some embodiments, a second hybridization region is 20 to 40 nucleotides in length. In some embodiments, a second hybridization region is 25 to 35 nucleotides in length.
[0018] In some embodiments, a ribonucleotide sequence of a second hybridization region has a specific G-C content. In some embodiments, a ribonucleotide sequence of a second hybridization region has a G-C content of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%.
[0019] In some embodiments, a ribonucleotide sequence of a second hybridization region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15. In some embodiments, a second hybridization region comprises a ribonucleotide sequence of SEQ ID NO: 15.
[0020] In some embodiments, there are a specific number of nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3 '-most nucleotide of a polyribonucleotide. In some embodiments, there are no more than 25 nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3 '-most nucleotide of a polyribonucleotide.
[0021] In some embodiments, a polyribonucleotide further comprises a 5’ polyadenylate (poly(A)) overhang. In some embodiments, a 5’ poly(A) overhang is 2-8 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is 3 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is 6 nucleotides in length.
[0022] In some embodiments, a polyribonucleotide further comprises a 3’ poly(A) overhang. In some embodiments, a 3’ poly(A) overhang is 2-8 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is 3 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is 6 nucleotides in length.
[0023] In some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang of a specific length as described herein and a 3’ poly (A) overhang as described herein. For example, in some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang that is 3 nucleotides in length and a 3’ poly(A) overhang that is 3 nucleotides in length. In some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang that is 6 nucleotides in length and a 3’ poly(A) overhang that is 6 nucleotides in length.
[0024] In some embodiments, a 5’ poly(A) overhang and / or a 3’ poly(A) overhang is / are unstructured.
[0025] In some embodiments, a polyribonucleotide comprises one or more spacers. In some embodiments, one or more spacers are 1-100 nucleotides in length. In some embodiments, one of the spacers is 1-100 nucleotides in length. In some embodiments, one of the spacers is 1-50 nucleotides in length. In some embodiments, one of the spacers is 10-100 nucleotides in length. In some embodiments, a polyribonucleotide comprises two or more spacers. In some embodiments, a first spacer is 1-50 nucleotides in length. In some embodiments, a second spacer is 10-100 nucleotides in length.
[0026] In some embodiments, a polyribonucleotide as described herein comprises an internal ribosomal entry site (IRES). In some embodiments, an IRES comprises a viral, a cellular, or an engineered IRES.
[0027] In some embodiments, a polyribonucleotide comprises a 5’ UTR. In some embodiments, a polyribonucleotide comprises a 3’ UTR.
[0028] In some embodiments, a polyribonucleotide comprises a payload sequence. In some embodiments, a payload sequence encodes a polypeptide. In some embodiments, a payload sequence comprises an RNA oligo, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof. In some embodiments, a payload sequence comprises two or more of an RNA oligo, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof.
[0029] In some embodiments, a polyribonucleotide comprises, in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, an IRES, a payload sequence encoding a polypeptide, a 3’ UTR, a spacer, a 5’ UTR, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises, in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, a first spacer, an IRES, a payload sequence encoding a polypeptide, a 3’ UTR, a second spacer, a 5’ UTR, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises, in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, a payload sequence comprising an RNA oligo, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, or an antisense oligonucleotide, a second hybridization region, and a 3’ poly(A) overhang.
[0030] In some embodiments, a polyribonucleotide comprises a combination of elements with specific lengths. For example, in some embodiments, a polyribonucleotide comprises a first hybridization region that is 10-50 nucleotides in length. In some embodiments, a polyribonucleotide comprises a second hybridization region that is 10-50 nucleotides in length. In some embodiments, a polyribonucleotide comprises a first spacer that is 1-50 nucleotides in length. In some embodiments, a polyribonucleotide comprises a second spacer that is 10-100 nucleotides in length. In some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang that is 2-8 nucleotides in length. In some embodiments, a polyribonucleotide comprises a 3’ poly(A) overhang that is 2-8 nucleotides in length.
[0031] In some embodiments, a polyribonucleotide comprises a first hybridization region that is 10-50 nucleotides in length. In some embodiments, a polyribonucleotide comprises a second hybridization region that is 10-50 nucleotides in length. In some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang that is 2-8 nucleotides in length. In some embodiments, a polyribonucleotide comprises a 3’ poly(A) overhang that is 2-8 nucleotides in length.
[0032] In some embodiments, a polyribonucleotide is 50-100,000 nucleotides in length. In some embodiments, a polyribonucleotide is at least 50, at least 100, at least 150, at least 250, at least 500, at least 750, at least 1000, at least 1250, at least 1500, at least 2000, at least 5000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 60,000, at least 70,000, at least 80,000, or at least 90,000 nucleotides in length. In some embodiments, a polyribonucleotide is at most 90,000, at most 80,000, at most 70,000, at most 60,000, at most 50,000, at most 40,000, at most 30,000, at most 20,000, at most 10,000, at most 5000, at most 2000, or at most 1500 nucleotides in length.
[0033] In some embodiments, a polyribonucleotide comprises one or more modified nucleotides. In some embodiments, one or more modified nucleotides comprise N4-acetylcytidine (ac4C), 5- hydroxymethyluridine (5hmu), N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza- uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methyl wyosine (mimG), 5- hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-methoxycytidine, 5-propynylcytidine, 2-thiocytidine, 5 -hydroxyuridine, 5-methyluridine, 5,6-dihydro-5- methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'- amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5 -carboxymethylesteruridine, 5-fbrmyluridine, 5-methoxyuridine, 5- propynyluridine, 5 -bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl- pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl -methylpseudouridine, Nl- ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2- aminoadenosine, 3 -methyladenosine, 7-deazaadenosine, 8-oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-O-methylguanine, or any combination thereof.
[0034] In some embodiments, one or more modified nucleotides comprise N4-acetylcytidine. In some embodiments, at least 5% of cytidine residues in the polyribonucleotide comprise N4- acetylcytidine. In some embodiments, less than 100% of cytidine residues in the polyribonucleotide comprise N4-acetylcytidine. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of cytidine residues in the polyribonucleotide comprise N4-acetylcytidine.
[0035] In some embodiments, one or more modified nucleotides comprise 5- hydroxymethyluridine. In some embodiments, at least 5% of uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine. In some embodiments, less than 100% of uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of uridine residues in the polyribonucleotide comprise 5- hydroxymethyluridine.
[0036] In some embodiments, one or more modified nucleotides comprise one or more nucleosides comprising a modified ribose. In some embodiments, a modified ribose is 2’-O-acetylated. In some embodiments, at least 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% of the nucleosides of the polyribonucleotide comprise a 2-0 acetylated ribose. In some embodiments, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10% of the nucleosides of the polyribonucleotide comprise a 2-0 acetylated ribose.
[0037] Among other things, the present disclosure provides compositions and methods for making circular RNA. In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase. In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a hybridization region. In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a first hybridization region or a second hybridization region.
[0038] In some embodiments, compositions or methods as described herein comprise or use an RNA ligase. In some embodiments, an RNA ligase is T4 RNA Ligase (e.g., T4 RNA Ligase I) or circLigase.
[0039] In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a poly(A) sequence. In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a poly(A) overhang. In some embodiments, a polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a 5’ poly(A) overhang and / or a 3’ poly(A) overhang.
[0040] In some embodiments, efficiency of circularization is measured using one or more assays. In some embodiments, one or more assays comprise an exonuclease digestion assay. In some embodiments, a one or more assays comprise a denaturing agarose gel. In some embodiments, aone or more assays comprise an HPLC assay. In some embodiments, a one or more assays comprise sequencing assay. In some embodiments, a sequencing assay comprises Nanopore® sequencing, Sanger sequencing, or next generation sequencing.
[0041] The present disclosure provides, among other things, a composition comprising a polyribonucleotide as described herein. In some embodiments, a composition comprises two or more polyribonucleotides. In some embodiments, a polyribonucleotide in a composition is a linear polyribonucleotide. In some embodiments, a subset of two or more polyribonucleotides are linear polyribonucleotides. In some embodiments, a linear polyribonucleotide comprises a 5' monophosphate at a 5 '-most nucleotide. In some embodiments, a subset of linear polyribonucleotides comprise a 5' monophosphate at a 5 '-most nucleotide. In some embodiments, a linear polyribonucleotide comprises a 3' hydroxyl at a 3 '-most nucleotide of a polyribonucleotide. In some embodiments, a subset of linear polyribonucleotides comprise a 3' hydroxyl at a 3 '-most nucleotide of a polyribonucleotide. In some embodiments, a polyribonucleotide in a composition is a circular polyribonucleotide. In some embodiments, a subset of two or more polyribonucleotides are circular polyribonucleotides.
[0042] In some embodiments, a composition as provided herein comprises an RNA ligase.
[0043] In some embodiments, a composition as provided herein comprises a polyribonucleotide as described herein and an RNA ligase.
[0044] In some embodiments, a composition comprises 1 to 8 unit(s) of RNA ligase. In some embodiments, a composition comprises 1 to 8 unit(s) of RNA ligase per pg of a polyribonucleotide. In some embodiments, a composition comprises 1 to 8 unit(s) of RNA ligase per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 3 to 6 units of RNA ligase. In some embodiments, a composition comprises 3 to 6 units of RNA ligase per pg of a polyribonucleotide. In some embodiments, a composition comprises 3 to 6 units of RNA ligase per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 6 units of RNA ligase. In some embodiments, a composition comprises 6 units of RNA ligase per pg of a polyribonucleotide. In some embodiments, a composition comprises 6 units of RNA ligase per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 3 units of RNA ligase. In some embodiments, a composition comprises 3 units of RNA ligase per pg of a polyribonucleotide. In someembodiments, a composition comprises 3 units of RNA ligase per pg of two or more poly rib onucl eoti de s .
[0045] In some embodiments, a composition as provided herein comprises a 5’ pyrophosphohydrolase. In some embodiments, a 5’ pyrophosphohydrolase is RNA 5’ 5’ pyrophosphohydrolase (RppH).
[0046] In some embodiments, a composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase. In some embodiments, a composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of a polyribonucleotide. In some embodiments, a composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 5 to 10 units of 5’ pyrophosphohydrolase. In some embodiments, a composition comprises 5 to 10 units of 5’ pyrophosphohydrolase per pg of a polyribonucleotide. In some embodiments, a composition comprises 5 to 10 units of 5’ pyrophosphohydrolase per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 5 units of 5’ pyrophosphohydrolase. In some embodiments, a composition comprises 5 units of 5’ pyrophosphohydrolase, per pg of a polyribonucleotide. In some embodiments, a composition comprises 5 units of 5’ pyrophosphohydrolase, per pg of two or more polyribonucleotides. In some embodiments, a composition comprises 10 units of 5’ pyrophosphohydrolase. In some embodiments, a composition comprises 10 units of 5’ pyrophosphohydrolase per pg of a polyribonucleotide. In some embodiments, a composition comprises 10 units of 5’ pyrophosphohydrolase per pg of two or more polyribonucleotides.
[0047] In some embodiments, a linear polyribonucleotide circularizes when a composition is incubated. In some embodiments, a linear polyribonucleotide circularizes when a composition is incubated for 1 hour to 3 hours at 20 °C to 50 °C. In some embodiments, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 50 °C.
[0048] In some embodiments, a linear polyribonucleotide circularizes when a composition is incubated for 2 hours at 25 °C. In some embodiments, a linear polyribonucleotide circularizes when a composition is incubated for 2 hours at 37 °C. In some embodiments, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of linear polyribonucleotides circularize when the composition is incubated for 2 hours at 25 °C. In some embodiments, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of linear polyribonucleotides circularize when the composition is incubated for 2 hours at 37 °C.
[0049] Among other things, the present disclosure provides methods of circularizing polyribonucleotides. In some embodiments, a method of circularizing polyribonucleotides comprises incubating a composition. In some embodiments, incubating a composition comprising two or more polyribonucleotides and an RNA ligase. In some embodiments, two or more polyribonucleotides comprise linear polyribonucleotides.
[0050] In some embodiments, a composition is incubated for 1 to 3 hours. In some embodiments, a composition is incubated for 2 hours.
[0051] In some embodiments, a composition is incubated at 20 °C to 30 °C. In some embodiments, a composition is incubated at 25 °C. In some embodiments, a composition is incubated at 20 °C to 40 °C. In some embodiments, a composition is incubated at 37 °C.
[0052] In some embodiments, a subset of linear polyribonucleotides circularize when a composition is incubated. In some embodiments, a subset of linear polyribonucleotides circularize when a composition is incubated for 1 hour to 3 hours at 20 °C to 30 °C. In some embodiments, a subset of linear polyribonucleotides circularize when a composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C. In some embodiments, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of linear polyribonucleotides circularize when a composition is incubated for 1 hour to 3 hours at 20 °C to 30 °C. In some embodiments, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of linear polyribonucleotides circularize when a composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C. In some embodiments, at least 85% of linear polyribonucleotides circularize when the composition is incubated for 2 hours at25 °C. In some embodiments, at least 85% of linear polyribonucleotides circularize when the composition is incubated for 2 hours at 37 °C.
[0053] In some embodiments, compositions and methods as provided herein further comprises an osmolyte. In some embodiments, a composition further comprises an osmolyte. In some embodiments, an osmolyte is an amino acid-based osmolyte. In some embodiments, an amino acid-based osmolyte comprises a glycine-based osmolyte. In some embodiments, a glycine-based osmolyte comprise betaine.
[0054] In some embodiments, a method further comprises incubating two or more polyribonucleotides with a 5’ pyrophosphohydrolase.
[0055] In some embodiments, a step of incubating two or more polyribonucleotides with a 5’ pyrophosphohydrolase occurs prior to a step of incubating a composition comprising the two or more polyribonucleotides with an RNA ligase.
[0056] In some embodiments, a method further comprises digesting an incubated composition. In some embodiments, a method further comprises digesting an incubated composition with an exonuclease. In some embodiments, an exonuclease degrades linear polyribonucleotides. In some embodiments, an exonuclease is XRN-1, RNaseR, or ExoT.
[0057] In some embodiments, a method further comprises digesting an incubated composition with an exonuclease for 0.5 hours to 2 hours at 20 °C to 50 °C. In some embodiments, a method further comprises digesting with an exonuclease is for 1 hour at 37 °C.
[0058] Among other things, the present disclosure provides a polyribonucleotide as described herein or a composition as described herein for use in manufacturing circularized polyribonucleotides.
[0059] In some embodiments, a polyribonucleotide as described herein or a composition as described herein for use in manufacturing polyribonucleotides comprises a 5' monophosphate at a 5 '-most nucleotide.
[0060] Among other things, the present disclosure provides use of a polyribonucleotide as described herein or a composition as described herein in manufacturing circularized polyribonucleotides.
[0061] In some embodiments, a use of a polyribonucleotide as described herein or a composition as described herein in manufacturing polyribonucleotides comprises a 5' monophosphate at a 5'- most nucleotide.
[0062] Among other things, the present disclosure provides a kit comprising a polyribonucleotide as described herein, and a ligase. In some embodiments, a kit as described herein further comprises a 5’ pyrophosphohydrolase.
[0063] Among other things, the present disclosure provides a cell comprising a polyribonucleotide as described herein or a composition as described herein.
[0064] The present disclosure provides, among other things, a DNA molecule that encodes a polyribonucleotide as described herein.
[0065] Among other things, the present disclosure provides a method of making a polyribonucleotide as described herein. In some embodiments, a method of making comprises incubating the DNA molecule as described herein with an RNA polymerase and ribonucleotides.
[0066] In some embodiments, ribonucleotides comprise one or more naturally occurring ribonucleotides.
[0067] In some embodiments, ribonucleotides comprise one or more modified ribonucleotides. In some embodiments, one or more modified ribonucleotides comprise N4-acetylcytidine (ac4C),5-hydroxymethyluridine (5hmu), N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza- uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine,6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methyl wyosine (mimG), 5- hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-methoxycytidine, 5- propynylcytidine, 2-thiocytidine, 5 -hydroxyuridine, 5-methyluridine, 5,6-dihydro-5- methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'- amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5 -carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5- propynyluridine, 5 -bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl- pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl -methylpseudouridine, Nl- ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2- aminoadenosine, 3 -methyladenosine, 7-deazaadenosine, 8-oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-O-methylguanine, or any combination thereof.
[0068] Among other things, the present disclosure provides, a pharmaceutical composition. In some embodiments, a pharmaceutical composition as described herein comprises a circularized RNA. In some embodiments, a circularized RNA is produced by a method as described herein.
[0069] In some embodiments, a pharmaceutical, further comprises a plurality of lipid nanoparticles or liposomes. In some embodiments, a circular RNA is partially or fully encapsulated by lipid nanoparticles of liposomes of a plurality.
[0070] Among other things, the present disclosure provides a method comprising administering a pharmaceutical composition as described herein to a subject in need thereof.
[0071] Among other things, the present disclosure provides a use of a circularized RNA as described herein. In some embodiments, a circularized RNA is produced by a method as described herein in a manufacture of a medicament for treating a subject in need thereof.
[0072] These, and other aspects encompassed by the present disclosure, are described in more detail below and in the claims.BRIEF DESCRIPTION OF THE DRAWINGS
[0073] FIG. 1 is a schematic of an exemplary method provided herein. As shown, an exemplary method (100) provided herein comprises transcribing single-stranded RNA (ssRNA) transcribed from a DNA template using a polymerase, e.g., a T7 polymerase (101). Transcribed ssRNA comprises a first hybridization region and a second hybridization region, which will hybridize and form a U-shaped structure, thereby bringing the 5 '-most nucleotide and the 3 '-most nucleotide of the ssRNA into proximity with one another (102). In some embodiments, the 5'- most nucleotide comprises a 5' triphosphate. In some embodiments, the 3 '-most nucleotide comprises a 3' hydroxyl. As shown, where the 5'-most nucleotide comprises a 5' triphosphate, a method provided herein comprises dephosphorylating the 5' triphosphate to produce a 5' monophosphate (103). In other words, the 5 '-most nucleotide of the ssRNA will now comprise a 5' monophosphate instead of a 5' triphosphate. The method further comprises ligating the 5' monophosphate of the 5 '-most nucleotide with the 3' hydroxyl of the 3 '-most nucleotide (104), thereby forming a circRNA from the ssRNA.
[0074] FIG. 2 shows results of an exemplary XRN1 digestion assay. XRN-1 is an exonuclease with specificity for 5' monophosphate bearing ssRNA. Increased XRN1 digestion indicates that an increased amount of 5' monophosphate (e.g., that dephosphorylation of a 5' triphosphate was successful). The XRN1 digestion assay was performed on exemplary ssRNA as described herein following treatment with various amounts of RNA 5’ pyrophosphohydrolase (RppH) enzyme. Lanes designations used are: Ladder: DNA ladder. C-: Negative control Construct 7 Digest, no enzymatic treatment (no RppH or XRN-1). C-: Negative control 7, no RppH treatment. 5U: XRN-1 digest of construct 7 RNA treated with 5U RppH. 10U: XRN-1 digest of Construct 7 RNA treated with 10U RppH. 25U: XRN-1 digest of Construct 7 RNA treated with 25U RppH. 50U: XRN-1 digest of Construct 7 RNA treated with 50U RppH.
[0075] FIG. 3 shows results of an exemplary ligation efficiency assay following RppH / T4 RNA ligase treatment on exemplary ssRNA described herein. Circularization efficiency was assayed across a variety of constructs with different adenine overhangs at the 5' and 3' ends of the ssRNA. Lanes designations used are: Ladder: ssRNA Ladder. C3: Luc2 RS + 3’ 3A RNA. C2: Luc2 5’ 3A + RS RNA. C6: Luc2 RS + 3’ 6A RNA. C5: Luc2 5’ 6A + RS RNA.
[0076] FIG. 4 shows a 2% agarose denaturing gel of exemplary ligated ssRNA as described herein, where the ligation reaction was performed together or separately than thedephosphorylation reaction. Lanes designations used are: Ladder: ssRNA Ladder. N: no ligase Luc2 RS + 3’ 6A (Construct 6). IR: Individual RppH and T4 Ligase reactions, SR: Single RppH and T4 Ligase reactions.
[0077] FIG. 5 shows a 2% agarose denaturing gel of an exemplary ligation efficiency assay performed after a 30-minutes XRN-1 digestion. Lanes designations used are: Ladder: ssRNA Ladder. Wells 1-4: pre-XRN-1 exonuclease digestion. C-: Construct 7 RNA template negative digest control. C-: uncapped linear Luc2 RNA negative digest control. C-: Unligated (e.g., nonligated) RppH treated Construct 7 RNA. L: Ligated Construct 7 RNA. Wells 5-8: post-XRN-1 exonuclease digestion. C-: Construct 7 RNA template negative digest control. C-: uncapped linear Luc2 RNA negative digest control. C+: Unligated (e.g., non-ligated) RppH treated Construct 7 RNA positive digest control. L: Ligated Construct 7 RNA. N: Non-denatured unligated (e.g., non-ligated) construct 7 RNA. All samples were mass normalized at 500 ng and denatured except for sample in well 9 (N).
[0078] FIG. 6 shows a 2% agarose denaturing gel of XRN-1 digested RNA pre- and postligation performed after a 1-hour XRN-1 digestion. Lanes designations used are: Ladder: ssRNA Ladder. Wells 1-4: pre-XRN-1 exonuclease digestion. C-: Construct 7 RNA template negative digest control. C-: uncapped linear Luc2 RNA negative digest control. C-: Unligated (e.g., non-ligated) RppH treated Construct 7 RNA. L: Ligated Construct 7 RNA. Wells 5-8: post-XRN-1 exonuclease digestion. C-: Construct 7 RNA template negative digest control. C-: uncapped linear Luc2 RNA negative digest control. C+: Unligated (e.g., non-ligated) RppH treated Construct 7 RNA positive digest control. L: Ligated Construct 7 RNA. N: Non-denatured unligated (e.g., non-ligated) construct 7 RNA. All samples were mass normalized at 500 ng and denatured except for sample in well 9 (N).
[0079] FIG. 7 shows a 4% agarose denaturing gel of an unmodified template ssRNA as provided herein and its products derived from circularization with T4 NEB Ligase and circLigase under different conditions (e.g., variable temperature and betaine addition). Templates contain the iHRV IRES (Chen, et. al., 2022, which is incorporated herein by reference in its entirety), NLuc ORF, 5’ and 3’ -Xenopus globin UTRs, hybridization regions, and overhanging adenines at the 5' and 3' ends to promote ligation. Lanes designations used are: B+: 5M Betaine added to reaction, B-: No Betaine added to reaction.
[0080] FIG. 8 shows a 2% agarose denaturing gel of ssRNA comprising unmodified and modified nucleotides and circularized counterparts. Templates contain the Flue ORF, hybridization regions and overhanging adenines at the 5’ and 3’ ends to promote ligation. Lanes designations used are: IR: Individual RppH and T4 Ligase reactions, SR: Single RppH and T4 Ligase reactions.
[0081] FIG. 9 shows 4% agarose denaturing gels of products after dephosphorylation and ligase treatments on ssRNA templates using unmodified and modified nucleotides. ssRNA used comprised iHRV IRES, NLuc ORF, 5' and 3' Xenopus globin UTRs, hybridization regions, and overhanging adenines at the 5' and 3' ends. The ssRNA also comprised spacers between a first hybridization region and an iHRV IRES as indicated at the top of each lane.
[0082] FIGS. 10A-10C include graphs of exemplary nanoluciferase expression from circRNA as described herein. Unpurified circRNA and associated templates (pre-ligation, RppH treated) were used as input for synthetizing NanoLuc in an in vitro translation (IVTT) assay. Luminescence was measured after incubation for 90 minutes at 30°C. The increase in luminescence demonstrates that allowing IRES folding and / or avoiding intervening from the hairpin formed by hybridization regions with it, enabled higher expression from exemplary circRNA. FIG. 10A shows the results obtained from unmodified RNA. FIG. 10B shows the results obtained from RNA including Ac4C and 5hmU in place of 100% cysteine and uridine residues in the RNA, respectively. FIG. 10C shows the results obtained from RNA including 100% 2'O-modified residues.
[0083] FIGS. 11A-11B show an agarose gel of RNA products encoding a NanoLuc protein after an IVT reaction coupled to dephosphorylation and ligation reactions. FIG. 11A shows results obtained from addition of 0 mM ATP and 2 mM ATP to each dephosphorylation and ligation reaction. FIG. 11B shows results obtained from addition of 1 mM ATP to each dephosphorylation and ligation reaction.
[0084] FIG. 12 includes electropherograms of exemplary circular RNA and linear input RNA samples encoding an exemplary luciferase (NanoLuc; labeled “Nluc”), as assessed with capillary electrophoresis. The first sample titled “Circular Nluc unpurified” shows results from an exemplary unpurified circular RNA synthesized with a multi-enzymatic one-pot method as described herein, with the two largest peaks representing the circular RNA fraction and the linear RNA fraction, respectively. The second sample titled “Linear RNA input NLuc” shows resultsfrom an exemplary RNA transcribed from a DNA template without a T4 RNA Ligase 4 added to the IVT / dephosphorylation reaction, with a single large peak representing the linear RNA fraction. The third sample titled “Circular Nluc Purified” shows results from an exemplary purified circular RNA synthesized with a multi-enzymatic one-pot method and purified with RNase R digest as described herein. A single large peak represents the RNase R resistantcircular RNA fraction. The fourth sample titled “ssRNA Ladder” shows results from an ssRNA ladder sample used as a size reference for other RNAs tested.
[0085] FIG. 13 includes electropherograms of exemplary circular RNA and linear input RNA samples encoding an exemplary luciferase (NanoLuc; labeled “Nluc”), as assessed with capillary electrophoresis. The first sample titled “Unmodified Circular Nluc unpurified (pA-RnR-)” shows results from an exemplary unpurified circular RNA synthesized with a multi-enzymatic one-pot method as described herein, with the two largest peaks representing the circular RNA fraction and the linear RNA fraction, respectively. The second sample titled “Unmodified Linear RNA non-ligated Nluc (pA-RnR-)” shows results from an exemplary RNA transcribed from a DNA template without a T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction, with a single large peak representing the linear RNA fraction. The third sample titled “Unmodified Circular Nluc unpurified (pA+RnR-)” shows results of the first sample after polyA tailing treatment. The fourth sample titled “Unmodified Circular Nluc Purified (pA+ RnR+)” shows results from an exemplary purified circular RNA synthesized with a multi-enzymatic one-pot method and purified with RNase R digest as described herein. A single large peak represents the RNase R resistant-circular RNA fraction. The fifth sample titled “Unmodified Linear Nluc Purified (pA+ RnR+)” shows results of the second sample after polyA tailing treatment. The last (sixth) sample titled “ssRNA Ladder” shows results from an ssRNA ladder sample used as a size reference for other RNAs tested.
[0086] FIG. 14 includes electropherograms of exemplary circular RNA and linear input RNA samples encoding an exemplary Green Fluorescence Protein (GFP; labeled “eGFP”), as assessed with capillary electrophoresis. The first sample titled “Unmodified Circular eGFP unpurified (pA-RnR-)” shows results from an exemplary unpurified circular RNA synthesized with a multi- enzymatic one-pot method as described herein, with the two largest peaks representing the circular RNA fraction and the linear RNA fraction, respectively. The second sample titled “Unmodified Linear RNA non-ligated eGFP (pA-RnR-)” shows results from an exemplary RNAtranscribed from a DNA template without a T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction, with a single large peak representing the linear RNA fraction. The third sample titled “Unmodified Circular eGFP Purified (pA+ RnR+)” shows results from an exemplary purified circular RNA synthesized with a multi-enzymatic one-pot method and purified with RNase R digest as described herein. A single large peak represents the RNase R resistant-circular RNA fraction. The last (fourth) sample titled “ssRNA Ladder” shows results from an ssRNA ladder sample used as a size reference for other RNAs tested.
[0087] FIG. 15 is a bar plot showing expression of an exemplary luciferase in HEK293 cells 72 hours after transfection with exemplary unmodified circular RNAs encoding the Nluc protein (100 ng dose). Exemplary circular RNAs were synthesized with a multi-enzyme one-pot reaction as described herein.
[0088] FIGS. 16A-16C show an agarose gel of products after an IVT reaction coupled to one- pot reaction method, two-pot reaction method, or individual reaction method. The agarose gel shows circularization efficiency of unmodified and chemically modified RNAs encoding for NanoLuciferase. FIG. 16A shows results obtained from a one pot reaction method that shows products after an IVT reaction coupled to RppH (dephosphorylation) and T4 RNA Ligation reactions. FIG. 16B shows results obtained from a two pot reaction method that shows products after an IVT reaction coupled only to RppH (dephosphorylation) reaction. FIG. 16C shows results obtained from an individual reaction method that shows products after an IVT reaction in which RppH (dephosphorylation) reaction and T4 RNA Ligation reaction are performed individually.
[0089] FIG. 17 includes electropherograms of exemplary circular RNA and linear input 2-0 Ac modified RNA samples encoding an exemplary luciferase (NanoLuc; labeled “Nluc”), as assessed with capillary electrophoresis. The first sample titled “2-0 Ac modified Circular Nluc unpurified (pA-RnR-)” shows results obtained from an exemplary unpurified circular RNA synthesized with a multi-enzymatic one-pot method as described herein, with the two largest peaks representing the circular RNA fraction and the linear RNA fraction, respectively. The second sample titled “2-0 Ac modified Linear Nluc unpurified (pA-RnR-)” shows results obtained from an exemplary RNA transcribed from a DNA template without a T4 RNA Ligase 4 and RNA 5’ Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction, withpeaks representing denatured and non-denatured linear RNA fractions. The third sample titled “2-0 Ac modified Circular Nluc unpurified (pA+RnR-)” shows results of the first sample obtained after polyA tailing treatment. The fourth sample titled “2-0 Ac modified Circular Nluc Purified (pA+ RnR+)” shows results obtained from an exemplary purified circular RNA synthesized with a multi-enzymatic one-pot method and purified with RNase R digest as described herein. A single large peak represents the RNase R resistant-circular RNA fraction. The fifth sample titled “2-0 Ac modified Linear Nluc Purified (pA+ RnR+)” shows results of the second sample obtained after polyA tailing treatment. The last (sixth) sample titled “ssRNA Ladder” shows results obtained from an ssRNA ladder sample used as a size reference for other RNAs tested.
[0090] FIG. 18 is a bar plot showing expression of an exemplary luciferase in HEK293 cells 24 hours after transfection with exemplary Ac4C / 5hmU modified circular RNAs encoding the Nluc protein (50 ng dose). Exemplary circular RNAs were synthesized with a multi -enzyme one-pot reaction as described herein.
[0091] FIG. 19 includes electropherograms of exemplary circular RNA and linear input RNA samples encoding an exemplary luciferase (NanoLuc; labeled “Nluc”) produced using a DNA template comprising an exemplary set of hybridization regions with 30% G-C content, as assessed with capillary electrophoresis. The first sample titled “Unmodified Circular Nluc unpurified (pA-RnR-)” shows results from an exemplary unpurified circular RNA synthesized with a multi-enzymatic one-pot method as described herein, with the two largest peaks representing the circular RNA fraction and the linear RNA fraction, respectively. The second sample titled “Unmodified Linear RNA non-ligated Nluc (pA-RnR-)” shows results from an exemplary RNA transcribed from a DNA template without a T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction, with a single large peak representing the linear RNA fraction. The third sample titled “Unmodified Circular Nluc Purified (pA+ RnR+)” shows results from an exemplary purified circular RNA synthesized with a multi-enzymatic one-pot method, tailed with polyA, and purified with RNase R digest as described herein. A single large peak represents the RNase R resistant-circular RNA fraction. The last (fourth) sample titled “ssRNA Ladder” shows results from an ssRNA ladder sample used as a size reference for other RNAs tested.CERTAIN DEFINITIONS
[0092] About or approximately: As used herein, the terms “about” and “approximately,” when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” or “approximately” in that context. For example, in some embodiments, the term “about” or “approximately” may encompass a range of values that within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.
[0093] Administering: As used herein, the term “administering” or “administration” typically refers to administration of a composition to a subject to achieve delivery of an agent that is, or is included in, the composition. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g, by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g, perfusion) for at least a selected period of time.
[0094] Antigen: The term “antigen”, as used herein, refers to an agent that elicits an immune response; and / or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody. In some embodiments, an antigen elicits a humoral response (e.g., including production of antigen-specific antibodies); in some embodiments, an antigen elicits a cellular response (e.g., involving T-cells whose receptors specifically interact with the antigen). In some embodiments, an antigen comprises at least one epitope of a target protein. In someembodiments, an epitope may be a linear epitope. In some embodiments, an epitope may be a conformational epitope. In some embodiments, an antigen binds to an antibody and may or may not induce a particular physiological response in an organism. In general, an antigen may be or include any chemical entity such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (in some embodiments other than a biologic polymer [e.g., other than a nucleic acid or amino acid polymer) etc. In some embodiments, an antigen is or comprises a polypeptide. In some embodiments, an antigen is or comprises a glycan. Those of ordinary skill in the art will appreciate that, in general, an antigen may be provided in isolated or pure form, or alternatively may be provided in crude form (e.g., together with other materials, for example in an extract such as a cellular extract or other relatively crude preparation of an antigen-containing source). In some embodiments, antigens utilized in accordance with the present invention are provided in a crude form. In some embodiments, an antigen is a recombinant antigen.
[0095] Delivery / contacting: As used interchangeably herein, the term “delivery,” “delivering,” or “contacting” refers to introduction of a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell. A target cell can be cultured in vitro or ex vivo or be present in a subject (in vivo). Methods of introducing a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) into a target cell can vary with in vitro, ex vivo, or in vivo applications. In some embodiments, a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell in a cell culture by in vitro transfection. In some embodiments, a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell via delivery vehicles (e.g., nanoparticles, liposomes, and / or complexation with a cellpenetrating agent). In some embodiments, a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) can be introduced into a target cell in a subject by administering a polynucleotide (e.g., as described herein) or a fusion polypeptide (e.g., as described herein) to a subject.
[0096] Functional: As used herein, the term “functional” is used to refer to a form or fragment of an entity that exhibits a particular property and / or activity.
[0097] Nucleoside The term “nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments,a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.
[0098] Nucleic acid / Oligonucleotide / Polynucleotide: As used herein, the terms “nucleic acid” and “polynucleotide” and “oligonucleotide” are used interchangeably, and refer to a polymer of 3 nucleotides or more. In some embodiments, a nucleic acid comprises DNA. In some embodiments, a nucleic acid comprises RNA. In some embodiments, a nucleic acid comprises messenger RNA (mRNA). In some embodiments, a nucleic acid is single stranded. In some embodiments, a nucleic acid is double stranded. In some embodiments, a nucleic acid comprises both single and double stranded portions. In some embodiments, a nucleic acid comprises a backbone that comprises one or more phosphodiester linkages. In some embodiments, a nucleic acid comprises a backbone that comprises both phosphodiester and non- phosphodiester linkages. For example, in some embodiments, a nucleic acid may comprise a backbone that comprises one or more phosphorothioate or 5'-N-phosphoramidite linkages and / or one or more peptide bonds, e.g., as in a “peptide nucleic acid”. In some embodiments, a nucleic acid comprises one or more, or all, natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises on or more, or all, non-natural residues. In some embodiments, a non-natural residue comprises a nucleoside analog e.g., 2-aminoadenosine, 2- thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2- aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8 -oxoadenosine, 8 -oxoguanosine, 6-0- methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a non-natural residue comprises one or more modified sugars (e.g., 2'- fluororibose, ribose, 2' -deoxyribose, arabinose, and hexose) as compared to those in naturalresidues. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or polypeptide. In some embodiments, a nucleic acid has a nucleotide sequence that comprises one or more introns. In some embodiments, a nucleic acid may be prepared by isolation from a natural source, enzymatic synthesis e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro, reproduction in a recombinant cell or system, or chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000,12.500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000,18.500, 19,000, 19,500, or 20,000 or more residues or nucleotides long. When a number of nucleotides is used as an indication of size, e.g., of a polynucleotide, a certain number of nucleotides refers to the number of nucleotides on a single strand, e.g., of a polynucleotide.
[0099] Payload: In general, the term “payload”, as used herein, refers to an agent that may be delivered or transported by association with another entity. In some embodiments, such association may be or include a covalent linkage; in some embodiments such association may be or include non-covalent interaction(s). In some embodiments, association may be direct; in some embodiments, association may be indirect. The term “payload” is not limited to a particular chemical identity or type; for example, in some embodiments, a payload may be or comprise, for example, an entity of any chemical class including, for example, a lipid, a metal, a nucleic acid, a polypeptide, a saccharide (e.g., a polysaccharide), small molecule, or a combination or complex thereof. In some embodiments, a payload may be or comprise a biological modifier, a detectable agent (e.g, a dye, a fluorophore, a radiolabel, etc.), a detecting agent, a nutrient, a therapeutic agent, etc., or a combination thereof. In some embodiments, a payload may be or comprise a cell or organism, or a fraction, extract, or component thereof. In some embodiments, a payload may be or comprise a natural product in that it is found in and / or is obtained from nature; alternatively or additionally, in some embodiments, the term may be used to refer to one or more entities that is man-made in that it is designed, engineered, and / or produced through action of the hand of man and / or is not found in nature. In some embodiments, a payload may be or comprise an agent in isolated or pure form; in some embodiments, such agent may be in crude form.
[0100] Polypeptide: The term “polypeptide”, as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids or more. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional, biologically active, or characteristic fragments, portions or domains (e.g, fragments, portions, or domains retaining at least one activity) of such complete polypeptides. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g, terminal acetylation, amidation, methylation, etc. In some embodiments, polypeptides may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof.
[0101] Polyribonucleotide or RNA: As used herein, the terms “polyribonucleotide” and “RNA” are used interchangeably to refer to a polymer of 3 ribonucleotides or more. In some embodiments, an RNA is single stranded. In some embodiments, an RNA is double stranded. In some embodiments, an RNA comprises both single and double stranded portions. In some embodiments, an RNA comprises a backbone structure as described in the definition of "Nucleic acid / Oligonucleotide " above. An RNA can be a regulatory RNA (e.g., siRNA, microRNA, etc ), or a messenger RNA (mRNA) oligonucleotide. In some embodiments, where an RNA is a mRNA oligonucleotide, the RNA comprises at its 3’ end a poly(A) region. In some embodiments where an RNA is an mRNA oligonucleotide, the RNA typically comprises at its 5’ end an art- recognized cap structure, e.g., for recognizing and attachment of an mRNA to a ribosome to initiate translation. In some embodiments, a polyribonucleotide can be referred to as an RNA oligonucleotide. When a number of ribonucleotides is used as an indication of size, e.g., for an RNA, a certain number of nucleotides refers to the number of ribonucleotides on a single strand.
[0102] Subject: As used herein, the term “subject” refers an organism, typically a mammal (e.g, a human). In some embodiments, a subject is suffering from a disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, orcondition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered.
[0103] Therapeutic agent: As used herein, the phrase “therapeutic agent” refers to an agent that, when administered to a subject, has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition.
[0104] Variant: As used herein, the term “variant” refers to an entity that shows significant structural identity with a reference entity but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared with the reference entity. In many embodiments, a variant also differs functionally from its reference entity. In general, whether a particular entity is properly considered to be a “variant” of a reference entity is based on its degree of structural identity with the reference entity. For example, a variant polypeptide may differ from a reference polypeptide as a result of one or more differences in amino acid sequence and / or one or more differences in chemical moieties (e.g, carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. Alternatively or additionally, in some embodiments, a variant polypeptide does not share at least one characteristic sequence element with a reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, a variant polypeptide shares one or more of the biological activities of the reference polypeptide. In some embodiments, a variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, a variant polypeptide shows a reduced level of one or more biological activities as compared with the reference polypeptide.
[0105] Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, e.g, RNA synthesis, and tissue culture and transformation (e.g, electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Green and Sambrook, MolecularCloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), which is incorporated herein by reference for any purpose.DETAILED DESCRIPTION OF CERTAIN EMBODIMENTSI. RNA
[0106] Among other things, the present disclosure provides one or more polynucleotides (e.g., polyribonucleotides (e.g., circRNA)). In some embodiments, a polynucleotide is a polyribonucleotide. In some embodiments, a polynucleotide is linear. In some embodiments, a polynucleotide in circular (e.g., circRNA).
[0107] In some embodiments, a polyribonucleotide as described herein comprises one or more ends (e.g., a 5’ end and / or a 3’ end). In some embodiments, a polyribonucleotide as described herein comprises a 5’ end. In some embodiments, a polyribonucleotide as described herein comprises a 3’ end. In some embodiments, a 5’ end comprises a 5 ’-most nucleotide. In some embodiments, a 3’ end comprises a 3 ’-most nucleotide.
[0108] In some embodiments, a 5 ’-most nucleotide of a polyribonucleotide as described herein comprises a specific nucleotide. In some embodiments, a 5’-most nucleotide of a polyribonucleotide as described herein comprises a modified nucleotide. For example, in some embodiments, a 5’-most nucleotide comprises a 5' triphosphate, 5' diphosphate, or a 5' monophosphate. In some embodiments, a 5 ’-most nucleotide comprises a 5' monophosphate.
[0109] In some embodiments, a 3 ’-most nucleotide of a polyribonucleotide as described herein comprises a specific nucleotide. In some embodiments, a 3 ’-most nucleotide of a polyribonucleotide as described herein comprises a modified nucleotide. For example, in some embodiments, a 3’-most nucleotide comprises a 3’ hydroxyl.
[0110] In some embodiments, a polyribonucleotide comprises one or more hybridization regions. In some embodiments, a polyribonucleotide comprises a first hybridization region. In some embodiments, a polyribonucleotide comprises a second hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is or comprises a complement of a ribonucleotide sequence of a first hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is or comprises a reverse complement of a ribonucleotide sequence of a first hybridization region. In some embodiments, aribonucleotide sequence of a second hybridization region is or comprises a ribonucleotide sequence of a first hybridization region.[OHl] In some embodiments, a first hybridization region is about 5 to about 100 nucleotides in length. In some embodiments, a first hybridization region is about 10 to about 50 nucleotides in length. In some embodiments, a first hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a first hybridization region is about 15 to about 45 nucleotides in length. In some embodiments, a first hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a first hybridization region is about 25 to about 35 nucleotides in length. In some embodiments, a first hybridization region is at least about 10 nucleotides in length. In some embodiments, a first hybridization region is at most about 100 nucleotides in length. In some embodiments, a first hybridization region is at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 nucleotides in length. In some embodiments, a first hybridization region is at most about 100, at most about 95, at most about 90, at most about 85, at most about 80, at most about 75, at most about 70, at most about 65, at most about 60, at most about 55, or at most about 50 nucleotides in length.
[0112] In some embodiments, a ribonucleotide sequence of a hybridization region may contain sequence identity (i.e., similarity) to a sequence as described herein. For example, in some embodiments, a ribonucleotide sequence of a hybridization region (e.g., a first hybridization region, a second hybridization region) is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence as described herein.
[0113] In some embodiments, a ribonucleotide sequence of a first hybridization region is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least 7 about 0%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a TTAGCCGACGCGGCGAGCCCGCCTCGCGCG (SEQ ID NO.: 14). In some embodiments, a first hybridization region is or comprises a ribonucleotide sequence of SEQ ID NO.: 14. In someembodiments, a first hybridization region is or comprises a ribonucleotide sequence that is at least 90% identical to SEQ ID NO.: 14.
[0114] In some embodiments, a ribonucleotide sequence of a first hybridization region may comprise a specific GC content. For example, in some embodiments, a first hybridization region may comprise a GC content of at least about 50%. In some embodiments, a first hybridization region may comprise a GC content of at most about 100%. In some embodiments, a first hybridization region may comprise a GC content of at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
[0115] Ribonucleotides as described herein may comprise a specific number of nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide as described herein. In some embodiments, a ribonucleotide as described herein comprises at most about 35 nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide. In some embodiments, a ribonucleotide as described herein comprises at most about 30, at most about 25, at most about 20, or at most about 15 nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide. In some embodiments, a ribonucleotide as described herein comprises at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 nucleotides between a 5 '-most nucleotide of a first hybridization region and a 5 '-most nucleotide of a polyribonucleotide.
[0116] In some embodiments, a second hybridization region is about 5 to about 100 nucleotides in length. In some embodiments, a second hybridization region is about 10 to about 50 nucleotides in length. In some embodiments, a second hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a second hybridization region is about 15 to about 45 nucleotides in length. In some embodiments, a second hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a second hybridization region is about 25 to about 35 nucleotides in length. In some embodiments, a second hybridization region is at least about 10 nucleotides in length. In some embodiments, a second hybridization region is atmost about 100 nucleotides in length. In some embodiments, a second hybridization region is at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 nucleotides in length. In some embodiments, a second hybridization region is at most about 100, at most about 95, at most about 90, at most about 85, at most about 80, at most about 75, at most about 70, at most about 65, at most about 60, at most about 55, or at most about 50 nucleotides in length.
[0117] In some embodiments, a ribonucleotide sequence of a second hybridization region is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a CGCGCGAGGCGGGCTCGCCGCGTCGGCTAA (SEQ ID NO : 15). In some embodiments, a second hybridization region is or comprises a ribonucleotide sequence of SEQ ID NO.: 15. In some embodiments, a second hybridization region is or comprises a ribonucleotide sequence that is at least about 90% identical to SEQ ID NO.: 15.
[0118] In some embodiments, a ribonucleotide sequence of a second hybridization region may comprise a specific GC content. For example, in some embodiments, a second hybridization region may comprise a GC content of at least about 50%. In some embodiments, a second hybridization region may comprise a GC content of at most about 100%. In some embodiments, a second hybridization region may comprise a GC content of at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
[0119] In some embodiments, ribonucleotides as described herein may comprise a specific number of nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3'- most nucleotide of a polyribonucleotide as described herein. In some embodiments, a ribonucleotide as described herein comprises at most about 35 nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3 '-most nucleotide of a polyribonucleotide. In some embodiments, a ribonucleotide as described herein comprises at most about 30, at most about 25, at most about 20, or at most about 15 nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3 '-most nucleotide of a polyribonucleotide. In some embodiments, a ribonucleotide as described herein comprises at least about 1, at least about 2, atleast about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 nucleotides between a 3 '-most nucleotide of a second hybridization region and a 3 '-most nucleotide of a polyribonucleotide.
[0120] In some embodiments, a polyribonucleotide as described herein comprises one or more polyadenylate (poly(A)) sequences. In some embodiments, a polyribonucleotide comprises a 5’ poly(A) sequence. In some embodiments, a polyribonucleotide comprises a 5’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises a 3’ poly(A) sequence. In some embodiments, a polyribonucleotide comprises a 3’ poly(A) overhang.
[0121] In some embodiments, a 5’ poly(A) overhang is about 1-10 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is about 2-8 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is about 2, about 3, about 4, about 5, about 6, about 7, or about 8 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is about 3 nucleotides in length. In some embodiments, a 5’ poly(A) overhang is about 6 nucleotides in length.
[0122] In some embodiments, a 3’ poly(A) overhang is about 1-10 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is about 2-8 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is about 2, about 3, about 4, about 5, about 6, about 7, or about 8 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is about 3 nucleotides in length. In some embodiments, a 3’ poly(A) overhang is about 6 nucleotides in length.
[0123] In some embodiments, a poly(A) overhang is structured. In some embodiments, a poly(A) overhang is structured. In some embodiments, a 3’ poly(A) overhang is structured. In some embodiments, a 3’ poly(A) overhang is unstructured. In some embodiments, a 5’ poly(A) overhang is structured. In some embodiments, a 5’ poly(A) overhang is unstructured.
[0124] In some embodiments, polyribonucleotides as described herein may further comprise a translation initiation site (e.g., a start codon). In some embodiments, polyribonucleotides as described herein may further comprise a translation termination site (e g., a stop codon). In some embodiments, polyribonucleotides as described herein may comprise a Kozak sequence. In some embodiments, polyribonucleotides as described herein may comprise an internal ribosome entry site (IRES). In some embodiments, polyribonucleotides as described herein may further comprise a UTR (e.g., a 5’ UTR, a 3’ UTR).
[0125] Polyribonucleotides as described herein may further comprise one or more spacers. In some embodiments, a polyribonucleotide as described herein comprises one spacer. In some embodiments, a polyribonucleotide as described herein comprises at least one spacer. In some embodiments, a polyribonucleotide as described herein comprises at least two spacers.
[0126] In some embodiments, a spacer as described herein is between about 1-100 nucleotides in length. In some embodiments, a spacer as described herein is between about 10-100, about 10- 90, about 10-80, about 10-70, about 10-60, or about 10-50 nucleotides in length. In some embodiments, a spacer as described herein is between about 1-50 nucleotides in length. In some embodiments, a spacer as described herein is between about 10-50 nucleotides in length.
[0127] Spacers as disclosed herein may be located in one or more regions of a polyribonucleotide as described herein. In some embodiments, a spacer may be located between a hybridization region and a translation initiation site. In some embodiments, a spacer may be located between a hybridization region and an IRES. In some embodiments, a spacer may be located between a first hybridization region and a translation initiation site. In some embodiments, a spacer may be located between a first hybridization region and an IRES. In some embodiments, a spacer may be located between a 3’ untranslated region (UTR) and a 5’ UTR of a polyribonucleotide as described herein.
[0128] Among other things, a polyribonucleotide as described herein may further comprise an internal ribosomal entry site (IRES). In some embodiments, an IRES is a viral IRES. In some embodiments, an IRES is a cellular IRES. In some embodiments, an IRES is a mammalian IRES. In some embodiments, an IRES is a naturally occurring IRES. In some embodiments, an IRES is a synthetic (e.g., engineered) IRES. For example, in some embodiments an IRES is an iHRV IRES.
[0129] Polyribonucleotides as disclosed herein may, for example, further comprise a payload sequence. In some embodiments, a payload sequence may encode a polypeptide. In some embodiments, a payload sequence does not encode a polypeptide.
[0130] In some embodiments, a payload sequence is an DNA sequence. In some embodiments, a payload sequence is an RNA sequence. In some embodiments, a payload sequence is an RNA oligonucleotide, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof. In some embodiments, a payload sequence comprises one or more of an RNA oligonucleotide, a messenger RNA (mRNA), aninhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof. In some embodiments, a payload sequence comprises two or more of an RNA oligonucleotide, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof.
[0131] In some embodiments, polyribonucleotides as described herein may further comprise specific codons. In some embodiments, polyribonucleotides as described herein may further comprise a start codon. In some embodiments, polyribonucleotides as described herein may further comprise a stop codon.
[0132] In some embodiments, a polyribonucleotide as described herein comprises sequences in a specific order. For example, in some embodiments, a polyribonucleotide comprises in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, an IRES, a payload sequence, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, an IRES, a payload sequence, 3’UTR, a spacer, a 5’UTR, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises in 5’ to 3’ order (when present): a 5’ poly(A) overhang, a first hybridization region, a first spacer, an IRES, a Kozak sequence, a payload sequence, a stop codon, a 3’UTR, a second spacer, a 5’UTR, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, a first spacer, an IRES, a payload sequence, a 3’UTR, a second spacer, a 5’UTR, a second hybridization region, and a 3’ poly(A) overhang. In some embodiments, a polyribonucleotide comprises in 5’ to 3’ order a 5’ poly(A) overhang, a first hybridization region, a payload sequence, a second hybridization region, and a 3’ poly(A) overhang.
[0133] Polyribonucleotides as described herein are of a specific length. In some embodiments, a polyribonucleotide is about 50-100,000 nucleotides in length. In some embodiments, a polyribonucleotide is about 500-100,000 nucleotides in length. In some embodiments, a polyribonucleotide is about 5000-100,000 nucleotides in length. In some embodiments, a polyribonucleotide is about 50,000-100,000 nucleotides in length.
[0134] Polyribonucleotides as described herein may comprises different nucleotides. For example, in some embodiments, a polyribonucleotide comprises naturally occurring nucleotides. In some embodiments, a polyribonucleotide comprises synthetic (e.g., engineered) nucleotides.In some embodiments, a polyribonucleotide comprises one or more modified nucleotides. In some embodiments, a polyribonucleotide comprises one or more chemically modified nucleotides.
[0135] In some embodiments, a polyribonucleotide comprises at least about 5% modified nucleotides. In some embodiments, a polyribonucleotide comprises at most about 100% modified nucleotides. In some embodiments, a polyribonucleotide comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified nucleotides.
[0136] In some embodiments, a polyribonucleotide comprises modified cytidine residues. In some embodiments, a polyribonucleotide comprises N4-acetylcytidine. In some embodiments, a polyribonucleotide comprises at least about 5% modified cytidine residues. In some embodiments, a polyribonucleotide comprises at most about 100% modified cytidine residues. In some embodiments, a polyribonucleotide comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified cytidine residues.
[0137] In some embodiments, a polyribonucleotide comprises modified uridine residues. In some embodiments, a polyribonucleotide comprises 5-hydroxymethyluridin. In some embodiments, a polyribonucleotide comprises at least about 5% modified uridine residues. In some embodiments, a polyribonucleotide comprises at most about 100% modified uridine residues. In some embodiments, a polyribonucleotide comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified uridine residues.
[0138] In some embodiments, a polyribonucleotide comprises modified ribose residues. In some embodiments, a polyribonucleotide comprises 2’-0 ribose (e.g., 2’-O-acetylated). In some embodiments, a polyribonucleotide comprises at least about 5% modified ribose residues. In some embodiments, a polyribonucleotide comprises at most about 100% modified ribose residues. In some embodiments, a polyribonucleotide comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified ribose residues.IL Circular RNA (circRNA)
[0139] Among other things, the present disclosure provides polynucleotides (e.g., polyribonucleotides (e.g., circRNA)). In some embodiments, a polynucleotide (e.g., DNA) as described herein undergoes transcription to form a polyribonucleotide (e.g., a linear polyribonucleotide). In some embodiments, a polyribonucleotide circularizes to form a circRNA. In some embodiments, circularization is spontaneous. In some embodiments, circularization is not spontaneous.
[0140] In some embodiments, a circRNA is or comprises one or more elements of a polynucleotide as described herein. In some embodiments, a circRNA is or comprises every element of a polynucleotide as described herein. In some embodiments, a circRNA is or comprises one or more elements of a polyribonucleotide as described herein. In some embodiments, a circRNA is or comprises every element of a polyribonucleotide as described herein.
[0141] In some embodiments, a circRNA comprises one or more hybridization regions. In some embodiments, a circRNA comprises a first hybridization region. In some embodiments, a circRNA comprises a second hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is or comprises a complement of a ribonucleotide sequence of a first hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is or comprises a reverse complement of a ribonucleotide sequenceof a first hybridization region. In some embodiments, a ribonucleotide sequence of a second hybridization region is or comprises a ribonucleotide sequence of a first hybridization region.
[0142] In some embodiments, a first hybridization region is about 5 to about 100 nucleotides in length. In some embodiments, a first hybridization region is about 10 to about 50 nucleotides in length. In some embodiments, a first hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a first hybridization region is about 15 to about 45 nucleotides in length. In some embodiments, a first hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a first hybridization region is about 25 to about 35 nucleotides in length. In some embodiments, a first hybridization region is at least about 10 nucleotides in length. In some embodiments, a first hybridization region is at most about 100 nucleotides in length. In some embodiments, a first hybridization region is at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 nucleotides in length. In some embodiments, a first hybridization region is at most about 100, at most about 95, at most about 90, at most about 85, at most about 80, at most about 75, at most about 70, at most about 65, at most about 60, at most about 55, or at most about 50 nucleotides in length.
[0143] In some embodiments, a ribonucleotide sequence of a hybridization region may contain sequence identity (also referred to as similarity) to a sequence as described herein. For example, in some embodiments, a ribonucleotide sequence of a hybridization region (e.g., a first hybridization region, a second hybridization region) is at least about 50%, at least 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence as described herein.
[0144] In some embodiments, a ribonucleotide sequence of a first hybridization region is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a TTAGCCGACGCGGCGAGCCCGCCTCGCGCG (SEQ ID NO.: 14). In some embodiments, a first hybridization region is or comprises a ribonucleotide sequence of SEQ ID NO.: 14. In someembodiments, a first hybridization region is or comprises a ribonucleotide sequence that is at least about 90% identical to SEQ ID NO.: 14.
[0145] In some embodiments, a ribonucleotide sequence of a first hybridization region may comprise a specific GC content. For example, in some embodiments, a first hybridization region may comprise a GC content of at least about 50%. In some embodiments, a first hybridization region may comprise a GC content of at most about 100%. In some embodiments, a first hybridization region may comprise a GC content of at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
[0146] In some embodiments, a second hybridization region is about 5 to about 100 nucleotides in length. In some embodiments, a second hybridization region is about 10 to about 50 nucleotides in length. In some embodiments, a second hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a second hybridization region is about 15 to about 45 nucleotides in length. In some embodiments, a second hybridization region is about 20 to about 40 nucleotides in length. In some embodiments, a second hybridization region is about 25 to about 35 nucleotides in length. In some embodiments, a second hybridization region is at least about 10 nucleotides in length. In some embodiments, a second hybridization region is at most about 100 nucleotides in length. In some embodiments, a second hybridization region is at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 nucleotides in length. In some embodiments, a second hybridization region is at most about 100, at most about 95, at most about 90, at most about 85, at most about 80, at most about 75, at most about 70, at most about 65, at most about 60, at most about 55, or at most about 50 nucleotides in length.
[0147] In some embodiments, a ribonucleotide sequence of a second hybridization region is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a CGCGCGAGGCGGGCTCGCCGCGTCGGCTAA (SEQ ID NO.: 15). In some embodiments, a second hybridization region is or comprises a ribonucleotide sequence of SEQ ID NO.: 15. Insome embodiments, a second hybridization region is or comprises a ribonucleotide sequence that is at least about 90% identical to SEQ ID NO.: 15.
[0148] In some embodiments, a ribonucleotide sequence of a second hybridization region may comprise a specific GC content. For example, in some embodiments, a second hybridization region may comprise a GC content of at least about 50%. In some embodiments, a second hybridization region may comprise a GC content of at most about 100%. In some embodiments, a second hybridization region may comprise a GC content of at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
[0149] In some embodiments, a circRNA as described herein comprises one or more polyadenylate (poly(A)) sequences. In some embodiments, a circRNA comprises a poly(A) sequence. In some embodiments, a poly(A) sequence of a circRNA as described herein is formed by ligation of a 5’ poly(A) overhang and 3’ poly(A) overhang of a polyribonucleotide as described herein.
[0150] In some embodiments, a 5’ poly(A) sequence is about 1-20 nucleotides in length. In some embodiments, a poly(A) sequence is about 2-16 nucleotides in length. In some embodiments, a poly(A) sequence is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In some embodiments, a poly(A) sequence is about 3 nucleotides in length. In some embodiments, a poly(A) sequence is about 6 nucleotides in length. In some embodiments, a poly(A) sequence is about 9 nucleotides in length. In some embodiments, a poly(A) sequence is about 12 nucleotides in length.
[0151] In some embodiments, a circRNA as described herein may further comprise a translation initiation site (e.g., a start codon). In some embodiments, polyribonucleotides as described herein may further comprise a translation termination site (e.g., a stop codon). In some embodiments, a circRNA as described herein may comprise a Kozak sequence. In some embodiments, a circRNA as described herein may comprise an internal ribosome entry site (IRES). In some embodiments, a circRNA as described herein may further comprise a UTR (e.g., a 5’ UTR, a 3’ UTR).
[0152] CircRNAs as described herein may further comprise one or more spacers. In some embodiments, a circRNA as described herein comprises one spacer. In some embodiments, acircRNA as described herein comprises at least one spacer. In some embodiments, a circRNA as described herein comprises at least two spacers.
[0153] In some embodiments, a spacer as described herein is between about 1-100 nucleotides in length. In some embodiments, a spacer as described herein is between about 10-100, about 10- 90, about 10-80, about 10-70, about 10-60, or about 10-50 nucleotides in length. In some embodiments, a spacer as described herein is between about 1-50 nucleotides in length. In some embodiments, a spacer as described herein is between about 10-50 nucleotides in length.
[0154] Spacers as disclosed herein may be located in one or more regions of a circRNA as described herein. In some embodiments, a spacer may be located between a hybridization region and a translation initiation site. In some embodiments, a spacer may be located between a hybridization region and an IRES. In some embodiments, a spacer may be located between a first hybridization region and a translation initiation site. In some embodiments, a spacer may be located between a first hybridization region and an IRES. In some embodiments, a spacer may be located between a 3’ untranslated region (UTR) and a 5’ UTR of a circRNA as described herein.
[0155] Among other things, a circRNA as described herein may further comprise an internal ribosomal entry site (IRES). In some embodiments, an IRES is a viral IRES. In some embodiments, an IRES is a cellular IRES. In some embodiments, an IRES is a mammalian IRES. In some embodiments, an IRES is a naturally occurring IRES. In some embodiments, an IRES is a synthetic (e.g., engineered) IRES. For example, in some embodiments an IRES is an iHRV IRES.
[0156] CircRNAs as disclosed herein may, for example, further comprises a payload sequence. In some embodiments, a payload sequence may encode a polypeptide. In some embodiments, a payload sequence does not encode a polypeptide.
[0157] In some embodiments, a payload sequence is an DNA sequence. In some embodiments, a payload sequence is an RNA sequence. In some embodiments, a payload sequence is an RNA oligonucleotide, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof. In some embodiments, a payload sequence comprises one or more of an RNA oligonucleotide, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof. In some embodiments, a payload sequence comprises two or more of an RNAoligonucleotide, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof.
[0158] In some embodiments, a circRNA as described herein may further comprise specific codons. In some embodiments, a circRNA as described herein may further comprise a start codon. In some embodiments, a circRNA as described herein may further comprise a stop codon.
[0159] In some embodiments, a circRNA as described herein comprises sequences in a specific order. For example, in some embodiments, a circRNA comprises (e.g., in sequential order) a poly(A) sequence, a first hybridization region, an IRES, a payload sequence, and a second hybridization region. In some embodiments, a circRNA comprises (e.g., in sequential order) a poly(A) sequence, a first hybridization region, an IRES, a payload sequence, 3’UTR, a spacer, a 5’UTR, and a second hybridization region. In some embodiments, a circRNA comprises (e.g., in sequential order) a poly(A) sequence, a first hybridization region, a first spacer, an IRES, a Kozak sequence, a payload sequence, a stop codon, a 3’UTR, a second spacer, a 5’UTR, and a second hybridization region. In some embodiments, a circRNA comprises (e.g., in sequential order) a poly(A) sequence, a first hybridization region, a first spacer, an IRES, a payload sequence, a 3’UTR, a second spacer, a 5’UTR, and a second hybridization region. In some embodiments, a circRNA comprises (e.g., in sequential order) a poly(A) sequence, a first hybridization region, a payload sequence, and a second hybridization region.
[0160] CircRNAs as described herein are of a specific length. In some embodiments, a circRNA is about 50-100,000 nucleotides in length. In some embodiments, a circRNA is about 500- 100,000 nucleotides in length. In some embodiments, a circRNA is about 5000-100,000 nucleotides in length. In some embodiments, a circRNA is about 50,000-100,000 nucleotides in length.
[0161] CircRNAs as described herein may comprise different nucleotides. For example, in some embodiments, a circRNA comprises naturally occurring nucleotides. In some embodiments, a circRNA comprises synthetic (e.g., engineered) nucleotides. In some embodiments, a circRNA comprises one or more modified nucleotides. In some embodiments, a circRNA comprises one or more chemically modified nucleotides.
[0162] In some embodiments, a circRNA comprises at least about 5% modified nucleotides. In some embodiments, a circRNA comprises at most about 100% modified nucleotides. In some embodiments, a circRNA comprises at least about 5%, at least about 10%, at least about 15%, atleast about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified nucleotides.
[0163] In some embodiments, a circRNA comprises modified cytidine residues. In some embodiments, a circRNA comprises N4-acetylcytidine. In some embodiments, a circRNA comprises at least about 5% modified cytidine residues. In some embodiments, a circRNA comprises at most about 100% modified cytidine residues. In some embodiments, a circRNA comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified cytidine residues.
[0164] In some embodiments, a circRNA comprises modified uridine residues. In some embodiments, a circRNA comprises 5-hydroxymethyluridin. In some embodiments, a circRNA comprises at least about 5% modified uridine residues. In some embodiments, a circRNA comprises at most about 100% modified uridine residues. In some embodiments, a circRNA comprises at least at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified uridine residues.
[0165] In some embodiments, a circRNA comprises modified ribose residues. In some embodiments, a circRNA comprises 2’-0 ribose (e.g., 2’-O-acetylated). In some embodiments, a circRNA comprises at least about 5% modified ribose residues. In some embodiments, a circRNA comprises at most about 100% modified ribose residues. In some embodiments, a circRNA comprises at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% modified ribose residues.III. Additional RNA FeaturesA. Modified Ribonucleotides
[0166] In some embodiments, a polyribonucleotide (e.g., circRNA) as described herein comprises one or more modified ribonucleotides. In some embodiments, a polyribonucleotide (e.g., circRNA) comprises a modified nucleobase, a modified ribose, a modified backbone, or any combination thereof.
[0167] In some embodiments, a polyribonucleotide (e.g., circRNA) comprises a modified nucleobase.
[0168] In some embodiments, a polyribonucleotide (e.g., circRNA) disclosed herein comprises one or more modified ribonucleotides comprising: N4-acetylcytidine (ac4C), 5- hydroxymethyluridine (5hmu), N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza- uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methyl wyosine (mimG), 5- hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5-methoxycytidine, 5- propynylcytidine, 2-thiocytidine, 5 -hydroxyuridine, 5-methyluridine, 5,6-dihydro-5- methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'- amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5 -carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5- propynyluridine, 5 -bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl- pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl -methylpseudouridine, Nl- ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2- aminoadenosine, 3 -methyladenosine, 7-deazaadenosine, 8-oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-O-methylguanine, or any combination thereof.
[0169] In some embodiments, one or more modified ribonucleotides comprises a nucleoside comprising an acetyl group, wherein the nucleoside is N4-acetylcytidine and the modified ribonucleotide has a structure of:wherein R is a 5’ monophosphate, a 5’ diphosphate, or a 5’ triphosphate.
[0170] In some embodiments, one or more modified ribonucleotides comprises a nucleoside comprising an acetyl group, wherein the nucleoside is N4-acetylcytidine and the modified ribonucleotide has a structure of:
[0171] In some embodiments, a polyribonucleotide (e.g., circRNA) comprises cytidine residues. In some embodiments, at least 5% of cytidine residues in the polyribonucleotide (e.g., circRNA) comprise N4-acetylcytidine. In some embodiments, less than 100% of cytidine residues in the polyribonucleotide (e.g., circRNA) comprise N4-acetylcytidine. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of cytidine residues in the polyribonucleotide (e.g., circRNA) comprise N4- acetylcytidine. In some embodiments, 100% of cytidine residues in the polyribonucleotide (e.g., circRNA) comprise N4-acetylcytidine.
[0172] In some embodiments, a polyribonucleotide (e.g., circRNA) disclosed herein comprises cytidine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65 %, about 5% to 60%, about 5% to 55%, about 5% to 50 %, about 5% to 45 %, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25 %, about 5% to 20%, about 5% to 15 %, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of cytidine residues in a polyribonucleotide (e.g., circRNA) comprises N4-acetylcytidine.
[0173] In some embodiments, one or more modified ribonucleotides comprises a nucleoside comprising a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine and has a structure ofwherein R is a 5’ monophosphate, a 5’ diphosphate, or a 5’ triphosphate.
[0174] In some embodiments, one or more modified ribonucleotides comprises a nucleoside comprising a hydroxymethyl group, wherein the nucleoside is 5-hydroxymethyluridine and has a structure of
[0175] In some embodiments, the polyribonucleotide (e.g., circRNA) comprises uridine residues. In some embodiments, at least 5% of uridine residues in the polyribonucleotide (e.g., circRNA) comprise 5-hydroxymethyluridine. In some embodiments, less than 100% of uridine residues in the polyribonucleotide (e.g., circRNA) comprise 5-hydroxymethyluridine. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of uridine residues in the polyribonucleotide (e.g., circRNA) comprise 5-hydroxymethyluridine. In some embodiments, more than 60% of uridine residues in the polyribonucleotide (e.g., circRNA) comprise 5-hydroxymethyluridine. In some embodiments, 100% of uridine residues in the polyribonucleotide (e.g., circRNA) comprise 5- hydroxymethyluridine.
[0176] In some embodiments, a polyribonucleotide (e.g., circRNA) disclosed herein comprises uridine residues. In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65 %, about 5% to 60%, about 5% to 55%, about 5% to 50 %, about 5% to 45 %, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25 %, about 5% to 20%, about 5% to 15 %, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of uridine residues in a polyribonucleotide (e.g., circRNA) comprises 5-hydroxymethyluridine.
[0177] In some embodiments, a polyribonucleotide (e.g., circRNA) comprises one or more modified ribonucleotides. In some embodiments, a polyribonucleotide (e.g., circRNA) comprises a modified ribose.
[0178] In some embodiments, one or more modified ribonucleotides comprises a nucleoside comprising a ribose moiety comprising an acetyl group, wherein the ribose is 2’-O-acetylated and the modified ribonucleotide has a structure of:(a) wherein X is a 5’ monophosphate, a 5’ diphosphate, or a 5’ triphosphate; and(b) wherein R is a nucleobase chosen from: adenine or a modified version thereof, a guanine or a modified version thereof, a cytosine or a modified version thereof, or a uracil or a modified version thereof.
[0179] In some embodiments, the nucleobase is adenine, and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0180] In some embodiments, the nucleobase is guanine, and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0181] In some embodiments, the nucleobase is cytosine, and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0182] In some embodiments, the nucleobase is N4-acetylcytidine, and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0183] In some embodiments, the nucleobase is uracil, and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0184] In some embodiments, the nucleobase is 5-hydroxymethyluridine and the modified ribonucleotide has a 5’ triphosphate and a structure of
[0185] In some embodiments, the nucleobase is N1 -methylpseudouridine and the modified ribonucleotide has a 5’ triphosphate and a structure of:
[0186] In some embodiments, at least 5% of the ribose moi eties are acetylated (2’-0-aceylated).
[0187] In some embodiments, about 5% to about 99% of the ribose moieties are acetylated (2’- O-aceylated). In some embodiments, at least 5% of the ribose moieties are acetylated (2’-O- aceylated). In some embodiments, less than 100% of the ribose moieties are acetylated (2’-O- aceylated). In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the ribose moieties are acetylated (2’-O-aceylated).
[0188] In some embodiments, about 5% to 99%, about 5% to 95%, about 5% to 90%, about 5% to 85%, about 5% to 80%, about 5% to 75%, about 5% to 70%, about 5% to 65 %, about 5% to 60%, about 5% to 55%, about 5% to 50 %, about 5% to 45 %, about 5% to 40%, about 5% to 35%, about 5% to 30%, about 5% to 25 %, about 5% to 20%, about 5% to 15 %, about 5% to 10%, about 10% to 99%, about 15% to 99%, about 20% to 99%, about 25% to 99%, about 30% to 99%, about 35% to 99%, about 40% to 99%, about 45% to 99%, about 50% to 99%, about 55% to 99%, about 60% to 99%, about 65% to 99%, about 70% to 99%, about 80% to 99%, about 85% to 99%, about 90% to 99%, or about 95% to 99% of the ribose moieties are acetylated (2’-O-aceylated).
[0189] In some embodiments, a polyribonucleotide (e.g., circRNA) disclosed herein further comprises one or more ribonucleotides that does not comprise a 2’-0 acetylated ribose.B, Payloads
[0190] The present disclosure provides systems, compositions, and methods useful for the delivery of nucleic acids (e.g., polyribonucleotides, e.g., circRNA) that include a payload sequence. A payload sequence is generally a sequence of interest e.g., comprising a sequence that encodes a target payload, such as a target peptide or polypeptide) that is desired to be introduced into a cell, tissue, organ, organism, and / or system comprising cells.
[0191] In some embodiments, a payload sequence comprises a sequence that encodes a single target peptide or polypeptide. For example, in some embodiments, a payload sequence encodes a target polypeptide (e.g, an enzyme, cytokine, antibody, receptor, et ). In some embodiments, a payload sequence comprises a sequence that encodes a plurality of (e.g., at least 2, at least 3, at least 4, at least 5, or above) target peptides or polypeptides. In some embodiments, a payload sequence comprises a sequence that encodes a fusion polypeptide and / or a chimeric polypeptide, e.g., a payload sequence encoding at least a portion of two or more peptides or polypeptides (e.g., a chimeric receptor). In some embodiments, a payload sequence comprises a sequence that encodes two or more polypeptides in the same oligonucleotide (e.g., two or more polypeptides are that controlled by the same or different regulatory elements).
[0192] In some embodiments, a payload sequence comprises a synthetic nucleic acid.
[0193] In some embodiments, a polyribonucleotide comprising a payload sequence is a singlestranded RNA (ssRNA) oligonucleotide. In some embodiments, a polyribonucleotide comprising a payload sequence is a double-stranded RNA (dsRNA) oligonucleotide. In some embodiments, a polyribonucleotide comprising a payload sequence is a circularized RNA (circRNA) oligonucleotide
[0194] In some embodiments, a polyribonucleotide comprising a payload sequence is a viral RNA oligonucleotide. In some embodiments, a polyribonucleotide comprising a payload sequence is a non-viral RNA oligonucleotide.
[0195] In some embodiments, a polyribonucleotide comprising a payload sequence is a synthetic RNAs. Synthetic RNAs can be produced by any methods known in the art. For example, in some embodiments synthetic RNAs can be produced, e.g., by in vitro transcription of a DNA template.
[0196] In some embodiments, a polyribonucleotide comprises a target payload-encoding open reading frame (ORF).
[0197] In some embodiments, a polyribonucleotide comprising a payload sequence further comprise an additional element, including, but not limited to, spacers, binding motifs, etc.
[0198] In some embodiments, a polyribonucleotide comprising a payload sequence comprises one or more of: a target-encoding region, a gene regulatory element, and a transcription terminator. Non-limiting examples of gene regulatory elements include promoters, transcriptional activators, enhancers, and polyadenylation signals. In some embodiments, a payload sequence comprises a target-encoding region, a gene regulatory element, and a transcription terminator, positioned relative to each other such that the target- encoding region is between the gene regulatory element and the transcription terminator.
[0199] In some embodiments, a target-encoding region encodes a gene product. In some embodiments, such a gene product is an RNA. In some embodiments, a target-encoding region encodes a polypeptide (such as a protein, such as a glycoprotein). In some embodiments, a target-encoding region encodes a fusion polypeptide and / or a chimeric polypeptide. In some embodiments, a target-encoding region encodes one gene product. In some embodiments, a target-encoding region encodes more than one gene product (e.g, 2, 3, 4, 5, 6, 7 or more gene products). In some embodiments, a target-encoding region encodes a regulatory RNA (e.g, a siRNA, microRNA, etc.).
[0200] In some embodiments, a payload sequence encodes a gene product. In some embodiments, a payload sequence encodes a polypeptide (such as a protein, such as a glycoprotein). In some embodiments, a payload sequence encodes a fusion polypeptide and / or a chimeric polypeptide. In some embodiments, a payload sequence encodes one gene product. In some embodiments, a payload sequence encodes more than one gene product (e.g., 2, 3, 4, 5, 6, 7 or more gene products). In some embodiments, a payload sequence encodes a regulatory RNA (e.g., a siRNA, microRNA, etc.).
[0201] In some embodiments, a payload sequence comprises one or more aptamer- or polypeptide-binding domains (e.g., transcription factor binding domains).
[0202] A payload sequence can be of any length, for example, between 2 and 100,000,000 nucleotides in length (or any integer value therebetween). In some embodiments, a payload sequence comprises at least 20 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 350 nucleotides, at least 400 nucleotides, at least 450nucleotides, at least 500 nucleotides, at least 550 nucleotides, at least 600 nucleotides, at least 650 nucleotides, at least 700 nucleotides, at least 750 nucleotides, at least 800 nucleotides, at least 850 nucleotides, at least 900 nucleotides, at least 950 nucleotides, at least 1000 nucleotides, at least 1100 nucleotides, at least 1200 nucleotides, at least 1300 nucleotides, at least 1400 nucleotides, at least 1500 nucleotides, at least 1600 nucleotides, at least 1700 nucleotides, at least 1800 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 3000 nucleotides, at least 4000 nucleotides, at least 5000 nucleotides, at least 6000 nucleotides, at least 7000 nucleotides, at least 8000 nucleotides, at least 9000 nucleotides, at least 10,000 nucleotides, at least 11,000 nucleotides, at least 12,000 nucleotides, at least 13,000 nucleotides, at least 14,000 nucleotides, at least 15,000 nucleotides, at least 16,000 nucleotides, at least 17,000 nucleotides, at least 18,000 nucleotides, at least 19,000 nucleotides, at least 20,000 nucleotides, at least 21,000 nucleotides, at least 22,000 nucleotides, at least 23,000 nucleotides, at least 24,000 nucleotides, or at least 25,000 nucleotides.
[0203] In some embodiments, an oligonucleotide comprising a payload sequence is between 50 and 25,000 nucleotides in length, between 100 and 20,000 nucleotides in length, between 500 and 10,000 nucleotides in length, between 1,000 and 8,000 nucleotides in length, and / or between 2,000 and 5,000 nucleotides in length.V. Methods of Making circRNA
[0204] Among other things, the present disclosure provides methods of making circRNA. In some embodiments, a method of making a circRNA comprises a step of transcribing a polyribonucleotide. For example, in some embodiments, a polyribonucleotide as described herein is transcribed from a polynucleotide (e.g., DNA) template as described herein. In some embodiments, a polyribonucleotide is transcribed from a double-stranded DNA (dsDNA) template. In some embodiments, a dsDNA template may be linear. In some embodiments, a dsDNA template may be circular.
[0205] Transcription of a polyribonucleotide from a template polynucleotide may be performed using a polymerase. In some embodiments, a polymerase is an RNA polymerase. In some embodiments, a polymerase is a DNA dependent RNA-polymerase. In some embodiments, a polymerase is an RNA dependent RNA-polymerase. In some embodiments, an RNA polymerase is RNA polymerase I, RNA polymerase II, RNA polymerase III, T7 RNA polymerase,POLRMT, Primase, PrimPol, or a combination thereof. In some embodiments, an RNA polymerase is T7 RNA polymerase.
[0206] In some embodiments, a method of making a circRNA comprises a step of structure formation of a polyribonucleotide. Typically, structure formation will occur spontaneously. For example, in some embodiments, a polyribonucleotide transcribed from a template polynucleotide as described herein comprises homology regions that may form a structure (e.g., spontaneously). In some embodiments, a structure may be formed spontaneously by hydrogen bonds. For example, in some embodiments, a transcribed polyribonucleotide comprises a first hybridization region and a second hybridization region. In some embodiments, a first hybridization region and a second hybridization region may hybridize to form a U-shape structure (e.g., spontaneously). In some embodiments, a first hybridization region and a second hybridization region may hybridize to form a hair-pin structure (e.g., spontaneously).
[0207] In some embodiments, a method of making a circRNA comprises a step of dephosphorylation. For example, in some embodiments, a 5 ’-most nucleotide of a polyribonucleotide comprises a 5' triphosphate. In some embodiments, a method provided herein comprises dephosphorylating the 5' triphosphate to produce a 5' monophosphate. In some embodiments, a method provided herein comprises dephosphorylating the 5' triphosphate to produce a 5' diphosphate. In some embodiments, a method provided herein comprises dephosphorylating the 5' diphosphate to produce a 5' monophosphate.
[0208] Dephosphorylation of a polyribonucleotide may be performed using a pyrophosphohydrolase. In some embodiments, a pyrophosphohydrolase is an RNA pyrophosphohydrolase. In some embodiments, a pyrophosphohydrolase is an RNA 5’ pyrophosphohydrolase.
[0209] In some embodiments, a method as provided herein uses a specific amount of pyrophosphohydrolase. For example, in some embodiments, about 1 to about 30 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) is used. In some embodiments, about 1 to about 20 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) is used. In some embodiments, about 5 to about 10 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) is used. In some embodiments, about 10 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) is used. In some embodiments, about 5 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) is used. In some embodiments,about 1 to about 30 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) per pg of one or more polyribonucleotides is used. In some embodiments, about 1 to about 20 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) per pg of one or more polyribonucleotides is used. In some embodiments, about 5 to about 10 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) per pg of one or more polyribonucleotides is used. In some embodiments, about 10 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) per pg of one or more polyribonucleotides is used. In some embodiments, about 5 unit(s) of pyrophosphohydrolase (e.g., 5’ pyrophosphohydrolase) per pg of one or more polyribonucleotides is used.
[0210] In some embodiments, a method of making a circRNA comprises a step of ligation (e.g., to form a circRNA). For example, in some embodiments, a method provided herein comprises ligating a 5 '-most nucleotide with a 3 '-most nucleotide of a polyribonucleotide as described herein. In some embodiments, a method provided herein comprises ligating a 5' monophosphate of a 5 '-most nucleotide with a 3' hydroxyl of a 3 '-most nucleotide of a polyribonucleotide as described herein.
[0211] Ligation of a polyribonucleotide may be performed using a ligase. In some embodiments, a ligase is a DNA ligase. In some embodiments, a ligase is an RNA ligase. In some embodiments, a ligase is a T4 RNA ligase. In some embodiments, a ligase is a T4 RNA ligase I. In some embodiments, a ligase is a T7 RNA ligase. In some embodiments, a ligase is a circLigase. In some embodiments, a ligase is a double-stranded circLigase. In some embodiments, a ligase is a single-stranded circLigase. In some embodiments, a ligase is a ssDNA (single-stranded DNA) circLigase.
[0212] In some embodiments, a method as provided herein uses a specific amount of ligase. For example, in some embodiments, about 1 to about 16 unit(s) of ligase (e.g., RNA ligase) is used. In some embodiments, about 1 to about 8 unit(s) of ligase (e.g., RNA ligase) is used. In some embodiments, about 3 to about 6 unit(s) of ligase (e.g., RNA ligase) is used. In some embodiments, about 6 unit(s) of ligase (e.g., RNA ligase) is used. In some embodiments, about 3 unit(s) of ligase (e.g., RNA ligase) is used. In some embodiments, about 1 to about 16 unit(s) of ligase (e.g., RNA ligase) per pg of one or more polyribonucleotides is used. In some embodiments, about 1 to about 8 unit(s) of ligase (e.g., RNA ligase) per pg of one or more polyribonucleotides is used. In some embodiments, about 3 to about 6 unit(s) of ligase (e.g.,RNA ligase) per pg of one or more polyribonucleotides is used. In some embodiments, about 6 unit(s) of ligase (e.g., RNA ligase) per pg of one or more polyribonucleotides is used. In some embodiments, about 3 unit(s) of ligase (e.g., RNA ligase) per pg of one or more polyribonucleotides is used.
[0213] In some embodiments, a composition as described herein further comprises an osmolyte. In some embodiments a method as provided herein uses an osmolyte. In some embodiments, an osmolyte is or comprises an amino acid-based osmolyte, a methylamine osmolyte, a carbohydrate osmolyte, or a combination thereof. In some embodiments, a methylamine osmolyte, is or comprises glycerophosphorylcholine, trimethylamine N-oxide, or a combination thereof. In some embodiments, a carbohydrate osmolyte is or comprises sorbitol, glycerol, myonisitol, diglycerol phosphate, or a combination thereof. In some embodiments, an amino acid-based osmolyte is or comprises a proline-based osmolyte, a glycine-based osmolyte, an ectoine-based osmolyte, an alanine-based osmolyte, or a combination thereof. In some embodiments, an alanine-based osmolyte is or comprises beta-alanine. In some embodiments, an amino acid-based osmolyte is or comprises a glycine-based osmolyte. In some embodiments, a glycine-based osmolyte is or comprises betaine.
[0214] Among other things, the present disclosure provides methods of making circRNA from a polynucleotide. In some embodiments, a method as provided herein is a one-pot method (e.g., all steps are performed in one vial / pot). In some embodiments, a method as provided herein is not a one-pot method. For example, in some embodiments, a method as provided herein is a two-pot method.
[0215] In some embodiments, all steps of a method of making circRNA as provided herein (e.g., transcription, structure formation (e.g., spontaneously), dephosphorylation, ligation and / or digestion) are performed in one pot. In some embodiments, two or more steps of a method of making circRNA as provided herein are performed in one pot. For example, in some embodiments, steps of dephosphorylation and ligation may be performed in one pot.
[0216] In some embodiments, all steps of a method of making circRNA as provided herein (e.g., transcription, structure formation (e.g., spontaneously), dephosphorylation, ligation, and / or ligation) are performed concurrently (e.g., in parallel, simultaneously). In some embodiments, two or more steps of a method of making circRNA as provided herein are performedconcurrently. For example, in some embodiments, steps of dephosphorylation and ligation may be performed concurrently.
[0217] In some embodiments, a method of making circRNA as provided herein comprises incubation (e.g., incubating a composition comprising a polyribonucleotide as described herein). In some embodiments, a method of making circRNA comprises incubation (e g., of a composition as described herein) for specified periods of time. For example, in some embodiments, each of the steps (e g., transcription, structure formation (e.g., spontaneously), dephosphorylation, ligation, and / or digestion) of a method as described herein may further comprise a step of incubation (e.g., of a composition as described herein) for specified periods of time. In some embodiments, a method of making circRNA comprises incubation of a composition for about 0.5 hour to about 20 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 0.5 hour to about 18 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 0.5 hour to about 16 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 4 hours to about 16 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 0.5 hour to about 6 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 1 hour to about 3 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for about 1 hour, about 2 hours, about 3 hours, or about 4 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at least about 0.5 hour. In some embodiments, a method of making circRNA comprises incubation of a composition for at least about 1 hour. In some embodiments, a method of making circRNA comprises incubation of a composition for at least about 2 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at least about 3 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at least about 4 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at most about 3 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at most about 6 hours. In some embodiments, a method of making circRNA comprises incubation of a composition for at most about 16 hours.
[0218] In some embodiments, a method of making circRNA as provided herein comprises performing a step of the method provided herein at a specific temperature(s). For example, in some embodiments, a step of a method provided herein may be performed between 1 °C to 70 °C. In some embodiments, a step of a method provided herein may be performed between 1 °C to 60 °C. In some embodiments, a step of a method provided herein may be performed between 1 °C to 50 °C. In some embodiments, a step of a method provided herein may be performed between 10 °C to 60 °C. In some embodiments, a step of a method provided herein may be performed between 10 °C to 40 °C. In some embodiments, a step of a method provided herein may be performed between 20 °C to 50 °C. In some embodiments, a step of a method provided herein may be performed between 30 °C to 50 °C. In some embodiments, a step of a method provided herein may be performed between 20 °C to 30 °C. In some embodiments, a step of a method provided herein may be performed between 50 °C to 60 °C. In some embodiments, a step of a method provided herein may be performed at 25 °C. In some embodiments, a step of a method provided herein may be performed at 37 °C.
[0219] In some embodiments, a method of making circRNA as provided herein comprises a step of digestion. For example, in some embodiments, a method provided herein comprises digestion of a composition (e.g., an incubated composition comprising a polyribonucleotide) as described herein. In some embodiments, a method provided herein comprises digestion of a composition comprising a polyribonucleotide as described herein using an exonuclease.
[0220] Digestion of a polyribonucleotide (e.g., linear polyribonucleotide) may be performed using an exonuclease. In some embodiments, an exonuclease is a DNA exonuclease. In some embodiments, an exonuclease is an RNA exonuclease. In some embodiments, an exonuclease is XRN-1. In some embodiments, an exonuclease is RNase R. In some embodiments, an exonuclease is ExoT.
[0221] In some embodiments, efficiency of circularization depends on incubation time. For example, in some embodiments, at least about 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated for a specified period of time, as describedherein. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated for about 1 hour to about 3 hours. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated for about 2 hours.
[0222] In some embodiments, efficiency of circularization depends on temperature. For example, in some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated at a specified temperature. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated at about 20 °C to 40 °C. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated at about 37 °C. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated at about 20 °C to 30 °C. In some embodiments, at least about 25%, at least about 50%, at least about 75%, at least about 80%, atleast about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a polyribonucleotide (e.g., linear polyribonucleotide) circularizes when incubated at about 25 °C.
[0223] In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase compared to a polyribonucleotide that does not comprise a hybridization region. For example, in some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a first hybridization region. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a second hybridization region. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase compared to a polyribonucleotide that does not comprise a poly(A) sequence. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a 5’ poly(A) overhang. In some embodiments, a polyribonucleotide as described herein circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise a 3’ poly(A) overhang.
[0224] Efficiency of circularization may be measured using one or more assays. For example, in some embodiments efficiency of circularization is measured using an exonuclease digestion assay, agarose denaturing gels, High-performance liquid chromatography (HPLC), and sequencing (e g., Nanopore, Sanger, next generation sequencing etc.). In some embodiments efficiency of circularization is measured using an exonuclease digestion assay.VI. Compositions
[0225] Among other things, the present disclosure provides compositions. Compositions disclosed herein comprise one or more polyribonucleotides (e.g., circRNAs) described herein.
[0226] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a pharmaceutical composition.
[0227] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is or comprises an immunogenic composition. An immunogenic composition is a composition that induces an immune response. In some embodiments, an immunogenic composition comprising one or more polyribonucleotides does not itself induce an immune response, but rather the one or more polyribonucleotides encode, e.g., one or more polypeptides that induce an immune response.
[0228] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is or comprises a vaccine.
[0229] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a gene therapy.
[0230] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a chemotherapy.
[0231] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a protein replacement therapy.
[0232] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is an immunotherapy.
[0233] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a cell engineering therapy.
[0234] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) comprises double stranded RNA. In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) does not comprise double stranded RNA.
[0235] In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein is characterized in that when assessed in a cell, tissue or an organism administered the polyribonucleotide (e.g., circRNA), reduces immunogenicity is observed relative to an appropriate reference comparator. In some embodiments, a reference comparator comprises an otherwise similar cell, tissue or organism that has been administered a composition comprising a comparable polyribonucleotide that does not include any acetyl groups. In some embodiments, reduced immunogenicity comprises reduced activation of an innate immune response induced toxicity. In some embodiments, reduced activation of an immune responsecomprises reduced activation of NFkb or an NFkb pathway, IRF or an IRF pathway, and / or other inflammatory cytokines in the cell, tissue or organism.
[0236] In some embodiments, reduced immunogenicity allows for repeated dosing, e.g., administration of at least two doses, of a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein to a cell, tissue or subject. In some embodiments, a second or subsequent dose of a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein has a substantially similar efficacy in a cell, tissue or subject compared to a first dose of a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein.
[0237] In some embodiments, reduced immunogenicity allows for administration of a higher dose of a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein related to an appropriate reference comparator. In some embodiments, a reference comparator comprises a comparable polyribonucleotide includes fewer acetyl groups than a polyribonucleotide (e.g., circRNA) in a composition. In some embodiments, a reference comparator comprises a comparable polyribonucleotide (e.g., circRNA) that does not include any modified nucleotides.
[0238] In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNA) disclosed herein is characterized in that when assessed in a cell, tissue or an organism administered the polyribonucleotide (e.g., circRNA), increased cell viability is observed relative to an appropriate reference comparator. In some embodiments, a reference comparator is a cell viability of a cell, tissue or organism that has been administered a comparable polyribonucleotide (e.g., circRNA) that does not include any modified nucleotides.
[0239] In some embodiments, cell viability is a measure of the length of time one or more cells of a cell, tissue or subject live.
[0240] In some embodiments, cell viability is a measure of a number of cells of a cell, tissue or subject alive at one or more time points.
[0241] In some embodiments, a composition disclosed herein is or comprises an in vitro transcribed polyribonucleotide (e.g., circRNA) comprising a modified ribonucleotide.
[0242] In some embodiments, a composition disclosed herein is or comprises an expression vector comprising a polynucleotide (e.g., circRNA) disclosed herein.A, Pharmaceutical Compositions
[0243] In some embodiments, a composition comprising one or more polyribonucleotides (e.g., circRNAs) is a pharmaceutical composition. In some embodiments, a pharmaceuticalcomposition further comprises a pharmaceutically acceptable excipient. Pharmaceutical compositions of the present disclosure may comprise a polypeptide disclosed herein, a polynucleotide disclosed herein, or an expression vector comprising a polynucleotide disclosed herein.
[0244] In some embodiments, a pharmaceutical composition can include a pharmaceutically acceptable carrier or excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions (e.g., NaCl), saline, buffered saline, glycerol, sugars such as mannitol, sucrose, or others, dextrose, fatty acid esters, etc., as well as combinations thereof.
[0245] A pharmaceutical composition can, if desired, be mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and / or aromatic substances and the like), which do not deleteriously react with the active compounds or interfere with their activity. In certain embodiments, a water-soluble carrier suitable for intravenous administration is used. In some embodiments, a pharmaceutical composition can be sterile.
[0246] A suitable pharmaceutical composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. A pharmaceutical composition can be a liquid solution, suspension, or emulsion.
[0247] A pharmaceutical composition can be formulated in accordance with the routine procedures as a pharmaceutical composition adapted for administration to human beings. The formulation of a pharmaceutical composition should suit the mode of administration. For example, in some embodiments, a composition for intravenous administration is typically a solution in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, asa dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachet indicating the quantity of active agent. Where a pharmaceutical composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water, saline or dextrose / water. Where a pharmaceutical composition is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
[0248] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions that are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts or cells in vitro or ex vivo. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals or cells in vitro or ex vivo is well understood, and the ordinarily skilled practitioner, e.g., a veterinary pharmacologist, can design and / or perform such modification with merely ordinary, if any, experimentation.
[0249] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a diluent or another excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, shaping and / or packaging the product into a desired single- or multidose unit.
[0250] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of a pharmaceutical composition described herein.VII. RNA Formulations
[0251] Among other things, provided herein are compositions comprising polyribonucleotides (e.g., circRNAs) and formulations thereof. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) disclosed herein is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) disclosed herein is formulated in a liposome formulation.
[0252] In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein encodes for a polypeptide. In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein is or comprises a messenger RNA. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a messenger RNA is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a messenger RNA is formulated in a liposome formulation.
[0253] In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein comprises a gRNA. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a gRNA is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a gRNA is formulated in a liposome formulation.
[0254] In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein comprises an inhibitory RNA. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising an inhibitory RNA is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising an inhibitory RNA is formulated in a liposome formulation.
[0255] In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein comprises an miRNA or siRNA. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a miRNA or siRNA is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising a miRNA or siRNA is formulated in a liposome formulation.
[0256] In some embodiments, a polyribonucleotide (e.g., circRNAs) disclosed herein comprises an antisense oligonucleotide. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising an antisense oligonucleotide is formulated in a lipid nanoparticle (LNP) formulation. In some embodiments, a composition comprising a polyribonucleotide (e.g., circRNAs) comprising an antisense oligonucleotide is formulated in a liposome formulation.
[0257] In some embodiments, the disclosure provides an LNP formulation comprising a polyribonucleotide disclosed herein for use in a pharmaceutical composition, e.g., an immunogenic composition. In some embodiments, the disclosure provides a liposomeformulation comprising a polyribonucleotide disclosed herein for use in a pharmaceutical composition, e.g., an immunogenic composition.VIII. Methods of Using circRNA
[0258] The disclosure provides, among other things, methods for using a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e g., pharmaceutical composition) comprising the same.
[0259] In some embodiments, provided herein is a method of administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject.
[0260] In some embodiments, provided herein is a vaccination method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject.
[0261] In some embodiments, disclosed herein is a gene therapy method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject. In some embodiments, a gene therapy method comprises delivery of one or more components of a gene therapy, e.g., a guide RNA and / or a Cas polypeptide.
[0262] In some embodiments, provided herein is a method for stimulating an immune response comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject.
[0263] In some embodiments, also provided herein is a cell therapy engineering method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject.
[0264] In some embodiments, provided herein is an immunotherapy method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed hereinto a cell, tissue or subject. In some embodiments, an immunotherapy method comprises delivery of an antibody therapy and / or an immune checkpoint therapy.
[0265] In some embodiments, disclosed herein is a protein replacement therapy method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject. In some embodiments, a protein replacement therapy comprises delivery of an enzyme replacement therapy.
[0266] In some embodiments, provided herein is a chemotherapeutic method comprising administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject.
[0267] In some embodiments, a method or use disclosed herein comprises determining cell viability of a cell, tissue or subject. In some embodiments, cell viability is a measure of a length of time one or more cells of a cell, tissue or subject live. In some embodiments, cell viability is a measure of a number of cells of a cell, tissue or subject alive at one or more time points.
[0268] In some embodiments, a cell, tissue or subject to which a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein has been administered exhibits improved cell viability as compared to a reference cell viability. In some embodiments, a reference cell viability is a cell viability of a cell, tissue or subject that has been administered a comparable polyribonucleotide or a composition comprising the same that does not include any acetyl groups.
[0269] In some embodiments, a method or use disclosed herein further comprises determining an immune system response of a cell, tissue or subject to which a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein has been administered. In some embodiments, an immune response comprises an innate immune system response comprising innate immune system induced toxicity. In some embodiments, determining an innate immune system response comprises determining a level and / or activation of NF-KB or an NF-KB pathway; IRF or an IRF pathway; or inflammatory cytokines, or a combination thereof in a cell, tissue or subject.
[0270] In some embodiments, a cell, tissue or subject to which a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein has been administered exhibits a reduced innate immune system response as compared to a reference. In some embodiments, a reference is an innate immune system response of a cell, tissue or subject that has been administered a comparable polyribonucleotide or a composition comprising the same that does not include any acetyl groups.
[0271] In some embodiments, a method or use disclosed herein further comprises determining efficacy of a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein in a cell, tissue or subject to which a polyribonucleotide or a composition comprising the same has been administered.
[0272] In some embodiments, determining efficacy comprises determining an antibody response or cellular response in a cell, tissue or subject. In some embodiments, a cell, tissue or subject to which a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein has been administered exhibits an increased antibody response or cellular response as compared to a reference. In some embodiments, a reference is an antibody response or cellular response of a cell, tissue or subject that has been administered a comparable polyribonucleotide or a composition comprising the same that does not include any acetyl groups.
[0273] In some embodiments, a method or use disclosed herein comprises administering a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject at least two times. In some embodiments, a method disclosed herein comprises administering a polyribonucleotide or a composition comprising the same to a cell, tissue or subject 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times or 10 times.
[0274] In some embodiments, a method or use disclosed herein comprises administering a plurality of doses of a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein to a cell, tissue or subject. In some embodiments, a second or subsequent dose of a polyribonucleotide or a composition comprising the same has a substantially similar efficacy in acell, tissue, or subject compared to administration of a first dose of a composition comprising a polyribonucleotide.
[0275] In some embodiments of any of the methods or uses disclosed herein, a polyribonucleotide (e.g., circRNAs) disclosed herein, or a composition (e.g., pharmaceutical composition) comprising a polyribonucleotide (e.g., circRNAs) disclosed herein is administered to a cell, tissue or subject at a higher dose compared to an appropriate reference comparator. In some embodiments, a reference comparator comprise a comparable polyribonucleotide that does not include any acetyl groups.
[0276] In some embodiments of any of the methods or uses disclosed herein, the composition is administered via any one of the following routes of administration: intramuscular, intravenous, subcutaneous, intrathecal, intradermal, ocular, intranasal, sublingual, or oral.
[0277] In some embodiments of any of the methods or uses disclosed herein a cell is a mammalian cell.
[0278] In some embodiments of any of the methods or uses disclosed herein a tissue is a mammalian tissue.
[0279] In some embodiments of any of the methods or uses disclosed herein, a subject is a mammal. In some embodiments, a mammal is a human.IX. Kits
[0280] Another aspect of the present disclosure further provides a pharmaceutical pack or kit. In some embodiments, a kit can comprise an RNA, a circRNA, or a composition described herein.
[0281] In some embodiments, a kit can comprise (i) a polymerase (e.g., T7 polymerase), (ii) a phosphohydrolase (e.g., pyrophosphorylase, e.g., RNA 5' pyrophosphorylase), (iii) a ligase (e.g., circLigase or T4 RNA ligase), (iv) a DNA template, (v) an ssRNA, (vi) ribonucleic acids (e.g., modified or unmodified ribonucleic acids), (vii) buffer, or (viii) and combination thereof.
[0282] In some embodiment, kits may be used in any applicable method, e.g., methods as described herein.EXAMPLES
[0283] The invention now being generally described, will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of some aspects and embodiments of the present invention, and is not intended to be limiting.Example 1: Template DNA Production
[0284] The present example describes certain exemplary methods of in vitro synthesis of template polyribonucleotides that may be utilized in some embodiments of the present disclosure.
[0285] In some embodiments, polyribonucleotides of the present disclosure may not limited by the size nor structure of the protein-encoding sequences therein. For example, in some embodiments, polyribonucleotides of the present disclosure may be used to deliver proteinencoding sequences of varying lengths and structures. Accordingly, polyribonucleotides of the present disclosure may be suitable vectors for the expression of many proteins, including large molecular weight proteins. For example, as shown herein, polyribonucleotides of the present disclosure can encode an optimized version of firefly luciferase.Template DNA Production
[0286] For certain ligation experiments, a Luc2 gene encoding an optimized version of firefly luciferase flanked by the Xenopus globin 5' and 3' UTRs was amplified from pGL4.10[luc2] (Promega). Amplification was carried out at an annealing temperature of 70°C in a 20 pL reaction consisting of 0.25 pM each primer “Luc2_fwd” and “Luc2_rev,” IX Herculase II buffer, 25 mM each dNTP, 15 ng pGL4.10[luc2] plasmid (Promega), and 0.4 pL Herculase II enzyme. After incubation, the resulting reaction mixture was subjected to treatment with 20U of Dpnl enzyme (New England Biolabs) to digest template plasmid. The digested product was purified using the DNA Clean & Concentrator-25 kit (Zymo Research) and eluted into 30 pL nuclease free water. The digested, primary PCR product was then used to synthesize a series of iterations of Luc2 T7 template with hybridization regions and overhanging adenines at the 5' and 3' ends with different lengths and orientations. The amplification for this secondary PCR was carried out at an annealing temperature of 50°C in a 20pL reaction comprising 0.25 pM each primer, IX Herculase II buffer, 25 mM each dNTP, 15 ng Luc2 primary amplification product, and 0.4 pL Herculase II enzyme. The primers for each construct were as follows:Construct 1 : (i) a random 30 5' end primer and (ii) a random 30 3' end primer,Construct 2: (i) a 3As and random 30 5’ end primer and (ii) a random 30 3' end primer, Construct 3: (i) a random 30 5' end primer and (ii) a 3As and random 30 3' end primer, Construct 4: (i) a 3As and random 30 5’ end primer and (ii) a 3As and random 30 3' end primer,Construct 5: (i) a 6As and random 30 5’ end primer and (ii) a random 30 3' end primer, Construct 6: (i) a random 30 5' end primer and (ii) a 6 As and random 30 3' end primer, Construct 7: (i) a 6As and random 30 5' end primer and (ii) a 6As and random 30 3' end primer.
[0287] The sequences of primers used were as follows:Luc2_fwd: CTTGTTCTTT TTGCAGAAGC TCAGAATAAA CGCTCAACTT TGGCCACCat ggaagatgcc aaaaacatta agaagggc (SEQ ID NO: 1);Luc2_rev: AGAATGTGAA GAAACTTTCT TTTTATTAGG AGCAGATACG AATGGCTACA TTTTGGGGGA CAACATTTTG TAAAGTGTAA GTTGGTATTA TGTAGCTTAG AGACTCCATT CGGGTGTTCT TGAGGCTGGT CTATCATTAc acggcgatct tgccgcc (SEQ ID NO: 2); random 30 5' end:gaattTAATA CGACTCACTA TAGGGCGCGC GAGGCGGGCT CGCCGCGTCG GCTAActtgt tctttttgc agaagc (SEQ ID NO: 3) random 30 3' end: CGCGCGAGGC GGGCTCGCCG CGTCGGCTAA agaatgtgaa gaaactttct ttttattagg (SEQ ID NO: 4)3As and random 30 5' end: gaattTAATA CGACTCACTA TAGGGAAACG CGCGAGGCGG GCTCGCCGCG TCGGCTAAct tgttcttttt gcagaagc (SEQ ID NO: 5) 3As and random 30 3' end: TTTCGCGCGA GGCGGGCTCG CCGCGTCGGC TAAagaatgt gaagaaact ttctttttat tagg (SEQ ID NO: 6)6As and random 30 5' end: gaattTAATA CGACTCACTA TAGGGAAAAAACGCGCGAGG CGGGCTCGCC GCGTCGGCTA Acttgttcttt ttgcagaagc (SEQ ID NO: 7)6As and random 30 3' end: TTTTTTCGCG CGAGGCGGGC TCGCCGCGTC GGCTAAagaa tgtgaagaaa ctttcttttt attagg (SEQ ID NO: 8).The resulting secondary PCR products were cleaned up using the DNA Clean & Concentrator-25 kit (Zymo Research) and eluted into 30 pL nuclease free water.Template DNA Production For Adding Spacers
[0288] For further ligation experiments, the hybridization regions, 5' and 3' adenine overhangs, a NanoLuc gene, a rhinovirus B IRES (iHRV) (Chen, et. al., 2022, which is incorporated herein by reference in its entirety), Xenopus globin 5' and 3' UTRs, and a spacer, were amplified from pcDNA3.3 TOPO plasmid (ThermoFisher). Amplification was carried out using the PCR reagents mentioned on the previous section with 0.25 pM of a forward primer described in this example below and 0.25 pM of Circ_rev at an annealing temperature of 65°C in a 20 pL reaction. The primers for were as follows:Circ fwd: gaattTAATACGACTCACTATAGGGAAAAAATTAGCCGACGCGGCGAGC (SEQ ID NO: 8)Circ rev: TTTTTTTTAGCCGACGCGGCGAGC (SEQ ID NO:9)
[0289] Additionally, spacers of different lengths and sequence composition were inserted between the IRES and the hybridization region by using a set of forward primers(“Circ_fwd_l 0_nt_spacer”, “Circ_fwd_30_nt_spacer”, “Circ_fwd_40_nt_spacer”, “Circ_fwd_50_nt_spacer”, and “Circ_rev,”) as follows:Circ fwd lO nt spacer: gaattTAATACGACTCACTATAGGGAAAAAATTAGCCGACGCGGCGAGCCCGCCTCGC GCGTTCCTCAGAGTTAAAACAGCGGATGGGTACCC (SEQ ID NO: 10)Circ_fwd_30_nt_spacer: gaattTAATACGACTCACTATAGGGAAAAAATTAGCCGACGCGGCGAGCCCGCCTCGC GCGGTTCCATGAGGGCTAGAATTACCTACCGGCTTAAAACAGCGGATGGGTACCC (SEQ ID NO: 11)Circ_fwd_40_nt_spacer: gaattTAATACGACTCACTATAGGGAAAAAATTAGCCGACGCGGCGAGCCCGCCTCGC GCGGAATGCACATTGCATCGATACATAAGATGTCTCGACCGCATTAAAACAGCGGA TGGGTACCC (SEQ ID NO: 12)Circ_fwd_50_nt_spacer: gaattTAATACGACTCACTATAGGGAAAAAATTAGCCGACGCGGCGAGCCCGCCTCGCGCGATCCGCACAAGTGGATGCGATGCGATTGCCCGCTAAGATATTCTAACGTGTTAAAACAGCGGATGGGTACCC (SEQ ID NO: 13)The DNA clean-up was carried out as described previously.Example 2: In Vitro Transcription (IVT) of RNA Templates
[0290] The present example describes certain exemplary methods of in vitro transcription of polyribonucleotides (e.g., ssRNA) that may be utilized in some embodiments of the present disclosure.
[0291] Different ssRNAs for ligation were synthesized in 20 pL IVT reactions consisting of 200 ng of the corresponding DNA amplified templates, 20 mM MgC12, 7.5-10 mM each NTP, IX HiScribe Transcription Buffer, 1-0.5M Betaine, and 2 uL HiScribe polymerase mix (New England Biolabs) and incubated at 37°C for 1 hour. In certain analyses, as referenced below, unmodified cytidine was replaced by N4-acetylcytidine (Ac4C) to synthetize 100% modified ssRNAs, unmodified uracil was replaced by 5-Hydroxymethyluracil (5hmU) to synthetize 100% modified ssRNAs, or both. In some embodiments, all unmodified ribonucleotides were replaced by 2-0 Ac modified nucleotides.
[0292] IVT products were cleaned up using Monarch 500 pg RNA Clean Up kit (New England Biolabs) and eluted into 88 pL nuclease-free water. Eluted products were then digested in 100 pL reactions consisting of IX DNase I buffer and 10U of DNase I (RNase-free) (New England Biolabs) at 37°C for 5 minutes to degrade DNA template. DNase I treated samples were cleaned up using Monarch 500 ug RNA Clean Up kit (New England Biolabs) and eluted into 50 pL nuclease-free water.
[0293] Alternatively, after the time of incubation, reactions were digested in 21 pL reactions containing 2U of DNase I (RNase-free) (New England Biolabs). Products were cleaned up using Monarch 500 pg RNA Clean Up kit or Dynabeads Carboxylic Acid for RNA Purification (Invitrogen), following manufacturer’s instructions and eluted into 100 pL nuclease-free water (New England Biolabs).Example 3: RppH Treatment for 5’ Monophosphate RNA Generation
[0294] The present example describes certain exemplary methods of generating 5' monophosphorylated polyribonucleotides that may be utilized in some embodiments of the present disclosure.
[0295] A total amount of 5 ug of RNA was subjected to a gradient of 5U, 10U, 25U, and 50U RNA 5' pyrophosphohydrolase (RppH) (New England Biolabs) in IX T4 RNA Ligase Reaction buffer (50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.5) in 50 uL reactions. RppH treated RNA was cleaned up using Monarch 50 ug RNA Clean Up kit (New England Biolabs) and eluted into 50 pL nuclease-free water. 1 ug of each cleaned up RppH treated RNA was digested with two units of the 5’ monophosphate specific exonuclease XRN-1 (NEB) for 0.5-1 hour at 37C in XRN-1 buffer (NEB 3) (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9). Digestion products were characterized by gel electrophoresis on 2% EX agarose gels (ThermoFisher).
[0296] Table 1 shows the concentrations of the different ssRNA samples after being subjected to digestion by XRN-1. As expected, the negative controls (Luc2 6A’s ssRNA and Luc2 ssRNA with no hybridization regions) that were not treated with 5' pyrophosphohydrolase (RppH) had the highest concentrations after XRN-1 digestion, since these RNAs are resistant to RppH. Compared to the negative controls, the positive control that was treated with RppH shows a significant decrease in concentration after being subjected to digestion. Furthermore, the ligated sample shows a concentration value between those of the negative and positive controls, which indicates the presence of an XRN-1 resistant (circular RNA portion) and sensitive fraction (linear portion).Table 1: RNA yield after XRN-1 digestion.
[0297] As part of the optimization for the circularization protocol, a gradient of RNA 5' pyrophosphohydrolase (RppH) enzyme was performed in order to determine the optimal units of RppH to use for monophosphate formation on IVT RNA. XRN-1 exonuclease digestion was used to assay efficiency due to its specificity for 5’ monophosphate bearing RNA.
[0298] No-enzyme negative controls were also conducted to rule out the possibility of RNA autohydrolysis during digestion. Reactions were carried out in 20 uL reactions consisting of 1 ug Luc2 RNA post-ligation, IXNEBuffer 3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.9), 2 uL (2U) of XRN-1 (New England Biolabs) and incubated at 25°C for 1 hour. Digestion was conducted at 25°C in order to prevent RNA autohydrolysis in the high pH and high divalent cation conditions of the reaction mix. The digested product was purified using the Monarch 10 ug RNA Clean Up kit (New England Biolabs) and eluted into 10 pL nuclease free water.
[0299] FIG. 2 shows that XRN-1 digestion was most efficient with 50 U RppH. This enzyme amount was used for all further ligation reaction optimizations. Based on later XRN-1 digestion data we obtained, higher amounts of RppH may further improve ligation efficiencies and will be tested by use of higher concentration RppH.
[0300] Based on the observation above in Example 4, a total amount of 5 ug of RNA templates were treated with 50 U of RNA 5' pyrophosphohydrolase (RppH) (New England Biolabs) with a concentration between 5, 000-25, OOOU / mL in IX T4 RNA Ligase Reaction buffer (50 mM Tris- HCl, 10 mM MgC12, 1 mM DTT, pH 7.5) in 50 uL reactions. Treated RNAs were cleaned up as described previously.Example 4: Additional Methods UtilizedOptimization of individual ligation reaction of ssRNA using T4 ssRNA Ligase I
[0301] Individual ligation reactions were performed in a 20 uL final volume, consisting of 5 ug RppH treated RNAs, IX T4 RNA Ligase I Buffer (50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.5), 1 mM ATP, 2U RNase Murine Inhibitor and 30 U T4 ssRNA Ligase 1 High Concentration (New England Biolabs) and incubated at 25°C, 37°C and 50°C for 1-2 hours. 20% PEG 8000 or IM Betaine as final concentrations were used as additives for the ligation reaction. The ligated product was cleaned up as described previously.Individual ligation reactions of template ssRNA using Circligase Enzyme
[0302] Individual ligation reactions were performed in a 20 uL final volume, consisting of 5 ug RppH treated RNAs, IX CircLigase Reaction Buffer, 0.05 mM ATP, 2.5 mM MnC12, IM Betaine and 100 U of Circligase enzyme, as final concentrations. Reactions were incubated at 50 or 60C. The ligated product was cleaned up as described previously.Single reaction test of RppH and T4 ssRNA Ligase I
[0303] 5 ug of triphosphate template RNA (no-RppH treated) was incubated in a 50 uL reaction containing IX T4 RNA Ligase I Buffer (50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.5), 1 mM ATP, 20% PEG8000, 2U of RNase Murine Inhibitor, 30 U T4 ssRNA Ligase 1 High Concentration (New England Biolabs) and 50-125 U of RNA 5' pyrophosphohydrolase (RppH) enzyme (New England Biolabs), at 25°C for 2 hours. The ligated product was cleaned up using the Monarch 500 ug RNA Clean Up kit (New England Biolabs) and eluted into 50 pL nuclease- free water.In vitro translation assay
[0304] The kit 1 -Step Human Coupled IVT, without adding Accessory Proteins, was used to perform in vitro translation of the NanoLuc gene (ThermoFisher) using 10 ng of RppH treated RNA as well as purified and unpurified ligation products (circular RNA). The 25 uL reactions were incubated at 30C for 90 min and 10 uL were taken to perform the readout using the Promega Nano-Gio™ Luciferase Assay System Kit and followed manufacturer’s instructions.RNA Quantification
[0305] RNA concentration was determined using a NanoDrop OneC spectrophotometer (Thermo Scientific).2% and 4% Agarose denaturing gels
[0306] RNA samples were treated with an RNA Loading Dye (New England Biolabs) containing 47.5% formamide. The denaturing of samples was carried out in 20 uL using 50-500 ng RNA samples and IX RNA Loading Dye, and incubation at 65°C for 7-10 min. After incubation thesamples were immediately placed in ice for 2 min and the whole denatured samples were loaded into a 2% or 4% E-Gel EX precast agarose gel (Invitrogen).In vitro transcription coupled to dephosphorylation and ligation reactions
[0307] A DNA template containing the elements for consequent RNA circularization, as well as a 10 nucleotide spacer between a first hybridization region and an iHRV IRES was used as the input in 50 pL IVT / dephosphorylation and ligation reactions. Ligation reactions included 100 ng of DNA, 20 mM MgC12, 2.5 mM MnC12, 7.5 mM each NTP, IX T4 RNA Ligase Reaction Buffer (NEB), IX circLigase reaction buffer or IX NEB Buffer 2, 60 U of T4 RNA Ligase I or circLigase (LGC Biosearch Technologies), 50 U of RNA 5' Pyrophosphohydrolase (NEB) and 2 uL HiScribe polymerase mix (New England Biolabs).
[0308] ATP concentration can limit a reaction due to ATP requirements for ligase activities and activity of T7 polymerization. Accordingly, a gradient of additional ATP was assessed from a range between 0 ATP added, 1 mM and 2 mM.
[0309] Reactions performed with T4 RNA Ligase I enzyme were incubated at 37 °C, while reactions incubated with circLigase enzyme were incubated at 50 °C. Both incubations were terminated after 1 hour.
[0310] After the time of incubation, reactions were digested with 2U of DNase I at 37 °C for 5 minutes to degrade DNA template. Products were cleaned up using Monarch 50 pg RNA Clean Up kit (New England Biolabs) and eluted into 35 pL nuclease-free water. Eluted products were then digested in 51 pL reactions consisting of IX DNase I buffer and 10U of DNase I (RNase- free) (New England Biolabs).Alternate in vitro transcription (IVT) coupled to dephosphorylation and ligation reactions
[0311] A DNA template containing the elements for consequent RNA circularization, including a 10-nucleotide random spacer between a first hybridization region and an iHRV IRES was used as the input in 50 pL IVT / dephosphorylation and ligation reactions. Ligation reactions included 100 ng of DNA, 20 mM MgC12, 2.5 mM MnC12, IM Betaine, 5mM ATP, 7.5 mM each NTP, IX T4 RNA Ligase Reaction Buffer (NEB), IX circLigase reaction buffer or IX NEB Buffer 2, 60 U of T4 RNA Ligase I or 100 U of circLigase (LGC Biosearch Technologies), 50 U of RNA 5' Pyrophosphohydrolase (NEB) and 2 uL HiScribe polymerase mix (New England Biolabs).
[0312] ATP concentration can limit a reaction due to ATP requirements for ligase activities and activity of T7 polymerization. Accordingly, a gradient of additional ATP was assessed from a range between 0 ATP added, 1 mM - 5mM; 5 mM being the ideal ATP final concentration.
[0313] Reactions performed with T4 RNA Ligase I enzyme were incubated at 37 °C, while reactions incubated with circLigase enzyme were incubated at 50 °C. Both incubations were terminated after 1 hour.
[0314] After the time of incubation, reactions were digested in 60 pL reactions consisting of 10U of DNase I (RNase-free) (New England Biolabs) and 100 U of Alkaline Phosphatase (Promega). Products were cleaned up using Monarch 500 pg RNA Clean Up kit or Dynabeads Carboxylic Acid for RNA Purification (Invitrogen), following manufacturer’s instructions and eluted into 100 pL nuclease-free water (New England Biolabs).In vitro transcription (IVT) coupled to dephosphorylation
[0315] A DNA template containing the elements for consequent RNA circularization, including a 10-nucleotide random spacer between a first hybridization region and an iHRV IRES was used as the input in 50 pL IVT / dephosphorylation reactions, reactions included 100 ng of DNA, 20 mM MgC12, 2.5 mM MnC12, IM Betaine, 5mM ATP, 7.5 mM each NTP, IX T4 RNA Ligase Reaction Buffer (NEB), IX circLigase reaction buffer or IX NEB Buffer 2, 50 U of RNA 5' Pyrophosphohydrolase (NEB) and 2 uL HiScribe polymerase mix (New England Biolabs). Reactions were incubated at 37 °C incubations were terminated after 1 hour.
[0316] After the time of incubation, reactions were digested in-60 55 pL reactions consisting of 10U of DNase I (RNase-free) (New England Biolabs) Products were cleaned up using Monarch 500 pg RNA Clean Up kit or Dynabeads Carboxylic Acid for RNA Purification (Invitrogen), following manufacturer’s instructions and eluted into 100 pL nuclease-free water (New England Biolabs).
[0317] Individual ligation reactions were performed in a 20 uL final volume, consisting of 5 ug RppH treated RNAs, IX T4 RNA Ligase I Buffer (50 mM Tris-HCl, 10 mM MgC12, 1 mM DTT, pH 7.5), 1 mM ATP, 2U RNase Murine Inhibitor and 30 U T4 ssRNA Ligase 1 High Concentration (New England Biolabs) and incubated at 37°C for 1 hour. 20% PEG 8000 or IM Betaine as final concentrations were used as additives for the ligation reaction. After the time ofincubation, reactions were digested in 21 uL reactions consisting of 20 U of Alkaline Phosphatase (Promega). The ligated product was cleaned up as described previously.Example 5; Results
[0318] Adenine overhangs can be included at the 5' and 3' ends of ssRNA templates. The present example provides an assessment of how adenine overhangs having different lengths and orientations impact formation of circRNA. FIG. 3 shows the effect different lengths and orientations of the adenine overhangs had on circularization efficiency in the single reaction RppH and T4 ssRNA Ligase I workflow using Luc2 RNA constructs 3, 2, 6 and 5. Prior research has described T4 ssRNA Ligase I having a preference for the acceptor (A > G > C > U) and donor (pC > pU > pA > pG) nucleotides during ligation (England et. al., 1978; Romaniuk et. al., 1978). FIG. 4 contradicts the prior results as the construct with six adenines on both the 5' and 3' ends (construct 7) showed the best ligation efficiency. This data suggests that the RppH / T4 RNA Ligase single reaction workflow is viable given the exonuclease resistant fraction in Lane 5. Construct 7 was used for all further studies.
[0319] The efficiency and specificity of exemplary methods provided herein are assessed. As illustrated in FIG. 5 and FIG. 6, the linear fraction of construct 7 runs at the expected size of 1900 nt. After the ligation reaction, an XRN-1 resistant band appears at -5000 bases, which is expected to be the circRNA fraction. In support of this conclusion, the RppH treated unligated (e.g., non-ligated) positive control RNA was degraded by XRN-1 at both 30 minutes and 1 hour since it is a direct substrate for the enzyme. Nonetheless, residual linear fractions were observed after digestion, which indicate highly structured regions being resistant to XRN-1 digestion, as reported before (Chapman, et. al., 2013). A theoretical reason for the possibly brighter intensity of the upper band after digestion is removal of linear products that influence the migration pattern of the circRNA fraction. The non-denatured unligated (e.g., non-ligated) control sample with hybridization regions both demonstrates what the circular product should look like and that the hybridization regions behave as expected.
[0320] Next, different efficiencies of circularization were assessed by using two ligases under variable conditions as temperature and betaine addition. As shown in FIG. 7, ligation at higher temperatures with circLigase enzyme helps with the melting of structured regions within the circularization template that might be interfering with the acceptor and donor sites. Nonetheless,the T4 RNA Ligase 4 from NEB, appears to have less efficiency at higher temperatures than 37C. This might be due to intrinsic enzyme properties or protein degradation, which suggest that a higher concentration of betaine could preserve the integrity of the enzyme and aid in the ligation of difficult templates as reported with circLigase.
[0321] An exemplary method provided herein was assessed to determine if it enabled the circularization of unmodified and chemically modified template RNAs. As shown in FIG. 8, individual reactions (RppH treatment independently from ligation reaction) provided higher circularization efficiency compared to single pot reactions using T4 RNA Ligase I from NEB. Additionally, it was shown that the different chemically modified nucleotides do not interfere with the ligation reaction, as the upper band corresponding to the circular RNA portion showed a comparable size.
[0322] The effects of spacers of different lengths and sequence composition on exemplary methods provided herein was also examined. While the addition of spacer sequences between the iHRV IRES and the hybridization regions did not abrogate circularization, it changed the appearance of the ligation products and dropped efficiency at around 40% (FIG. 9). However, it is still possible that the smear on the ligation products from the template without spacer across unmodified and modified nucleotides is derived from undenatured structures or residual protein. FIG. 10 further demonstrates the enhancement on expression after the addition of spacers of different lengths between structured portions of unmodified and chemically modified circular RNAs, compared to the original circular RNA design without spacer. As described previously, (Wesselhoeft, et. al., 2018), the addition of spacers between highly structured portions of a circular RNA allows appropriate folding of independent elements, e.g., an IRES, promoting proper functionality and consequently higher expression. Moreover, circRNA retains IRES activity after ligation as demonstrated by expression of the RppH treated RNA.
[0323] Table 2 shows the RNA yield obtained after the in vitro transcription (IVT) of a DNA template. The method used was coupled to RNA dephosphorylation and ligation reactions performed by two different ligases. Activities of the ligases were tested in two different buffers under an ATP gradient. Overall, reactions comprising circLigase enzyme showed higher total RNA yields (~48 ug per reaction), while reactions comprising T4 RNA Ligase I exhibited lower total RNA yields (~24 ug per reaction) but a bias for a higher yield for the circular RNA productfollowing ligation, as manifested by a bigger upper band on the agarose gels presented onFIG.llTable 2. RNA yield after a series of IVT reactions, coupled to RNA dephosphorylation and ligation reactions under different conditions.
[0324] As shown in FIG.ll, reactions comprising T4 RNA Ligase I demonstrated higher yield for circular RNA as shown by the increased density of the upper band. On the other hand, reactions comprising circLigase enzyme exhibited a higher RNA yield but a lower RNA yield for the circular RNA form. Furthermore, it is apparent that an increase in ATP concentration can bias the generation of circular RNA, without affecting the total RNA yield, because reactions in which no ATP was added had a smaller upper band corresponding to circular RNA, as compared to reactions where 1 mM and 2 mM ATP was added.Example 6: Characterization of Ligation Products
[0325] The present example describes exemplary methods of characterizing ligation products.
[0326] Ligation products will be analyzed by RNA sequencing and / or northern blotting. A panel of IRESes for translation initiation (including the wild type HRV IRES) will be used to confirm circRNAs can produce biologically relevant proteins.
[0327] Furthermore, the one-pot synthesis workflow with the circLigase enzymes, as well as the processes to further improve circularization efficiency will be optimized. Other ligases / monophosphate forming enzymes will also be tested.
[0328] In parallel to in vitro optimizations, a series of in vivo optimizations will also be performed using naked and LNP protected circRNAs to evaluate half-life and other characteristics compared to linear capped and polyadenylated RNA counterparts.Example 7: Generation and assessment of exemplary unmodified circular RNAs encoding Nluc and eGFP
[0329] The present example describes certain exemplary methods of generating circular RNAs that may be utilized in some embodiments of the present disclosure and methods for assessing the same.In vitro transcription (IVT) coupled to dephosphorylation and ligation reactions
[0330] A DNA template containing the elements for consequent RNA circularization, as well as a 10-nucleotide spacer between a first hybridization region and an iHRV IRES was used as the input in 50 pL IVT / dephosphorylation and ligation reactions. Ligation reactions included 100 ng of DNA, 20 mM MgC12, 2.5 mM MnC12, IM Betaine, 5mM ATP, 7.5 mM each NTP, IX T4 RNA Ligase Reaction Buffer (NEB), IX circLigase reaction buffer or IX NEB Buffer 2, 60 U of T4 RNA Ligase I or circLigase (LGC Biosearch Technologies), 50 U of RNA 5' Pyrophosphohydrolase (NEB) and 2 uL HiScribe polymerase mix (New England Biolabs).
[0331] ATP concentration can limit a reaction due to ATP requirements for ligase activities and activity of T7 polymerization. Accordingly, a gradient of additional ATP was assessed from a range between 0 ATP added, 1 mM and 5mM.
[0332] Reactions performed with T4 RNA Ligase I enzyme were incubated at 37 °C, while reactions incubated with circLigase enzyme were incubated at 50 °C. Both incubations were terminated after 1 hour.
[0333] After the time of incubation, reactions were digested with 2U of DNase I at 37 °C for 5 minutes to degrade DNA template. Products were cleaned up using Monarch 50 pg RNA Clean Up kit (New England Biolabs) and eluted into 35 pL nuclease-free water. Eluted products were then digested in 60 pL reactions consisting of 10U of DNase I (RNase-free) (New England Biolabs) and 100 U of Alkaline Phosphatase (Promega).Circular RNA Purification / Isolation
[0334] Polyadenylation of free 3 -OH ends: Polyadenylation tailing reactions of the remaining non-circularized input were performed after elution of products of IVT coupled to dephosphorylation and ligation reactions. The 20 uL reactions included 10 ug of RNA, 5U of E. coli Poly(A) Polymerase, IX Poly(A) Polymerase Reaction Buffer, ImM ATP and 20 U of RNase Inhibitor, Murine (New England Biolabs) and were incubated for 30 mins at 37C. Products were cleaned up using Monarch 50 pg RNA Clean Up kit (New England Biolabs) and eluted into 30 pL nuclease-free water.Rnase R digest
[0335] Purified products from polyadenylation tailing reactions were subjected to RNase R digest to remove the remaining non-circularized fraction from the circular RNA. The reactions included 1 ug of RNA, 10U of RNase R and IX RNase R Reaction Buffer (Abeam) in 20 uL reactions that were incubated for 30 mins at 37C. Products were cleaned up using Monarch 10 pg RNA Clean Up kit (New England Biolabs) and eluted into 10-15 pL nuclease-free water.Capillary electrophoresis
[0336] The circular and linear RNA fractions were analyzed by capillary electrophoresis using a pre-assembled BFS capillary cartridge operated by the BioPhase 8800 system (SCIEX). The reagents provided on the RNA 9000 Purity & Integrity kit (SCIEX) were prepared according to the manufacturer instructions and placed on disposable BioPhase starter outlet and inlet plates. The RNA samples were prepared at a final concentration of 3 ng / uL with Nuclease free-water (New England Biolabs) and a subsequent 1: 1 dilution was prepared with sample loading solution (SLS, SCIEX) for the final 60 uL working solution. Finally, the samples were denatured at 70C for 5 minutes and immediately placed on a PCR cold block for 2-5 minutes. Similarly, thessRNA ladder was prepared as described in the user manual for the mentioned kit. Data acquisition and analysis were performed using the BioPhase 8800 software vl.2.20 e-license.Results
[0337] Circular and linear RNA fractions for the various exemplary RNAs tested in the present example and assessed with capillary electrophoresis are shown in FIG. 12 (exemplary RNA tested is Nluc), FIG. 13 (exemplary RNA tested is Nluc), and FIG. 14 (exemplary RNA tested is eGFP).
[0338] As shown in first sample of FIG. 12, an exemplary enzymatic one-pot method for synthesizing circular RNA showed 61% efficiency for circularizing an RNA encoding a luciferase protein without purification, with 35% linear RNA remaining in the sample. After isolation and purification with pA tailing and RNAase R digest as described herein, circular RNAs were highly enriched with a purity of up to 97% (third sample of FIG. 12).
[0339] For comparison, a sample with RNA transcribed from a DNA template without T4 RNA Ligase 4 added to the IVT / dephosphorylation reaction was 98% pure for linear RNA (second sample of FIG. 12). An ssRNA ladder was used as a size reference for the other samples (fourth sample of FIG. 12).
[0340] As shown in first sample of FIG. 13, an exemplary enzymatic one-pot method for synthesizing circular RNA showed 54% efficiency for circularizing an RNA encoding a luciferase protein without purification, with 37% linear RNA remaining in the sample. The third electropherogram in FIG. 13 shows a sample produced according to the methods used for the first sample as well as a pA tailing treatment. After isolation and purification with pA tailing and RNAase R digest as described herein, circular RNAs were highly enriched with a purity of up to 92% (fourth sample of FIG. 13).
[0341] For comparison, a sample with RNA transcribed from a DNA template without T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction was 90% pure for linear RNA (second sample of FIG. 13).
[0342] The fifth sample (fifth electropherogram of FIG. 13) was produced according to the methods used for the second sample as well as pA tailing treatment and Rnase R digest, which shows degradation of the RNA. An ssRNA ladder was used as a size reference for the other samples (sixth sample of FIG. 13).
[0343] As shown in first sample of FIG. 14, an exemplary enzymatic one-pot method for synthesizing circular RNA showed 18% efficiency for circularizing an RNA encoding a luciferase protein without purification, with 81% linear RNA remaining in the sample. After isolation and purification with pA tailing and RNAase R digest as described herein, circular RNAs were highly enriched with a purity of up to 72% (third sample of FIG. 14).
[0344] For comparison, a sample with RNA transcribed from a DNA template without T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction was 100% pure for linear RNA (second sample of FIG. 14). An ssRNA ladder was used as a size reference for the other samples (fourth sample of FIG. 14).
[0345] This example demonstrates the effective manufacture of circular RNA from an enzymatic one-pot reaction. This example also demonstrates after polyA tailing followed by RNAse R digest enriches circular RNAs with a purity of up to greater than 90% for Nluc, and with significant increase in purity to greater than 70% for eGFP. In addition, this example provides support for using an enzymatic one-pot method for removing the non-circularized synthesized RNA transcribed from a DNA input.Example 8: In vitro expression with exemplary unmodifed circular RNAs
[0346] The present example describes certain exemplary methods of expressing and assessing expression of a target protein using unmodified circular RNAs. These methods may be utilized in some embodiments of the present disclosure.
[0347] HEK293 cells (ATCC) were cultured in high glucose GlutaMAX Dulbecco’s Modified Eagle Medium (Thermo Fisher) supplemented with 10% heat-inactivated fetal bovine serum, 100 units / mL penicillin and 100 pg / mL streptomycin and maintained at 37°C and 5% CO 2. Cells were harvested with TrypLE Express Enzyme (IX) and plated in a 96-well plate at a confluency of 25,000 cells / well 24h prior to transfection.
[0348] Exemplary RNAs for transfection were generated as described in Example 7.Transfection was carried out using Lipofectamine MessengerMAX (Thermo Fisher) at a 3.75 uL reagent per pg mRNA and using Opti-MEM media as diluent.
[0349] To measure cell expression readout, the Nano-Gio Luciferase Assay System (Promega) kit was used according to the manufacturer protocol to detect NLuc luminescence 72h aftertransfection. All measurements were performed on a GloMax Discover Microplate Reader (Promega). The signal data from experimental groups was normalized to untreated cells.
[0350] Cell expression readout of the exemplary luciferase are shown in FIG. 15. The first bar corresponds to the expression of a circular RNA encoding the exemplary luciferase (Nluc) protein before being pA tailed and digested with RNase R. The second sample corresponds to an RNA transcribed from the DNA template without T4 RNA Ligase 4 added to the IVT / dephosphorylation reaction. The third and fourth bars corresponds to the expression of the first and second samples, respectively, after pA tailing. The fifth bar corresponds to sample of circular RNA encoding the Nluc protein after the addition of the pA tail and digest with RNase R (enriched circles). The last sample corresponds to a linear capped RNA encoding the Nluc protein as control of the transfection. All exemplary test conditions showed increased expression of the exemplary luciferase at an exemplary lOOng dose relative to untreated cells. The results demonstrate that circular RNAs synthesized by a multi-enzymatic one-pot method as described herein are functional on HEK293 cells.
[0351] The results of the present example further demonstrate the functionality of exemplary circular RNAs generated with a multi-enzymatic one-pot method as described herein.Example 9: Comparison of exemplary IVT methods using exemplary circular RNAs
[0352] The present example compares exemplary IVT methods using exemplary modified and unmodified linear and circular RNAs. These methods may be utilized in some embodiments of the present disclosure.One Pot Reaction Method
[0353] One pot reaction method refers to the IVT reaction coupled to the RppH (dephosphorylation) and T4 RNA Ligation reactions. In some embodiments, as described herein this may be referred to as a co-transcriptional circularization method. Unmodified nucleotides, 100% 2-0 Ac modified nucleotides, and 100% Ac4C and 5hmU nucleotides instead of cytidine and uridine were used to generate unmodified and chemically modified circular RNA, respectively, as previously described. As observed from FIG. 16A, while the unmodified and Ac4C / 5hmU RNAs show a higher circularization efficiency, it was still possible to generate a 100% backbone modified circular RNA with this method.Two Pot Reaction Method
[0354] Two pot reaction method refers to the IVT reaction coupled only to the RppH (dephosphorylation) treatment. After an RNA clean-up step, the eluted mRNA was ligated (circularized) with the described individual T4 RNA Ligase I reaction. Similar to the above exemplary method (one pot reaction method) unmodified nucleotides, 100% 2-0 Ac modified nucleotides, and 100% Ac4C and 5hmU nucleotides were used instead of cytidine and uridine to generate unmodified and chemically modified circular RNA, respectively.
[0355] As can be seen from FIG. 16B, although an exemplary two pot reaction method increases the circularization efficiency for the Ac4C / 5hmU modified RNAs, this reaction involves setting up a separate ligation reaction, which is not as simplified as a one-pot reaction method. Additionally, a individual ligation reaction has a limit RNA input amount of 5 pg of RppH treated RNA per reaction, which also limits the output circRNA yield.Individual Reaction Method
[0356] Individual Reaction Method refers to the IVT reaction, RppH (dephosphorylation) reaction and the T4 RNA Ligation reactions performed individually. In other words, all reactions were performed separately. Unmodified nucleotides, 100% 2-0 Ac modified nucleotides, and 100% Ac4C and 5hmU nucleotides were used instead of cytidine and uridine for generate unmodified and chemically modified circular RNA, respectively. As shown in FIG. 16C, while the unmodified RNA showed a higher circularization efficiency compared to the chemically modified RNAs, it was still possible to generate a 100% backbone modified and 100% Ac4C / 5hmU circular RNA with this method.
[0357] These results illustrates that multiple methods may be utilized to generate unmodified and chemically modified circular RNAs. However, the one pot reaction method as described herein represents a highly simplified and efficient method to generate unmodified and chemically modified circular RNAs. Additionally, the one pot reaction method as described herein decreases time and cost for sample generation, since sample loss as well as hands-on-lab are significantly reduced.Example 10: Generation and assessment of exemplary modified circular RNAs encodingNine
[0358] The present example describes certain exemplary methods of generating modified circular RNAs that may be utilized in some embodiments of the present disclosure and methods for assessing the same.
[0359] Materials and methods as described in Example 7 were performed herein to generate and assess circular and linear input 2-0 Ac modified RNAs encoding Nluc protein.
[0360] As shown in first sample of FIG. 17, the exemplary enzymatic one-pot method for synthesizing circular RNA showed 60% efficiency for circularizing an RNA encoding a luciferase protein without purification, with 23% linear RNA remaining in the sample. The third sample (third electropherogram of FIG. 17) represents the first sample after a pA tailing treatment. After isolation and purification with pA tailing and RNAase R digest as described herein, circular RNAs were highly enriched with a purity of up to 98% (fourth sample of FIG. 17).
[0361] For comparison, a sample with RNA transcribed from a DNA template without T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction was 61% denatured linear RNA and 36% non-denatured linear RNA (second sample of FIG. 17)
[0362] The fifth sample represents the second sample after a pA tailing treatment and Rnase R digest, which shows degradation of the RNA. An ssRNA ladder was used as a size reference for the other samples (sixth sample of FIG. 17).
[0363] This example demonstrates the effective manufacture of modified circular RNA from an enzymatic one-pot reaction. This example also demonstrates after polyA tailing followed by RNAse R digest enriches circular RNAs with a purity of up to -98% for Nluc. In addition, this example provides support for using an enzymatic method for removing the non-circularized synthesized RNA transcribed from a DNA input.Example 11: In vitro expression with exemplary modified circular RNAs
[0364] The present example describes certain exemplary methods of expressing and assessing expression of a target protein using modified circular RNAs. These methods may be utilized in some embodiments of the present disclosure.
[0365] HEK293 cells (ATCC) were cultured in high glucose GlutaMAX Dulbecco’s Modified Eagle Medium (Thermo Fisher) supplemented with 10% heat-inactivated fetal bovine serum, 100 units / mL penicillin and 100 pg / mL streptomycin and maintained at 37°C and 5% CO 2. Cells were harvested with TrypLE Express Enzyme (IX) and plated in a 96-well plate at a confluency of 25,000 cells / well 24h prior to transfection.
[0366] Exemplary RNAs for transfection were generated as described in Example 7.Transfection was carried out using Lipofectamine MessengerMAX (Thermo Fisher) at a 3.75 uL reagent per pg mRNA and using Opti-MEM media as diluent.
[0367] To measure cell expression readout, the Nano-Gio Luciferase Assay System (Promega) kit was used according to the manufacturer protocol to detect NLuc luminescence 24h after transfection. All measurements were performed on a GloMax Discover Microplate Reader (Promega). The signal data from experimental groups was normalized to untreated cells.
[0368] Cell expression readout of the exemplary luciferase are shown in FIG. 18. The first bar corresponds to a Ac4C / 5hmU modified linear capped RNA encoding the the exemplary luciferase (Nluc) protein as control of the transfection. The second sample corresponds to the same linear capped RNA encoding the Nluc protein as control of the transfection, but in equimolar amounts as the circular RNA molecule, since both the circular Nluc and linear capped Nluc have different RNA lengths. The third bar corresponds to the expression of a Ac4C / 5hmU modified circular RNA encoding the Nluc protein before being purified, pA tailed and digested with RNase R. The fourth bar corresponds to the expression of an Ac4C / 5hmU modified RNA transcribed from the same DNA template as the first sample, excluding T4 RNA Ligase I and RNA 5' Pyrophosphohydrolase (RppH) from the reaction. All exemplary test conditions showed increased expression of the exemplary luciferase at an exemplary 50ng dose relative to untreated cells. The results demonstrate that modified circular RNAs synthesized by a multi-enzymatic one-pot method as described herein are functional on HEK293 cells.
[0369] The results of the present example further demonstrate the functionality of exemplary modified circular RNAs generated with a multi-enzymatic one-pot method as described herein.Example 12: Generation and assessment of exemplary unmodified circular RNAs encoding Nluc using a DNA template with hybridization regions comprising reduced G-C content
[0370] The present example describes certain exemplary methods of generating circular RNAs that may be utilized in some embodiments of the present disclosure and methods for assessing the same.Materials and Methods
[0371] Materials and methods as described in Example 7 were performed to generate and assess circular and linear input unmodified RNAs encoding an exemplary Nluc protein. However, the present example employed a DNA template comprising exemplary hybridization regions with low G-C content (30%) compared to other hybridization regions exemplified herein (e.g., 80% G-C content).
[0372] First and second hybridization regions, and corresponding primers used for their introduction into the circularization template were as follows:First hybridization region (5’): 5’- ATATATATATCGGCGAGCCCATATATATAT-3’ (SEQ ID NO : 31).Primer used for adding first hybridization region to the circularization template (T7 promoter underlined, 10 nt random spacer (SEQ ID NO.: 27) in italics): gaattTAATACGACTCACTATAGGGAAAAAAATATATATATCGGCGAGCCCATATATAT ATTTCCTCAGAGTTAAAACAGCGGATGGGTACCCSecond hybridization region (3’): 5’-ATATATATATCGGCGAGCCCATATATATAT-3’ (SEQ ID NO.: 31)Primer used for adding second hybridization region to the circularization template TTTTTTATATATATATCGGCGAGCCCATATATATATGGCCAAAGTTGAGCGTTTATTC TG)Results
[0373] The circular and linear RNA fractions were analyzed by capillary electrophoresis as described in Example 7. Circular and linear RNA fractions for the various exemplary RNAs tested in the present example and assessed with capillary electrophoresis are shown in FIG. 19. As shown in the first sample of FIG, 19, an exemplary enzymatic one-pot method forsynthesizing circular RNA using a low G-C content set of hybridization regions showed 32% efficiency for circularizing an RNA encoding a luciferase protein without any purification, with 68% linear RNA remaining in the sample. The third sample (as shown in third electropherogram of FIG. 19) was produced using an exemplary enzymatic one-pot method for synthesizing circular RNA which employed a low G-C content set of hybridization regions after isolation and purification with pA tailing and RNAase R digest as described herein. As shown in the third electropherogram of FIG. 19, circular RNAs produced using this method were highly enriched with a purity of up to 93%.
[0374] For comparison, a sample with RNA transcribed from a DNA template with the exemplary low-GC content set of hybridization regions and without T4 RNA Ligase 4 and RNA 5' Pyrophosphohydrolase (RppH) added to the IVT / dephosphorylation reaction was 100% pure for linear RNA (second electropherogram of FIG. 19). An ssRNA ladder (fourth electropherogram of FIG. 19) was used as a size reference for the samples in this example.
[0375] The results of the present example demonstrate effective generation of exemplary modified circular RNAs employing a DNA template with low G-C content hybridization regions using a multi -enzymatic one-pot method. Taken together with results of the preceding examples, the present example provides support for generating circular RNAs using DNA templates with hybridization regions comprising a wide range of G-C content (e g., low G-C content, high G-C content) using an enzymatic one-pot method as described herein.EXEMPLARY SEQUENCES
[0376] The following table provides exemplary nucleotide sequences as described herein.Table 3. Exemplary nucleotide sequences for circular RNAs.CERTAIN EMBODIMENTS
[0377] Embodiment 1. A polyribonucleotide comprising: a. a 5’ end comprising a 5 ’-most nucleotide, b. a 3’ end comprising a 3 ’-most nucleotide, c. a first hybridization region and a second hybridization region, wherein the ribonucleotide sequence of the second hybridization region is a reverse complement of the ribonucleotide sequence of the first hybridization region.
[0378] Embodiment 2. The polyribonucleotide of embodiment 1, wherein the first hybridization region is 10 to 50 nucleotides in length.
[0379] Embodiment 3. The polyribonucleotide of embodiment 1 or 2, wherein the first hybridization region is 20 to 40 nucleotides in length.
[0380] Embodiment 4. The polyribonucleotide of any one of embodiments 1 to 3, wherein the first hybridization region is 25 to 35 nucleotides in length.
[0381] Embodiment 5. The polyribonucleotide of any one of embodiments 1 to 4, wherein the ribonucleotide sequence of the first hybridization region has a G-C content of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%.
[0382] Embodiment 6. The polyribonucleotide of any one of embodiments 1 to 5, wherein the ribonucleotide sequence of the first hybridization region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14.
[0383] Embodiment 7. The polyribonucleotide of any one of embodiments 1 to 6, wherein the first hybridization region comprises a ribonucleotide sequence of SEQ ID NO: 14.
[0384] Embodiment 8. The polyribonucleotide of any one of embodiments 1 to 7, wherein there are no more than 25 nucleotides between a 5 '-most nucleotide of the first hybridization region and the 5 '-most nucleotide of the polyribonucleotide.
[0385] Embodiment 9. The polyribonucleotide of any one of embodiments 1 to 8, wherein the second hybridization region is 10 to 50 nucleotides in length.
[0386] Embodiment 10. The polyribonucleotide of any one of embodiments 1 to 9, wherein the second hybridization region is 20 to 40 nucleotides in length.
[0387] Embodiment 11. The polyribonucleotide of any one of embodiments 1 to 10, wherein the second hybridization region is 25 to 35 nucleotides in length.
[0388] Embodiment 12. The polyribonucleotide of any one of embodiments 1 to 11, wherein the ribonucleotide sequence of the second hybridization region has a G-C content of at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%.
[0389] Embodiment 13. The polyribonucleotide of any one of embodiments 1 to 12, wherein the ribonucleotide sequence of the second hybridization region is at least 80% , at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15.
[0390] Embodiment 14. The polyribonucleotide of any one of embodiments 1 to 13, wherein the second hybridization region comprises a ribonucleotide sequence of SEQ ID NO: 15.
[0391] Embodiment 15. The polyribonucleotide of any one of embodiments 1 to 14, wherein there are no more than 25 nucleotides between a 3 '-most nucleotide of the second hybridization region and the 3 '-most nucleotide of the polyribonucleotide.
[0392] Embodiment 16. The polyribonucleotide of any one of embodiments 1 to 15, wherein the polyribonucleotide further comprises a 5’ polyadenylate (poly(A)) overhang.
[0393] Embodiment 17. The polyribonucleotide of embodiment 16, wherein the 5’ poly(A) overhang is 2-8 nucleotides in length.
[0394] Embodiment 18. The polyribonucleotide of embodiment 16 or 17, wherein the 5’ poly(A) overhang is 3 nucleotides in length.
[0395] Embodiment 19. The polyribonucleotide of embodiment 16 or 17, wherein the 5’ poly(A) overhang is 6 nucleotides in length.
[0396] Embodiment 20. The polyribonucleotide of any one of embodiments 1 to 19, wherein the polyribonucleotide further comprises a 3’ poly(A) overhang.
[0397] Embodiment 21. The polyribonucleotide of embodiment 20, wherein the 3 ’ poly(A) overhang is 2-8 nucleotides in length.
[0398] Embodiment 22. The polyribonucleotide of embodiment 20 or 21, wherein the 3 ’ poly(A) overhang is 3 nucleotides in length.
[0399] Embodiment 23. The polyribonucleotide of embodiment 20 or 21 , wherein the 3 ’ poly(A) overhang is 6 nucleotides in length.
[0400] Embodiment 24. The polyribonucleotide of any one of embodiments 20 to 22, wherein the polyribonucleotide comprises a 5’ poly(A) overhang that is 3 nucleotides in length and a 3’ poly(A) overhang that is 3 nucleotides in length.
[0401] Embodiment 25. The polyribonucleotide of any one of embodiments 20, 21 and 23 , wherein the polyribonucleotide comprises a 6 nucleotides-long 5’ poly(A) overhang and a 6 nucleotides-long 3’ poly(A) overhang.
[0402] Embodiment 26. The polyribonucleotide of any one of embodiments 20 to 25, wherein the 5’ poly(A) overhang and the 3’ poly(A) overhang are unstructured.
[0403] Embodiment 27. The polyribonucleotide of any one of embodiments 1 to 26, wherein the polyribonucleotide comprises one or more spacers.
[0404] Embodiment 28. The polyribonucleotide of embodiment 27, wherein the one or more spacers are 1-100 nucleotides in length.
[0405] Embodiment 29. The polyribonucleotide of embodiment 27 or 28, wherein one of the spacers is 1-100 nucleotides in length.
[0406] Embodiment 30. The polyribonucleotide of any one of embodiments 27 to 29, wherein one of the spacers is 1-50 nucleotides in length.
[0407] Embodiment 31. The polyribonucleotide of any one of embodiments 27 to 29, wherein one of the spacers is 10-100 nucleotides in length.
[0408] Embodiment 32. The polyribonucleotide of any one of embodiments 1 to 31, wherein the polyribonucleotide comprises an internal ribosomal entry site (IRES).
[0409] Embodiment 33. The polyribonucleotide of embodiment 32, wherein the IRES comprises a viral, cellular or engineered IRES.
[0410] Embodiment 34. The polyribonucleotide of any one of embodiments 1 to 33, wherein the polyribonucleotide comprises a 5’ UTR.
[0411] Embodiment 35. The polyribonucleotide of any one of embodiments 1 to 34, wherein the polyribonucleotide comprises a 3’ UTR.
[0412] Embodiment 36. The polyribonucleotide of any one of embodiments 1 to 35, wherein the polyribonucleotide comprises a payload sequence.
[0413] Embodiment 37. The polyribonucleotide of embodiment 36, wherein the payload sequence encodes a polypeptide.
[0414] Embodiment 38. The polyribonucleotide of embodiment 36 or 37, wherein the polyribonucleotide comprises, in 5’ to 3’ order: a. a 5’ poly(A) overhang, b. a first hybridization region, c. an IRES, d. a payload sequence encoding a polypeptide, e. a 3’ UTR, f. a spacer, g. a 5’ UTR,h. a second hybridization region, and f. a 3’ poly(A) overhang.
[0415] Embodiment 39. The polyribonucleotide of embodiment 36 or 37, wherein the polyribonucleotide comprises, in 5’ to 3’ order: a. a 5’ poly(A) overhang, b. a first hybridization region, c. a first spacer, d. an IRES, e. a payload sequence encoding a polypeptide, f. a 3’ UTR, g. a second spacer, h. a 5’ UTR, i. a second hybridization region, and j . a 3 ’ poly(A) overhang.
[0416] Embodiment 40. The polyribonucleotide of embodiment 39, wherein the first spacer is 1-50 nucleotides in length.
[0417] Embodiment 41. The polyribonucleotide of embodiment 39, wherein the second spacer is 10-100 nucleotides in length.
[0418] Embodiment 42. The polyribonucleotide of any one of embodiments 39 to 41, wherein: a. the first hybridization region is 10-50 nucleotides in length, b. the second hybridization region is 10-50 nucleotides in length, c. the first spacer is 1-50 nucleotides in length, d. the second spacer is 10- 100 nucleotides in length, e. the 5’ poly(A) overhang is 2-8 nucleotides in length, and f. the 3’ poly(A) overhang is 2-8 nucleotides in length.
[0419] Embodiment 43. The polyribonucleotide of embodiment 36, wherein the payload sequence comprises an RNA oligo, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof.
[0420] Embodiment 44. The polyribonucleotide of embodiment 43, wherein the polyribonucleotide comprises, in 5’ to 3’ order:a. a 5’ poly(A) overhang, b. a first hybridization region, c. a payload sequence comprising an RNA oligo, a messenger RNA (mRNA), an inhibitory RNA, an miRNA, an siRNA, or an antisense oligonucleotide, d. a second hybridization region, and e. a 3’ poly(A) overhang.
[0421] Embodiment 45. The polyribonucleotide of embodiment 43 or 44, wherein the payload sequence comprises two or more of an RNA oligo, a messenger RNA (mRNA) (e.g., that encodes a polypeptide / protein), an inhibitory RNA, an miRNA, an siRNA, an antisense oligonucleotide, or any combination thereof.
[0422] Embodiment 46. The polyribonucleotide of any one of embodiments 22-45, wherein: a. the first hybridization region is 10-50 nucleotides in length, b. the second hybridization region is 10-50 nucleotides in length, c. the 5’ poly(A) overhang is 2-8 nucleotides in length, and d. the 3’ poly(A) overhang is 2-8 nucleotides in length.
[0423] Embodiment 47. The polyribonucleotide of any one of embodiments 1 to 46, wherein the polyribonucleotide is 50-100,000 nucleotides in length.
[0424] Embodiment 48. The polyribonucleotide of any one of embodiments 1 to 47, wherein the polyribonucleotide is at least 50, at least 100, at least 150, at least 250, at least 500, at least 750, at least 1000, at least 1250, at least 1500, at least 2000, at least 5000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 60,000, at least 70,000, at least 80,000, or at least 90,000 nucleotides in length.
[0425] Embodiment 49. The polyribonucleotide of any one of embodiments 1 to 48, wherein the polyribonucleotide is at most 90,000, at most 80,000, at most 70,000, at most 60,000, at most 50,000, at most 40,000, at most 30,000, at most 20,000, at most 10,000, at most 5000, at most 2000, or at most 1500 nucleotides in length.
[0426] Embodiment 50. The polyribonucleotide of any one of embodiments 1 to 49, wherein the polyribonucleotide comprises one or more modified nucleotides.
[0427] Embodiment 51. The polyribonucleotide of embodiment 50, wherein the one or more modified nucleotides comprise N4-acetylcytidine (ac4C), 5-hydroxymethyluridine (5hmu),N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methylwyosine (mimG), 5-hydroxy cytidine, 5- hydroxymethylcytidine, 5-carboxycytidine, 5-methoxycytidine, 5-propynylcytidine, 2- thiocytidine, 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-O- methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'- deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5 -carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5- propynyluridine, 5 -bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl- pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl -methylpseudouridine, Nl- ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2- aminoadenosine, 3 -methyladenosine, 7-deazaadenosine, 8-oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-O-methylguanine, or any combination thereof.
[0428] Embodiment 52. The polyribonucleotide of embodiment 50 or 51, wherein the one or more modified nucleotides comprise N4-acetylcytidine.
[0429] Embodiment 53. The polyribonucleotide of embodiment 52, wherein at least 5% of cytidine residues in the polyribonucleotide comprise N4-acetylcytidine.
[0430] Embodiment 54. The polyribonucleotide of embodiment 52 or 53, wherein less than 100% of cytidine residues in the polyribonucleotide comprise N4-acetylcytidine.
[0431] Embodiment 55. The polyribonucleotide of any one of embodiments 52 to 54, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of cytidine residues in the polyribonucleotide comprise N4-acetylcytidine.
[0432] Embodiment 56. The polyribonucleotide of any one of embodiments 50 to 55, wherein the one or more modified nucleotides comprise 5-hydroxymethyluridine.
[0433] Embodiment 57. The polyribonucleotide of embodiment 56, wherein at least 5% of uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine.
[0434] Embodiment 58. The polyribonucleotide of embodiment 56 or 57, wherein less than 100% of uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine.
[0435] Embodiment 59. The polyribonucleotide of any one of embodiments 56 to 58, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of uridine residues in the polyribonucleotide comprise 5-hydroxymethyluridine.
[0436] Embodiment 60. The polyribonucleotide of any one of embodiments 50 to 59, wherein the one or more modified nucleotides comprise one or more nucleosides comprising a modified ribose.
[0437] Embodiment 61. The polyribonucleotide of embodiment 60, wherein the modified ribose is 2’-O-acetylated.
[0438] Embodiment 62. The polyribonucleotide of embodiment 60 or 61, wherein at least 1%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% of the nucleosides of the polyribonucleotide comprise a 2-0 acetylated ribose.
[0439] Embodiment 63. The polyribonucleotide of any one of embodiments 60 to 62, wherein no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10% of the nucleosides of the polyribonucleotide comprise a 2-0 acetylated ribose.
[0440] Embodiment 64. The polyribonucleotide of any one of embodiments 1 to 63, wherein the 5 '-most nucleotide of the polyribonucleotide comprises a 5' triphosphate, 5' diphosphate, or a 5' monophosphate.
[0441] Embodiment 65. The polyribonucleotide of embodiment 64, wherein the 5 '-most nucleotide of the polyribonucleotide comprises a 5' monophosphate.
[0442] Embodiment 66. The polyribonucleotide of any one of embodiments 1 to 65, wherein the 3'-most nucleotide comprises a 3' hydroxyl.
[0443] Embodiment 67. The polyribonucleotide of any one of embodiments 1 to 66, wherein the polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise the first hybridization region or the second hybridization region.
[0444] Embodiment 68. The polyribonucleotide of any one of embodiments 1 to 67, wherein the polyribonucleotide circularizes with greater efficiency in the presence of an RNA ligase as compared to a polyribonucleotide that does not comprise the 5’ poly(A) overhang and the 3’ poly(A) overhang.
[0445] Embodiment 69. The polyribonucleotide of embodiment 67 or 68, wherein the RNA ligase is T4 RNA Ligase I or circLigase.
[0446] Embodiment 70. The polyribonucleotide of any one of embodiments 67 to 69, wherein efficiency of circularization is measured using one or more assays, wherein the one or more assays comprise an exonuclease digestion assay.
[0447] Embodiment 71. The polyribonucleotide of any one of embodiments 67 to 70, wherein efficiency of circularization is measured using one or more assays, wherein the one or more assays comprise a denaturing agarose gel.
[0448] Embodiment 72. The polyribonucleotide of any one of embodiments 67 to 71, wherein efficiency of circularization is measured using one or more assays, wherein the one or more assays comprise an HPLC assay.
[0449] Embodiment 73. The polyribonucleotide of any one of embodiments 67 to 72, wherein efficiency of circularization is measured using one or more assays, wherein the one or more assays comprise sequencing assay.
[0450] Embodiment 74. The polyribonucleotide of embodiment 73, wherein the sequencing assay comprises Nanopore® sequencing, Sanger sequencing, or next generation sequencing.
[0451] Embodiment 75. A composition comprising: a. two or more polyribonucleotides according to any one of embodiments 1- 74, wherein a subset of the two or more polyribonucleotides are linear polyribonucleotides, andthe subset of linear polyribonucleotides comprise a 5' monophosphate at the 5'-most nucleotide and a 3' hydroxyl at the 3 '-most nucleotide of the polyribonucleotide, and b. an RNA ligase.
[0452] Embodiment 76. The composition of embodiment 75, wherein the composition comprises 1 to 8 unit(s) of RNA ligase per pg of the two or more polyribonucleotides.
[0453] Embodiment 77. The composition of embodiment 75 or 76, wherein the composition comprises 3 to 6 units of RNA ligase per pg of the two or more polyribonucleotides.
[0454] Embodiment 78. The composition of any one of embodiments 75 to 77, wherein the composition comprises 6 units of RNA ligase per pg of the two or more polyribonucleotides.
[0455] Embodiment 79. The composition of any one of embodiments 75 to 77, wherein the composition comprises 3 units of RNA ligase per pg of the two or more polyribonucleotides.
[0456] Embodiment 80. The composition of any one of embodiments 75 to 79, wherein the ligase is a circLigase or a T4 RNA ligase.
[0457] Embodiment 81. The composition of any one of embodiments 75 to 80, wherein the composition comprises a 5’ pyrophosphohydrolase.
[0458] Embodiment 82. The composition of embodiment 81, wherein the composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0459] Embodiment 83. The composition of embodiment 81 or 82, wherein the composition comprises 5 to 10 units of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0460] Embodiment 84. The composition of any one of embodiments 81 to 83, wherein the composition comprises 5 units of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0461] Embodiment 85. The composition of any one of embodiments 81 to 83, wherein the composition comprises 10 units of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0462] Embodiment 86. The composition of any one of embodiments 81 to 85, wherein the 5’ pyrophosphohydrolase is RNA 5’ 5’ pyrophosphohydrolase (RppH).
[0463] Embodiment 87. The composition of any one of embodiments 75 to 86, wherein the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 50 °C.
[0464] Embodiment 88. The composition of embodiment 87, wherein at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 50 °C.
[0465] Embodiment 89. The composition of any one of embodiments 75 to 88, wherein the linear polyribonucleotides circularize when the composition is incubated for 2 hours at 37 °C.
[0466] Embodiment 90. The composition of embodiment 89, wherein at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the linear polyribonucleotides circularize when the composition is incubated for 2 hours at 37 °C.
[0467] Embodiment 91. The composition of any one of embodiments 75 to 90, wherein a subset of the two or more polyribonucleotides are circular polyribonucleotides.
[0468] Embodiment 92. A method of circularizing polyribonucleotides, comprising: i. incubating a composition comprising: a. two or more polyribonucleotides according to any one of embodiments 1- 74, and wherein the two or more polyribonucleotides comprise linear polyribonucleotides, b. an RNA ligase; wherein a subset of the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C.
[0469] Embodiment 93. The method of embodiment 92, wherein the composition comprises 1 to 8 unit(s) of RNA ligase per pg of the two or more polyribonucleotides.
[0470] Embodiment 94. The method of embodiment 92 or 93, wherein the composition comprises 3 to 6 units of RNA ligase per pg of the two or more polyribonucleotides.
[0471] Embodiment 95. The method of any one of embodiments 92 to 94, wherein the composition comprises 6 units of RNA ligase per pg of the two or more polyribonucleotides.
[0472] Embodiment 96. The method of any one of embodiments 92 to 94, wherein the composition comprises 3 units of RNA ligase per pg of the two or more polyribonucleotides.
[0473] Embodiment 97. The method of any one of embodiments 92 to 96, wherein the ligase is a circLigase or a T4 RNA ligase.
[0474] Embodiment 98. The method of any one of embodiments 92 to 97, wherein the composition further comprises an osmolyte.
[0475] Embodiment 99. The method of embodiment 98, wherein the osmolyte is an amino acid-based osmolyte.
[0476] Embodiment 100. The method of embodiment 99 wherein the amino acid-based osmolyte comprises a glycine-based osmolyte.
[0477] Embodiment 101. The method of embodiment 100, wherein the glycine-based osmolyte comprise betaine.
[0478] Embodiment 102. The method of any one of embodiments 92 to 101, wherein the linear polyribonucleotides comprise a 5' monophosphate at the 5'-most nucleotide.
[0479] Embodiment 103. The method of any one of embodiments 92 to 102, wherein the linear polyribonucleotides comprise a 3' hydroxyl at the 3 '-most nucleotide of the polyribonucleotide.
[0480] Embodiment 104. The method of any one of embodiments 92 to 103, the composition is incubated for 1 to 3 hours.
[0481] Embodiment 105. The method of any one of embodiments 92 to 104, the composition is incubated for 2 hours.
[0482] Embodiment 106. The method of any one of embodiments 92 to 105, the composition is incubated at 20 °C to 40 °C.
[0483] Embodiment 107. The method of any one of embodiments 92 to 106, the composition is incubated at 25 °C.
[0484] Embodiment 108. The method of any one of embodiments 92 to 107, wherein at least30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least96%, at least 97%, at least 98%, at least 99%, or 100% of the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C.
[0485] Embodiment 109. The method of any one of embodiments 92 to 108, wherein at least 85% of the linear polyribonucleotides circularize when the composition is incubated for 2 hours at 37 °C.
[0486] Embodiment 110. The method of any one of embodiments 92 to 109, wherein the composition further comprises a 5’ pyrophosphohydrolase.
[0487] Embodiment 111. The method of embodiment 110, wherein the composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0488] Embodiment 112. The method of embodiment 110 or 111, wherein the composition comprises 5 to 10 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0489] Embodiment 113. The method of any one of embodiments 110 to 112, wherein the composition comprises 5 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0490] Embodiment 114. The method of any one of embodiments 110 to 112, wherein the composition comprises 10 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0491] Embodiment 115. The method of any one of embodiments 110 to 114, wherein the 5’ pyrophosphohydrolase is RNA 5’ pyrophosphohydrolase (RppH).
[0492] Embodiment 116. The method of any one of embodiments 92 to 109, wherein the method further comprises incubating the two or more polyribonucleotides with a 5’ pyrophosphohydrolase.
[0493] Embodiment 117. The method of embodiment 116, wherein the step of incubating the two or more polyribonucleotides with the 5’ pyrophosphohydrolase occurs prior to the step of incubating the composition comprising the two or more polyribonucleotides with the RNA ligase.
[0494] Embodiment 118. The method of embodiment 116 or 117, wherein the composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
[0495] Embodiment 119. The method of any one of embodiments 116 to 118, wherein the composition comprises 5 to 10 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0496] Embodiment 120. The method of any one of embodiments 116 to 119, wherein the composition comprises 5 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0497] Embodiment 121. The method of any one of embodiments 116 to 119, wherein the composition comprises 10 units of 5’ pyrophosphohydrolase per pg of the two or more linear polyribonucleotides.
[0498] Embodiment 122. The method of any one of embodiments 116 to 121, wherein the 5’ pyrophosphohydrolase is RNA 5’ pyrophosphohydrolase (RppH).
[0499] Embodiment 123. The method of any one of embodiments 92 to 122, further comprising digesting the incubated composition with an exonuclease for 0.5 hours to 2 hours at 20 °C to 50 °C, and wherein the exonuclease degrades linear polyribonucleotides.
[0500] Embodiment 124. The method of embodiment 123, wherein digesting with the exonuclease is for 1 hour at 37 °C.
[0501] Embodiment 125. The method of embodiment 123 or 124, wherein the exonuclease is XRN-1, RNaseR, or ExoT.
[0502] Embodiment 126. A polyribonucleotide of any one of embodiments 1 to 74 or a composition of any one of embodiments 75 to 91 for use in manufacturing circularized polyribonucleotides.
[0503] 127. A polyribonucleotide of any one of embodiments 1 to 74 or a composition of any one of embodiments 75 to 91 for use in manufacturing polyribonucleotides comprising a 5' monophosphate at the 5 '-most nucleotide.
[0504] Embodiment 128. Use of a polyribonucleotide of any one of embodiments 1 to 74 or a composition of any one of embodiments 75 to 91 in manufacturing circularized polyribonucleotides.
[0505] Embodiment 129. Use of a polyribonucleotide of any one of embodiments 1 to 74 or a composition of any one of embodiments 75 to 91 in manufacturing polyribonucleotides comprising a 5' monophosphate at the 5'-most nucleotide.
[0506] Embodiment 130. A kit comprising:i. polyribonucleotide of any one of embodiments 1 to 74, and ii. a ligase.
[0507] Embodiment 131. The kit of embodiment 130 further comprising a 5’ pyrophosphohydrolase.
[0508] Embodiment 132. A cell comprising a polyribonucleotide of any one of embodiments 1 to 74 or a composition of any one of embodiments 75 to 91.
[0509] Embodiment 133. A DNA molecule that encodes a polyribonucleotide of any one of embodiments 1 to 74.
[0510] Embodiment 134. A method of making a polyribonucleotide of any one of embodiments 1 to 74 comprising: incubating the DNA molecule of embodiment 133 with: i. an RNA polymerase, and ii. ribonucleotides.
[0511] Embodiment 135. The method of embodiment 134, wherein the ribonucleotides comprise one or more naturally occurring ribonucleotides.
[0512] Embodiment 136. The method of embodiment 134 or 135, wherein the ribonucleotides comprise one or more modified ribonucleotides.
[0513] Embodiment 137. The method of embodiment 136, wherein the one or more modified ribonucleotides comprise N4-acetylcytidine (ac4C), 5-hydroxymethyluridine (5hmu), N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5-formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methylwyosine (mimG), 5-hydroxy cytidine, 5- hydroxymethylcytidine, 5-carboxycytidine, 5-methoxycytidine, 5-propynylcytidine, 2- thiocytidine, 5-hydroxyuridine, 5-methyluridine, 5,6-dihydro-5-methyluridine, 2'-O- methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'-deoxyuridine, 2'-amino-2'- deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5-hydroxymethyluridine, 5- carboxyuridine, 5 -carboxymethylesteruridine, 5-formyluridine, 5-methoxyuridine, 5- propynyluridine, 5 -bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl- pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl -methylpseudouridine, Nl-ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2- aminoadenosine, 3 -methyladenosine, 7-deazaadenosine, 8-oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-O-methylguanine, or any combination thereof.
[0514] Embodiment 137b. The method of embodiment 136, wherein the one or more modified nucleotides comprise one or more nucleosides comprising a modified ribose.
[0515] Embodiment 137b 1. The method of embodiment 137b, wherein the modified ribose is 2’-O-acetylated.
[0516] Embodiment 138. A pharmaceutical composition comprising a circularized RNA produced by a method according to any one of embodiments 92 to 125.
[0517] Embodiment 139. The pharmaceutical composition of embodiment 138, further comprising a plurality of lipid nanoparticles or liposomes, wherein the circular RNA is partially or fully encapsulated by lipid nanoparticles of liposomes of the plurality.
[0518] Embodiment 140. A method comprising administering a pharmaceutical composition according to embodiment 138 or 139 to a subject in need thereof.
[0519] Embodiment 141. Use of a circularized RNA produced by a method according to any one of embodiments 92 to 125 in the manufacture of a medicament for treating a subject in need thereof.EQUIVALENTS
[0520] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Further, it should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the claims that follow.
Claims
CLAIMS1. A method of circularizing polyribonucleotides, comprising: i. incubating a composition comprising: a. two or more polyribonucleotides, wherein the two or more polyribonucleotides comprise linear polyribonucleotides, b. an RNA ligase; wherein a subset of the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C, and wherein at least one of the polyribonucleotides comprises a. a 5’ end comprising a 5 ’-most nucleotide, b. a 3’ end comprising a 3 ’-most nucleotide, and c. a first hybridization region and a second hybridization region, wherein the ribonucleotide sequence of the second hybridization region is a reverse complement of the ribonucleotide sequence of the first hybridization region.
2. The method of claim 1, wherein the first hybridization region is 10 to 50 nucleotides in length.
3. The method of claim 1 or claim 2, wherein the ribonucleotide sequence of the first hybridization region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14.
4. The method of any one of claims 1 to 3, wherein there are no more than 25 nucleotides between a 5 '-most nucleotide of the first hybridization region and the 5 '-most nucleotide of the polyribonucleotide.
5. The method of any one of claims 1 to 4, wherein the second hybridization region is 10 to 50 nucleotides in length.
6. The method of any one of claims 1 to 5, wherein the ribonucleotide sequence of the second hybridization region is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15.
7. The method of any one of claims 1 to 6, wherein there are no more than 25 nucleotides between a 3 '-most nucleotide of the second hybridization region and the 3 '-most nucleotide of the polyribonucleotide.
8. The method of any one of claims 1 to 7, wherein the polyribonucleotide further comprises a 5’ polyadenylate (poly(A)) overhang.
9. The method of claim 8, wherein the 5’ poly(A) overhang is 2-8 nucleotides in length.
10. The method of any one of claims 1 to 9, wherein the polyribonucleotide further comprises a 3’ poly(A) overhang.
11. The method of claim 10, wherein the 3 ’ poly(A) overhang is 2-8 nucleotides in length.
12. The method of any one of claims 1 to 11, wherein the polyribonucleotide comprises one or more spacers.
13. The method of any one of claims 1 to 12, wherein the polyribonucleotide comprises an internal ribosomal entry site (IRES).
14. The method of any one of claims 1 to 13, wherein the polyribonucleotide comprises a 5’ UTR.
15. The method of any one of claims 1 to 14, wherein the polyribonucleotide comprises a 3’UTR.
16. The method of any one of claims 1 to 15, wherein the polyribonucleotide comprises a payload sequence.
17. The method of any one of claims 1 to 16, wherein the polyribonucleotide comprises one or more modified nucleotides.
18. The method of claim 17, wherein the one or more modified nucleotides comprise N4- acetylcytidine (ac4C), 5-hydroxymethyluridine (5hmu), N1 -methylpseudouridine, pyridin-4-one ribonucleoside, 5 -aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 5-methyl cytidine (m5C), 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), 5- formyl-cytidine (f5C), N4-methyl-cytidine (m4C), 2-amino-purine, 2, 6-di aminopurine, 2-amino- 6-halo-purine, 6-halo-purine, inosine (I), 1 -methyl -inosine (ml I), wyosine (imG), methylwyosine (mimG), 5-hydroxycytidine, 5-hydroxymethylcytidine, 5-carboxycytidine, 5- methoxycytidine, 5-propynylcytidine, 2-thiocytidine, 5 -hydroxyuridine, 5 -methyluridine, 5,6- dihydro-5-methyluridine, 2'-O-methyluridine, 2'-O-methyl-5-methyluridine, 2'-fluoro-2'- deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 4-thiouridine, 5- hydroxymethyluridine, 5-carboxyuridine, 5-carboxymethylesteruridine, 5-formyluridine, 5- methoxyuridine, 5-propynyluridine, 5-bromouridine, 5-iodouridine, 5-fluorouridine, pseudouridine, 2'-O-methyl-pseudouridine, N 1 -hydroxypseudouridine, 2'-O-methyl-Nl- methylpseudouridine, N1 -ethylpseudouridine, N1 -hydroxymethylpseudouridine, and arauridine, N 6-methyladenosine, 2-aminoadenosine, 3-methyladenosine, 7-deazaadenosine, 8- oxoadenosine, inosine, thienoguanosine, 7-deazaguanosine, 8-oxoguanosine, 6-0- methylguanine, or any combination thereof.
19. The method of claim 17 or claim 18, wherein the one or more modified nucleotides comprise one or more nucleosides comprising a modified ribose.
20. The method of claim 19, wherein the modified ribose is 2’-0-acetylated.
21. The method of any one of claims 1 to 20, wherein the 5 '-most nucleotide of the polyribonucleotide comprises a 5' monophosphate and the 3 '-most nucleotide comprises a 3' hydroxyl.
22. The method of any one of claims 1 to 21, wherein the composition comprises 1 to 8 unit(s) of RNA ligase per pg of the two or more polyribonucleotides.
23. The method of any one of claims 1 to 22, wherein the ligase is a circLigase or a T4 RNA ligase.
24. The method of any one of claims 1 to 23, wherein the composition further comprises an osmolyte.
25. The method of any one of claims 1 to 24, wherein the linear polyribonucleotides comprise a 5' monophosphate at the 5'-most nucleotide and a 3' hydroxyl at the 3'-most nucleotide of the polyribonucleotide.
26. The method of any one of claims 1 to 25, the composition is incubated for 1 to 3 hours.
27. The method of any one of claims 1 to 26, the composition is incubated at 20 °C to 40 °C.
28. The method of any one of claims 1 to 27, wherein at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the linear polyribonucleotides circularize when the composition is incubated for 1 hour to 3 hours at 20 °C to 40 °C.
29. The method of any one of claims 1 to 28, wherein the composition further comprises a 5’ pyrophosphohydrolase.
30. The method of claim 29, wherein the composition comprises 1 to 20 unit(s) of 5’ pyrophosphohydrolase per pg of the two or more polyribonucleotides.
31. The method of claim 29 or claim 30, wherein the 5’ pyrophosphohydrolase is RNA 5’ pyrophosphohydrolase (RppH).
32. The method of any one of claims 1 to 28, wherein the method further comprises incubating the two or more polyribonucleotides with a 5’ pyrophosphohydrolase.
33. The method of claim 32, wherein the step of incubating the two or more polyribonucleotides with the 5’ pyrophosphohydrolase occurs prior to the step of incubating the composition comprising the two or more polyribonucleotides with the RNA ligase.
34. The method of claim 32 or 33, wherein the 5’ pyrophosphohydrolase is RNA 5’ pyrophosphohydrolase (RppH).
35. The method of any one of claims 1 to 34, further comprising digesting the incubated composition with an exonuclease for 0.5 hours to 2 hours at 20 °C to 50 °C, and wherein the exonuclease degrades linear polyribonucleotides.
36. The method of claim 35 wherein the exonuclease is XRN-1, RNaseR, or ExoT.
37. A pharmaceutical composition comprising a circularized RNA produced by a method according to any one of claims 1 to 36.
38. A method comprising administering a pharmaceutical composition according to claim 37 to a subject in need thereof.
39. Use of a circularized RNA produced by a method according to any one of claims 1 to 36 in the manufacture of a medicament for treating a subject in need thereof.
Citation Information
Patent Citations
Compositions and methods for transient gene therapy with enhanced stability
WO2016197121A1