Inhibitors of expression and / or function

WO2025125576A3PCT designated stage expired Publication Date: 2025-08-14E THERAPEUTICS LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/086234
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-06
Filing Date
2024-12-13
Publication Date
2025-08-14

AI Technical Summary

Technical Problem

Current therapeutic options for diseases associated with the SLC25A5/ANT2 gene, such as non-alcoholic fatty liver disease (NAFLD) and obesity, are limited in effectiveness.

Method used

Development of siRNA oligomers conjugated with ligand moieties, specifically targeting the SLC25A5/ANT2 gene for inhibition of its expression and function.

Benefits of technology

The siRNA oligomers effectively reduce the expression and function of SLC25A5/ANT2, providing a therapeutic approach for treating metabolic diseases like NAFLD and obesity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to inhibitors, and compositions containing inhibitors, and uses of the same in the treatment or prevention of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] INHIBITORS OF EXPRESSION AND / OR FUNCTION FIELD The present invention provides inhibitors, such as nucleic acid compounds, such as siRNA, suitable for therapeutic use. Additionally, the present invention provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and condition BACKGROUND OF THE INVENTION Inhibitors, such as oligonucleoside / oligonucleotide compounds which are inhibitors of gene expression and / or expression or function of other targets such as LNCRNAs, can have important therapeutic applications in medicine. Oligonucleotides / oligonucleosides can be used to silence genes that are responsible for a particular disease. Gene-silencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleoside / oligonucleotides that prevent the formation of proteins by gene-silencing. A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for the treatment of various diseases including central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases. The present invention relates to inhibitors, such oligomers e.g. nucleic acids, e.g. oligonucleoside / oligonucleotide compounds, and their use in the treatment and / or prevention of disease. The SLC25A5 gene belongs to the ANT gene family, which itself belongs to the superfamily that includes genes encoding brown fat mitochondrial uncoupling proteins and mitochondrial phosphate carrier proteins. This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene, adenine nucleotide translocator 2 (ANT2), functions as a major constituent of the mitochondrial permeability-transition pore complex that catalyses the exchange of mitochondrial ATP with cytosolic ADP. As a result of its antiporter function, ANT2 maintains mitochondrial membrane potential by regulating ADP / ATP ratios in oxidative phosphorylation. ANT2 facilitates uncoupling of the mitochondrial membrane when acylated by SIRT4. Though uncoupling the membrane potential typically leads to apoptosis, ANT2 was found to be antiapoptotic. As a result, it is postulated to mediate the TFIIH- dependent response to DNA damage as a component of the MMS19-XPD. STATEMENTS OF INVENTION The invention is defined as in the claims and relates to, inter alia: In one aspect, the invention relates to an inhibitor of expression and / or function of SLC25A5 / ANT2, wherein said inhibitor is conjugated to one or more ligand moieties. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said inhibitor is an siRNA oligomer. In another aspect, the invention relates to an inhibitor of expression and / or function of SLC25A5 / ANT2, wherein said inhibitor is an siRNA oligomer. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one or more GalNAc ligand derivatives. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligand derivatives. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the target of the inhibitor is SLC25A5 / ANT2. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the inhibitor is a nucleic acid for inhibiting expression of SLC25A5 comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand sequences as listed in Table 2. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the inhibitor is a nucleic acid for inhibiting expression of SLC25A5 comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the first strand modified sequences as listed in Table 3. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in claim 8 or 9, in particular wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in Tables 2 or 3. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand sequences as listed in Table 2, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of the second strand modified sequences as listed in Table 4, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the first strand sequences as listed in Table 2. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the first strand modified sequences as listed in Table 3. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the second strand sequences as listed in Table 2. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the first strand modified sequences as listed in Table 4. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO:304, SEQ ID NO:323, SEQ ID NO:439, SEQ ID NO:453 and SEQ ID NO:496. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 304 or SEQ ID NO: 280. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the following sequences: SEQ ID NO:856, SEQ ID NO:875, SEQ ID NO:991, SEQ ID NO:1005 and SEQ ID NO:1048. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises SEQ ID NO: 856 or SEQ ID NO: 832. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO:580 or SEQ ID NO: 556. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the following sequences: SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises SEQ ID NO:1132 or SEQ ID NO:1108. In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 304 SEQ ID NO: 580 SEQ ID NO: 323 SEQ ID NO: 599 SEQ ID NO: 439 SEQ ID NO: 715 SEQ ID NO: 453 SEQ ID NO: 729 SEQ ID NO: 496 SEQ ID NO: 772 In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 304 SEQ ID NO: 580 In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 280 SEQ ID NO: 556 In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Modified first strand Modified second strand SEQ ID NO: 856 SEQ ID NO: 1132 SEQ ID NO: 875 SEQ ID NO: 1151 SEQ ID NO: 991 SEQ ID NO: 1267 SEQ ID NO: 1005 SEQ ID NO: 1281 SEQ ID NO: 1048 SEQ ID NO: 1324 In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Modified first strand Modified second strand SEQ ID NO: 856 SEQ ID NO: 1132 In a further aspect, the invention relates to an inhibitor according to the invention, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Modified first strand Modified second strand SEQ ID NO: 856 SEQ ID NO: 1132 In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 or 23 nucleosides in length. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the SLC25A5 gene is between 17 and 30 nucleosides in length. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3’ terminus of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the nucleic acid is an siRNA oligonucleoside. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises: i) 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii) 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or iii) 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv) 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v) 2, or more than 2, consecutive abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or vi) a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii) a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or viii) an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix) abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards that terminus; x) abasic nucleosides as the 2 terminal nucleosides connected via a 3’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3’-3’ reversed linkage; xii) abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the reversed internucleoside linkage is a 3’3 reversed linkage. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the reversed internucleoside linkage is a 5’5 reversed linkage. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 5-5’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. An inhibitor, or inhibitor for use, according to the invention wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 5’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the 2 consecutive inverted abasic nucleosides in the 5’ terminal region of the second strand present as the following 5’ terminal motif wherein: T represents a 2’Me ribose modification, B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of the second strand, and Z represents the remaining 19 contiguous basic nucleosides of said second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises a 2’-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises a 2’-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first and second strand each comprise 2'-Me and 2’-F modifications. In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand. In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, wherein the siRNA comprises 3 or more 2’-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 72’-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2’-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand. In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, wherein said first strand comprises at least 52’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3’ terminal region. In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA wherein said first strand comprises 72’-Me consecutive modifications at the 3’ terminal region, preferably including the terminal nucleoside at the 3’ terminal region. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate internucleoside linkages. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ or 3’ near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located as defined herein. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably a terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3’ terminal region thereof. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA through a linker. In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the siRNA oligomer, preferably at the 3’ terminal region thereof. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the ligand moiety comprises

[0002] . In a further aspect, the invention relates to an inhibitor according to the invention, comprising the structure: wherein: R1at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligonucleoside moiety. In a further aspect, the invention relates to an inhibitor according to the invention, comprising the structure , wherein oligonucleotide represents the contiguous nucleosides of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, comprising the structure wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleoside moiety. In a further aspect, the invention relates to an inhibitor according to the invention, comprising the structure , wherein oligonucleotide represents the contiguous nucleosides of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, wherein the structure is conjugated to the 3’ terminal region of the second strand. In a further aspect, the invention relates to an inhibitor according to the invention, formulated as a pharmaceutical composition with an excipient and / or carrier. In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to one or more preceding aspects, in combination with a pharmaceutically acceptable excipient or carrier. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, further comprising a GLP-1 agonist and / or a THR-beta agonist. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, wherein the GLP-1 agonist is semaglutide. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, wherein the THR-beta agonist is resmetirom. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, wherein the GLP-1 / GIP dual agonist is tirzepatide. In a further aspect, the invention relates to the pharmaceutical composition according to the invention, further comprising one or more of: an amylin receptor agonist (such as pramlintide), and / or a dual amylin + calcitonin receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (such as cilofexor or obeticholic acid), and / or an FGF-21 analogue or FGF-21 receptor agonist (such as efruxifermin), and / or an FGF-19 analogue or FGF-19 receptor agonist (such as aldafermin), and / or a galectin 3 inhibitor (such as belapectin), and / or a PPAR^ agonist (such as elafibrinor), and / or a PPAR^ agonist (such as pioglitazone or rosiglitazone), and / or a mixed PPAR^ and / or ^ and / or ^ agonist, and / or a pan PPAR^^^ agonist (such as lanafibranor), and / or an acetyl CoA desaturase activator, and / or an ASK1 inhibitor (such as selonsertib), and / or an LOXL2 inhibitor (such as simtuzumab), and / or a dual CCR2 / 5 inhibitor (such as cenicriviroc), and / or an inhibitor of an enzyme in the de novo lipogenesis (DNL) pathway including citrate / isocitrate carrier (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), and / or an inhibitor of an enzyme in the cholesterol biosynthesis pathway (such as an HMGCoA reductase inhibitor, such as atorvastatin). In another aspect, the invention relates to an inhibitor according to the invention or a pharmaceutical composition according to the invention for use in therapy. In another aspect, the invention relates to an inhibitor according to the invention or a pharmaceutical composition according to the invention for use in the prevention and / or treatment of metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or for use in reducing adipogenesis. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the inhibitor or the pharmaceutical composition is to be used in combination with a GLP-1 agonist and / or a THR-beta agonist. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the GLP-1 agonist is semaglutide. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the THR-beta agonist is resmetirom. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the GLP-1 / GIP dual agonist is tirzepatide. In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the inhibitor or the pharmaceutical composition is to be used in combination with one or more of: an amylin receptor agonist (such as pramlintide), and / or a dual amylin + calcitonin receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (such as cilofexor or obeticholic acid), and / or an FGF-21 analogue or FGF-21 receptor agonist (such as efruxifermin), and / or an FGF-19 analogue or FGF-19 receptor agonist (such as aldafermin), and / or a galectin 3 inhibitor (such as belapectin), and / or a PPAR^ agonist (such as elafibrinor), and / or a PPAR^ agonist (such as pioglitazone or rosiglitazone), and / or a mixed PPAR^ and / or ^ and / or ^ agonist, and / or a pan PPAR^^^ agonist (such as lanafibranor), and / or an acetyl CoA desaturase activator, and / or an ASK1 inhibitor (such as selonsertib), and / or an LOXL2 inhibitor (such as simtuzumab), and / or a dual CCR2 / 5 inhibitor (such as cenicriviroc), and / or an inhibitor of an enzyme in the de novo lipogenesis (DNL) pathway including citrate / isocitrate carrier (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), and / or an inhibitor of an enzyme in the cholesterol biosynthesis pathway (such as an HMGCoA reductase inhibitor, such as atorvastatin). In another aspect, the invention relates to the use of SLC25A5 / ANT2 as a target for identifying one or more therapeutic agents for the treatment or prevention of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or for reducing adipogenesis. In another aspect, the invention relates to a method of treating or preventing metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or a method of reducing adipogenesis, which comprises administering to a patient an inhibitor of expression and / or function of SLC25A5 / ANT2, such as an inhibitor according to the invention. In a further aspect, the invention relates to a method according to the invention, wherein the inhibitor of expression and / or function of SLC25A5 / ANT2 is administered together with a GLP-1 agonist and / or a THR-beta agonist. In a further aspect, the invention relates to a method according to the invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP- 1 / GIP / GCGR triple agonist. In a further aspect, the invention relates to a method according to the invention, wherein the GLP-1 agonist is semaglutide. In a further aspect, the invention relates to a method according to the invention, wherein the GLP-1 / GIP dual agonist is tirzepatide. In a further aspect, the invention relates to a method according to the invention, wherein the THR-beta agonist is resmetirom. In a further aspect, the invention relates to a method according to the invention, wherein the inhibitor of expression and / or function of SLC25A5 / ANT2 is administered together with one or more of: an amylin receptor agonist (such as pramlintide), and / or a dual amylin + calcitonin receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (such as cilofexor or obeticholic acid), and / or an FGF-21 analogue or FGF-21 receptor agonist (such as efruxifermin), and / or an FGF-19 analogue or FGF-19 receptor agonist (such as aldafermin), and / or a galectin 3 inhibitor (such as belapectin), and / or a PPAR^ agonist (such as elafibrinor), and / or a PPAR^ agonist (such as pioglitazone or rosiglitazone), and / or a mixed PPAR^ and / or ^ and / or ^ agonist, and / or a pan PPAR^^^ agonist (such as lanafibranor), and / or an acetyl CoA desaturase activator, and / or an ASK1 inhibitor (such as selonsertib), and / or an LOXL2 inhibitor (such as simtuzumab), and / or a dual CCR2 / 5 inhibitor (such as cenicriviroc), and / or an inhibitor of an enzyme in the de novo lipogenesis (DNL) pathway including citrate / isocitrate carrier (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), and / or an inhibitor of an enzyme in the cholesterol biosynthesis pathway (such as an HMGCoA reductase inhibitor, such as atorvastatin). In another aspect, the invention relates to the use of an inhibitor according to the invention or a pharmaceutical composition according to the invention, in the preparation of a medicament for the treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non- alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or for reducing adipogenesis In another aspect, the invention relates to SLC25A5 / ANT2 for use as a biomarker of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis. In another aspect, the invention relates to SLC25A5 / ANT2 for use in an in vivo method of predicting susceptibility to prevention and / or treatment of metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis, typically by monitoring the sequence and / or level of expression and / or function of SLC25A5 / ANT2 in a sample obtained from a patient. In another aspect, the invention relates to a method of predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis, in a patient, said method comprising: (a) obtaining a sample from the patient, (b) detecting the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient, (c) predicting susceptibility to a disease related to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis, based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient, (d) preferably administering to the diagnosed patient an effective amount of an inhibitor of SLC25A5 / ANT2. FIGURES Figure 1a: An exemplary linear configuration for a conjugate. Figure 1b: An exemplary branched configuration for a conjugate. Figure 2: Linker and ligand portions of constructs suitable for use according to the present invention including tether 1a. While Figure 2 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein. It should also be understood that while Figure 2 depicts as a product molecules based on the linker and ligand portions as specifically depicted in Figure 2 attached to an oligonucleoside moiety as also depicted herein, this product may alternatively further comprise, or consist essentially of, molecules wherein the linker and ligand portions are essentially as depicted in Figure 2 attached to an oligonucleoside moiety but having the F substituent as shown in Figure 2 on the cyclo-octyl ring replaced by a substituent, which could occur as a result of hydrolytic displacement, such as an OH substituent, or the OH substituent could be synthesized as a linker in its own right. In this way, (a) tether 1a constructs can consist essentially of molecules having linker and ligand portions specifically as depicted in Figure 2, with a F substituent on the cyclo-octyl ring; or (b) tether 1a constructs can consist essentially of molecules having linker and ligand portions essentially as depicted in Figure 2 but having the F substituent as shown in Figure 2 on the cyclo- octyl ring replaced by an OH substituent, or (c) tether 1a constructs can comprise a mixture of molecules as defined in (a) and / or (b). Figure 3: Linker and ligand portions of constructs suitable for use according to the present invention including tether 1b. While Figure 3 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein. The comments made in relation to Figure 2 and the possible replacement of the F substituent as shown in Figure 2 on the cyclo-octyl ring replaced by a substituent, which could occur as a result of hydrolytic displacement, such as an OH substituent, or the OH substituent could be synthesized as a linker in its own right, apply equally to tether 1b constructs. In this way, (a) tether 1b constructs can consist essentially of molecules having linker and ligand portions specifically as depicted in Figure 3, with a F substituent on the cyclo-octyl ring; or (b) tether 1b constructs can consist essentially of molecules having linker and ligand portions essentially as depicted in Figure 3 but having the F substituent as shown in Figure 3 on the cyclo- octyl ring replaced by an OH substituent, or (c) tether 1b constructs can comprise a mixture of molecules as defined in (a) and / or (b). Figure 4: Linker and ligand portions of constructs suitable for use according to the present invention including tether 2a. While Figure 4 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein. Figure 5: Linker and ligand portions of constructs suitable for use according to the present invention including tether 2b. While Figure 5 depicts the linker to be conjugated to an oligonucleotide, it is to be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside as disclosed herein. Figure 6: Formulae described in Sentences 1-101 disclosed herein. Figure 7: Formulae described in Clauses 1-56 disclosed herein. Figures 8a and 8b: Inverted abasic constructs that can be used with nucleic acid sequences according to the present invention as described herein. For Figure 8a, a GalNAc linker is attached to the 5’ end region of the sense strand in use (not depicted in Figure 8a). For Figure 8b, a GalNAc linker is attached to the 3’ end region of the sense strand in use (not depicted in Figure 8b). iaia as shown at the 3’ end region of the sense strand in Figure 8a represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides at the 3’ end region of the sense strand, (ii) wherein a 3’-3’ reversed linkage is provided between the antepenultimate nucleoside (namely at position 21 of the sense strand, wherein position 1 is the terminal 5’ nucleoside of the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleosides is 5’-3’ when reading towards the 3’ end region comprising the terminal and penultimate abasic nucleosides. iaia as shown at the 5’ end region of the sense strand in Figure 8b represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides at the 5’ end region of the sense strand, (ii) wherein a 5’-5’ reversed linkage is provided between the antepenultimate nucleoside (namely at position 1 of the sense strand, not including the iaia motif at the 5’ end region of the sense strand in the nucleoside position numbering on the sense strand) and the adjacent penultimate abasic residue of the sense strand, and (iii) the linkage between the terminal and penultimate abasic nucleosides is 3’-5’ when reading towards the 5’ end region comprising the terminal and penultimate abasic nucleosides. Figures 9a and 9b: Duplex constructs according to Table 5. Figures 10: Summary of mRNA and protein knockdown effects of a single dose of GalNAc-siRNAs, ETX- M00001397, ETX-M00001570, ETX-M00001378, ETX-M00001513, and ETX-M00001527 (1 mg / kg or 3 mg / kg) in mouse liver tissues. As a negative control, a non-target specific siRNA was used. The y-axis values are the relative mRNA or protein expression and data is normalized to the saline control group (n=4). Each data point represents the relative mRNA or protein expression as Mean ± SEM from n=4 experiment. Figure 11: Liver samples stained with H&E were given a score for NAFLD Activity Score (NAS) using the clinical criteria outlined by Kleiner et al. (2005). Total NAS represents the sum of scores for steatosis, inflammation, and ballooning, and ranges from 0-8. NAS score was determined by Gubra Histopathological Objective Scoring Technology (GHOST) deep learning app developed by Gubra using the VIS software (Visiopharm, Denmark) for a more accurate and objective method for staging disease in DIO-NASH mouse models. Results are presented as change in NAS score (improvement or worsening) at study termination compared to the pre-dose biopsy. Also shown is the percentage of animals with at least a 1- or 2-point improvement in NAS. Figure 12: ALT and AST were measured in plasma samples after 12 weeks ETX-312 (ETX-M00001378) treatment using commercial kits (Roche Diagnostics), on the cobas c501 autoanalyzer. ALT and AST levels were increased in DIO-NASH mice (vehicle sc, siCtrl, vehicle PO). Treatment with ETX-312 (ETX- M00001378) alone or in combination with semaglutide or resmetirom significantly reduced both ALT and AST levels. Results are presented as absolute levels as Mean ± SEM from n=16 experiment. * p < 0.05; *** p < 0.001; **** p < 0.0001. Figure 13: TIMP-1 and PIIINP are non-invasive blood biomarkers for NAFLD / NASH that predict hepatic fibrosis. TIMP-1 was measured in plasma collected in EDTA tubes using a commercial ELISA kit (R&D Systems). PIIINP was measured in plasma collected in EDTA tubes using a commercial ELISA kit (Cusabio). TIMP-1 and PIIINP levels were increased in DIO-NASH mice (vehicle sc, siCtrl, vehicle PO). Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or resmetirom significantly reduced both TIMP-1 and PIIINP levels. Results are presented as absolute levels as Mean ± SEM from n=16 experiment. An outlier analysis was conducted by comparing the studentised residuals of the linear model fitted to the subcutaneous treatment subset of the data to the critical Bonferroni alpha level (0.05 / 88 = ~0.00057). One animal in the semaglutide group was identified as an outlier which was verified by an influence analysis. This animal was concluded as both highly outlying and influential and was excluded from all TIMP-1 and PIIINP analysis. * p < 0.05; *** p < 0.001; **** p < 0.0001. Figure 14: Terminal liver weight to body weight ratio demonstrates hepatomegaly in DIO-NASH mice. Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or resmetirom significantly reduced liver to body weight ratio. Results are presented as percent liver:body weight as Mean ± SEM from n=16 experiment. ** p < 0.01; **** p < 0.0001. Figure 15: Overview of Human Hydrodynamic Injection (HDI) Mouse study. Figure 16: Human SLC25A5 mRNA knockdown in Hydrodynamic Injection (HDI) mouse model. Mice received siRNA (3 mg / kg) subcutaneously on Day -6, followed by HDI of human SLC25A5 plasmid on Day 0. qPCR on Day 1 confirmed reduced human SLC25A5 mRNA expression, with several siRNAs including ETX-M00001378 (ETX-M00001751) and ETX-M00001354 (ETX-M00002666) showing the most significant knockdown relative to controls. Data is represented as Mean + / - SEM from n=5 experiment. *** p < 0.001; **** p < 0.0001. Figure 17: Overview of single-dose, 84-day study in non-human primates (NHPs). Figure 18: Hepatic SLC25A5 mRNA Knockdown and ANT2 Protein Reduction in NHPs Treated with ETX-M00001378 (ETX-M00001751) and ETX-M00001354 (ETX-M00002666). Non-naïve cynomolgus macaques received a single 3 mg / kg subcutaneous dose of ETX siRNAs, with liver biopsies on Days -7, 28, 56, and 84. Treatment resulted in up to a 72% reduction in hepatic SLC25A5 mRNA and a 57-60% reduction in ANT2 protein, with ANT2 levels sustained at approximately a 40% reduction through Day 84. Data is represented as Mean + / - SEM. The syringe icon represents a single subcutaneous dose of 3 mg / kg. Figure 19: Tolerability of ETX-M00001378 (ETX-M00001751) and ETX-M00001354 (ETX- M00002666) in NHPs. Plasma markers of hepatic function (ALT, AST, ALP, GGT) were assessed pre- treatment (Days 0), and on Days 14, 28, 56, and 84 post-treatment. All markers remained within normal ranges, indicating good tolerability. ALT: Alanine Transaminase; AST: Aspartate Transaminase; ALP: Alkaline Phosphatase; GGT: Gamma-Glutamyltransferase. Dashed lines indicate the reference range for normal values. DETAILED DESCRIPTION The present invention, inter alia, provides inhibitors, for example oligomers such as nucleic acids, such as inhibitory RNA molecules (which may be referred to as iRNA or siRNA), and compositions containing the same which can affect expression of a target, for example by binding to mRNA transcribed from a gene. The target may be within a cell, e.g. a cell within a subject, such as a human. The inhibitors can be used to prevent and / or treat medical conditions associated with the e.g. the expression of a target gene. In particular the present invention identifies inhibitors of expression and / or function of SLC25A5 / ANT2 as useful in the prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis. ADP / ATP translocase 2 (ANT2) is a protein that in humans is encoded by the SLC25A5 gene on the X chromosome. This protein functions as an antiporter for ADP / ATP exchange between the mitochondrial matrix and cytoplasm. The present invention relates to an inhibitor of expression and / or function of SLC25A5 / ANT2. Accordingly, in certain embodiments, the invention relates to an inhibitor of expression of the SLC25A5 gene, such as an siRNA that targets an mRNA transcribed from the SLC25A5 gene. In certain embodiments, the invention relates to an inhibitor of function of the gene product ANT2. Both options are encompassed when it referred herein to an inhibitor of SLC25A5 / ANT2 or an inhibitor of the invention. In humans, ANT2 is encoded by the SLC25A5 gene (SEQ ID NO:1381). SEQ ID NO:1381 (SLC25A5) ATCGGCCATTTGCTTCGCTCCGCCCCGCAGCGCCGGAGTCAAAGCCGGTTCCCGGCCCAGTCCCGTCCT GCAGCAGTCTGCCTCCTCTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGG TGGAGTGGCCGCAGCCATCTCCAAGACGGCGGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAG GTACGTCCTGGGATCCAGGAGCCCAACCAGGAAGTGGGGGGAAGGGTCGCACAGAAGGCGGGCGCCC GAGGGGTGGCGGGGAGCGAACTCTAAAGACATGGCCAGGGAAGCGGCTTAGGAGAGGCCAGAGCGG GGCGCAGAGGCAGAACAGAAGTCAAACTGGTGGGAGGCGCCTTTAGTGACCTGAAGTAGTGAGTCTA GGAAGGGGCCGGGGGCAGAGGGCAGGACCAGGCTCTCGGCATCTCCGAGGCGGCGGACTCGGATGG AGCAGTTTCTGAGTGACGGCCTCCCCGGGCCTGGGCGTCAAGGGCGAAGGCCGAAAGCCGGCGTTAG AAAGAGGAACGCCAGTTCTTACCGAAGACCTCAAGGTCGCGGCAAGGAGATAACTGCCCGGGGGAGG CCATGCGCCCGGGTCCAGCGGCCTCCCAGCCCGCGGACGCGCTCAAACCTCGCCGGGCCGGAAGCCG GCGCCGGGAAGCGCGTGTGCCTTTTACGTCCGCCCCCGCGCAGCCGCGGCCGCTGCCGCCGCGTCTCC GCCTGCCTCCCTGCGCCGCGCGCTCTCCAGTGCCGGCTCTAGAGGGCGCTCCTGGGCTAGCGTGTAGG GCTGGCGGCGGCGGCGCTCGGGTCACCTCTGGGAGCGGAGTGGGGGCGGAGCGAGACGGAAGCAGCT CAGGAGACTTGAGGCGTAGGCTGCGGTCCCCAAGGTGACCGCGCCCTATGTGGGACTCGCCCTAATGC CTCTGAACCTGGGTTTGAGGTAATGACCTTTCTCCTAGGTCTGAAGGTCACGGGTCCGCTGGAGGATG CCCCCTCTCCACTCAGAGGGGTGGAGGCTTAATGCTACTGGTGCAGATCACCTCTTCCCCTGTGACAGC CTCAGAGGGTTGGGAGGGTCCAGCCAGTATGATATACGAAGACTAGATTTGAGAGAGGGGAGCCTAC CTTAAAGGGCATTGATCGAGATGGCATAAGCTCTTCTCTTTCCCTTCCCCATGGTTATAACTGTCCCTG TTGGCTTCCTTCCTGTCTGTTAGGTGCAGCATGCCAGCAAGCAGATCACTGCAGATAAGCAATACAAA GGCATTATAGACTGCGTGGTCCGTATTCCCAAGGAGCAGGGAGTTCTGTCCTTCTGGCGCGGTAACCT GGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTTAACTTCGCCTTCAAAGATAAATACAAGCAGA TCTTCCTGGGTGGTGTGGACAAGAGAACCCAGTTTTGGCTCTACTTTGCAGGGAATCTGGCATCGGGT GGTGCCGCAGGGGCCACATCCCTGTGTTTTGTGTACCCTCTTGATTTTGCCCGTACCCGTCTAGCAGCT GATGTGGGTAAAGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACA AATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGA GCCGCCTACTTCGGTATCTATGACACTGCAAAGGGTAAGTTTGCTGTGGGCTTTAACGTTGTGTTCTTA GGAGACAGTTTAAAAGAGCATTGTACCAACCTAACAGTCCAAGAGCTAAAGAGTTGTTTTTTTAATTG CTAAAGGAAGCCAAGATCATCCAATGCAACCCTTGTGTACAGATGACGTGTTTAGGGGATGTGGGGA AAGGAAGTCAGTAAAACTCTGCTTTTTGGTAAAAGCATCTCTTTCCTATTCCCAGGAATGCTTCCGGAT CCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGAC TTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAAGTAAGTTCC ACTTGAGCAGAAGATAAAGTTGTAGTCGTGGGGCAATCTGCTGCCACAAACTGGTGATACATACCTTT AAAATGGCTGTCTGTCCAAGTCAAGGGATGGGGTTGATAGCATCTGTGTCTGTTCCACAACTGCCTTTG AGCTGGCCCTTCAGATGCCTATGAATGAGGGTGCTTAAATGGTGTTAGAGGTTAAGACCAATGGGTAG TCTGTATTCCTGTGGTCATAGCATTAATATTTCAGTGTTGCCCATGCTAATGTGTGAATGTTGGATTTA AAGCTGACGTTCTTAGAGGTGGGGCTCTGCTTTATTTAGCCTAGTGAATCTTAGGATTTTTCATCGGCC TTCAGTCACTAACTCCATGTCTTTATTCTTTGCAGCTGACATCATGTACACAGGCACGCTTGACTGCTG GCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAG GCATGGGTGGTGCTTTTGTGCTTGTCTTGTATGATGAAATCAAGAAGTACACATAAGTTATTTCCTAGG ATTTTTCCCCCTGTGAACAGGCATGTTGTATTATATAACATATCTTGAGCATTCTTGACAGACTCCTGG CTGTCAGTTTCTCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCTGACCAGTT TTCTCTTAAAGCCATTTCCATGATGATGATGATGGGACTCAATTGTATTTTTTATTTCAGTCACTCCTGA TAAATAACAAATTTGGAGAAATAAAAATATCTAAAATAAATTTTGTCTGCAGTATATTTTCATATAAA AATGCATATTTGAGTGCTACATTCGAATAAATACTACCTTTTTAGTGAA The inventors employed network analysis that allows them to allocate multiple genes or proteins to a smaller number of driver processes; and to mine these processes for impactful drug targets. The approach takes advantage of information that is usually ignored in standard gene set analyses – the known and predicted interactions between genes (and proteins) and the inclusion of other genes in the same or related pathways. In particular, the inventors analysed Genome Wide Association Studies (GWAS) metanalyses for Non-Alcoholic Fatty Liver Disease (NAFLD) using network models which highlighted SLC25A5 / ANT2 as a preferred target for NAFLD among other known targets associated with NAFLD. The inhibition disclosed herein may be of the gene SLC25A5 or protein ANT2 resulting from expression of the SLC25A5 gene and reference to SLC25A5 / ANT2 hereby explicitly incorporates a reference to inhibition of the expression or function of the gene and, separately, of the protein product. DEFINITIONS The “first strand”, also called the antisense strand or guide strand herein and which can be used interchangeably herein, refers to the nucleic acid strand, e.g. the strand of an siRNA, e.g. a dsiRNA, which includes a region that is substantially complementary to a target sequence, e.g. to an mRNA. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. In some embodiments, a double stranded nucleic acid e.g. an siRNA agent of the invention includes a nucleotide mismatch in the antisense strand. The “second strand” (also called the sense strand or passenger strand herein, and which can be used interchangeably herein), refers to the strand of a nucleic acid e.g. siRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. In the context of molecule comprising a nucleic acid provided with a ligand moiety, optionally also with a linker moiety, the nucleic acid of the invention may be referred to as an oligonucleotide moiety or oligonucleoside moiety Oligonucleotides are short nucleic acid polymers. Whilst oligonucleotides contain phosphodiester bonds between the nucleoside component thereof (base plus sugar), the present invention is not limited to oligonucleotides always joined by such a phosphodiester bond between adjacent nucleosides, and other oligomers of nucleosides joined by bonds which are bonds other than a phosphate bond are contemplated. For example, a bond between nucleotides may be a phosphorothioate bond. Therefore, the term “oligonucleoside” herein covers both oligonucleotides and other oligomers of nucleosides. An oligonucleoside which is a nucleic acid having at least a portion which is an oligonucleotide is preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides is also preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides, and also having one or more phosphorothioate backbone bonds between nucleosides (typically in a terminal region of the first and / or second strands) is also preferred according to the present invention. It is preferred herein that the nucleic acid according to the invention is a double stranded oligonucleoside comprising one or more phosphorothioate backbone bonds between nucleosides. Accordingly, in all instances in which the present application refers to an oligonucleotide, particularly in the chemical structures disclosed herein, the oligonucleotide may equally be an oligonucleoside as defined herein. In some embodiments, a double stranded nucleic acid e.g. siRNA agent of the invention includes a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is, for example, within 5, 4, 3, 2, or 1 nucleosides from the 3 '-end of the nucleic acid e.g. siRNA. In another embodiment, the nucleoside mismatch is, for example, in the 3'- terminal nucleoside of the nucleic acid e.g. siRNA. A "target sequence" (which may be called a target RNA or a target mRNA) refers to a contiguous portion of the nucleoside sequence of an mRNA molecule formed during the transcription of a gene, including mRNA that is a product of RNA processing of a primary transcription product, or can be a contiguous portion of the nucleotide sequence of any RNA molecule such as a LNCRNA which it is desired to inhibit. The target sequence may be from about 10-35 nucleosides in length, e.g., about 15-30 nucleosides in length. For example, the target sequence can be from about 15-30 nucleosides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18- 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20- 21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. The term “ribonucleoside” or “nucleoside” can also refer to a modified nucleoside as further detailed below. A nucleic acid can be a DNA or an RNA, and can comprise modified nucleosides. RNA is a preferred nucleic acid. The terms "iRNA", “siRNA”, "RNAi agent," and "iRNA agent," "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence- specific degradation of mRNA through RNA interference (RNAi). A double stranded RNA is referred to herein as a "double stranded siRNA (dsiRNA) agent", "double stranded siRNA (dsiRNA) molecule", "double stranded RNA (dsRNA) agent", "double stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", which refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA. The majority of nucleosides of each strand of the nucleic acid, e.g. a dsRNA molecule, are preferably ribonucleosides, but in that case each or both strands can also include one or more non- ribonucleosides, e.g., a deoxyribonucleoside or a modified ribonucleoside. In addition, as used in this specification, an "siRNA" may include ribonucleosides with chemical modifications. The term "modified nucleoside" refers to a nucleoside having, independently, a modified sugar moiety, a modified internucleoside linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleoside encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. Any such modifications, as used in a siRNA type molecule, are encompassed by "iRNA" or "RNAi agent" or “siRNA” or “siRNA agent” for the purposes of this specification and claims. The duplex region of a nucleic acid of the invention e.g. a dsRNA may range from about 9 to 40 base pairs in length such as 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. The two strands forming the duplex structure may be different portions of one larger molecule, or they may be separate molecules e.g. RNA molecules. The term "nucleoside overhang" refers to at least one unpaired nucleoside that extends from the duplex structure of a double stranded nucleic acid. A ds nucleic acid can comprise an overhang of at least one nucleoside; alternatively, the overhang can comprise at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more. A nucleoside overhang can comprise or consist of a nucleoside analog, including a deoxynucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the / nucleoside(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand. In certain embodiments, the antisense strand has a 1-10 nucleoside, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleoside overhang at the 3'-end or the 5'-end. "Blunt" or "blunt end" means that there are no unpaired nucleoside at that end of the double stranded nucleic acid, i.e., no nucleoside overhang. The nucleic acids of the invention include those with no nucleoside overhang at one end or with no nucleoside overhangs at either end. Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence, refers to the ability of an oligonucleoside comprising the first nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleoside or polynucleoside comprising the second nucleoside sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Complementary sequences within nucleic acid e.g. a dsiRNA, as described herein, include base-pairing of the oligonucleoside or polynucleoside comprising a first nucleoside sequence to an oligonucleoside or polynucleoside comprising a second nucleoside sequence over the entire length of one or both nucleoside sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" or “partially complementary”with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably not more than 5, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. Overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a nucleic acid e.g. dsRNA comprising one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside comprises a sequence of 17 nucleosides that is fully complementary to the shorter oligonucleoside, can yet be referred to as "fully complementary". "Complementary" sequences, as used herein, can also include, or be formed entirely from, non-Watson- Crick base pairs or base pairs formed from non-natural and modified nucleosides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms "complementary," "fully complementary" and "substantially / partially complementary" herein can be used with respect to the base matching between the sense strand and the antisense strand of a nucleic acid e.g. dsiRNA, or between the antisense strand of a double stranded nucleic acid e.g. siRNA agent and a target sequence. Within the present invention, the second strand of the nucleic acid according to the invention, in particular a dsiRNA for inhibiting SLC25A5, is at least partially complementary to the first strand of said nucleic acid. In certain embodiments, a first and second strand of a nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. Alternatively, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs, wherein at least 14, 15, 16 or 17 of said base pairs are complementary base pairs, in particular Watson-Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs, wherein at least 14, 15, 16, 17, 18 or all 19 base pairs are complementary base pairs, in particular Watson-Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs, wherein at least 16, 17, 18, 19, 20 or all 21 base pairs are complementary base pairs, in particular Watson-Crick base pairs. As used herein, a nucleic acid that is "substantially complementary” or “partially complementary” to at least part of a messenger RNA (mRNA) refers to a polynucleoside that is substantially or partially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a gene). In certain embodiments, the contiguous portion of the mRNA is a sequence as listed in Table 1, i.e., any one of SEQ ID NOs:1-276. For example, a polynucleoside is complementary to at least a part of an mRNA of a gene of interest if the sequence is substantially or partially complementary to a non-interrupted portion of an mRNA encoding that gene. Accordingly, in some preferred embodiments, the antisense oligonucleosides as disclosed herein are fully complementary to the target gene sequence. In other embodiments, the antisense oligonucleosides disclosed herein are substantially or partially complementary to a target RNA sequence and comprise a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the target RNA sequence, such as at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary or 100% complementary. In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention is partially or fully complementary to a contiguous portion of RNA transcribed from the SLC25A5 gene. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of at least 17 nucleosides of the SLC25A5 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of the SLC25A5 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of any one of the sequences as listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention is partially complementary to a contiguous portion of the SLC25A5 mRNA if it comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of the SLC25A5 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 19 nucleosides, wherein at least 14, 15, 16, 17, 18 or all 19 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 23 nucleosides, wherein at least 18, 19, 20, 21, 22 or all 23 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In some embodiments, a nucleic acid e.g. an siRNA of the invention includes a sense strand that is substantially or partially complementary to an antisense oligonucleoside which, in turn, is complementary to a target gene sequence and comprises a contiguous nucleoside sequence. The nucleoside sequence of the sense strand is typically at least about 80% complementary over its entire length to the equivalent region of the nucleoside sequence of the antisense strand, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. In some embodiments, a nucleic acid e.g. an siRNA of the invention includes an antisense strand that is substantially or partially complementary to the target sequence and comprises a contiguous nucleoside sequence which is at least 80% complementary over its entire length to the target sequence such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a non- human primate, e.g., a monkey, and a chimpanzee), or a non-primate or a bird that expresses the target gene, either endogenously or heterologously, when the target gene sequence has sufficient complementarity to the nucleic acid e.g. iRNA agent to promote target knockdown. In certain preferred embodiments, the subject is a human. The terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with gene expression. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. The terms “prevent” or “prevention” as used herein are defined as eliminating or reducing the likelihood of occurrence of one or more symptoms of a disease or disorder. For example, the inhibitor disclosed herein can be used to prevent the occurrence of a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis. "Therapeutically effective amount," as used herein, is intended to include the amount of a nucleic acid e.g. an iRNA that, when administered to a patient for treating a subject having disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease or its related comorbidities). The phrase "pharmaceutically acceptable" is employed herein to refer to compounds, materials, compositions, or dosage forms which are suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Where a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention. The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. For example, "sense strand or antisense strand" is understood as "sense strand or antisense strand or sense strand and antisense strand." The term "about" is used herein to mean within the typical ranges of tolerances in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that "about" can modify each of the numbers in the series or range. The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21 nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range. As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of "no more than 2 nucleosides" has a 2, 1, or 0 nucleoside overhang. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range. The terminal region of a strand is the last 5 nucleotides from the 5’ or the 3’ end. A nucleobase sequence is the sequence of the bases of the nucleic acid in an oligomer. Various embodiments of the invention can be combined as determined appropriate by one of skill in the art. TARGET A target for inhibition disclosed herein may be, without limitation, an mRNA, polypeptide, protein, or gene. These targets are a target the inhibition of which helps in the prevention and / or treatment of a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis and / or in reducing adipogenesis. The target for inhibition is the gene SLC25A5 or a gene product thereof, such as an mRNA transcribed from the SLC25A5 gene or the ANT2 protein, and inhibition may be effected by inhibition of expression or function of the SLC25A5 / ANT2 gene or protein or both. In a preferred embodiment, the target is an mRNA expressed from the SLC25A5 gene. Exemplary target sequences on the SLC25A5 mRNA are listed below in Table 1. Following Table 1 provides oligonucleoside mRNA target sequences of SLC25A5, together with the corresponding positions in transcript ENST00000317881.9. It is to be understood that SEQ ID NO: 1 to 276 refer to human (Homo sapiens) mRNA sequences. Table 1 SEQ ID NO Oligonucleotide mRNA target sequence Starting position on 5’ ^ 3’ ENST00000317881.9 SEQ ID NO: 1 ACUAUUUACUGGUUGAAAAUGGG 1072 SEQ ID NO: 2 UACAAAGGCAUUAUAGACUGCGU 223 SEQ ID NO: 3 UAUGAUGAAAUCAAGAAGUACAC 943 SEQ ID NO: 4 AUGAUGAUGGGACUCAAUUGUAU 1146 SEQ ID NO: 5 AGGCAUUAUAGACUGCGUGGUCC 228 SEQ ID NO: 6 CAGUCACUCCUGAUAAAUAACAA 1178 SEQ ID NO: 7 CAAUACAAAGGCAUUAUAGACUG 220 SEQ ID NO: 8 GAGCCGCCUACUUCGGUAUCUAU 635 SEQ ID NO: 9 CGAGCCGCCUACUUCGGUAUCUA 634 SEQ ID NO: 10 AUAGACUGCGUGGUCCGUAUUCC 235 SEQ ID NO: 11 AACACUCACAUCGUCAUCAGCUG 691 SEQ ID NO: 12 UAACUUCGCCUUCAAAGAUAAAU 333 SEQ ID NO: 13 GCCUACUUCGGUAUCUAUGACAC 640 SEQ ID NO: 14 UAUUUACUGGUUGAAAAUGGGAA 1074 SEQ ID NO: 15 UUUGCCCGUACCCGUCUAGCAGC 478 SEQ ID NO: 16 GCAGUCAGGGCGCAAAGGAACUG 792 SEQ ID NO: 17 AUUUACUGGUUGAAAAUGGGAAG 1075 SEQ ID NO: 18 CCGAGCCGCCUACUUCGGUAUCU 633 SEQ ID NO: 19 GGCCUCGGUGACUGCCUGGUUAA 538 SEQ ID NO: 20 CACAUCGUCAUCAGCUGGAUGAU 697 SEQ ID NO: 21 UAUUUCAGUCACUCCUGAUAAAU 1173 SEQ ID NO: 22 GCUGGAUGAUCGCACAGACUGUC 710 SEQ ID NO: 23 AAGCAAUACAAAGGCAUUAUAGA 217 SEQ ID NO: 24 AGGCCUCGGUGACUGCCUGGUUA 537 SEQ ID NO: 25 GGCUUUAACGUGUCUGUGCAGGG 598 SEQ ID NO: 26 ACAAAGGCAUUAUAGACUGCGUG 224 SEQ ID NO: 27 CUGUGAACAGGCAUGUUGUAUUA 993 SEQ ID NO: 28 UCAUCUGACCAGUUUUCUCUUAA 1107 SEQ ID NO: 29 CAAGGCUUUAACGUGUCUGUGCA 595 SEQ ID NO: 30 AUGCAGUCAGGGCGCAAAGGAAC 790 SEQ ID NO: 31 UGGAUGAUCGCACAGACUGUCAC 712 SEQ ID NO: 32 AAAGGCAUUAUAGACUGCGUGGU 226 SEQ ID NO: 33 GAUGAUCGCACAGACUGUCACUG 714 SEQ ID NO: 34 GACUGCGUGGUCCGUAUUCCCAA 238 SEQ ID NO: 35 AGCAAUACAAAGGCAUUAUAGAC 218 SEQ ID NO: 36 GUCAUCAGCUGGAUGAUCGCACA 703 SEQ ID NO: 37 GCAUUAUAGACUGCGUGGUCCGU 230 SEQ ID NO: 38 AUUUUGCCCGUACCCGUCUAGCA 476 SEQ ID NO: 39 UCACAUCGUCAUCAGCUGGAUGA 696 SEQ ID NO: 40 CCUCUUGAUUUUGCCCGUACCCG 469 SEQ ID NO: 41 UUAUAGACUGCGUGGUCCGUAUU 233 SEQ ID NO: 42 GCCGCCUACUUCGGUAUCUAUGA 637 SEQ ID NO: 43 UAGACUGCGUGGUCCGUAUUCCC 236 SEQ ID NO: 44 CGUCAUCAGCUGGAUGAUCGCAC 702 SEQ ID NO: 45 CAUUAUAGACUGCGUGGUCCGUA 231 SEQ ID NO: 46 CGCCUACUUCGGUAUCUAUGACA 639 SEQ ID NO: 47 UUUUAUUUCAGUCACUCCUGAUA 1170 SEQ ID NO: 48 UCGUCAUCAGCUGGAUGAUCGCA 701 SEQ ID NO: 49 UGAUUUUGCCCGUACCCGUCUAG 474 SEQ ID NO: 50 UGCAAAGGGAAUGCUUCCGGAUC 663 SEQ ID NO: 51 CCAAGGCUUUAACGUGUCUGUGC 594 SEQ ID NO: 52 CAAAGGCAUUAUAGACUGCGUGG 225 SEQ ID NO: 53 UCUUGAUUUUGCCCGUACCCGUC 471 SEQ ID NO: 54 ACCGAGCCGCCUACUUCGGUAUC 632 SEQ ID NO: 55 UUAUCAUCUACCGAGCCGCCUAC 623 SEQ ID NO: 56 CUUGAUUUUGCCCGUACCCGUCU 472 SEQ ID NO: 57 AUUAUCAUCUACCGAGCCGCCUA 622 SEQ ID NO: 58 AUCAUCUACCGAGCCGCCUACUU 625 SEQ ID NO: 59 GGCUCUUAACUUCGCCUUCAAAG 327 SEQ ID NO: 60 CCCCACCCAGGCUCUUAACUUCG 318 SEQ ID NO: 61 GUCCGUAUUCCCAAGGAGCAGGG 247 SEQ ID NO: 62 AGGAGCAGGGAGUUCUGUCCUUC 260 SEQ ID NO: 63 AUUCCCAAGGAGCAGGGAGUUCU 253 SEQ ID NO: 64 GGUCCGUAUUCCCAAGGAGCAGG 246 SEQ ID NO: 65 GAGCAGGGAGUUCUGUCCUUCUG 262 SEQ ID NO: 66 UGGUCCGUAUUCCCAAGGAGCAG 245 SEQ ID NO: 67 GGAGCAGGGAGUUCUGUCCUUCU 261 SEQ ID NO: 68 AAGGAGCAGGGAGUUCUGUCCUU 259 SEQ ID NO: 69 UAUUCCCAAGGAGCAGGGAGUUC 252 SEQ ID NO: 70 CAAGGAGCAGGGAGUUCUGUCCU 258 SEQ ID NO: 71 UCCCCACCCAGGCUCUUAACUUC 317 SEQ ID NO: 72 GCUCUUAACUUCGCCUUCAAAGA 328 SEQ ID NO: 73 AUUUCAGUCACUCCUGAUAAAUA 1174 SEQ ID NO: 74 UUCAGUCACUCCUGAUAAAUAAC 1176 SEQ ID NO: 75 UUUCAGUCACUCCUGAUAAAUAA 1175 SEQ ID NO: 76 GAUGAUGGGACUCAAUUGUAUUU 1148 SEQ ID NO: 77 AUGAUGGGACUCAAUUGUAUUUU 1149 SEQ ID NO: 78 GUCACUCCUGAUAAAUAACAAAU 1180 SEQ ID NO: 79 AUAUUCAUCUGACCAGUUUUCUC 1103 SEQ ID NO: 80 UGAACAGGCAUGUUGUAUUAUAU 996 SEQ ID NO: 81 AAAGGGAAUGCUUCCGGAUCCCA 666 SEQ ID NO: 82 AAGGGAAUGCUUCCGGAUCCCAA 667 SEQ ID NO: 83 UCCGAGGCCUCGGUGACUGCCUG 533 SEQ ID NO: 84 GAACAGGCAUGUUGUAUUAUAUA 997 SEQ ID NO: 85 GCAAUACAAAGGCAUUAUAGACU 219 SEQ ID NO: 86 UUAUUUCAGUCACUCCUGAUAAA 1172 SEQ ID NO: 87 UGAUGAUGGGACUCAAUUGUAUU 1147 SEQ ID NO: 88 AUCUGACCAGUUUUCUCUUAAAG 1109 SEQ ID NO: 89 UCUGACCAGUUUUCUCUUAAAGC 1110 SEQ ID NO: 90 CAGAUAAGCAAUACAAAGGCAUU 212 SEQ ID NO: 91 AGAUAAGCAAUACAAAGGCAUUA 213 SEQ ID NO: 92 CUUUAACGUGUCUGUGCAGGGUA 600 SEQ ID NO: 93 UUUAACGUGUCUGUGCAGGGUAU 601 SEQ ID NO: 94 ACUCACAUCGUCAUCAGCUGGAU 694 SEQ ID NO: 95 GAUGAUGAUGGGACUCAAUUGUA 1145 SEQ ID NO: 96 AGACUGCGUGGUCCGUAUUCCCA 237 SEQ ID NO: 97 GUGAACAGGCAUGUUGUAUUAUA 995 SEQ ID NO: 98 UUUAUUUCAGUCACUCCUGAUAA 1171 SEQ ID NO: 99 GAUAAGCAAUACAAAGGCAUUAU 214 SEQ ID NO: 100 ACACUCACAUCGUCAUCAGCUGG 692 SEQ ID NO: 101 AGCCGCCUACUUCGGUAUCUAUG 636 SEQ ID NO: 102 CUCACAUCGUCAUCAGCUGGAUG 695 SEQ ID NO: 103 CCGCCUACUUCGGUAUCUAUGAC 638 SEQ ID NO: 104 GCUUUAACGUGUCUGUGCAGGGU 599 SEQ ID NO: 105 GUUCGCCGCCGCAUGAUGAUGCA 772 SEQ ID NO: 106 GGCAUUAUAGACUGCGUGGUCCG 229 SEQ ID NO: 107 ACUGCGUGGUCCGUAUUCCCAAG 239 SEQ ID NO: 108 UCAUCUACCGAGCCGCCUACUUC 626 SEQ ID NO: 109 UUUUGCCCGUACCCGUCUAGCAG 477 SEQ ID NO: 110 CACUCACAUCGUCAUCAGCUGGA 693 SEQ ID NO: 111 AUUAUAGACUGCGUGGUCCGUAU 232 SEQ ID NO: 112 GAGGCCUCGGUGACUGCCUGGUU 536 SEQ ID NO: 113 CUGGAUGAUCGCACAGACUGUCA 711 SEQ ID NO: 114 UUGAUUUUGCCCGUACCCGUCUA 473 SEQ ID NO: 115 AUGAUCGCACAGACUGUCACUGC 715 SEQ ID NO: 116 GGAUGAUCGCACAGACUGUCACU 713 SEQ ID NO: 117 GAUUUUGCCCGUACCCGUCUAGC 475 SEQ ID NO: 118 UAUCAUCUACCGAGCCGCCUACU 624 SEQ ID NO: 119 UAUAGACUGCGUGGUCCGUAUUC 234 SEQ ID NO: 120 CACUGCAGAUAAGCAAUACAAAG 207 SEQ ID NO: 121 UCACUGCAGAUAAGCAAUACAAA 206 SEQ ID NO: 122 AUCACUGCAGAUAAGCAAUACAA 205 SEQ ID NO: 123 CAGCAAGCAGAUCACUGCAGAUA 195 SEQ ID NO: 124 AGAUCACUGCAGAUAAGCAAUAC 203 SEQ ID NO: 125 GAUCACUGCAGAUAAGCAAUACA 204 SEQ ID NO: 126 AAGCAGAUCACUGCAGAUAAGCA 199 SEQ ID NO: 127 AGCAGAUCACUGCAGAUAAGCAA 200 SEQ ID NO: 128 CCAGCAAGCAGAUCACUGCAGAU 194 SEQ ID NO: 129 CAGAUCACUGCAGAUAAGCAAUA 202 SEQ ID NO: 130 UGAUAAAUAACAAAUUUGGAGAA 1188 SEQ ID NO: 131 ACUCCUGAUAAAUAACAAAUUUG 1183 SEQ ID NO: 132 CUGAAAGGGAAUUCCGAGGCCUC 521 SEQ ID NO: 133 AUGUUGUAUUAUAUAACAUAUCU 1005 SEQ ID NO: 134 AAUUCCGAGGCCUCGGUGACUGC 530 SEQ ID NO: 135 UGAAAGGGAAUUCCGAGGCCUCG 522 SEQ ID NO: 136 GUUGUAUUAUAUAACAUAUCUUG 1007 SEQ ID NO: 137 GGAAUUCCGAGGCCUCGGUGACU 528 SEQ ID NO: 138 AAGGGAAUUCCGAGGCCUCGGUG 525 SEQ ID NO: 139 GGAGCUGAAAGGGAAUUCCGAGG 517 SEQ ID NO: 140 CUGGAGCUGAAAGGGAAUUCCGA 515 SEQ ID NO: 141 AGCUGAAAGGGAAUUCCGAGGCC 519 SEQ ID NO: 142 UGGAGCUGAAAGGGAAUUCCGAG 516 SEQ ID NO: 143 GAGCUGAAAGGGAAUUCCGAGGC 518 SEQ ID NO: 144 AGGCAUGUUGUAUUAUAUAACAU 1001 SEQ ID NO: 145 UGUUGUAUUAUAUAACAUAUCUU 1006 SEQ ID NO: 146 UUGUAUUAUAUAACAUAUCUUGA 1008 SEQ ID NO: 147 CAGGCAUGUUGUAUUAUAUAACA 1000 SEQ ID NO: 148 GAAAGGGAAUUCCGAGGCCUCGG 523 SEQ ID NO: 149 GGGAAUUCCGAGGCCUCGGUGAC 527 SEQ ID NO: 150 AAAGGGAAUUCCGAGGCCUCGGU 524 SEQ ID NO: 151 AGGGAAUUCCGAGGCCUCGGUGA 526 SEQ ID NO: 152 GUGCUUGUCUUGUAUGAUGAAAU 931 SEQ ID NO: 153 CUUCGCCUUCAAAGAUAAAUACA 336 SEQ ID NO: 154 CUGCCUGGUUAAGAUCUACAAAU 549 SEQ ID NO: 155 UAUCUAUGACACUGCAAAGGGAA 651 SEQ ID NO: 156 CUUUUGUGCUUGUCUUGUAUGAU 926 SEQ ID NO: 157 GGUGACUGCCUGGUUAAGAUCUA 544 SEQ ID NO: 158 AUGACACUGCAAAGGGAAUGCUU 656 SEQ ID NO: 159 UUCGGUAUCUAUGACACUGCAAA 646 SEQ ID NO: 160 UAUUCAUCUGACCAGUUUUCUCU 1104 SEQ ID NO: 161 ACUUCGGUAUCUAUGACACUGCA 644 SEQ ID NO: 162 CUGGUUAAGAUCUACAAAUCUGA 553 SEQ ID NO: 163 GUAUCUAUGACACUGCAAAGGGA 650 SEQ ID NO: 164 CAAGGGUGCAUGGUCCAAUGUUC 885 SEQ ID NO: 165 AGAUCUACAAAUCUGAUGGGAUU 560 SEQ ID NO: 166 UACUUCGGUAUCUAUGACACUGC 643 SEQ ID NO: 167 CAUGGGUGGUGCUUUUGUGCUUG 915 SEQ ID NO: 168 GGUAUUAUCAUCUACCGAGCCGC 619 SEQ ID NO: 169 GCGUGGUCCGUAUUCCCAAGGAG 242 SEQ ID NO: 170 AUCUAUGACACUGCAAAGGGAAU 652 SEQ ID NO: 171 UGCUUUUGUGCUUGUCUUGUAUG 924 SEQ ID NO: 172 UGUACCAAGGCUUUAACGUGUCU 590 SEQ ID NO: 173 GGGUGCAUGGUCCAAUGUUCUCA 888 SEQ ID NO: 174 CGCCUUCAAAGAUAAAUACAAGC 339 SEQ ID NO: 175 CAGGGUAUUAUCAUCUACCGAGC 616 SEQ ID NO: 176 CCUACUUCGGUAUCUAUGACACU 641 SEQ ID NO: 177 UGGUUAAGAUCUACAAAUCUGAU 554 SEQ ID NO: 178 UGUGCAGGGUAUUAUCAUCUACC 612 SEQ ID NO: 179 AAUCUGAUGGGAUUAAGGGCCUG 569 SEQ ID NO: 180 GUCUGUGCAGGGUAUUAUCAUCU 609 SEQ ID NO: 181 UCUGAUGGGAUUAAGGGCCUGUA 571 SEQ ID NO: 182 UACCAAGGCUUUAACGUGUCUGU 592 SEQ ID NO: 183 AAUAUUCAUCUGACCAGUUUUCU 1102 SEQ ID NO: 184 UGACUGCCUGGUUAAGAUCUACA 546 SEQ ID NO: 185 GGGUUGACUUCCUAUCCAUUUGA 745 SEQ ID NO: 186 UCUAUGACACUGCAAAGGGAAUG 653 SEQ ID NO: 187 GGUUAAGAUCUACAAAUCUGAUG 555 SEQ ID NO: 188 GCAGGGUAUUAUCAUCUACCGAG 615 SEQ ID NO: 189 ACUGCCUGGUUAAGAUCUACAAA 548 SEQ ID NO: 190 AUCUGAUGGGAUUAAGGGCCUGU 570 SEQ ID NO: 191 UCGGUAUCUAUGACACUGCAAAG 647 SEQ ID NO: 192 GUACCCGUCUAGCAGCUGAUGUG 485 SEQ ID NO: 193 GGUAUCUAUGACACUGCAAAGGG 649 SEQ ID NO: 194 AGCUGAUGUGGGUAAAGCUGGAG 498 SEQ ID NO: 195 CGUCUAGCAGCUGAUGUGGGUAA 490 SEQ ID NO: 196 AAGGGCCUGUACCAAGGCUUUAA 583 SEQ ID NO: 197 UGCCCGUACCCGUCUAGCAGCUG 480 SEQ ID NO: 198 AGCAGCUGAUGUGGGUAAAGCUG 495 SEQ ID NO: 199 GCCCGUACCCGUCUAGCAGCUGA 481 SEQ ID NO: 200 CAGCUGAUGUGGGUAAAGCUGGA 497 SEQ ID NO: 201 AGGGUAUUAUCAUCUACCGAGCC 617 SEQ ID NO: 202 UAUUAUCAUCUACCGAGCCGCCU 621 SEQ ID NO: 203 CCGUACCCGUCUAGCAGCUGAUG 483 SEQ ID NO: 204 CUGAUGGGAUUAAGGGCCUGUAC 572 SEQ ID NO: 205 GUGUCUGUGCAGGGUAUUAUCAU 607 SEQ ID NO: 206 CUGCGUGGUCCGUAUUCCCAAGG 240 SEQ ID NO: 207 UGCGUGGUCCGUAUUCCCAAGGA 241 SEQ ID NO: 208 CCUGGUUAAGAUCUACAAAUCUG 552 SEQ ID NO: 209 GUAUGAUGAAAUCAAGAAGUACA 942 SEQ ID NO: 210 AAGAUCUACAAAUCUGAUGGGAU 559 SEQ ID NO: 211 CUGUGCAGGGUAUUAUCAUCUAC 611 SEQ ID NO: 212 CUGUACCAAGGCUUUAACGUGUC 589 SEQ ID NO: 213 UAGCAGCUGAUGUGGGUAAAGCU 494 SEQ ID NO: 214 GCAUGGGUGGUGCUUUUGUGCUU 914 SEQ ID NO: 215 CUCGGUGACUGCCUGGUUAAGAU 541 SEQ ID NO: 216 GUCUAGCAGCUGAUGUGGGUAAA 491 SEQ ID NO: 217 UCUACAAAUCUGAUGGGAUUAAG 563 SEQ ID NO: 218 CUACUUCGGUAUCUAUGACACUG 642 SEQ ID NO: 219 GCAGCUGAUGUGGGUAAAGCUGG 496 SEQ ID NO: 220 CCCGUACCCGUCUAGCAGCUGAU 482 SEQ ID NO: 221 UGUCUGUGCAGGGUAUUAUCAUC 608 SEQ ID NO: 222 UGUGCUUGUCUUGUAUGAUGAAA 930 SEQ ID NO: 223 GUACCAAGGCUUUAACGUGUCUG 591 SEQ ID NO: 224 AAGGGUGCAUGGUCCAAUGUUCU 886 SEQ ID NO: 225 GUGACUGCCUGGUUAAGAUCUAC 545 SEQ ID NO: 226 CUGAUGUGGGUAAAGCUGGAGCU 500 SEQ ID NO: 227 CGUGGUCCGUAUUCCCAAGGAGC 243 SEQ ID NO: 228 UGACACUGCAAAGGGAAUGCUUC 657 SEQ ID NO: 229 GGGAUUAAGGGCCUGUACCAAGG 577 SEQ ID NO: 230 UCUGUGCAGGGUAUUAUCAUCUA 610 SEQ ID NO: 231 UUAACGUGUCUGUGCAGGGUAUU 602 SEQ ID NO: 232 AGGGCCUGUACCAAGGCUUUAAC 584 SEQ ID NO: 233 UAUGACACUGCAAAGGGAAUGCU 655 SEQ ID NO: 234 CCUCGGUGACUGCCUGGUUAAGA 540 SEQ ID NO: 235 GUGCUUUUGUGCUUGUCUUGUAU 923 SEQ ID NO: 236 UGGGUGGUGCUUUUGUGCUUGUC 917 SEQ ID NO: 237 CCCGUCUAGCAGCUGAUGUGGGU 488 SEQ ID NO: 238 UAAGGGCCUGUACCAAGGCUUUA 582 SEQ ID NO: 239 UUGUGCUUGUCUUGUAUGAUGAA 929 SEQ ID NO: 240 ACAAAUCUGAUGGGAUUAAGGGC 566 SEQ ID NO: 241 AUCUACAAAUCUGAUGGGAUUAA 562 SEQ ID NO: 242 UGCAGGGUAUUAUCAUCUACCGA 614 SEQ ID NO: 243 GCCUGUACCAAGGCUUUAACGUG 587 SEQ ID NO: 244 UAAGAUCUACAAAUCUGAUGGGA 558 SEQ ID NO: 245 GCUUUUGUGCUUGUCUUGUAUGA 925 SEQ ID NO: 246 CUACAAAUCUGAUGGGAUUAAGG 564 SEQ ID NO: 247 UUCAAGGGUGCAUGGUCCAAUGU 883 SEQ ID NO: 248 UGGGAUUAAGGGCCUGUACCAAG 576 SEQ ID NO: 249 CUUCGGUAUCUAUGACACUGCAA 645 SEQ ID NO: 250 ACCAAGGCUUUAACGUGUCUGUG 593 SEQ ID NO: 251 GGCAUGGGUGGUGCUUUUGUGCU 913 SEQ ID NO: 252 GUUAAGAUCUACAAAUCUGAUGG 556 SEQ ID NO: 253 UACCCGUCUAGCAGCUGAUGUGG 486 SEQ ID NO: 254 CUAUGACACUGCAAAGGGAAUGC 654 SEQ ID NO: 255 UCUAGCAGCUGAUGUGGGUAAAG 492 SEQ ID NO: 256 CUGCAAAGGGAAUGCUUCCGGAU 662 SEQ ID NO: 257 UUGCCCGUACCCGUCUAGCAGCU 479 SEQ ID NO: 258 GGGUAUUAUCAUCUACCGAGCCG 618 SEQ ID NO: 259 CCCUCUUGAUUUUGCCCGUACCC 468 SEQ ID NO: 260 CGUACCCGUCUAGCAGCUGAUGU 484 SEQ ID NO: 261 UACAAAUCUGAUGGGAUUAAGGG 565 SEQ ID NO: 262 GUGUACCCUCUUGAUUUUGCCCG 463 SEQ ID NO: 263 GGCCUGUACCAAGGCUUUAACGU 586 SEQ ID NO: 264 GAUGGGAUUAAGGGCCUGUACCA 574 SEQ ID NO: 265 GUAUUAUCAUCUACCGAGCCGCC 620 SEQ ID NO: 266 GGGCCUGUACCAAGGCUUUAACG 585 SEQ ID NO: 267 UGAUGGGAUUAAGGGCCUGUACC 573 SEQ ID NO: 268 UAACGUGUCUGUGCAGGGUAUUA 603 SEQ ID NO: 269 AAGGCAUUAUAGACUGCGUGGUC 227 SEQ ID NO: 270 ACUUCCCCACCCAGGCUCUUAAC 314 SEQ ID NO: 271 CAAUGUCAUCAGAUACUUCCCCA 300 SEQ ID NO: 272 AUGUCAUCAGAUACUUCCCCACC 302 SEQ ID NO: 273 AAUGUCAUCAGAUACUUCCCCAC 301 SEQ ID NO: 274 CCAAUGUCAUCAGAUACUUCCCC 299 SEQ ID NO: 275 UACUUCCCCACCCAGGCUCUUAA 313 SEQ ID NO: 276 AUCUACCGAGCCGCCUACUUCGG 628 It is to be understood that SEQ ID NOs: 1 to 276 relate to human (Homo sapiens) mRNA sequences. DISEASE / CONDITIONS The present invention further provides methods of treatment of a subject in need thereof. The treatment methods of the invention include administering a nucleic acid such as an siRNA of the invention to a subject, e.g., a subject that would benefit from a reduction or inhibition of the expression of SLC25A5 gene, in a therapeutically effective amount e.g. a nucleic acid such as an siRNA targeting SLC25A5 or a pharmaceutical composition comprising the nucleic acid targeting SLC25A5. The disease to be treated is related to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non- alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis and / or adipogenesis. The disease to be treated is related to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis and / or adipogenesis. The inhibitor according to the invention may be used in the prevention and / or treatment of a metabolic disease or disorder. As used herein, the term "metabolic disease" refers to a disease or condition affecting a metabolic process in a subject and is often caused by disruption of normal metabolism. The patient to be treated may be a patient that already has a metabolic disease or disorder or that is at risk of developing a metabolic disease or disorder. That is, in certain embodiments, the inhibitor of the present invention may be used in the treatment and / or management of an existing metabolic disease or disorder. Treatment and / or management of an existing metabolic disease or disorder with the inhibitor of the present invention may prevent worsening of the metabolic disease or disorder and / or reverse the metabolic disease or disorder. In some instances, treatment of an existing metabolic disease or disorder with the inhibitor of the present invention may even cure the metabolic disease or disorder. In certain embodiments, the inhibitor of the present invention may be used to prevent manifestation of a metabolic disease or disorder in a patient that is at risk of developing a metabolic disease or disorder. The skilled person is capable of diagnosing whether a patient has a metabolic disease or disorder or is at risk of developing a metabolic disease or disorder. For example, a metabolic disease or disorder may be diagnosed based weight gain and / or one or more blood markers, including, without limitation, blood glucose levels, blood insulin levels, blood free fatty acid levels, blood HbA1c levels, blood fibrinogen levels, blood cholesterol levels and blood triglyceride levels. The skilled person is aware of threshold values of one or more blood markers that indicate the presence of a metabolic disease or disorder or the risk of developing a metabolic disease or disorder. In certain embodiments, the metabolic disease is fatty liver disease, in particular non-alcoholic fatty liver disease (NAFLD). As used herein “fatty-liver disease” refers to a disease wherein fat is excessively accumulated in the liver and can cause severe diseases such as chronic hepatitis and hepatic cirrhosis. In patients with fatty liver disease, lipids, particularly neutral fat, accumulate in hepatocytes to the extent that the amount exceeds the physiologically permissible range. From a biochemical point of view, a standard for judgment of fatty liver is that the weight of neutral fat is about 10% (100 mg / g wet weight) or more of the wet weight of hepatic tissue. Fatty liver disease is generally detected by observation of elevated serum levels of liver-specific enzymes such as the transaminases ALT and AST, which serve as indices of hepatocyte injury, as well as by presentation of symptoms, which include fatigue and pain in the region of the liver, though definitive diagnosis often requires a biopsy and may be supported by imaging such as ultrasound and / or MRI. The term “NAFLD” or “non-alcoholic fatty liver disease”, as used herein, relates to a condition occurring when fat is deposited in the liver (steatosis) not due to excessive alcohol use. It is related to insulin resistance and the metabolic syndrome. In a preferred embodiment, the fatty liver disease is Non-Alcoholic SteatoHepatitis (NASH). NASH, as used herein, refers to a liver disease characterized by an accumulation of fat (lipid droplets), along with inflammation and degeneration of hepatocytes. Once initiated, the disease is accompanied with a high risk of cirrhosis, a state wherein liver functions are altered that can progress to liver insufficiency. Thereafter, NASH often progresses to liver cancer. In certain embodiments, the invention relates to the inhibitor according to the invention for use in reducing one or more of steatosis, lobular inflammation, and / or hepatocytic ballooning. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a disease or disorder associated with increased steatosis, increased lobular inflammation, and / or increased hepatocytic ballooning. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the invention results in one or more of: reduced steatosis, reduced lobular inflammation, and / or reduced hepatocytic ballooning. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment and / or prevention of liver steatosis. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment and / or prevention of lobular inflammation of the liver. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment and / or prevention of hepatocytic ballooning of the liver. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment or prevention of liver fibrosis in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a disease or disorder associated with liver fibrosis. In certain embodiments, the invention relates to the inhibitor according to the invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the invention reduces fibrosis stage. The person skilled in the art is aware of method to determine the level of liver steatosis, lobular inflammation, hepatocytic ballooning or fibrosis stage in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in reducing the levels of one or more of Alanine transaminase (ALT), Aspartate transaminase (AST), Tissue inhibitor of metalloproteinases-1 (TIMP-1) and / or Type III Procollagen Peptide (PIIINP) in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a disease associated with elevated levels of one or more of Alanine transaminase (ALT), Aspartate transaminase (AST), Tissue inhibitor of metalloproteinases-1 (TIMP-1) and / or Type III Procollagen Peptide (PIIINP) in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a metabolic disease or disorder associated with elevated levels of one or more of Alanine transaminase (ALT), Aspartate transaminase (AST), Tissue inhibitor of metalloproteinases-1 (TIMP-1) and / or Type III Procollagen Peptide (PIIINP) in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a metabolic disease or disorder, wherein the inhibitor according to the invention reduces the levels of one or more of Alanine transaminase (ALT), Aspartate transaminase (AST), Tissue inhibitor of metalloproteinases-1 (TIMP-1) and / or Type III Procollagen Peptide (PIIINP) in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the invention reduces the levels of one or more of Alanine transaminase (ALT), Aspartate transaminase (AST), Tissue inhibitor of metalloproteinases-1 (TIMP-1) and / or Type III Procollagen Peptide (PIIINP) in a patient. The skilled person is aware of methods and commercial kits to determine the levels of ALT, AST, TIMP- 1 and PIIINP in a patient. In certain In certain embodiments, the invention relates to the inhibitor according to the invention for use in reducing the ratio between liver weight and body weight. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a disease or disorder associated with increased liver weight. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a metabolic disease or disorder associated with increased liver weight. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a metabolic disease or disorder, wherein the inhibitor according to the invention reduces the ratio between liver weight and body weight in a patient. In certain embodiments, the invention relates to the inhibitor according to the invention for use in treating and / or preventing a fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the invention reduces the ratio between liver weight and body weight in a patient. In certain embodiments, the metabolic disease is obesity. The term “obesity” as used herein refers to a condition in which the natural energy reserve, stored in the fatty tissue of animals, in particular humans and other mammals, is increased to a point where it is associated with certain health conditions or increased mortality. The term “obese” as used herein is defined for an adult human as having a body mass index (BMI) greater than 30. Obesity is commonly associated with excessive body weight gain, in particular diet- induced body weight gain. "(Diet-induced) body weight gain" is defined herein as body weight gain resulting from an excessive dietary intake, including an excessive dietary intake of fat, in particular saturated fat, and optionally an excessive dietary intake of simple sugars, including sucrose and fructose. For a given subject, an excessive dietary intake, in particular of fat and optionally of simple sugars, refers to the consumption of an amount of diet, in particular of fat and optionally of simple sugars, higher than the amount necessary to meet the physiological needs and maintain the energy balance of said subject. The effect of a treatment on reduction of - or prevention - of diet-induced body weight gain in a subject can be assessed by comparing body weight gain observed in a subject receiving the treatment with those observed in the same subject without treatment receiving the same diet and having the same level of physical activity. In certain embodiments, a patient is at risk of developing obesity if the patient has a BMI greater than 25. In certain embodiments, a patient is obese if the patient has a BMI greater than 30. The term “body mass index” as used herein means the ratio of weight in kg divided by the height in metres, squared. A “disease associated with adipogenesis” refers to a medical condition characterized by the abnormal proliferation and differentiation of adipocytes (fat cells) within the body, leading to an excessive accumulation of adipose tissue. This condition often results in health complications such as obesity, metabolic disorders, and associated comorbidities. Within the present invention, a “reduction of adipogenesis” refers to a medical or pharmaceutical intervention designed to decrease the formation and accumulation of adipocytes within the body. A reduction in adipogenesis may be determined and / or quantified based on the size and / or number of adipocytes in a tissue sample obtained from a patient. Alternatively, or in addition, a reduction in adipogenesis may be determined and / or quantified by gene expression analysis, measurement of adipogenic markers (i.e., by ELISA), assessment of lipid accumulation in a sample and / or measurement of triglyceride levels in cells or tissues. Thus, in a particular embodiment, the invention relates to an inhibitor suitable for use, or for use, in prevention and / or treatment of metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis and / or for use in reducing adipogenesis. INHIBITORS Inhibitors of the invention include nucleic acids such as siRNAs, antibodies and antigen binding fragments thereof, e.g., monoclonal antibodies, polypeptides, antibody–drug conjugates, and small molecules. Preferred are nucleic acids such as siRNA. Certain preferred features of inhibitors of the invention, where these are oligonucelosides such as siRNA, are given below. In certain embodiments, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene (SEQ ID NO:1381). In a preferred embodiment, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to an SLC25A5 mRNA. In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:277-552. In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO: 277-552. In certain embodiments, the first strand comprises any one of SEQ ID NO: 277-552. In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 553-828; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises any one of SEQ ID NO: 553-828. In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 277-552. In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 277-552. In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:553-828; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises any one of SEQ ID NO: 553-828. In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 553-828; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 553-828; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand. In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO: 277-552; and a second strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO: 553-828. It is preferred herein that the duplex region is formed between a first (antisense) strand and a complementary second (sense) strand. Exemplary pairs of complementary antisense and sense strands are listed in Table 2 below. Table 2 provides the unmodified first (antisense) and corresponding unmodified second (sense) strand sequences for siRNA oligonucleosides according to the present invention, together with the corresponding positions in the overall gene sequence of SEQ ID NO:1381 as follows. Table 2: SEQ ID Antisense Strand Base Sequence SEQ ID Sense Strand Base Sequence Corresponding NO (AS) 5’ ^ 3’ NO (SS) 5’ ^ 3’ positions on (Shown as an Unmodified (Shown as an Unmodified ENST00000317 Nucleotide Sequence) Nucleotide Sequence) 881.9 SEQ ID UUAAGAGAAAACUGGUCAG SEQ ID AUCUGACCAGUUUUCU 1107-1129 NO: 304 AUGA NO: 580 CUUAA SEQ ID UAUCAGGAGUGACUGAAAU SEQ ID UUAUUUCAGUCACUCC 1170-1192 NO: 323 AAAA NO: 599 UGAUA SEQ ID UCCCUUUGCAGUGUCAUAG SEQ ID AUCUAUGACACUGCAA 650-672 NO: 439 AUAC NO: 715 AGGGA SEQ ID AUCAGAUUUGUAGAUCUUA SEQ ID GUUAAGAUCUACAAAU 554-576 NO: 453 ACCA NO: 729 CUGAU SEQ ID AUCAGCUGCUAGACGGGUA SEQ ID CGUACCCGUCUAGCAG 482-504 NO: 496 CGGG NO: 772 CUGAU SEQ ID CCCAUUUUCAACCAGUAAA SEQ ID UAUUUACUGGUUGAAA 1072-1094 NO: 277 UAGU NO: 553 AUGGG SEQ ID ACGCAGUCUAUAAUGCCUU SEQ ID CAAAGGCAUUAUAGAC 223-245 NO: 278 UGUA NO: 554 UGCGU SEQ ID GUGUACUUCUUGAUUUCAU SEQ ID UGAUGAAAUCAAGAAG 943-965 NO: 279 CAUA NO: 555 UACAC SEQ ID AUACAAUUGAGUCCCAUCA SEQ ID GAUGAUGGGACUCAAU 1146-1168 NO: 280 UCAU NO: 556 UGUAU SEQ ID GGACCACGCAGUCUAUAAU SEQ ID GCAUUAUAGACUGCGU 228-250 NO: 281 GCCU NO: 557 GGUCC SEQ ID UUGUUAUUUAUCAGGAGUG SEQ ID GUCACUCCUGAUAAAU 1178-1200 NO: 282 ACUG NO: 558 AACAA SEQ ID CAGUCUAUAAUGCCUUUGU SEQ ID AUACAAAGGCAUUAUA 220-242 NO: 283 AUUG NO: 559 GACUG SEQ ID AUAGAUACCGAAGUAGGCG SEQ ID GCCGCCUACUUCGGUA 635-657 NO: 284 GCUC NO: 560 UCUAU SEQ ID UAGAUACCGAAGUAGGCGG SEQ ID AGCCGCCUACUUCGGU 634-656 NO: 285 CUCG NO: 561 AUCUA SEQ ID GGAAUACGGACCACGCAGU SEQ ID AGACUGCGUGGUCCGU 235-257 NO: 286 CUAU NO: 562 AUUCC SEQ ID CAGCUGAUGACGAUGUGAG SEQ ID CACUCACAUCGUCAUC 691-713 NO: 287 UGUU NO: 563 AGCUG SEQ ID AUUUAUCUUUGAAGGCGAA SEQ ID ACUUCGCCUUCAAAGA 333-355 NO: 288 GUUA NO: 564 UAAAU SEQ ID GUGUCAUAGAUACCGAAGU SEQ ID CUACUUCGGUAUCUAU 640-662 NO: 289 AGGC NO: 565 GACAC SEQ ID UUCCCAUUUUCAACCAGUA SEQ ID UUUACUGGUUGAAAAU 1074-1096 NO: 290 AAUA NO: 566 GGGAA SEQ ID GCUGCUAGACGGGUACGGG SEQ ID UGCCCGUACCCGUCUA 478-500 NO: 291 CAAA NO: 567 GCAGC SEQ ID CAGUUCCUUUGCGCCCUGA SEQ ID AGUCAGGGCGCAAAGG 792-814 NO: 292 CUGC NO: 568 AACUG SEQ ID CUUCCCAUUUUCAACCAGU SEQ ID UUACUGGUUGAAAAUG 1075-1097 NO: 293 AAAU NO: 569 GGAAG SEQ ID AGAUACCGAAGUAGGCGGC SEQ ID GAGCCGCCUACUUCGG 633-655 NO: 294 UCGG NO: 570 UAUCU SEQ ID UUAACCAGGCAGUCACCGA SEQ ID CCUCGGUGACUGCCUG 538-560 NO: 295 GGCC NO: 571 GUUAA SEQ ID AUCAUCCAGCUGAUGACGA SEQ ID CAUCGUCAUCAGCUGG 697-719 NO: 296 UGUG NO: 572 AUGAU SEQ ID AUUUAUCAGGAGUGACUGA SEQ ID UUUCAGUCACUCCUGA 1173-1195 NO: 297 AAUA NO: 573 UAAAU SEQ ID GACAGUCUGUGCGAUCAUC SEQ ID UGGAUGAUCGCACAGA 710-732 NO: 298 CAGC NO: 574 CUGUC SEQ ID UCUAUAAUGCCUUUGUAUU SEQ ID GCAAUACAAAGGCAUU 217-239 NO: 299 GCUU NO: 575 AUAGA SEQ ID UAACCAGGCAGUCACCGAG SEQ ID GCCUCGGUGACUGCCU 537-559 NO: 300 GCCU NO: 576 GGUUA SEQ ID CCCUGCACAGACACGUUAA SEQ ID CUUUAACGUGUCUGUG 598-620 NO: 301 AGCC NO: 577 CAGGG SEQ ID CACGCAGUCUAUAAUGCCU SEQ ID AAAGGCAUUAUAGACU 224-246 NO: 302 UUGU NO: 578 GCGUG SEQ ID UAAUACAACAUGCCUGUUC SEQ ID GUGAACAGGCAUGUUG 993-1015 NO: 303 ACAG NO: 579 UAUUA SEQ ID UGCACAGACACGUUAAAGC SEQ ID AGGCUUUAACGUGUCU 595-617 NO: 305 CUUG NO: 581 GUGCA SEQ ID GUUCCUUUGCGCCCUGACU SEQ ID GCAGUCAGGGCGCAAA 790-812 NO: 306 GCAU NO: 582 GGAAC SEQ ID GUGACAGUCUGUGCGAUCA SEQ ID GAUGAUCGCACAGACU 712-734 NO: 307 UCCA NO: 583 GUCAC SEQ ID ACCACGCAGUCUAUAAUGC SEQ ID AGGCAUUAUAGACUGC 226-248 NO: 308 CUUU NO: 584 GUGGU SEQ ID CAGUGACAGUCUGUGCGAU SEQ ID UGAUCGCACAGACUGU 714-736 NO: 309 CAUC NO: 585 CACUG SEQ ID UUGGGAAUACGGACCACGC SEQ ID CUGCGUGGUCCGUAUU 238-260 NO: 310 AGUC NO: 586 CCCAA SEQ ID GUCUAUAAUGCCUUUGUAU SEQ ID CAAUACAAAGGCAUUA 218-240 NO: 311 UGCU NO: 587 UAGAC SEQ ID UGUGCGAUCAUCCAGCUGA SEQ ID CAUCAGCUGGAUGAUC 703-725 NO: 312 UGAC NO: 588 GCACA SEQ ID ACGGACCACGCAGUCUAUA SEQ ID AUUAUAGACUGCGUGG 230-252 NO: 313 AUGC NO: 589 UCCGU SEQ ID UGCUAGACGGGUACGGGCA SEQ ID UUUGCCCGUACCCGUC 476-498 NO: 314 AAAU NO: 590 UAGCA SEQ ID UCAUCCAGCUGAUGACGAU SEQ ID ACAUCGUCAUCAGCUG 696-718 NO: 315 GUGA NO: 591 GAUGA SEQ ID CGGGUACGGGCAAAAUCAA SEQ ID UCUUGAUUUUGCCCGU 469-491 NO: 316 GAGG NO: 592 ACCCG SEQ ID AAUACGGACCACGCAGUCU SEQ ID AUAGACUGCGUGGUCC 233-255 NO: 317 AUAA NO: 593 GUAUU SEQ ID UCAUAGAUACCGAAGUAGG SEQ ID CGCCUACUUCGGUAUC 637-659 NO: 318 CGGC NO: 594 UAUGA SEQ ID GGGAAUACGGACCACGCAG SEQ ID GACUGCGUGGUCCGUA 236-258 NO: 319 UCUA NO: 595 UUCCC SEQ ID GUGCGAUCAUCCAGCUGAU SEQ ID UCAUCAGCUGGAUGAU 702-724 NO: 320 GACG NO: 596 CGCAC SEQ ID UACGGACCACGCAGUCUAU SEQ ID UUAUAGACUGCGUGGU 231-253 NO: 321 AAUG NO: 597 CCGUA SEQ ID UGUCAUAGAUACCGAAGUA SEQ ID CCUACUUCGGUAUCUA 639-661 NO: 322 GGCG NO: 598 UGACA SEQ ID UGCGAUCAUCCAGCUGAUG SEQ ID GUCAUCAGCUGGAUGA 701-723 NO: 324 ACGA NO: 600 UCGCA SEQ ID CUAGACGGGUACGGGCAAA SEQ ID AUUUUGCCCGUACCCG 474-496 NO: 325 AUCA NO: 601 UCUAG SEQ ID GAUCCGGAAGCAUUCCCUU SEQ ID CAAAGGGAAUGCUUCC 663-685 NO: 326 UGCA NO: 602 GGAUC SEQ ID GCACAGACACGUUAAAGCC SEQ ID AAGGCUUUAACGUGUC 594-616 NO: 327 UUGG NO: 603 UGUGC SEQ ID CCACGCAGUCUAUAAUGCC SEQ ID AAGGCAUUAUAGACUG 225-247 NO: 328 UUUG NO: 604 CGUGG SEQ ID GACGGGUACGGGCAAAAUC SEQ ID UUGAUUUUGCCCGUAC 471-493 NO: 329 AAGA NO: 605 CCGUC SEQ ID GAUACCGAAGUAGGCGGCU SEQ ID CGAGCCGCCUACUUCG 632-654 NO: 330 CGGU NO: 606 GUAUC SEQ ID GUAGGCGGCUCGGUAGAUG SEQ ID AUCAUCUACCGAGCCG 623-645 NO: 331 AUAA NO: 607 CCUAC SEQ ID AGACGGGUACGGGCAAAAU SEQ ID UGAUUUUGCCCGUACC 472-494 NO: 332 CAAG NO: 608 CGUCU SEQ ID UAGGCGGCUCGGUAGAUGA SEQ ID UAUCAUCUACCGAGCC 622-644 NO: 333 UAAU NO: 609 GCCUA SEQ ID AAGUAGGCGGCUCGGUAGA SEQ ID CAUCUACCGAGCCGCC 625-647 NO: 334 UGAU NO: 610 UACUU SEQ ID CUUUGAAGGCGAAGUUAAG SEQ ID CUCUUAACUUCGCCUU 327-349 NO: 335 AGCC NO: 611 CAAAG SEQ ID CGAAGUUAAGAGCCUGGGU SEQ ID CCACCCAGGCUCUUAA 318-340 NO: 336 GGGG NO: 612 CUUCG SEQ ID CCCUGCUCCUUGGGAAUAC SEQ ID CCGUAUUCCCAAGGAG 247-269 NO: 337 GGAC NO: 613 CAGGG SEQ ID GAAGGACAGAACUCCCUGC SEQ ID GAGCAGGGAGUUCUGU 260-282 NO: 338 UCCU NO: 614 CCUUC SEQ ID AGAACUCCCUGCUCCUUGG SEQ ID UCCCAAGGAGCAGGGA 253-275 NO: 339 GAAU NO: 615 GUUCU SEQ ID CCUGCUCCUUGGGAAUACG SEQ ID UCCGUAUUCCCAAGGA 246-268 NO: 340 GACC NO: 616 GCAGG SEQ ID CAGAAGGACAGAACUCCCU SEQ ID GCAGGGAGUUCUGUCC 262-284 NO: 341 GCUC NO: 617 UUCUG SEQ ID CUGCUCCUUGGGAAUACGG SEQ ID GUCCGUAUUCCCAAGG 245-267 NO: 342 ACCA NO: 618 AGCAG SEQ ID AGAAGGACAGAACUCCCUG SEQ ID AGCAGGGAGUUCUGUC 261-283 NO: 343 CUCC NO: 619 CUUCU SEQ ID AAGGACAGAACUCCCUGCU SEQ ID GGAGCAGGGAGUUCUG 259-281 NO: 344 CCUU NO: 620 UCCUU SEQ ID GAACUCCCUGCUCCUUGGG SEQ ID UUCCCAAGGAGCAGGG 252-274 NO: 345 AAUA NO: 621 AGUUC SEQ ID AGGACAGAACUCCCUGCUC SEQ ID AGGAGCAGGGAGUUCU 258-280 NO: 346 CUUG NO: 622 GUCCU SEQ ID GAAGUUAAGAGCCUGGGUG SEQ ID CCCACCCAGGCUCUUA 317-339 NO: 347 GGGA NO: 623 ACUUC SEQ ID UCUUUGAAGGCGAAGUUAA SEQ ID UCUUAACUUCGCCUUC 328-350 NO: 348 GAGC NO: 624 AAAGA SEQ ID UAUUUAUCAGGAGUGACUG SEQ ID UUCAGUCACUCCUGAU 1174-1196 NO: 349 AAAU NO: 625 AAAUA SEQ ID GUUAUUUAUCAGGAGUGAC SEQ ID CAGUCACUCCUGAUAA 1176-1198 NO: 350 UGAA NO: 626 AUAAC SEQ ID UUAUUUAUCAGGAGUGACU SEQ ID UCAGUCACUCCUGAUA 1175-1197 NO: 351 GAAA NO: 627 AAUAA SEQ ID AAAUACAAUUGAGUCCCAU SEQ ID UGAUGGGACUCAAUUG 1148-1170 NO: 352 CAUC NO: 628 UAUUU SEQ ID AAAAUACAAUUGAGUCCCA SEQ ID GAUGGGACUCAAUUGU 1149-1171 NO: 353 UCAU NO: 629 AUUUU SEQ ID AUUUGUUAUUUAUCAGGAG SEQ ID CACUCCUGAUAAAUAA 1180-1202 NO: 354 UGAC NO: 630 CAAAU SEQ ID GAGAAAACUGGUCAGAUGA SEQ ID AUUCAUCUGACCAGUU 1103-1125 NO: 355 AUAU NO: 631 UUCUC SEQ ID AUAUAAUACAACAUGCCUG SEQ ID AACAGGCAUGUUGUAU 996-1018 NO: 356 UUCA NO: 632 UAUAU SEQ ID UGGGAUCCGGAAGCAUUCC SEQ ID AGGGAAUGCUUCCGGA 666-688 NO: 357 CUUU NO: 633 UCCCA SEQ ID UUGGGAUCCGGAAGCAUUC SEQ ID GGGAAUGCUUCCGGAU 667-689 NO: 358 CCUU NO: 634 CCCAA SEQ ID CAGGCAGUCACCGAGGCCU SEQ ID CGAGGCCUCGGUGACU 533-555 NO: 359 CGGA NO: 635 GCCUG SEQ ID UAUAUAAUACAACAUGCCU SEQ ID ACAGGCAUGUUGUAUU 997-1019 NO: 360 GUUC NO: 636 AUAUA SEQ ID AGUCUAUAAUGCCUUUGUA SEQ ID AAUACAAAGGCAUUAU 219-241 NO: 361 UUGC NO: 637 AGACU SEQ ID UUUAUCAGGAGUGACUGAA SEQ ID AUUUCAGUCACUCCUG 1172-1194 NO: 362 AUAA NO: 638 AUAAA SEQ ID AAUACAAUUGAGUCCCAUC SEQ ID AUGAUGGGACUCAAUU 1147-1169 NO: 363 AUCA NO: 639 GUAUU SEQ ID CUUUAAGAGAAAACUGGUC SEQ ID CUGACCAGUUUUCUCU 1109-1131 NO: 364 AGAU NO: 640 UAAAG SEQ ID GCUUUAAGAGAAAACUGGU SEQ ID UGACCAGUUUUCUCUU 1110-1132 NO: 365 CAGA NO: 641 AAAGC SEQ ID AAUGCCUUUGUAUUGCUUA SEQ ID GAUAAGCAAUACAAAG 212-234 NO: 366 UCUG NO: 642 GCAUU SEQ ID UAAUGCCUUUGUAUUGCUU SEQ ID AUAAGCAAUACAAAGG 213-235 NO: 367 AUCU NO: 643 CAUUA SEQ ID UACCCUGCACAGACACGUU SEQ ID UUAACGUGUCUGUGCA 600-622 NO: 368 AAAG NO: 644 GGGUA SEQ ID AUACCCUGCACAGACACGU SEQ ID UAACGUGUCUGUGCAG 601-623 NO: 369 UAAA NO: 645 GGUAU SEQ ID AUCCAGCUGAUGACGAUGU SEQ ID UCACAUCGUCAUCAGC 694-716 NO: 370 GAGU NO: 646 UGGAU SEQ ID UACAAUUGAGUCCCAUCAU SEQ ID UGAUGAUGGGACUCAA 1145-1167 NO: 371 CAUC NO: 647 UUGUA SEQ ID UGGGAAUACGGACCACGCA SEQ ID ACUGCGUGGUCCGUAU 237-259 NO: 372 GUCU NO: 648 UCCCA SEQ ID UAUAAUACAACAUGCCUGU SEQ ID GAACAGGCAUGUUGUA 995-1017 NO: 373 UCAC NO: 649 UUAUA SEQ ID UUAUCAGGAGUGACUGAAA SEQ ID UAUUUCAGUCACUCCU 1171-1193 NO: 374 UAAA NO: 650 GAUAA SEQ ID AUAAUGCCUUUGUAUUGCU SEQ ID UAAGCAAUACAAAGGC 214-236 NO: 375 UAUC NO: 651 AUUAU SEQ ID CCAGCUGAUGACGAUGUGA SEQ ID ACUCACAUCGUCAUCA 692-714 NO: 376 GUGU NO: 652 GCUGG SEQ ID CAUAGAUACCGAAGUAGGC SEQ ID CCGCCUACUUCGGUAU 636-658 NO: 377 GGCU NO: 653 CUAUG SEQ ID CAUCCAGCUGAUGACGAUG SEQ ID CACAUCGUCAUCAGCU 695-717 NO: 378 UGAG NO: 654 GGAUG SEQ ID GUCAUAGAUACCGAAGUAG SEQ ID GCCUACUUCGGUAUCU 638-660 NO: 379 GCGG NO: 655 AUGAC SEQ ID ACCCUGCACAGACACGUUA SEQ ID UUUAACGUGUCUGUGC 599-621 NO: 380 AAGC NO: 656 AGGGU SEQ ID UGCAUCAUCAUGCGGCGGC SEQ ID UCGCCGCCGCAUGAUG 772-794 NO: 381 GAAC NO: 657 AUGCA SEQ ID CGGACCACGCAGUCUAUAA SEQ ID CAUUAUAGACUGCGUG 229-251 NO: 382 UGCC NO: 658 GUCCG SEQ ID CUUGGGAAUACGGACCACG SEQ ID UGCGUGGUCCGUAUUC 239-261 NO: 383 CAGU NO: 659 CCAAG SEQ ID GAAGUAGGCGGCUCGGUAG SEQ ID AUCUACCGAGCCGCCU 626-648 NO: 384 AUGA NO: 660 ACUUC SEQ ID CUGCUAGACGGGUACGGGC SEQ ID UUGCCCGUACCCGUCU 477-499 NO: 385 AAAA NO: 661 AGCAG SEQ ID UCCAGCUGAUGACGAUGUG SEQ ID CUCACAUCGUCAUCAG 693-715 NO: 386 AGUG NO: 662 CUGGA SEQ ID AUACGGACCACGCAGUCUA SEQ ID UAUAGACUGCGUGGUC 232-254 NO: 387 UAAU NO: 663 CGUAU SEQ ID AACCAGGCAGUCACCGAGG SEQ ID GGCCUCGGUGACUGCC 536-558 NO: 388 CCUC NO: 664 UGGUU SEQ ID UGACAGUCUGUGCGAUCAU SEQ ID GGAUGAUCGCACAGAC 711-733 NO: 389 CCAG NO: 665 UGUCA SEQ ID UAGACGGGUACGGGCAAAA SEQ ID GAUUUUGCCCGUACCC 473-495 NO: 390 UCAA NO: 666 GUCUA SEQ ID GCAGUGACAGUCUGUGCGA SEQ ID GAUCGCACAGACUGUC 715-737 NO: 391 UCAU NO: 667 ACUGC SEQ ID AGUGACAGUCUGUGCGAUC SEQ ID AUGAUCGCACAGACUG 713-735 NO: 392 AUCC NO: 668 UCACU SEQ ID GCUAGACGGGUACGGGCAA SEQ ID UUUUGCCCGUACCCGU 475-497 NO: 393 AAUC NO: 669 CUAGC SEQ ID AGUAGGCGGCUCGGUAGAU SEQ ID UCAUCUACCGAGCCGC 624-646 NO: 394 GAUA NO: 670 CUACU SEQ ID GAAUACGGACCACGCAGUC SEQ ID UAGACUGCGUGGUCCG 234-256 NO: 395 UAUA NO: 671 UAUUC SEQ ID CUUUGUAUUGCUUAUCUGC SEQ ID CUGCAGAUAAGCAAUA 207-229 NO: 396 AGUG NO: 672 CAAAG SEQ ID UUUGUAUUGCUUAUCUGCA SEQ ID ACUGCAGAUAAGCAAU 206-228 NO: 397 GUGA NO: 673 ACAAA SEQ ID UUGUAUUGCUUAUCUGCAG SEQ ID CACUGCAGAUAAGCAA 205-227 NO: 398 UGAU NO: 674 UACAA SEQ ID UAUCUGCAGUGAUCUGCUU SEQ ID GCAAGCAGAUCACUGC 195-217 NO: 399 GCUG NO: 675 AGAUA SEQ ID GUAUUGCUUAUCUGCAGUG SEQ ID AUCACUGCAGAUAAGC 203-225 NO: 400 AUCU NO: 676 AAUAC SEQ ID UGUAUUGCUUAUCUGCAGU SEQ ID UCACUGCAGAUAAGCA 204-226 NO: 401 GAUC NO: 677 AUACA SEQ ID UGCUUAUCUGCAGUGAUCU SEQ ID GCAGAUCACUGCAGAU 199-221 NO: 402 GCUU NO: 678 AAGCA SEQ ID UUGCUUAUCUGCAGUGAUC SEQ ID CAGAUCACUGCAGAUA 200-222 NO: 403 UGCU NO: 679 AGCAA SEQ ID AUCUGCAGUGAUCUGCUUG SEQ ID AGCAAGCAGAUCACUG 194-216 NO: 404 CUGG NO: 680 CAGAU SEQ ID UAUUGCUUAUCUGCAGUGA SEQ ID GAUCACUGCAGAUAAG 202-224 NO: 405 UCUG NO: 681 CAAUA SEQ ID UUCUCCAAAUUUGUUAUUU SEQ ID AUAAAUAACAAAUUUG 1188-1210 NO: 406 AUCA NO: 682 GAGAA SEQ ID CAAAUUUGUUAUUUAUCAG SEQ ID UCCUGAUAAAUAACAA 1183-1205 NO: 407 GAGU NO: 683 AUUUG SEQ ID GAGGCCUCGGAAUUCCCUU SEQ ID GAAAGGGAAUUCCGAG 521-543 NO: 408 UCAG NO: 684 GCCUC SEQ ID AGAUAUGUUAUAUAAUACA SEQ ID GUUGUAUUAUAUAACA 1005-1027 NO: 409 ACAU NO: 685 UAUCU SEQ ID GCAGUCACCGAGGCCUCGG SEQ ID UUCCGAGGCCUCGGUG 530-552 NO: 410 AAUU NO: 686 ACUGC SEQ ID CGAGGCCUCGGAAUUCCCU SEQ ID AAAGGGAAUUCCGAGG 522-544 NO: 411 UUCA NO: 687 CCUCG SEQ ID CAAGAUAUGUUAUAUAAUA SEQ ID UGUAUUAUAUAACAUA 1007-1029 NO: 412 CAAC NO: 688 UCUUG SEQ ID AGUCACCGAGGCCUCGGAA SEQ ID AAUUCCGAGGCCUCGG 528-550 NO: 413 UUCC NO: 689 UGACU SEQ ID CACCGAGGCCUCGGAAUUC SEQ ID GGGAAUUCCGAGGCCU 525-547 NO: 414 CCUU NO: 690 CGGUG SEQ ID CCUCGGAAUUCCCUUUCAG SEQ ID AGCUGAAAGGGAAUUC 517-539 NO: 415 CUCC NO: 691 CGAGG SEQ ID UCGGAAUUCCCUUUCAGCU SEQ ID GGAGCUGAAAGGGAAU 515-537 NO: 416 CCAG NO: 692 UCCGA SEQ ID GGCCUCGGAAUUCCCUUUC SEQ ID CUGAAAGGGAAUUCCG 519-541 NO: 417 AGCU NO: 693 AGGCC SEQ ID CUCGGAAUUCCCUUUCAGC SEQ ID GAGCUGAAAGGGAAUU 516-538 NO: 418 UCCA NO: 694 CCGAG SEQ ID GCCUCGGAAUUCCCUUUCA SEQ ID GCUGAAAGGGAAUUCC 518-540 NO: 419 GCUC NO: 695 GAGGC SEQ ID AUGUUAUAUAAUACAACAU SEQ ID GCAUGUUGUAUUAUAU 1001-1023 NO: 420 GCCU NO: 696 AACAU SEQ ID AAGAUAUGUUAUAUAAUAC SEQ ID UUGUAUUAUAUAACAU 1006-1028 NO: 421 AACA NO: 697 AUCUU SEQ ID UCAAGAUAUGUUAUAUAAU SEQ ID GUAUUAUAUAACAUAU 1008-1030 NO: 422 ACAA NO: 698 CUUGA SEQ ID UGUUAUAUAAUACAACAUG SEQ ID GGCAUGUUGUAUUAUA 1000-1022 NO: 423 CCUG NO: 699 UAACA SEQ ID CCGAGGCCUCGGAAUUCCC SEQ ID AAGGGAAUUCCGAGGC 523-545 NO: 424 UUUC NO: 700 CUCGG SEQ ID GUCACCGAGGCCUCGGAAU SEQ ID GAAUUCCGAGGCCUCG 527-549 NO: 425 UCCC NO: 701 GUGAC SEQ ID ACCGAGGCCUCGGAAUUCC SEQ ID AGGGAAUUCCGAGGCC 524-546 NO: 426 CUUU NO: 702 UCGGU SEQ ID UCACCGAGGCCUCGGAAUU SEQ ID GGAAUUCCGAGGCCUC 526-548 NO: 427 CCCU NO: 703 GGUGA SEQ ID AUUUCAUCAUACAAGACAA SEQ ID GCUUGUCUUGUAUGAU 931-953 NO: 428 GCAC NO: 704 GAAAU SEQ ID UGUAUUUAUCUUUGAAGGC SEQ ID UCGCCUUCAAAGAUAA 336-358 NO: 429 GAAG NO: 705 AUACA SEQ ID AUUUGUAGAUCUUAACCAG SEQ ID GCCUGGUUAAGAUCUA 549-571 NO: 430 GCAG NO: 706 CAAAU SEQ ID UUCCCUUUGCAGUGUCAUA SEQ ID UCUAUGACACUGCAAA 651-673 NO: 431 GAUA NO: 707 GGGAA SEQ ID AUCAUACAAGACAAGCACA SEQ ID UUUGUGCUUGUCUUGU 926-948 NO: 432 AAAG NO: 708 AUGAU SEQ ID UAGAUCUUAACCAGGCAGU SEQ ID UGACUGCCUGGUUAAG 544-566 NO: 433 CACC NO: 709 AUCUA SEQ ID AAGCAUUCCCUUUGCAGUG SEQ ID GACACUGCAAAGGGAA 656-678 NO: 434 UCAU NO: 710 UGCUU SEQ ID UUUGCAGUGUCAUAGAUAC SEQ ID CGGUAUCUAUGACACU 646-668 NO: 435 CGAA NO: 711 GCAAA SEQ ID AGAGAAAACUGGUCAGAUG SEQ ID UUCAUCUGACCAGUUU 1104-1126 NO: 436 AAUA NO: 712 UCUCU SEQ ID UGCAGUGUCAUAGAUACCG SEQ ID UUCGGUAUCUAUGACA 644-666 NO: 437 AAGU NO: 713 CUGCA SEQ ID UCAGAUUUGUAGAUCUUAA SEQ ID GGUUAAGAUCUACAAA 553-575 NO: 438 CCAG NO: 714 UCUGA SEQ ID GAACAUUGGACCAUGCACC SEQ ID AGGGUGCAUGGUCCAA 885-907 NO: 440 CUUG NO: 716 UGUUC SEQ ID AAUCCCAUCAGAUUUGUAG SEQ ID AUCUACAAAUCUGAUG 560-582 NO: 441 AUCU NO: 717 GGAUU SEQ ID GCAGUGUCAUAGAUACCGA SEQ ID CUUCGGUAUCUAUGAC 643-665 NO: 442 AGUA NO: 718 ACUGC SEQ ID CAAGCACAAAAGCACCACC SEQ ID UGGGUGGUGCUUUUGU 915-937 NO: 443 CAUG NO: 719 GCUUG SEQ ID GCGGCUCGGUAGAUGAUAA SEQ ID UAUUAUCAUCUACCGA 619-641 NO: 444 UACC NO: 720 GCCGC SEQ ID CUCCUUGGGAAUACGGACC SEQ ID GUGGUCCGUAUUCCCA 242-264 NO: 445 ACGC NO: 721 AGGAG SEQ ID AUUCCCUUUGCAGUGUCAU SEQ ID CUAUGACACUGCAAAG 652-674 NO: 446 AGAU NO: 722 GGAAU SEQ ID CAUACAAGACAAGCACAAA SEQ ID CUUUUGUGCUUGUCUU 924-946 NO: 447 AGCA NO: 723 GUAUG SEQ ID AGACACGUUAAAGCCUUGG SEQ ID UACCAAGGCUUUAACG 590-612 NO: 448 UACA NO: 724 UGUCU SEQ ID UGAGAACAUUGGACCAUGC SEQ ID GUGCAUGGUCCAAUGU 888-910 NO: 449 ACCC NO: 725 UCUCA SEQ ID GCUUGUAUUUAUCUUUGAA SEQ ID CCUUCAAAGAUAAAUA 339-361 NO: 450 GGCG NO: 726 CAAGC SEQ ID GCUCGGUAGAUGAUAAUAC SEQ ID GGGUAUUAUCAUCUAC 616-638 NO: 451 CCUG NO: 727 CGAGC SEQ ID AGUGUCAUAGAUACCGAAG SEQ ID UACUUCGGUAUCUAUG 641-663 NO: 452 UAGG NO: 728 ACACU SEQ ID GGUAGAUGAUAAUACCCUG SEQ ID UGCAGGGUAUUAUCAU 612-634 NO: 454 CACA NO: 730 CUACC SEQ ID CAGGCCCUUAAUCCCAUCA SEQ ID UCUGAUGGGAUUAAGG 569-591 NO: 455 GAUU NO: 731 GCCUG SEQ ID AGAUGAUAAUACCCUGCAC SEQ ID CUGUGCAGGGUAUUAU 609-631 NO: 456 AGAC NO: 732 CAUCU SEQ ID UACAGGCCCUUAAUCCCAU SEQ ID UGAUGGGAUUAAGGGC 571-593 NO: 457 CAGA NO: 733 CUGUA SEQ ID ACAGACACGUUAAAGCCUU SEQ ID CCAAGGCUUUAACGUG 592-614 NO: 458 GGUA NO: 734 UCUGU SEQ ID AGAAAACUGGUCAGAUGAA SEQ ID UAUUCAUCUGACCAGU 1102-1124 NO: 459 UAUU NO: 735 UUUCU SEQ ID UGUAGAUCUUAACCAGGCA SEQ ID ACUGCCUGGUUAAGAU 546-568 NO: 460 GUCA NO: 736 CUACA SEQ ID UCAAAUGGAUAGGAAGUCA SEQ ID GUUGACUUCCUAUCCA 745-767 NO: 461 ACCC NO: 737 UUUGA SEQ ID CAUUCCCUUUGCAGUGUCA SEQ ID UAUGACACUGCAAAGG 653-675 NO: 462 UAGA NO: 738 GAAUG SEQ ID CAUCAGAUUUGUAGAUCUU SEQ ID UUAAGAUCUACAAAUC 555-577 NO: 463 AACC NO: 739 UGAUG SEQ ID CUCGGUAGAUGAUAAUACC SEQ ID AGGGUAUUAUCAUCUA 615-637 NO: 464 CUGC NO: 740 CCGAG SEQ ID UUUGUAGAUCUUAACCAGG SEQ ID UGCCUGGUUAAGAUCU 548-570 NO: 465 CAGU NO: 741 ACAAA SEQ ID ACAGGCCCUUAAUCCCAUC SEQ ID CUGAUGGGAUUAAGGG 570-592 NO: 466 AGAU NO: 742 CCUGU SEQ ID CUUUGCAGUGUCAUAGAUA SEQ ID GGUAUCUAUGACACUG 647-669 NO: 467 CCGA NO: 743 CAAAG SEQ ID CACAUCAGCUGCUAGACGG SEQ ID ACCCGUCUAGCAGCUG 485-507 NO: 468 GUAC NO: 744 AUGUG SEQ ID CCCUUUGCAGUGUCAUAGA SEQ ID UAUCUAUGACACUGCA 649-671 NO: 469 UACC NO: 745 AAGGG SEQ ID CUCCAGCUUUACCCACAUC SEQ ID CUGAUGUGGGUAAAGC 498-520 NO: 470 AGCU NO: 746 UGGAG SEQ ID UUACCCACAUCAGCUGCUA SEQ ID UCUAGCAGCUGAUGUG 490-512 NO: 471 GACG NO: 747 GGUAA SEQ ID UUAAAGCCUUGGUACAGGC SEQ ID GGGCCUGUACCAAGGC 583-605 NO: 472 CCUU NO: 748 UUUAA SEQ ID CAGCUGCUAGACGGGUACG SEQ ID CCCGUACCCGUCUAGC 480-502 NO: 473 GGCA NO: 749 AGCUG SEQ ID CAGCUUUACCCACAUCAGC SEQ ID CAGCUGAUGUGGGUAA 495-517 NO: 474 UGCU NO: 750 AGCUG SEQ ID UCAGCUGCUAGACGGGUAC SEQ ID CCGUACCCGUCUAGCA 481-503 NO: 475 GGGC NO: 751 GCUGA SEQ ID UCCAGCUUUACCCACAUCA SEQ ID GCUGAUGUGGGUAAAG 497-519 NO: 476 GCUG NO: 752 CUGGA SEQ ID GGCUCGGUAGAUGAUAAUA SEQ ID GGUAUUAUCAUCUACC 617-639 NO: 477 CCCU NO: 753 GAGCC SEQ ID AGGCGGCUCGGUAGAUGAU SEQ ID UUAUCAUCUACCGAGC 621-643 NO: 478 AAUA NO: 754 CGCCU SEQ ID CAUCAGCUGCUAGACGGGU SEQ ID GUACCCGUCUAGCAGC 483-505 NO: 479 ACGG NO: 755 UGAUG SEQ ID GUACAGGCCCUUAAUCCCA SEQ ID GAUGGGAUUAAGGGCC 572-594 NO: 480 UCAG NO: 756 UGUAC SEQ ID AUGAUAAUACCCUGCACAG SEQ ID GUCUGUGCAGGGUAUU 607-629 NO: 481 ACAC NO: 757 AUCAU SEQ ID CCUUGGGAAUACGGACCAC SEQ ID GCGUGGUCCGUAUUCC 240-262 NO: 482 GCAG NO: 758 CAAGG SEQ ID UCCUUGGGAAUACGGACCA SEQ ID CGUGGUCCGUAUUCCC 241-263 NO: 483 CGCA NO: 759 AAGGA SEQ ID CAGAUUUGUAGAUCUUAAC SEQ ID UGGUUAAGAUCUACAA 552-574 NO: 484 CAGG NO: 760 AUCUG SEQ ID UGUACUUCUUGAUUUCAUC SEQ ID AUGAUGAAAUCAAGAA 942-964 NO: 485 AUAC NO: 761 GUACA SEQ ID AUCCCAUCAGAUUUGUAGA SEQ ID GAUCUACAAAUCUGAU 559-581 NO: 486 UCUU NO: 762 GGGAU SEQ ID GUAGAUGAUAAUACCCUGC SEQ ID GUGCAGGGUAUUAUCA 611-633 NO: 487 ACAG NO: 763 UCUAC SEQ ID GACACGUUAAAGCCUUGGU SEQ ID GUACCAAGGCUUUAAC 589-611 NO: 488 ACAG NO: 764 GUGUC SEQ ID AGCUUUACCCACAUCAGCU SEQ ID GCAGCUGAUGUGGGUA 494-516 NO: 489 GCUA NO: 765 AAGCU SEQ ID AAGCACAAAAGCACCACCC SEQ ID AUGGGUGGUGCUUUUG 914-936 NO: 490 AUGC NO: 766 UGCUU SEQ ID AUCUUAACCAGGCAGUCAC SEQ ID CGGUGACUGCCUGGUU 541-563 NO: 491 CGAG NO: 767 AAGAU SEQ ID UUUACCCACAUCAGCUGCU SEQ ID CUAGCAGCUGAUGUGG 491-513 NO: 492 AGAC NO: 768 GUAAA SEQ ID CUUAAUCCCAUCAGAUUUG SEQ ID UACAAAUCUGAUGGGA 563-585 NO: 493 UAGA NO: 769 UUAAG SEQ ID CAGUGUCAUAGAUACCGAA SEQ ID ACUUCGGUAUCUAUGA 642-664 NO: 494 GUAG NO: 770 CACUG SEQ ID CCAGCUUUACCCACAUCAG SEQ ID AGCUGAUGUGGGUAAA 496-518 NO: 495 CUGC NO: 771 GCUGG SEQ ID GAUGAUAAUACCCUGCACA SEQ ID UCUGUGCAGGGUAUUA 608-630 NO: 497 GACA NO: 773 UCAUC SEQ ID UUUCAUCAUACAAGACAAG SEQ ID UGCUUGUCUUGUAUGA 930-952 NO: 498 CACA NO: 774 UGAAA SEQ ID CAGACACGUUAAAGCCUUG SEQ ID ACCAAGGCUUUAACGU 591-613 NO: 499 GUAC NO: 775 GUCUG SEQ ID AGAACAUUGGACCAUGCAC SEQ ID GGGUGCAUGGUCCAAU 886-908 NO: 500 CCUU NO: 776 GUUCU SEQ ID GUAGAUCUUAACCAGGCAG SEQ ID GACUGCCUGGUUAAGA 545-567 NO: 501 UCAC NO: 777 UCUAC SEQ ID AGCUCCAGCUUUACCCACA SEQ ID GAUGUGGGUAAAGCUG 500-522 NO: 502 UCAG NO: 778 GAGCU SEQ ID GCUCCUUGGGAAUACGGAC SEQ ID UGGUCCGUAUUCCCAA 243-265 NO: 503 CACG NO: 779 GGAGC SEQ ID GAAGCAUUCCCUUUGCAGU SEQ ID ACACUGCAAAGGGAAU 657-679 NO: 504 GUCA NO: 780 GCUUC SEQ ID CCUUGGUACAGGCCCUUAA SEQ ID GAUUAAGGGCCUGUAC 577-599 NO: 505 UCCC NO: 781 CAAGG SEQ ID UAGAUGAUAAUACCCUGCA SEQ ID UGUGCAGGGUAUUAUC 610-632 NO: 506 CAGA NO: 782 AUCUA SEQ ID AAUACCCUGCACAGACACG SEQ ID AACGUGUCUGUGCAGG 602-624 NO: 507 UUAA NO: 783 GUAUU SEQ ID GUUAAAGCCUUGGUACAGG SEQ ID GGCCUGUACCAAGGCU 584-606 NO: 508 CCCU NO: 784 UUAAC SEQ ID AGCAUUCCCUUUGCAGUGU SEQ ID UGACACUGCAAAGGGA 655-677 NO: 509 CAUA NO: 785 AUGCU SEQ ID UCUUAACCAGGCAGUCACC SEQ ID UCGGUGACUGCCUGGU 540-562 NO: 510 GAGG NO: 786 UAAGA SEQ ID AUACAAGACAAGCACAAAA SEQ ID GCUUUUGUGCUUGUCU 923-945 NO: 511 GCAC NO: 787 UGUAU SEQ ID GACAAGCACAAAAGCACCA SEQ ID GGUGGUGCUUUUGUGC 917-939 NO: 512 CCCA NO: 788 UUGUC SEQ ID ACCCACAUCAGCUGCUAGA SEQ ID CGUCUAGCAGCUGAUG 488-510 NO: 513 CGGG NO: 789 UGGGU SEQ ID UAAAGCCUUGGUACAGGCC SEQ ID AGGGCCUGUACCAAGG 582-604 NO: 514 CUUA NO: 790 CUUUA SEQ ID UUCAUCAUACAAGACAAGC SEQ ID GUGCUUGUCUUGUAUG 929-951 NO: 515 ACAA NO: 791 AUGAA SEQ ID GCCCUUAAUCCCAUCAGAU SEQ ID AAAUCUGAUGGGAUUA 566-588 NO: 516 UUGU NO: 792 AGGGC SEQ ID UUAAUCCCAUCAGAUUUGU SEQ ID CUACAAAUCUGAUGGG 562-584 NO: 517 AGAU NO: 793 AUUAA SEQ ID UCGGUAGAUGAUAAUACCC SEQ ID CAGGGUAUUAUCAUCU 614-636 NO: 518 UGCA NO: 794 ACCGA SEQ ID CACGUUAAAGCCUUGGUAC SEQ ID CUGUACCAAGGCUUUA 587-609 NO: 519 AGGC NO: 795 ACGUG SEQ ID UCCCAUCAGAUUUGUAGAU SEQ ID AGAUCUACAAAUCUGA 558-580 NO: 520 CUUA NO: 796 UGGGA SEQ ID UCAUACAAGACAAGCACAA SEQ ID UUUUGUGCUUGUCUUG 925-947 NO: 521 AAGC NO: 797 UAUGA SEQ ID CCUUAAUCCCAUCAGAUUU SEQ ID ACAAAUCUGAUGGGAU 564-586 NO: 522 GUAG NO: 798 UAAGG SEQ ID ACAUUGGACCAUGCACCCU SEQ ID CAAGGGUGCAUGGUCC 883-905 NO: 523 UGAA NO: 799 AAUGU SEQ ID CUUGGUACAGGCCCUUAAU SEQ ID GGAUUAAGGGCCUGUA 576-598 NO: 524 CCCA NO: 800 CCAAG SEQ ID UUGCAGUGUCAUAGAUACC SEQ ID UCGGUAUCUAUGACAC 645-667 NO: 525 GAAG NO: 801 UGCAA SEQ ID CACAGACACGUUAAAGCCU SEQ ID CAAGGCUUUAACGUGU 593-615 NO: 526 UGGU NO: 802 CUGUG SEQ ID AGCACAAAAGCACCACCCA SEQ ID CAUGGGUGGUGCUUUU 913-935 NO: 527 UGCC NO: 803 GUGCU SEQ ID CCAUCAGAUUUGUAGAUCU SEQ ID UAAGAUCUACAAAUCU 556-578 NO: 528 UAAC NO: 804 GAUGG SEQ ID CCACAUCAGCUGCUAGACG SEQ ID CCCGUCUAGCAGCUGA 486-508 NO: 529 GGUA NO: 805 UGUGG SEQ ID GCAUUCCCUUUGCAGUGUC SEQ ID AUGACACUGCAAAGGG 654-676 NO: 530 AUAG NO: 806 AAUGC SEQ ID CUUUACCCACAUCAGCUGC SEQ ID UAGCAGCUGAUGUGGG 492-514 NO: 531 UAGA NO: 807 UAAAG SEQ ID AUCCGGAAGCAUUCCCUUU SEQ ID GCAAAGGGAAUGCUUC 662-684 NO: 532 GCAG NO: 808 CGGAU SEQ ID AGCUGCUAGACGGGUACGG SEQ ID GCCCGUACCCGUCUAG 479-501 NO: 533 GCAA NO: 809 CAGCU SEQ ID CGGCUCGGUAGAUGAUAAU SEQ ID GUAUUAUCAUCUACCG 618-640 NO: 534 ACCC NO: 810 AGCCG SEQ ID GGGUACGGGCAAAAUCAAG SEQ ID CUCUUGAUUUUGCCCG 468-490 NO: 535 AGGG NO: 811 UACCC SEQ ID ACAUCAGCUGCUAGACGGG SEQ ID UACCCGUCUAGCAGCU 484-506 NO: 536 UACG NO: 812 GAUGU SEQ ID CCCUUAAUCCCAUCAGAUU SEQ ID CAAAUCUGAUGGGAUU 565-587 NO: 537 UGUA NO: 813 AAGGG SEQ ID CGGGCAAAAUCAAGAGGGU SEQ ID GUACCCUCUUGAUUUU 463-485 NO: 538 ACAC NO: 814 GCCCG SEQ ID ACGUUAAAGCCUUGGUACA SEQ ID CCUGUACCAAGGCUUU 586-608 NO: 539 GGCC NO: 815 AACGU SEQ ID UGGUACAGGCCCUUAAUCC SEQ ID UGGGAUUAAGGGCCUG 574-596 NO: 540 CAUC NO: 816 UACCA SEQ ID GGCGGCUCGGUAGAUGAUA SEQ ID AUUAUCAUCUACCGAG 620-642 NO: 541 AUAC NO: 817 CCGCC SEQ ID CGUUAAAGCCUUGGUACAG SEQ ID GCCUGUACCAAGGCUU 585-607 NO: 542 GCCC NO: 818 UAACG SEQ ID GGUACAGGCCCUUAAUCCC SEQ ID AUGGGAUUAAGGGCCU 573-595 NO: 543 AUCA NO: 819 GUACC SEQ ID UAAUACCCUGCACAGACAC SEQ ID ACGUGUCUGUGCAGGG 603-625 NO: 544 GUUA NO: 820 UAUUA SEQ ID GACCACGCAGUCUAUAAUG SEQ ID GGCAUUAUAGACUGCG 227-249 NO: 545 CCUU NO: 821 UGGUC SEQ ID GUUAAGAGCCUGGGUGGGG SEQ ID UUCCCCACCCAGGCUC 314-336 NO: 546 AAGU NO: 822 UUAAC SEQ ID UGGGGAAGUAUCUGAUGAC SEQ ID AUGUCAUCAGAUACUU 300-322 NO: 547 AUUG NO: 823 CCCCA SEQ ID GGUGGGGAAGUAUCUGAUG SEQ ID GUCAUCAGAUACUUCC 302-324 NO: 548 ACAU NO: 824 CCACC SEQ ID GUGGGGAAGUAUCUGAUGA SEQ ID UGUCAUCAGAUACUUC 301-323 NO: 549 CAUU NO: 825 CCCAC SEQ ID GGGGAAGUAUCUGAUGACA SEQ ID AAUGUCAUCAGAUACU 299-321 NO: 550 UUGG NO: 826 UCCCC SEQ ID UUAAGAGCCUGGGUGGGGA SEQ ID CUUCCCCACCCAGGCU 313-335 NO: 551 AGUA NO: 827 CUUAA SEQ ID CCGAAGUAGGCGGCUCGGU SEQ ID CUACCGAGCCGCCUAC 628-650 NO: 552 AGAU NO: 828 UUCGG In a particular embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO:304 SEQ ID NO:580 SEQ ID NO:323 SEQ ID NO:599 SEQ ID NO:439 SEQ ID NO:715 SEQ ID NO:453 SEQ ID NO:729 SEQ ID NO:496 SEQ ID NO:772 In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 304 SEQ ID NO: 580 In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO:280 SEQ ID NO:556 In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:829-1104. In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO: 829-1104. In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 829-1104. In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 829-1104. In certain embodiments, the first strand comprises any one of SEQ ID NO: 829-1104. The modification pattern of the nucleic acids as set forth in SEQ ID NO: 829-1104 is summarized in Table 3 below: Table 3 provides the modified first (antisense) sequences, together with the corresponding unmodified first (antisense) sequences for siRNA oligonucleosides according to the present invention as follows. Table 3 Antisense Modified Antisense Strand SEQ ID Underlying Base SEQ ID strand ID 5’ ^ 3’ NO (AS - Sequence NO (AS - mod) 5’ ^ 3’ unmod) (Shown as an Unmodified Nucleotide Sequence) ETX- UmsUfsAmAmGmAfGmAmAmAmAmCm SEQ ID UUAAGAGAAAAC SEQ ID S00003198 UmGfGmUfCmAfGmAmUmsGmsAm NO: 856 UGGUCAGAUGA NO: 304 ETX- UmsAfsUmCmAmGfGmAmGmUmGmAm SEQ ID UAUCAGGAGUGA SEQ ID S00003274 CmUfGmAfAmAfUmAmAmsAmsAm NO: 875 CUGAAAUAAAA NO: 323 ETX- UmsCfsCmCmUmUfUmGmCmAmGmUm SEQ ID UCCCUUUGCAGU SEQ ID S00003738 GmUfCmAfUmAfGmAmUmsAmsCm NO: 991 GUCAUAGAUAC NO: 439 ETX- AmsUfsCmAmGmAfUmUmUmGmUmAm SEQ ID AUCAGAUUUGUA SEQ ID S00003794 GmAfUmCfUmUfAmAmCmsCmsAm NO: 1005 GAUCUUAACCA NO: 453 ETX- AmsUfsCmAmGmCfUmGmCmUmAmGm SEQ ID AUCAGCUGCUAG SEQ ID S00003966 AmCfGmGfGmUfAmCmGmsGmsGm NO: 1048 ACGGGUACGGG NO: 496 ETX- CmsCfsCmAmUmUfUmUmCmAmAmCm SEQ ID CCCAUUUUCAAC SEQ ID S00003090 CmAfGmUfAmAfAmUmAmsGmsUm NO: 829 CAGUAAAUAGU NO: 277 ETX- AmsCfsGmCmAmGfUmCmUmAmUmAm SEQ ID ACGCAGUCUAUA SEQ ID S00003094 AmUfGmCfCmUfUmUmGmsUmsAm NO: 830 AUGCCUUUGUA NO: 278 ETX- GmsUfsGmUmAmCfUmUmCmUmUmGm SEQ ID GUGUACUUCUUG SEQ ID S00003098 AmUfUmUfCmAfUmCmAmsUmsAm NO: 831 AUUUCAUCAUA NO: 279 ETX- AmsUfsAmCmAmAfUmUmGmAmGmUm SEQ ID AUACAAUUGAGU SEQ ID S00003102 CmCfCmAfUmCfAmUmCmsAmsUm NO: 832 CCCAUCAUCAU NO: 280 ETX- GmsGfsAmCmCmAfCmGmCmAmGmUm SEQ ID GGACCACGCAGU SEQ ID S00003106 CmUfAmUfAmAfUmGmCmsCmsUm NO: 833 CUAUAAUGCCU NO: 281 ETX- UmsUfsGmUmUmAfUmUmUmAmUmCm SEQ ID UUGUUAUUUAUC SEQ ID S00003110 AmGfGmAfGmUfGmAmCmsUmsGm NO: 834 AGGAGUGACUG NO: 282 ETX- CmsAfsGmUmCmUfAmUmAmAmUmGm SEQ ID CAGUCUAUAAUG SEQ ID S00003114 CmCfUmUfUmGfUmAmUmsUmsGm NO: 835 CCUUUGUAUUG NO: 283 ETX- AmsUfsAmGmAmUfAmCmCmGmAmAm SEQ ID AUAGAUACCGAA SEQ ID S00003118 GmUfAmGfGmCfGmGmCmsUmsCm NO: 836 GUAGGCGGCUC NO: 284 ETX- UmsAfsGmAmUmAfCmCmGmAmAmGm SEQ ID UAGAUACCGAAG SEQ ID S00003122 UmAfGmGfCmGfGmCmUmsCmsGm NO: 837 UAGGCGGCUCG NO: 285 ETX- GmsGfsAmAmUmAfCmGmGmAmCmCm SEQ ID GGAAUACGGACC SEQ ID S00003126 AmCfGmCfAmGfUmCmUmsAmsUm NO: 838 ACGCAGUCUAU NO: 286 ETX- CmsAfsGmCmUmGfAmUmGmAmCmGm SEQ ID CAGCUGAUGACG SEQ ID S00003130 AmUfGmUfGmAfGmUmGmsUmsUm NO: 839 AUGUGAGUGUU NO: 287 ETX- AmsUfsUmUmAmUfCmUmUmUmGmAm SEQ ID AUUUAUCUUUGA SEQ ID S00003134 AmGfGmCfGmAfAmGmUmsUmsAm NO: 840 AGGCGAAGUUA NO: 288 ETX- GmsUfsGmUmCmAfUmAmGmAmUmAm SEQ ID GUGUCAUAGAUA SEQ ID S00003138 CmCfGmAfAmGfUmAmGmsGmsCm NO: 841 CCGAAGUAGGC NO: 289 ETX- UmsUfsCmCmCmAfUmUmUmUmCmAm SEQ ID UUCCCAUUUUCA SEQ ID S00003142 AmCfCmAfGmUfAmAmAmsUmsAm NO: 842 ACCAGUAAAUA NO: 290 ETX- GmsCfsUmGmCmUfAmGmAmCmGmGm SEQ ID GCUGCUAGACGG SEQ ID S00003146 GmUfAmCfGmGfGmCmAmsAmsAm NO: 843 GUACGGGCAAA NO: 291 ETX- CmsAfsGmUmUmCfCmUmUmUmGmCm SEQ ID CAGUUCCUUUGC SEQ ID S00003150 GmCfCmCfUmGfAmCmUmsGmsCm NO: 844 GCCCUGACUGC NO: 292 ETX- CmsUfsUmCmCmCfAmUmUmUmUmCm SEQ ID CUUCCCAUUUUC SEQ ID S00003154 AmAfCmCfAmGfUmAmAmsAmsUm NO: 845 AACCAGUAAAU NO: 293 ETX- AmsGfsAmUmAmCfCmGmAmAmGmUm SEQ ID AGAUACCGAAGU SEQ ID S00003158 AmGfGmCfGmGfCmUmCmsGmsGm NO: 846 AGGCGGCUCGG NO: 294 ETX- UmsUfsAmAmCmCfAmGmGmCmAmGm SEQ ID UUAACCAGGCAG SEQ ID S00003162 UmCfAmCfCmGfAmGmGmsCmsCm NO: 847 UCACCGAGGCC NO: 295 ETX- AmsUfsCmAmUmCfCmAmGmCmUmGm SEQ ID AUCAUCCAGCUG SEQ ID S00003166 AmUfGmAfCmGfAmUmGmsUmsGm NO: 848 AUGACGAUGUG NO: 296 ETX- AmsUfsUmUmAmUfCmAmGmGmAmGm SEQ ID AUUUAUCAGGAG SEQ ID S00003170 UmGfAmCfUmGfAmAmAmsUmsAm NO: 849 UGACUGAAAUA NO: 297 ETX- GmsAfsCmAmGmUfCmUmGmUmGmCm SEQ ID GACAGUCUGUGC SEQ ID S00003174 GmAfUmCfAmUfCmCmAmsGmsCm NO: 850 GAUCAUCCAGC NO: 298 ETX- UmsCfsUmAmUmAfAmUmGmCmCmUm SEQ ID UCUAUAAUGCCU SEQ ID S00003178 UmUfGmUfAmUfUmGmCmsUmsUm NO: 851 UUGUAUUGCUU NO: 299 ETX- UmsAfsAmCmCmAfGmGmCmAmGmUm SEQ ID UAACCAGGCAGU SEQ ID S00003182 CmAfCmCfGmAfGmGmCmsCmsUm NO: 852 CACCGAGGCCU NO: 300 ETX- CmsCfsCmUmGmCfAmCmAmGmAmCm SEQ ID CCCUGCACAGAC SEQ ID S00003186 AmCfGmUfUmAfAmAmGmsCmsCm NO: 853 ACGUUAAAGCC NO: 301 ETX- CmsAfsCmGmCmAfGmUmCmUmAmUm SEQ ID CACGCAGUCUAU SEQ ID S00003190 AmAfUmGfCmCfUmUmUmsGmsUm NO: 854 AAUGCCUUUGU NO: 302 ETX- UmsAfsAmUmAmCfAmAmCmAmUmGm SEQ ID UAAUACAACAUG SEQ ID S00003194 CmCfUmGfUmUfCmAmCmsAmsGm NO: 855 CCUGUUCACAG NO: 303 ETX- UmsGfsCmAmCmAfGmAmCmAmCmGm SEQ ID UGCACAGACACG SEQ ID S00003202 UmUfAmAfAmGfCmCmUmsUmsGm NO: 857 UUAAAGCCUUG NO: 305 ETX- GmsUfsUmCmCmUfUmUmGmCmGmCm SEQ ID GUUCCUUUGCGC SEQ ID S00003206 CmCfUmGfAmCfUmGmCmsAmsUm NO: 858 CCUGACUGCAU NO: 306 ETX- GmsUfsGmAmCmAfGmUmCmUmGmUm SEQ ID GUGACAGUCUGU SEQ ID S00003210 GmCfGmAfUmCfAmUmCmsCmsAm NO: 859 GCGAUCAUCCA NO: 307 ETX- AmsCfsCmAmCmGfCmAmGmUmCmUm SEQ ID ACCACGCAGUCU SEQ ID S00003214 AmUfAmAfUmGfCmCmUmsUmsUm NO: 860 AUAAUGCCUUU NO: 308 ETX- CmsAfsGmUmGmAfCmAmGmUmCmUm SEQ ID CAGUGACAGUCU SEQ ID S00003218 GmUfGmCfGmAfUmCmAmsUmsCm NO: 861 GUGCGAUCAUC NO: 309 ETX- UmsUfsGmGmGmAfAmUmAmCmGmGm SEQ ID UUGGGAAUACGG SEQ ID S00003222 AmCfCmAfCmGfCmAmGmsUmsCm NO: 862 ACCACGCAGUC NO: 310 ETX- GmsUfsCmUmAmUfAmAmUmGmCmCm SEQ ID GUCUAUAAUGCC SEQ ID S00003226 UmUfUmGfUmAfUmUmGmsCmsUm NO: 863 UUUGUAUUGCU NO: 311 ETX- UmsGfsUmGmCmGfAmUmCmAmUmCm SEQ ID UGUGCGAUCAUC SEQ ID S00003230 CmAfGmCfUmGfAmUmGmsAmsCm NO: 864 CAGCUGAUGAC NO: 312 ETX- AmsCfsGmGmAmCfCmAmCmGmCmAm SEQ ID ACGGACCACGCA SEQ ID S00003234 GmUfCmUfAmUfAmAmUmsGmsCm NO: 865 GUCUAUAAUGC NO: 313 ETX- UmsGfsCmUmAmGfAmCmGmGmGmUm SEQ ID UGCUAGACGGGU SEQ ID S00003238 AmCfGmGfGmCfAmAmAmsAmsUm NO: 866 ACGGGCAAAAU NO: 314 ETX- UmsCfsAmUmCmCfAmGmCmUmGmAm SEQ ID UCAUCCAGCUGA SEQ ID S00003242 UmGfAmCfGmAfUmGmUmsGmsAm NO: 867 UGACGAUGUGA NO: 315 ETX- CmsGfsGmGmUmAfCmGmGmGmCmAm SEQ ID CGGGUACGGGCA SEQ ID S00003246 AmAfAmUfCmAfAmGmAmsGmsGm NO: 868 AAAUCAAGAGG NO: 316 ETX- AmsAfsUmAmCmGfGmAmCmCmAmCm SEQ ID AAUACGGACCAC SEQ ID S00003250 GmCfAmGfUmCfUmAmUmsAmsAm NO: 869 GCAGUCUAUAA NO: 317 ETX- UmsCfsAmUmAmGfAmUmAmCmCmGm SEQ ID UCAUAGAUACCG SEQ ID S00003254 AmAfGmUfAmGfGmCmGmsGmsCm NO: 870 AAGUAGGCGGC NO: 318 ETX- GmsGfsGmAmAmUfAmCmGmGmAmCm SEQ ID GGGAAUACGGAC SEQ ID S00003258 CmAfCmGfCmAfGmUmCmsUmsAm NO: 871 CACGCAGUCUA NO: 319 ETX- GmsUfsGmCmGmAfUmCmAmUmCmCm SEQ ID GUGCGAUCAUCC SEQ ID S00003262 AmGfCmUfGmAfUmGmAmsCmsGm NO: 872 AGCUGAUGACG NO: 320 ETX- UmsAfsCmGmGmAfCmCmAmCmGmCm SEQ ID UACGGACCACGC SEQ ID S00003266 AmGfUmCfUmAfUmAmAmsUmsGm NO: 873 AGUCUAUAAUG NO: 321 ETX- UmsGfsUmCmAmUfAmGmAmUmAmCm SEQ ID UGUCAUAGAUAC SEQ ID S00003270 CmGfAmAfGmUfAmGmGmsCmsGm NO: 874 CGAAGUAGGCG NO: 322 ETX- UmsGfsCmGmAmUfCmAmUmCmCmAm SEQ ID UGCGAUCAUCCA SEQ ID S00003278 GmCfUmGfAmUfGmAmCmsGmsAm NO: 876 GCUGAUGACGA NO: 324 ETX- CmsUfsAmGmAmCfGmGmGmUmAmCm SEQ ID CUAGACGGGUAC SEQ ID S00003282 GmGfGmCfAmAfAmAmUmsCmsAm NO: 877 GGGCAAAAUCA NO: 325 ETX- GmsAfsUmCmCmGfGmAmAmGmCmAm SEQ ID GAUCCGGAAGCA SEQ ID S00003286 UmUfCmCfCmUfUmUmGmsCmsAm NO: 878 UUCCCUUUGCA NO: 326 ETX- GmsCfsAmCmAmGfAmCmAmCmGmUm SEQ ID GCACAGACACGU SEQ ID S00003290 UmAfAmAfGmCfCmUmUmsGmsGm NO: 879 UAAAGCCUUGG NO: 327 ETX- CmsCfsAmCmGmCfAmGmUmCmUmAm SEQ ID CCACGCAGUCUA SEQ ID S00003294 UmAfAmUfGmCfCmUmUmsUmsGm NO: 880 UAAUGCCUUUG NO: 328 ETX- GmsAfsCmGmGmGfUmAmCmGmGmGm SEQ ID GACGGGUACGGG SEQ ID S00003298 CmAfAmAfAmUfCmAmAmsGmsAm NO: 881 CAAAAUCAAGA NO: 329 ETX- GmsAfsUmAmCmCfGmAmAmGmUmAm SEQ ID GAUACCGAAGUA SEQ ID S00003302 GmGfCmGfGmCfUmCmGmsGmsUm NO: 882 GGCGGCUCGGU NO: 330 ETX- GmsUfsAmGmGmCfGmGmCmUmCmGm SEQ ID GUAGGCGGCUCG SEQ ID S00003306 GmUfAmGfAmUfGmAmUmsAmsAm NO: 883 GUAGAUGAUAA NO: 331 ETX- AmsGfsAmCmGmGfGmUmAmCmGmGm SEQ ID AGACGGGUACGG SEQ ID S00003310 GmCfAmAfAmAfUmCmAmsAmsGm NO: 884 GCAAAAUCAAG NO: 332 ETX- UmsAfsGmGmCmGfGmCmUmCmGmGm SEQ ID UAGGCGGCUCGG SEQ ID S00003314 UmAfGmAfUmGfAmUmAmsAmsUm NO: 885 UAGAUGAUAAU NO: 333 ETX- AmsAfsGmUmAmGfGmCmGmGmCmUm SEQ ID AAGUAGGCGGCU SEQ ID S00003318 CmGfGmUfAmGfAmUmGmsAmsUm NO: 886 CGGUAGAUGAU NO: 334 ETX- CmsUfsUmUmGmAfAmGmGmCmGmAm SEQ ID CUUUGAAGGCGA SEQ ID S00003322 AmGfUmUfAmAfGmAmGmsCmsCm NO: 887 AGUUAAGAGCC NO: 335 ETX- CmsGfsAmAmGmUfUmAmAmGmAmGm SEQ ID CGAAGUUAAGAG SEQ ID S00003326 CmCfUmGfGmGfUmGmGmsGmsGm NO: 888 CCUGGGUGGGG NO: 336 ETX- CmsCfsCmUmGmCfUmCmCmUmUmGm SEQ ID CCCUGCUCCUUG SEQ ID S00003330 GmGfAmAfUmAfCmGmGmsAmsCm NO: 889 GGAAUACGGAC NO: 337 ETX- GmsAfsAmGmGmAfCmAmGmAmAmCm SEQ ID GAAGGACAGAAC SEQ ID S00003334 UmCfCmCfUmGfCmUmCmsCmsUm NO: 890 UCCCUGCUCCU NO: 338 ETX- AmsGfsAmAmCmUfCmCmCmUmGmCm SEQ ID AGAACUCCCUGC SEQ ID S00003338 UmCfCmUfUmGfGmGmAmsAmsUm NO: 891 UCCUUGGGAAU NO: 339 ETX- CmsCfsUmGmCmUfCmCmUmUmGmGm SEQ ID CCUGCUCCUUGG SEQ ID S00003342 GmAfAmUfAmCfGmGmAmsCmsCm NO: 892 GAAUACGGACC NO: 340 ETX- CmsAfsGmAmAmGfGmAmCmAmGmAm SEQ ID CAGAAGGACAGA SEQ ID S00003346 AmCfUmCfCmCfUmGmCmsUmsCm NO: 893 ACUCCCUGCUC NO: 341 ETX- CmsUfsGmCmUmCfCmUmUmGmGmGm SEQ ID CUGCUCCUUGGG SEQ ID S00003350 AmAfUmAfCmGfGmAmCmsCmsAm NO: 894 AAUACGGACCA NO: 342 ETX- AmsGfsAmAmGmGfAmCmAmGmAmAm SEQ ID AGAAGGACAGAA SEQ ID S00003354 CmUfCmCfCmUfGmCmUmsCmsCm NO: 895 CUCCCUGCUCC NO: 343 ETX- AmsAfsGmGmAmCfAmGmAmAmCmUm SEQ ID AAGGACAGAACU SEQ ID S00003358 CmCfCmUfGmCfUmCmCmsUmsUm NO: 896 CCCUGCUCCUU NO: 344 ETX- GmsAfsAmCmUmCfCmCmUmGmCmUm SEQ ID GAACUCCCUGCU SEQ ID S00003362 CmCfUmUfGmGfGmAmAmsUmsAm NO: 897 CCUUGGGAAUA NO: 345 ETX- AmsGfsGmAmCmAfGmAmAmCmUmCm SEQ ID AGGACAGAACUC SEQ ID S00003366 CmCfUmGfCmUfCmCmUmsUmsGm NO: 898 CCUGCUCCUUG NO: 346 ETX- GmsAfsAmGmUmUfAmAmGmAmGmCm SEQ ID GAAGUUAAGAGC SEQ ID S00003370 CmUfGmGfGmUfGmGmGmsGmsAm NO: 899 CUGGGUGGGGA NO: 347 ETX- UmsCfsUmUmUmGfAmAmGmGmCmGm SEQ ID UCUUUGAAGGCG SEQ ID S00003374 AmAfGmUfUmAfAmGmAmsGmsCm NO: 900 AAGUUAAGAGC NO: 348 ETX- UmsAfsUmUmUmAfUmCmAmGmGmAm SEQ ID UAUUUAUCAGGA SEQ ID S00003378 GmUfGmAfCmUfGmAmAmsAmsUm NO: 901 GUGACUGAAAU NO: 349 ETX- GmsUfsUmAmUmUfUmAmUmCmAmGm SEQ ID GUUAUUUAUCAG SEQ ID S00003382 GmAfGmUfGmAfCmUmGmsAmsAm NO: 902 GAGUGACUGAA NO: 350 ETX- UmsUfsAmUmUmUfAmUmCmAmGmGm SEQ ID UUAUUUAUCAGG SEQ ID S00003386 AmGfUmGfAmCfUmGmAmsAmsAm NO: 903 AGUGACUGAAA NO: 351 ETX- AmsAfsAmUmAmCfAmAmUmUmGmAm SEQ ID AAAUACAAUUGA SEQ ID S00003390 GmUfCmCfCmAfUmCmAmsUmsCm NO: 904 GUCCCAUCAUC NO: 352 ETX- AmsAfsAmAmUmAfCmAmAmUmUmGm SEQ ID AAAAUACAAUUG SEQ ID S00003394 AmGfUmCfCmCfAmUmCmsAmsUm NO: 905 AGUCCCAUCAU NO: 353 ETX- AmsUfsUmUmGmUfUmAmUmUmUmAm SEQ ID AUUUGUUAUUUA SEQ ID S00003398 UmCfAmGfGmAfGmUmGmsAmsCm NO: 906 UCAGGAGUGAC NO: 354 ETX- GmsAfsGmAmAmAfAmCmUmGmGmUm SEQ ID GAGAAAACUGGU SEQ ID S00003402 CmAfGmAfUmGfAmAmUmsAmsUm NO: 907 CAGAUGAAUAU NO: 355 ETX- AmsUfsAmUmAmAfUmAmCmAmAmCm SEQ ID AUAUAAUACAAC SEQ ID S00003406 AmUfGmCfCmUfGmUmUmsCmsAm NO: 908 AUGCCUGUUCA NO: 356 ETX- UmsGfsGmGmAmUfCmCmGmGmAmAm SEQ ID UGGGAUCCGGAA SEQ ID S00003410 GmCfAmUfUmCfCmCmUmsUmsUm NO: 909 GCAUUCCCUUU NO: 357 ETX- UmsUfsGmGmGmAfUmCmCmGmGmAm SEQ ID UUGGGAUCCGGA SEQ ID S00003414 AmGfCmAfUmUfCmCmCmsUmsUm NO: 910 AGCAUUCCCUU NO: 358 ETX- CmsAfsGmGmCmAfGmUmCmAmCmCm SEQ ID CAGGCAGUCACC SEQ ID S00003418 GmAfGmGfCmCfUmCmGmsGmsAm NO: 911 GAGGCCUCGGA NO: 359 ETX- UmsAfsUmAmUmAfAmUmAmCmAmAm SEQ ID UAUAUAAUACAA SEQ ID S00003422 CmAfUmGfCmCfUmGmUmsUmsCm NO: 912 CAUGCCUGUUC NO: 360 ETX- AmsGfsUmCmUmAfUmAmAmUmGmCm SEQ ID AGUCUAUAAUGC SEQ ID S00003426 CmUfUmUfGmUfAmUmUmsGmsCm NO: 913 CUUUGUAUUGC NO: 361 ETX- UmsUfsUmAmUmCfAmGmGmAmGmUm SEQ ID UUUAUCAGGAGU SEQ ID S00003430 GmAfCmUfGmAfAmAmUmsAmsAm NO: 914 GACUGAAAUAA NO: 362 ETX- AmsAfsUmAmCmAfAmUmUmGmAmGm SEQ ID AAUACAAUUGAG SEQ ID S00003434 UmCfCmCfAmUfCmAmUmsCmsAm NO: 915 UCCCAUCAUCA NO: 363 ETX- CmsUfsUmUmAmAfGmAmGmAmAmAm SEQ ID CUUUAAGAGAAA SEQ ID S00003438 AmCfUmGfGmUfCmAmGmsAmsUm NO: 916 ACUGGUCAGAU NO: 364 ETX- GmsCfsUmUmUmAfAmGmAmGmAmAm SEQ ID GCUUUAAGAGAA SEQ ID S00003442 AmAfCmUfGmGfUmCmAmsGmsAm NO: 917 AACUGGUCAGA NO: 365 ETX- AmsAfsUmGmCmCfUmUmUmGmUmAm SEQ ID AAUGCCUUUGUA SEQ ID S00003446 UmUfGmCfUmUfAmUmCmsUmsGm NO: 918 UUGCUUAUCUG NO: 366 ETX- UmsAfsAmUmGmCfCmUmUmUmGmUm SEQ ID UAAUGCCUUUGU SEQ ID S00003450 AmUfUmGfCmUfUmAmUmsCmsUm NO: 919 AUUGCUUAUCU NO: 367 ETX- UmsAfsCmCmCmUfGmCmAmCmAmGm SEQ ID UACCCUGCACAG SEQ ID S00003454 AmCfAmCfGmUfUmAmAmsAmsGm NO: 920 ACACGUUAAAG NO: 368 ETX- AmsUfsAmCmCmCfUmGmCmAmCmAm SEQ ID AUACCCUGCACA SEQ ID S00003458 GmAfCmAfCmGfUmUmAmsAmsAm NO: 921 GACACGUUAAA NO: 369 ETX- AmsUfsCmCmAmGfCmUmGmAmUmGm SEQ ID AUCCAGCUGAUG SEQ ID S00003462 AmCfGmAfUmGfUmGmAmsGmsUm NO: 922 ACGAUGUGAGU NO: 370 ETX- UmsAfsCmAmAmUfUmGmAmGmUmCm SEQ ID UACAAUUGAGUC SEQ ID S00003466 CmCfAmUfCmAfUmCmAmsUmsCm NO: 923 CCAUCAUCAUC NO: 371 ETX- UmsGfsGmGmAmAfUmAmCmGmGmAm SEQ ID UGGGAAUACGGA SEQ ID S00003470 CmCfAmCfGmCfAmGmUmsCmsUm NO: 924 CCACGCAGUCU NO: 372 ETX- UmsAfsUmAmAmUfAmCmAmAmCmAm SEQ ID UAUAAUACAACA SEQ ID S00003474 UmGfCmCfUmGfUmUmCmsAmsCm NO: 925 UGCCUGUUCAC NO: 373 ETX- UmsUfsAmUmCmAfGmGmAmGmUmGm SEQ ID UUAUCAGGAGUG SEQ ID S00003478 AmCfUmGfAmAfAmUmAmsAmsAm NO: 926 ACUGAAAUAAA NO: 374 ETX- AmsUfsAmAmUmGfCmCmUmUmUmGm SEQ ID AUAAUGCCUUUG SEQ ID S00003482 UmAfUmUfGmCfUmUmAmsUmsCm NO: 927 UAUUGCUUAUC NO: 375 ETX- CmsCfsAmGmCmUfGmAmUmGmAmCm SEQ ID CCAGCUGAUGAC SEQ ID S00003486 GmAfUmGfUmGfAmGmUmsGmsUm NO: 928 GAUGUGAGUGU NO: 376 ETX- CmsAfsUmAmGmAfUmAmCmCmGmAm SEQ ID CAUAGAUACCGA SEQ ID S00003490 AmGfUmAfGmGfCmGmGmsCmsUm NO: 929 AGUAGGCGGCU NO: 377 ETX- CmsAfsUmCmCmAfGmCmUmGmAmUm SEQ ID CAUCCAGCUGAU SEQ ID S00003494 GmAfCmGfAmUfGmUmGmsAmsGm NO: 930 GACGAUGUGAG NO: 378 ETX- GmsUfsCmAmUmAfGmAmUmAmCmCm SEQ ID GUCAUAGAUACC SEQ ID S00003498 GmAfAmGfUmAfGmGmCmsGmsGm NO: 931 GAAGUAGGCGG NO: 379 ETX- AmsCfsCmCmUmGfCmAmCmAmGmAm SEQ ID ACCCUGCACAGA SEQ ID S00003502 CmAfCmGfUmUfAmAmAmsGmsCm NO: 932 CACGUUAAAGC NO: 380 ETX- UmsGfsCmAmUmCfAmUmCmAmUmGm SEQ ID UGCAUCAUCAUG SEQ ID S00003506 CmGfGmCfGmGfCmGmAmsAmsCm NO: 933 CGGCGGCGAAC NO: 381 ETX- CmsGfsGmAmCmCfAmCmGmCmAmGm SEQ ID CGGACCACGCAG SEQ ID S00003510 UmCfUmAfUmAfAmUmGmsCmsCm NO: 934 UCUAUAAUGCC NO: 382 ETX- CmsUfsUmGmGmGfAmAmUmAmCmGm SEQ ID CUUGGGAAUACG SEQ ID S00003514 GmAfCmCfAmCfGmCmAmsGmsUm NO: 935 GACCACGCAGU NO: 383 ETX- GmsAfsAmGmUmAfGmGmCmGmGmCm SEQ ID GAAGUAGGCGGC SEQ ID S00003518 UmCfGmGfUmAfGmAmUmsGmsAm NO: 936 UCGGUAGAUGA NO: 384 ETX- CmsUfsGmCmUmAfGmAmCmGmGmGm SEQ ID CUGCUAGACGGG SEQ ID S00003522 UmAfCmGfGmGfCmAmAmsAmsAm NO: 937 UACGGGCAAAA NO: 385 ETX- UmsCfsCmAmGmCfUmGmAmUmGmAm SEQ ID UCCAGCUGAUGA SEQ ID S00003526 CmGfAmUfGmUfGmAmGmsUmsGm NO: 938 CGAUGUGAGUG NO: 386 ETX- AmsUfsAmCmGmGfAmCmCmAmCmGm SEQ ID AUACGGACCACG SEQ ID S00003530 CmAfGmUfCmUfAmUmAmsAmsUm NO: 939 CAGUCUAUAAU NO: 387 ETX- AmsAfsCmCmAmGfGmCmAmGmUmCm SEQ ID AACCAGGCAGUC SEQ ID S00003534 AmCfCmGfAmGfGmCmCmsUmsCm NO: 940 ACCGAGGCCUC NO: 388 ETX- UmsGfsAmCmAmGfUmCmUmGmUmGm SEQ ID UGACAGUCUGUG SEQ ID S00003538 CmGfAmUfCmAfUmCmCmsAmsGm NO: 941 CGAUCAUCCAG NO: 389 ETX- UmsAfsGmAmCmGfGmGmUmAmCmGm SEQ ID UAGACGGGUACG SEQ ID S00003542 GmGfCmAfAmAfAmUmCmsAmsAm NO: 942 GGCAAAAUCAA NO: 390 ETX- GmsCfsAmGmUmGfAmCmAmGmUmCm SEQ ID GCAGUGACAGUC SEQ ID S00003546 UmGfUmGfCmGfAmUmCmsAmsUm NO: 943 UGUGCGAUCAU NO: 391 ETX- AmsGfsUmGmAmCfAmGmUmCmUmGm SEQ ID AGUGACAGUCUG SEQ ID S00003550 UmGfCmGfAmUfCmAmUmsCmsCm NO: 944 UGCGAUCAUCC NO: 392 ETX- GmsCfsUmAmGmAfCmGmGmGmUmAm SEQ ID GCUAGACGGGUA SEQ ID S00003554 CmGfGmGfCmAfAmAmAmsUmsCm NO: 945 CGGGCAAAAUC NO: 393 ETX- AmsGfsUmAmGmGfCmGmGmCmUmCm SEQ ID AGUAGGCGGCUC SEQ ID S00003558 GmGfUmAfGmAfUmGmAmsUmsAm NO: 946 GGUAGAUGAUA NO: 394 ETX- GmsAfsAmUmAmCfGmGmAmCmCmAm SEQ ID GAAUACGGACCA SEQ ID S00003562 CmGfCmAfGmUfCmUmAmsUmsAm NO: 947 CGCAGUCUAUA NO: 395 ETX- CmsUfsUmUmGmUfAmUmUmGmCmUm SEQ ID CUUUGUAUUGCU SEQ ID S00003566 UmAfUmCfUmGfCmAmGmsUmsGm NO: 948 UAUCUGCAGUG NO: 396 ETX- UmsUfsUmGmUmAfUmUmGmCmUmUm SEQ ID UUUGUAUUGCUU SEQ ID S00003570 AmUfCmUfGmCfAmGmUmsGmsAm NO: 949 AUCUGCAGUGA NO: 397 ETX- UmsUfsGmUmAmUfUmGmCmUmUmAm SEQ ID UUGUAUUGCUUA SEQ ID S00003574 UmCfUmGfCmAfGmUmGmsAmsUm NO: 950 UCUGCAGUGAU NO: 398 ETX- UmsAfsUmCmUmGfCmAmGmUmGmAm SEQ ID UAUCUGCAGUGA SEQ ID S00003578 UmCfUmGfCmUfUmGmCmsUmsGm NO: 951 UCUGCUUGCUG NO: 399 ETX- GmsUfsAmUmUmGfCmUmUmAmUmCm SEQ ID GUAUUGCUUAUC SEQ ID S00003582 UmGfCmAfGmUfGmAmUmsCmsUm NO: 952 UGCAGUGAUCU NO: 400 ETX- UmsGfsUmAmUmUfGmCmUmUmAmUm SEQ ID UGUAUUGCUUAU SEQ ID S00003586 CmUfGmCfAmGfUmGmAmsUmsCm NO: 953 CUGCAGUGAUC NO: 401 ETX- UmsGfsCmUmUmAfUmCmUmGmCmAm SEQ ID UGCUUAUCUGCA SEQ ID S00003590 GmUfGmAfUmCfUmGmCmsUmsUm NO: 954 GUGAUCUGCUU NO: 402 ETX- UmsUfsGmCmUmUfAmUmCmUmGmCm SEQ ID UUGCUUAUCUGC SEQ ID S00003594 AmGfUmGfAmUfCmUmGmsCmsUm NO: 955 AGUGAUCUGCU NO: 403 ETX- AmsUfsCmUmGmCfAmGmUmGmAmUm SEQ ID AUCUGCAGUGAU SEQ ID S00003598 CmUfGmCfUmUfGmCmUmsGmsGm NO: 956 CUGCUUGCUGG NO: 404 ETX- UmsAfsUmUmGmCfUmUmAmUmCmUm SEQ ID UAUUGCUUAUCU SEQ ID S00003602 GmCfAmGfUmGfAmUmCmsUmsGm NO: 957 GCAGUGAUCUG NO: 405 ETX- UmsUfsCmUmCmCfAmAmAmUmUmUm SEQ ID UUCUCCAAAUUU SEQ ID S00003606 GmUfUmAfUmUfUmAmUmsCmsAm NO: 958 GUUAUUUAUCA NO: 406 ETX- CmsAfsAmAmUmUfUmGmUmUmAmUm SEQ ID CAAAUUUGUUAU SEQ ID S00003610 UmUfAmUfCmAfGmGmAmsGmsUm NO: 959 UUAUCAGGAGU NO: 407 ETX- GmsAfsGmGmCmCfUmCmGmGmAmAm SEQ ID GAGGCCUCGGAA SEQ ID S00003614 UmUfCmCfCmUfUmUmCmsAmsGm NO: 960 UUCCCUUUCAG NO: 408 ETX- AmsGfsAmUmAmUfGmUmUmAmUmAm SEQ ID AGAUAUGUUAUA SEQ ID S00003618 UmAfAmUfAmCfAmAmCmsAmsUm NO: 961 UAAUACAACAU NO: 409 ETX- GmsCfsAmGmUmCfAmCmCmGmAmGm SEQ ID GCAGUCACCGAG SEQ ID S00003622 GmCfCmUfCmGfGmAmAmsUmsUm NO: 962 GCCUCGGAAUU NO: 410 ETX- CmsGfsAmGmGmCfCmUmCmGmGmAm SEQ ID CGAGGCCUCGGA SEQ ID S00003626 AmUfUmCfCmCfUmUmUmsCmsAm NO: 963 AUUCCCUUUCA NO: 411 ETX- CmsAfsAmGmAmUfAmUmGmUmUmAm SEQ ID CAAGAUAUGUUA SEQ ID S00003630 UmAfUmAfAmUfAmCmAmsAmsCm NO: 964 UAUAAUACAAC NO: 412 ETX- AmsGfsUmCmAmCfCmGmAmGmGmCm SEQ ID AGUCACCGAGGC SEQ ID S00003634 CmUfCmGfGmAfAmUmUmsCmsCm NO: 965 CUCGGAAUUCC NO: 413 ETX- CmsAfsCmCmGmAfGmGmCmCmUmCm SEQ ID CACCGAGGCCUC SEQ ID S00003638 GmGfAmAfUmUfCmCmCmsUmsUm NO: 966 GGAAUUCCCUU NO: 414 ETX- CmsCfsUmCmGmGfAmAmUmUmCmCm SEQ ID CCUCGGAAUUCC SEQ ID S00003642 CmUfUmUfCmAfGmCmUmsCmsCm NO: 967 CUUUCAGCUCC NO: 415 ETX- UmsCfsGmGmAmAfUmUmCmCmCmUm SEQ ID UCGGAAUUCCCU SEQ ID S00003646 UmUfCmAfGmCfUmCmCmsAmsGm NO: 968 UUCAGCUCCAG NO: 416 ETX- GmsGfsCmCmUmCfGmGmAmAmUmUm SEQ ID GGCCUCGGAAUU SEQ ID S00003650 CmCfCmUfUmUfCmAmGmsCmsUm NO: 969 CCCUUUCAGCU NO: 417 ETX- CmsUfsCmGmGmAfAmUmUmCmCmCm SEQ ID CUCGGAAUUCCC SEQ ID S00003654 UmUfUmCfAmGfCmUmCmsCmsAm NO: 970 UUUCAGCUCCA NO: 418 ETX- GmsCfsCmUmCmGfGmAmAmUmUmCm SEQ ID GCCUCGGAAUUC SEQ ID S00003658 CmCfUmUfUmCfAmGmCmsUmsCm NO: 971 CCUUUCAGCUC NO: 419 ETX- AmsUfsGmUmUmAfUmAmUmAmAmUm SEQ ID AUGUUAUAUAAU SEQ ID S00003662 AmCfAmAfCmAfUmGmCmsCmsUm NO: 972 ACAACAUGCCU NO: 420 ETX- AmsAfsGmAmUmAfUmGmUmUmAmUm SEQ ID AAGAUAUGUUAU SEQ ID S00003666 AmUfAmAfUmAfCmAmAmsCmsAm NO: 973 AUAAUACAACA NO: 421 ETX- UmsCfsAmAmGmAfUmAmUmGmUmUm SEQ ID UCAAGAUAUGUU SEQ ID S00003670 AmUfAmUfAmAfUmAmCmsAmsAm NO: 974 AUAUAAUACAA NO: 422 ETX- UmsGfsUmUmAmUfAmUmAmAmUmAm SEQ ID UGUUAUAUAAUA SEQ ID S00003674 CmAfAmCfAmUfGmCmCmsUmsGm NO: 975 CAACAUGCCUG NO: 423 ETX- CmsCfsGmAmGmGfCmCmUmCmGmGm SEQ ID CCGAGGCCUCGG SEQ ID S00003678 AmAfUmUfCmCfCmUmUmsUmsCm NO: 976 AAUUCCCUUUC NO: 424 ETX- GmsUfsCmAmCmCfGmAmGmGmCmCm SEQ ID GUCACCGAGGCC SEQ ID S00003682 UmCfGmGfAmAfUmUmCmsCmsCm NO: 977 UCGGAAUUCCC NO: 425 ETX- AmsCfsCmGmAmGfGmCmCmUmCmGm SEQ ID ACCGAGGCCUCG SEQ ID S00003686 GmAfAmUfUmCfCmCmUmsUmsUm NO: 978 GAAUUCCCUUU NO: 426 ETX- UmsCfsAmCmCmGfAmGmGmCmCmUm SEQ ID UCACCGAGGCCU SEQ ID S00003690 CmGfGmAfAmUfUmCmCmsCmsUm NO: 979 CGGAAUUCCCU NO: 427 ETX- AmsUfsUmUmCmAfUmCmAmUmAmCm SEQ ID AUUUCAUCAUAC SEQ ID S00003694 AmAfGmAfCmAfAmGmCmsAmsCm NO: 980 AAGACAAGCAC NO: 428 ETX- UmsGfsUmAmUmUfUmAmUmCmUmUm SEQ ID UGUAUUUAUCUU SEQ ID S00003698 UmGfAmAfGmGfCmGmAmsAmsGm NO: 981 UGAAGGCGAAG NO: 429 ETX- AmsUfsUmUmGmUfAmGmAmUmCmUm SEQ ID AUUUGUAGAUCU SEQ ID S00003702 UmAfAmCfCmAfGmGmCmsAmsGm NO: 982 UAACCAGGCAG NO: 430 ETX- UmsUfsCmCmCmUfUmUmGmCmAmGm SEQ ID UUCCCUUUGCAG SEQ ID S00003706 UmGfUmCfAmUfAmGmAmsUmsAm NO: 983 UGUCAUAGAUA NO: 431 ETX- AmsUfsCmAmUmAfCmAmAmGmAmCm SEQ ID AUCAUACAAGAC SEQ ID S00003710 AmAfGmCfAmCfAmAmAmsAmsGm NO: 984 AAGCACAAAAG NO: 432 ETX- UmsAfsGmAmUmCfUmUmAmAmCmCm SEQ ID UAGAUCUUAACC SEQ ID S00003714 AmGfGmCfAmGfUmCmAmsCmsCm NO: 985 AGGCAGUCACC NO: 433 ETX- AmsAfsGmCmAmUfUmCmCmCmUmUm SEQ ID AAGCAUUCCCUU SEQ ID S00003718 UmGfCmAfGmUfGmUmCmsAmsUm NO: 986 UGCAGUGUCAU NO: 434 ETX- UmsUfsUmGmCmAfGmUmGmUmCmAm SEQ ID UUUGCAGUGUCA SEQ ID S00003722 UmAfGmAfUmAfCmCmGmsAmsAm NO: 987 UAGAUACCGAA NO: 435 ETX- AmsGfsAmGmAmAfAmAmCmUmGmGm SEQ ID AGAGAAAACUGG SEQ ID S00003726 UmCfAmGfAmUfGmAmAmsUmsAm NO: 988 UCAGAUGAAUA NO: 436 ETX- UmsGfsCmAmGmUfGmUmCmAmUmAm SEQ ID UGCAGUGUCAUA SEQ ID S00003730 GmAfUmAfCmCfGmAmAmsGmsUm NO: 989 GAUACCGAAGU NO: 437 ETX- UmsCfsAmGmAmUfUmUmGmUmAmGm SEQ ID UCAGAUUUGUAG SEQ ID S00003734 AmUfCmUfUmAfAmCmCmsAmsGm NO: 990 AUCUUAACCAG NO: 438 ETX- GmsAfsAmCmAmUfUmGmGmAmCmCm SEQ ID GAACAUUGGACC SEQ ID S00003742 AmUfGmCfAmCfCmCmUmsUmsGm NO: 992 AUGCACCCUUG NO: 440 ETX- AmsAfsUmCmCmCfAmUmCmAmGmAm SEQ ID AAUCCCAUCAGA SEQ ID S00003746 UmUfUmGfUmAfGmAmUmsCmsUm NO: 993 UUUGUAGAUCU NO: 441 ETX- GmsCfsAmGmUmGfUmCmAmUmAmGm SEQ ID GCAGUGUCAUAG SEQ ID S00003750 AmUfAmCfCmGfAmAmGmsUmsAm NO: 994 AUACCGAAGUA NO: 442 ETX- CmsAfsAmGmCmAfCmAmAmAmAmGm SEQ ID CAAGCACAAAAG SEQ ID S00003754 CmAfCmCfAmCfCmCmAmsUmsGm NO: 995 CACCACCCAUG NO: 443 ETX- GmsCfsGmGmCmUfCmGmGmUmAmGm SEQ ID GCGGCUCGGUAG SEQ ID S00003758 AmUfGmAfUmAfAmUmAmsCmsCm NO: 996 AUGAUAAUACC NO: 444 ETX- CmsUfsCmCmUmUfGmGmGmAmAmUm SEQ ID CUCCUUGGGAAU SEQ ID S00003762 AmCfGmGfAmCfCmAmCmsGmsCm NO: 997 ACGGACCACGC NO: 445 ETX- AmsUfsUmCmCmCfUmUmUmGmCmAm SEQ ID AUUCCCUUUGCA SEQ ID S00003766 GmUfGmUfCmAfUmAmGmsAmsUm NO: 998 GUGUCAUAGAU NO: 446 ETX- CmsAfsUmAmCmAfAmGmAmCmAmAm SEQ ID CAUACAAGACAA SEQ ID S00003770 GmCfAmCfAmAfAmAmGmsCmsAm NO: 999 GCACAAAAGCA NO: 447 ETX- AmsGfsAmCmAmCfGmUmUmAmAmAm SEQ ID AGACACGUUAAA SEQ ID S00003774 GmCfCmUfUmGfGmUmAmsCmsAm NO: 1000 GCCUUGGUACA NO: 448 ETX- UmsGfsAmGmAmAfCmAmUmUmGmGm SEQ ID UGAGAACAUUGG SEQ ID S00003778 AmCfCmAfUmGfCmAmCmsCmsCm NO: 1001 ACCAUGCACCC NO: 449 ETX- GmsCfsUmUmGmUfAmUmUmUmAmUm SEQ ID GCUUGUAUUUAU SEQ ID S00003782 CmUfUmUfGmAfAmGmGmsCmsGm NO: 1002 CUUUGAAGGCG NO: 450 ETX- GmsCfsUmCmGmGfUmAmGmAmUmGm SEQ ID GCUCGGUAGAUG SEQ ID S00003786 AmUfAmAfUmAfCmCmCmsUmsGm NO: 1003 AUAAUACCCUG NO: 451 ETX- AmsGfsUmGmUmCfAmUmAmGmAmUm SEQ ID AGUGUCAUAGAU SEQ ID S00003790 AmCfCmGfAmAfGmUmAmsGmsGm NO: 1004 ACCGAAGUAGG NO: 452 ETX- GmsGfsUmAmGmAfUmGmAmUmAmAm SEQ ID GGUAGAUGAUAA SEQ ID S00003798 UmAfCmCfCmUfGmCmAmsCmsAm NO: 1006 UACCCUGCACA NO: 454 ETX- CmsAfsGmGmCmCfCmUmUmAmAmUm SEQ ID CAGGCCCUUAAU SEQ ID S00003802 CmCfCmAfUmCfAmGmAmsUmsUm NO: 1007 CCCAUCAGAUU NO: 455 ETX- AmsGfsAmUmGmAfUmAmAmUmAmCm SEQ ID AGAUGAUAAUAC SEQ ID S00003806 CmCfUmGfCmAfCmAmGmsAmsCm NO: 1008 CCUGCACAGAC NO: 456 ETX- UmsAfsCmAmGmGfCmCmCmUmUmAm SEQ ID UACAGGCCCUUA SEQ ID S00003810 AmUfCmCfCmAfUmCmAmsGmsAm NO: 1009 AUCCCAUCAGA NO: 457 ETX- AmsCfsAmGmAmCfAmCmGmUmUmAm SEQ ID ACAGACACGUUA SEQ ID S00003814 AmAfGmCfCmUfUmGmGmsUmsAm NO: 1010 AAGCCUUGGUA NO: 458 ETX- AmsGfsAmAmAmAfCmUmGmGmUmCm SEQ ID AGAAAACUGGUC SEQ ID S00003818 AmGfAmUfGmAfAmUmAmsUmsUm NO: 1011 AGAUGAAUAUU NO: 459 ETX- UmsGfsUmAmGmAfUmCmUmUmAmAm SEQ ID UGUAGAUCUUAA SEQ ID S00003822 CmCfAmGfGmCfAmGmUmsCmsAm NO: 1012 CCAGGCAGUCA NO: 460 ETX- UmsCfsAmAmAmUfGmGmAmUmAmGm SEQ ID UCAAAUGGAUAG SEQ ID S00003826 GmAfAmGfUmCfAmAmCmsCmsCm NO: 1013 GAAGUCAACCC NO: 461 ETX- CmsAfsUmUmCmCfCmUmUmUmGmCm SEQ ID CAUUCCCUUUGC SEQ ID S00003830 AmGfUmGfUmCfAmUmAmsGmsAm NO: 1014 AGUGUCAUAGA NO: 462 ETX- CmsAfsUmCmAmGfAmUmUmUmGmUm SEQ ID CAUCAGAUUUGU SEQ ID S00003834 AmGfAmUfCmUfUmAmAmsCmsCm NO: 1015 AGAUCUUAACC NO: 463 ETX- CmsUfsCmGmGmUfAmGmAmUmGmAm SEQ ID CUCGGUAGAUGA SEQ ID S00003838 UmAfAmUfAmCfCmCmUmsGmsCm NO: 1016 UAAUACCCUGC NO: 464 ETX- UmsUfsUmGmUmAfGmAmUmCmUmUm SEQ ID UUUGUAGAUCUU SEQ ID S00003842 AmAfCmCfAmGfGmCmAmsGmsUm NO: 1017 AACCAGGCAGU NO: 465 ETX- AmsCfsAmGmGmCfCmCmUmUmAmAm SEQ ID ACAGGCCCUUAA SEQ ID S00003846 UmCfCmCfAmUfCmAmGmsAmsUm NO: 1018 UCCCAUCAGAU NO: 466 ETX- CmsUfsUmUmGmCfAmGmUmGmUmCm SEQ ID CUUUGCAGUGUC SEQ ID S00003850 AmUfAmGfAmUfAmCmCmsGmsAm NO: 1019 AUAGAUACCGA NO: 467 ETX- CmsAfsCmAmUmCfAmGmCmUmGmCm SEQ ID CACAUCAGCUGC SEQ ID S00003854 UmAfGmAfCmGfGmGmUmsAmsCm NO: 1020 UAGACGGGUAC NO: 468 ETX- CmsCfsCmUmUmUfGmCmAmGmUmGm SEQ ID CCCUUUGCAGUG SEQ ID S00003858 UmCfAmUfAmGfAmUmAmsCmsCm NO: 1021 UCAUAGAUACC NO: 469 ETX- CmsUfsCmCmAmGfCmUmUmUmAmCm SEQ ID CUCCAGCUUUAC SEQ ID S00003862 CmCfAmCfAmUfCmAmGmsCmsUm NO: 1022 CCACAUCAGCU NO: 470 ETX- UmsUfsAmCmCmCfAmCmAmUmCmAm SEQ ID UUACCCACAUCA SEQ ID S00003866 GmCfUmGfCmUfAmGmAmsCmsGm NO: 1023 GCUGCUAGACG NO: 471 ETX- UmsUfsAmAmAmGfCmCmUmUmGmGm SEQ ID UUAAAGCCUUGG SEQ ID S00003870 UmAfCmAfGmGfCmCmCmsUmsUm NO: 1024 UACAGGCCCUU NO: 472 ETX- CmsAfsGmCmUmGfCmUmAmGmAmCm SEQ ID CAGCUGCUAGAC SEQ ID S00003874 GmGfGmUfAmCfGmGmGmsCmsAm NO: 1025 GGGUACGGGCA NO: 473 ETX- CmsAfsGmCmUmUfUmAmCmCmCmAm SEQ ID CAGCUUUACCCA SEQ ID S00003878 CmAfUmCfAmGfCmUmGmsCmsUm NO: 1026 CAUCAGCUGCU NO: 474 ETX- UmsCfsAmGmCmUfGmCmUmAmGmAm SEQ ID UCAGCUGCUAGA SEQ ID S00003882 CmGfGmGfUmAfCmGmGmsGmsCm NO: 1027 CGGGUACGGGC NO: 475 ETX- UmsCfsCmAmGmCfUmUmUmAmCmCm SEQ ID UCCAGCUUUACC SEQ ID S00003886 CmAfCmAfUmCfAmGmCmsUmsGm NO: 1028 CACAUCAGCUG NO: 476 ETX- GmsGfsCmUmCmGfGmUmAmGmAmUm SEQ ID GGCUCGGUAGAU SEQ ID S00003890 GmAfUmAfAmUfAmCmCmsCmsUm NO: 1029 GAUAAUACCCU NO: 477 ETX- AmsGfsGmCmGmGfCmUmCmGmGmUm SEQ ID AGGCGGCUCGGU SEQ ID S00003894 AmGfAmUfGmAfUmAmAmsUmsAm NO: 1030 AGAUGAUAAUA NO: 478 ETX- CmsAfsUmCmAmGfCmUmGmCmUmAm SEQ ID CAUCAGCUGCUA SEQ ID S00003898 GmAfCmGfGmGfUmAmCmsGmsGm NO: 1031 GACGGGUACGG NO: 479 ETX- GmsUfsAmCmAmGfGmCmCmCmUmUm SEQ ID GUACAGGCCCUU SEQ ID S00003902 AmAfUmCfCmCfAmUmCmsAmsGm NO: 1032 AAUCCCAUCAG NO: 480 ETX- AmsUfsGmAmUmAfAmUmAmCmCmCm SEQ ID AUGAUAAUACCC SEQ ID S00003906 UmGfCmAfCmAfGmAmCmsAmsCm NO: 1033 UGCACAGACAC NO: 481 ETX- CmsCfsUmUmGmGfGmAmAmUmAmCm SEQ ID CCUUGGGAAUAC SEQ ID S00003910 GmGfAmCfCmAfCmGmCmsAmsGm NO: 1034 GGACCACGCAG NO: 482 ETX- UmsCfsCmUmUmGfGmGmAmAmUmAm SEQ ID UCCUUGGGAAUA SEQ ID S00003914 CmGfGmAfCmCfAmCmGmsCmsAm NO: 1035 CGGACCACGCA NO: 483 ETX- CmsAfsGmAmUmUfUmGmUmAmGmAm SEQ ID CAGAUUUGUAGA SEQ ID S00003918 UmCfUmUfAmAfCmCmAmsGmsGm NO: 1036 UCUUAACCAGG NO: 484 ETX- UmsGfsUmAmCmUfUmCmUmUmGmAm SEQ ID UGUACUUCUUGA SEQ ID S00003922 UmUfUmCfAmUfCmAmUmsAmsCm NO: 1037 UUUCAUCAUAC NO: 485 ETX- AmsUfsCmCmCmAfUmCmAmGmAmUm SEQ ID AUCCCAUCAGAU SEQ ID S00003926 UmUfGmUfAmGfAmUmCmsUmsUm NO: 1038 UUGUAGAUCUU NO: 486 ETX- GmsUfsAmGmAmUfGmAmUmAmAmUm SEQ ID GUAGAUGAUAAU SEQ ID S00003930 AmCfCmCfUmGfCmAmCmsAmsGm NO: 1039 ACCCUGCACAG NO: 487 ETX- GmsAfsCmAmCmGfUmUmAmAmAmGm SEQ ID GACACGUUAAAG SEQ ID S00003934 CmCfUmUfGmGfUmAmCmsAmsGm NO: 1040 CCUUGGUACAG NO: 488 ETX- AmsGfsCmUmUmUfAmCmCmCmAmCm SEQ ID AGCUUUACCCAC SEQ ID S00003938 AmUfCmAfGmCfUmGmCmsUmsAm NO: 1041 AUCAGCUGCUA NO: 489 ETX- AmsAfsGmCmAmCfAmAmAmAmGmCm SEQ ID AAGCACAAAAGC SEQ ID S00003942 AmCfCmAfCmCfCmAmUmsGmsCm NO: 1042 ACCACCCAUGC NO: 490 ETX- AmsUfsCmUmUmAfAmCmCmAmGmGm SEQ ID AUCUUAACCAGG SEQ ID S00003946 CmAfGmUfCmAfCmCmGmsAmsGm NO: 1043 CAGUCACCGAG NO: 491 ETX- UmsUfsUmAmCmCfCmAmCmAmUmCm SEQ ID UUUACCCACAUC SEQ ID S00003950 AmGfCmUfGmCfUmAmGmsAmsCm NO: 1044 AGCUGCUAGAC NO: 492 ETX- CmsUfsUmAmAmUfCmCmCmAmUmCm SEQ ID CUUAAUCCCAUC SEQ ID S00003954 AmGfAmUfUmUfGmUmAmsGmsAm NO: 1045 AGAUUUGUAGA NO: 493 ETX- CmsAfsGmUmGmUfCmAmUmAmGmAm SEQ ID CAGUGUCAUAGA SEQ ID S00003958 UmAfCmCfGmAfAmGmUmsAmsGm NO: 1046 UACCGAAGUAG NO: 494 ETX- CmsCfsAmGmCmUfUmUmAmCmCmCm SEQ ID CCAGCUUUACCC SEQ ID S00003962 AmCfAmUfCmAfGmCmUmsGmsCm NO: 1047 ACAUCAGCUGC NO: 495 ETX- GmsAfsUmGmAmUfAmAmUmAmCmCm SEQ ID GAUGAUAAUACC SEQ ID S00003970 CmUfGmCfAmCfAmGmAmsCmsAm NO: 1049 CUGCACAGACA NO: 497 ETX- UmsUfsUmCmAmUfCmAmUmAmCmAm SEQ ID UUUCAUCAUACA SEQ ID S00003974 AmGfAmCfAmAfGmCmAmsCmsAm NO: 1050 AGACAAGCACA NO: 498 ETX- CmsAfsGmAmCmAfCmGmUmUmAmAm SEQ ID CAGACACGUUAA SEQ ID S00003978 AmGfCmCfUmUfGmGmUmsAmsCm NO: 1051 AGCCUUGGUAC NO: 499 ETX- AmsGfsAmAmCmAfUmUmGmGmAmCm SEQ ID AGAACAUUGGAC SEQ ID S00003982 CmAfUmGfCmAfCmCmCmsUmsUm NO: 1052 CAUGCACCCUU NO: 500 ETX- GmsUfsAmGmAmUfCmUmUmAmAmCm SEQ ID GUAGAUCUUAAC SEQ ID S00003986 CmAfGmGfCmAfGmUmCmsAmsCm NO: 1053 CAGGCAGUCAC NO: 501 ETX- AmsGfsCmUmCmCfAmGmCmUmUmUm SEQ ID AGCUCCAGCUUU SEQ ID S00003990 AmCfCmCfAmCfAmUmCmsAmsGm NO: 1054 ACCCACAUCAG NO: 502 ETX- GmsCfsUmCmCmUfUmGmGmGmAmAm SEQ ID GCUCCUUGGGAA SEQ ID S00003994 UmAfCmGfGmAfCmCmAmsCmsGm NO: 1055 UACGGACCACG NO: 503 ETX- GmsAfsAmGmCmAfUmUmCmCmCmUm SEQ ID GAAGCAUUCCCU SEQ ID S00003998 UmUfGmCfAmGfUmGmUmsCmsAm NO: 1056 UUGCAGUGUCA NO: 504 ETX- CmsCfsUmUmGmGfUmAmCmAmGmGm SEQ ID CCUUGGUACAGG SEQ ID S00004002 CmCfCmUfUmAfAmUmCmsCmsCm NO: 1057 CCCUUAAUCCC NO: 505 ETX- UmsAfsGmAmUmGfAmUmAmAmUmAm SEQ ID UAGAUGAUAAUA SEQ ID S00004006 CmCfCmUfGmCfAmCmAmsGmsAm NO: 1058 CCCUGCACAGA NO: 506 ETX- AmsAfsUmAmCmCfCmUmGmCmAmCm SEQ ID AAUACCCUGCAC SEQ ID S00004010 AmGfAmCfAmCfGmUmUmsAmsAm NO: 1059 AGACACGUUAA NO: 507 ETX- GmsUfsUmAmAmAfGmCmCmUmUmGm SEQ ID GUUAAAGCCUUG SEQ ID S00004014 GmUfAmCfAmGfGmCmCmsCmsUm NO: 1060 GUACAGGCCCU NO: 508 ETX- AmsGfsCmAmUmUfCmCmCmUmUmUm SEQ ID AGCAUUCCCUUU SEQ ID S00004018 GmCfAmGfUmGfUmCmAmsUmsAm NO: 1061 GCAGUGUCAUA NO: 509 ETX- UmsCfsUmUmAmAfCmCmAmGmGmCm SEQ ID UCUUAACCAGGC SEQ ID S00004022 AmGfUmCfAmCfCmGmAmsGmsGm NO: 1062 AGUCACCGAGG NO: 510 ETX- AmsUfsAmCmAmAfGmAmCmAmAmGm SEQ ID AUACAAGACAAG SEQ ID S00004026 CmAfCmAfAmAfAmGmCmsAmsCm NO: 1063 CACAAAAGCAC NO: 511 ETX- GmsAfsCmAmAmGfCmAmCmAmAmAm SEQ ID GACAAGCACAAA SEQ ID S00004030 AmGfCmAfCmCfAmCmCmsCmsAm NO: 1064 AGCACCACCCA NO: 512 ETX- AmsCfsCmCmAmCfAmUmCmAmGmCm SEQ ID ACCCACAUCAGC SEQ ID S00004034 UmGfCmUfAmGfAmCmGmsGmsGm NO: 1065 UGCUAGACGGG NO: 513 ETX- UmsAfsAmAmGmCfCmUmUmGmGmUm SEQ ID UAAAGCCUUGGU SEQ ID S00004038 AmCfAmGfGmCfCmCmUmsUmsAm NO: 1066 ACAGGCCCUUA NO: 514 ETX- UmsUfsCmAmUmCfAmUmAmCmAmAm SEQ ID UUCAUCAUACAA SEQ ID S00004042 GmAfCmAfAmGfCmAmCmsAmsAm NO: 1067 GACAAGCACAA NO: 515 ETX- GmsCfsCmCmUmUfAmAmUmCmCmCm SEQ ID GCCCUUAAUCCC SEQ ID S00004046 AmUfCmAfGmAfUmUmUmsGmsUm NO: 1068 AUCAGAUUUGU NO: 516 ETX- UmsUfsAmAmUmCfCmCmAmUmCmAm SEQ ID UUAAUCCCAUCA SEQ ID S00004050 GmAfUmUfUmGfUmAmGmsAmsUm NO: 1069 GAUUUGUAGAU NO: 517 ETX- UmsCfsGmGmUmAfGmAmUmGmAmUm SEQ ID UCGGUAGAUGAU SEQ ID S00004054 AmAfUmAfCmCfCmUmGmsCmsAm NO: 1070 AAUACCCUGCA NO: 518 ETX- CmsAfsCmGmUmUfAmAmAmGmCmCm SEQ ID CACGUUAAAGCC SEQ ID S00004058 UmUfGmGfUmAfCmAmGmsGmsCm NO: 1071 UUGGUACAGGC NO: 519 ETX- UmsCfsCmCmAmUfCmAmGmAmUmUm SEQ ID UCCCAUCAGAUU SEQ ID S00004062 UmGfUmAfGmAfUmCmUmsUmsAm NO: 1072 UGUAGAUCUUA NO: 520 ETX- UmsCfsAmUmAmCfAmAmGmAmCmAm SEQ ID UCAUACAAGACA SEQ ID S00004066 AmGfCmAfCmAfAmAmAmsGmsCm NO: 1073 AGCACAAAAGC NO: 521 ETX- CmsCfsUmUmAmAfUmCmCmCmAmUm SEQ ID CCUUAAUCCCAU SEQ ID S00004070 CmAfGmAfUmUfUmGmUmsAmsGm NO: 1074 CAGAUUUGUAG NO: 522 ETX- AmsCfsAmUmUmGfGmAmCmCmAmUm SEQ ID ACAUUGGACCAU SEQ ID S00004074 GmCfAmCfCmCfUmUmGmsAmsAm NO: 1075 GCACCCUUGAA NO: 523 ETX- CmsUfsUmGmGmUfAmCmAmGmGmCm SEQ ID CUUGGUACAGGC SEQ ID S00004078 CmCfUmUfAmAfUmCmCmsCmsAm NO: 1076 CCUUAAUCCCA NO: 524 ETX- UmsUfsGmCmAmGfUmGmUmCmAmUm SEQ ID UUGCAGUGUCAU SEQ ID S00004082 AmGfAmUfAmCfCmGmAmsAmsGm NO: 1077 AGAUACCGAAG NO: 525 ETX- CmsAfsCmAmGmAfCmAmCmGmUmUm SEQ ID CACAGACACGUU SEQ ID S00004086 AmAfAmGfCmCfUmUmGmsGmsUm NO: 1078 AAAGCCUUGGU NO: 526 ETX- AmsGfsCmAmCmAfAmAmAmGmCmAm SEQ ID AGCACAAAAGCA SEQ ID S00004090 CmCfAmCfCmCfAmUmGmsCmsCm NO: 1079 CCACCCAUGCC NO: 527 ETX- CmsCfsAmUmCmAfGmAmUmUmUmGm SEQ ID CCAUCAGAUUUG SEQ ID S00004094 UmAfGmAfUmCfUmUmAmsAmsCm NO: 1080 UAGAUCUUAAC NO: 528 ETX- CmsCfsAmCmAmUfCmAmGmCmUmGm SEQ ID CCACAUCAGCUG SEQ ID S00004098 CmUfAmGfAmCfGmGmGmsUmsAm NO: 1081 CUAGACGGGUA NO: 529 ETX- GmsCfsAmUmUmCfCmCmUmUmUmGm SEQ ID GCAUUCCCUUUG SEQ ID S00004102 CmAfGmUfGmUfCmAmUmsAmsGm NO: 1082 CAGUGUCAUAG NO: 530 ETX- CmsUfsUmUmAmCfCmCmAmCmAmUm SEQ ID CUUUACCCACAU SEQ ID S00004106 CmAfGmCfUmGfCmUmAmsGmsAm NO: 1083 CAGCUGCUAGA NO: 531 ETX- AmsUfsCmCmGmGfAmAmGmCmAmUm SEQ ID AUCCGGAAGCAU SEQ ID S00004110 UmCfCmCfUmUfUmGmCmsAmsGm NO: 1084 UCCCUUUGCAG NO: 532 ETX- AmsGfsCmUmGmCfUmAmGmAmCmGm SEQ ID AGCUGCUAGACG SEQ ID S00004114 GmGfUmAfCmGfGmGmCmsAmsAm NO: 1085 GGUACGGGCAA NO: 533 ETX- CmsGfsGmCmUmCfGmGmUmAmGmAm SEQ ID CGGCUCGGUAGA SEQ ID S00004118 UmGfAmUfAmAfUmAmCmsCmsCm NO: 1086 UGAUAAUACCC NO: 534 ETX- GmsGfsGmUmAmCfGmGmGmCmAmAm SEQ ID GGGUACGGGCAA SEQ ID S00004122 AmAfUmCfAmAfGmAmGmsGmsGm NO: 1087 AAUCAAGAGGG NO: 535 ETX- AmsCfsAmUmCmAfGmCmUmGmCmUm SEQ ID ACAUCAGCUGCU SEQ ID S00004126 AmGfAmCfGmGfGmUmAmsCmsGm NO: 1088 AGACGGGUACG NO: 536 ETX- CmsCfsCmUmUmAfAmUmCmCmCmAm SEQ ID CCCUUAAUCCCA SEQ ID S00004130 UmCfAmGfAmUfUmUmGmsUmsAm NO: 1089 UCAGAUUUGUA NO: 537 ETX- CmsGfsGmGmCmAfAmAmAmUmCmAm SEQ ID CGGGCAAAAUCA SEQ ID S00004134 AmGfAmGfGmGfUmAmCmsAmsCm NO: 1090 AGAGGGUACAC NO: 538 ETX- AmsCfsGmUmUmAfAmAmGmCmCmUm SEQ ID ACGUUAAAGCCU SEQ ID S00004138 UmGfGmUfAmCfAmGmGmsCmsCm NO: 1091 UGGUACAGGCC NO: 539 ETX- UmsGfsGmUmAmCfAmGmGmCmCmCm SEQ ID UGGUACAGGCCC SEQ ID S00004142 UmUfAmAfUmCfCmCmAmsUmsCm NO: 1092 UUAAUCCCAUC NO: 540 ETX- GmsGfsCmGmGmCfUmCmGmGmUmAm SEQ ID GGCGGCUCGGUA SEQ ID S00004146 GmAfUmGfAmUfAmAmUmsAmsCm NO: 1093 GAUGAUAAUAC NO: 541 ETX- CmsGfsUmUmAmAfAmGmCmCmUmUm SEQ ID CGUUAAAGCCUU SEQ ID S00004150 GmGfUmAfCmAfGmGmCmsCmsCm NO: 1094 GGUACAGGCCC NO: 542 ETX- GmsGfsUmAmCmAfGmGmCmCmCmUm SEQ ID GGUACAGGCCCU SEQ ID S00004154 UmAfAmUfCmCfCmAmUmsCmsAm NO: 1095 UAAUCCCAUCA NO: 543 ETX- UmsAfsAmUmAmCfCmCmUmGmCmAm SEQ ID UAAUACCCUGCA SEQ ID S00004158 CmAfGmAfCmAfCmGmUmsUmsAm NO: 1096 CAGACACGUUA NO: 544 ETX- GmsAfsCmCmAmCfGmCmAmGmUmCm SEQ ID GACCACGCAGUC SEQ ID S00004162 UmAfUmAfAmUfGmCmCmsUmsUm NO: 1097 UAUAAUGCCUU NO: 545 ETX- GmsUfsUmAmAmGfAmGmCmCmUmGm SEQ ID GUUAAGAGCCUG SEQ ID S00004166 GmGfUmGfGmGfGmAmAmsGmsUm NO: 1098 GGUGGGGAAGU NO: 546 ETX- UmsGfsGmGmGmAfAmGmUmAmUmCm SEQ ID UGGGGAAGUAUC SEQ ID S00004170 UmGfAmUfGmAfCmAmUmsUmsGm NO: 1099 UGAUGACAUUG NO: 547 ETX- GmsGfsUmGmGmGfGmAmAmGmUmAm SEQ ID GGUGGGGAAGUA SEQ ID S00004174 UmCfUmGfAmUfGmAmCmsAmsUm NO: 1100 UCUGAUGACAU NO: 548 ETX- GmsUfsGmGmGmGfAmAmGmUmAmUm SEQ ID GUGGGGAAGUAU SEQ ID S00004178 CmUfGmAfUmGfAmCmAmsUmsUm NO: 1101 CUGAUGACAUU NO: 549 ETX- GmsGfsGmGmAmAfGmUmAmUmCmUm SEQ ID GGGGAAGUAUCU SEQ ID S00004182 GmAfUmGfAmCfAmUmUmsGmsGm NO: 1102 GAUGACAUUGG NO: 550 ETX- UmsUfsAmAmGmAfGmCmCmUmGmGm SEQ ID UUAAGAGCCUGG SEQ ID S00004186 GmUfGmGfGmGfAmAmGmsUmsAm NO: 1103 GUGGGGAAGUA NO: 551 ETX- CmsCfsGmAmAmGfUmAmGmGmCmGm SEQ ID CCGAAGUAGGCG SEQ ID S00004190 GmCfUmCfGmGfUmAmGmsAmsUm NO: 1104 GCUCGGUAGAU NO: 552 In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 1105-1380; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 1105-1380; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 1105-1380; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand. In certain embodiments, the second strand comprises any one of SEQ ID NO: 1105-1380. The modification pattern of the nucleic acids as set forth in SEQ ID NO: 1105-1380 is summarized in Table 4 below. Table 4 provides the modified second (sense) sequences, together with the corresponding unmodified second (sense) sequences for siRNA oligonucleosides according to the present invention as follows. Table 4 Sense Modified Sense Strand SEQ ID Underlying Base SEQ ID strand ID NO (SS - Sequence NO (SS - 5’ ^ 3’ mod) unmod) 5’ ^ 3’ (Shown as an Unmodified Nucleotide Sequence) ETX- iaiaAmsUmsCmUmGmAmCmCmAfGfUfU SEQ ID AUCUGACCAGUUU SEQ ID S00003197 mUmUmCmUmCmUmUmAmAm NO: 1132 UCUCUUAA NO: 580 ETX- iaiaUmsUmsAmUmUmUmCmAmGfUfCfA SEQ ID UUAUUUCAGUCAC SEQ ID S00003273 mCmUmCmCmUmGmAmUmAm NO: 1151 UCCUGAUA NO: 599 ETX- iaiaAmsUmsCmUmAmUmGmAmCfAfCfU SEQ ID AUCUAUGACACUG SEQ ID S00003737 mGmCmAmAmAmGmGmGmAm NO: 1267 CAAAGGGA NO: 715 ETX- iaiaGmsUmsUmAmAmGmAmUmCfUfAfC SEQ ID GUUAAGAUCUACA SEQ ID S00003793 mAmAmAmUmCmUmGmAmUm NO: 1281 AAUCUGAU NO: 729 ETX- iaiaCmsGmsUmAmCmCmCmGmUfCfUfA SEQ ID CGUACCCGUCUAG SEQ ID S00003965 mGmCmAmGmCmUmGmAmUm NO: 1324 CAGCUGAU NO: 772 ETX- iaiaUmsAmsUmUmUmAmCmUmGfGfUfU SEQ ID UAUUUACUGGUUG SEQ ID S00003089 mGmAmAmAmAmUmGmGmGm NO: 1105 AAAAUGGG NO: 553 ETX- iaiaCmsAmsAmAmGmGmCmAmUfUfAfU SEQ ID CAAAGGCAUUAUA SEQ ID S00003093 mAmGmAmCmUmGmCmGmUm NO: 1106 GACUGCGU NO: 554 ETX- iaiaUmsGmsAmUmGmAmAmAmUfCfAfA SEQ ID UGAUGAAAUCAAG SEQ ID S00003097 mGmAmAmGmUmAmCmAmCm NO: 1107 AAGUACAC NO: 555 ETX- iaiaGmsAmsUmGmAmUmGmGmGfAfCfU SEQ ID GAUGAUGGGACUC SEQ ID S00003101 mCmAmAmUmUmGmUmAmUm NO: 1108 AAUUGUAU NO: 556 ETX- iaiaGmsCmsAmUmUmAmUmAmGfAfCfU SEQ ID GCAUUAUAGACUG SEQ ID S00003105 mGmCmGmUmGmGmUmCmCm NO: 1109 CGUGGUCC NO: 557 ETX- iaiaGmsUmsCmAmCmUmCmCmUfGfAfU SEQ ID GUCACUCCUGAUA SEQ ID S00003109 mAmAmAmUmAmAmCmAmAm NO: 1110 AAUAACAA NO: 558 ETX- iaiaAmsUmsAmCmAmAmAmGmGfCfAfU SEQ ID AUACAAAGGCAUU SEQ ID S00003113 mUmAmUmAmGmAmCmUmGm NO: 1111 AUAGACUG NO: 559 ETX- iaiaGmsCmsCmGmCmCmUmAmCfUfUfC SEQ ID GCCGCCUACUUCG SEQ ID S00003117 mGmGmUmAmUmCmUmAmUm NO: 1112 GUAUCUAU NO: 560 ETX- iaiaAmsGmsCmCmGmCmCmUmAfCfUfU SEQ ID AGCCGCCUACUUC SEQ ID S00003121 mCmGmGmUmAmUmCmUmAm NO: 1113 GGUAUCUA NO: 561 ETX- iaiaAmsGmsAmCmUmGmCmGmUfGfGfU SEQ ID AGACUGCGUGGUC SEQ ID S00003125 mCmCmGmUmAmUmUmCmCm NO: 1114 CGUAUUCC NO: 562 ETX- iaiaCmsAmsCmUmCmAmCmAmUfCfGfU SEQ ID CACUCACAUCGUC SEQ ID S00003129 mCmAmUmCmAmGmCmUmGm NO: 1115 AUCAGCUG NO: 563 ETX- iaiaAmsCmsUmUmCmGmCmCmUfUfCfA SEQ ID ACUUCGCCUUCAA SEQ ID S00003133 mAmAmGmAmUmAmAmAmUm NO: 1116 AGAUAAAU NO: 564 ETX- iaiaCmsUmsAmCmUmUmCmGmGfUfAfU SEQ ID CUACUUCGGUAUC SEQ ID S00003137 mCmUmAmUmGmAmCmAmCm NO: 1117 UAUGACAC NO: 565 ETX- iaiaUmsUmsUmAmCmUmGmGmUfUfGfA SEQ ID UUUACUGGUUGAA SEQ ID S00003141 mAmAmAmUmGmGmGmAmAm NO: 1118 AAUGGGAA NO: 566 ETX- iaiaUmsGmsCmCmCmGmUmAmCfCfCfG SEQ ID UGCCCGUACCCGU SEQ ID S00003145 mUmCmUmAmGmCmAmGmCm NO: 1119 CUAGCAGC NO: 567 ETX- iaiaAmsGmsUmCmAmGmGmGmCfGfCfA SEQ ID AGUCAGGGCGCAA SEQ ID S00003149 mAmAmGmGmAmAmCmUmGm NO: 1120 AGGAACUG NO: 568 ETX- iaiaUmsUmsAmCmUmGmGmUmUfGfAfA SEQ ID UUACUGGUUGAAA SEQ ID S00003153 mAmAmUmGmGmGmAmAmGm NO: 1121 AUGGGAAG NO: 569 ETX- iaiaGmsAmsGmCmCmGmCmCmUfAfCfU SEQ ID GAGCCGCCUACUU SEQ ID S00003157 mUmCmGmGmUmAmUmCmUm NO: 1122 CGGUAUCU NO: 570 ETX- iaiaCmsCmsUmCmGmGmUmGmAfCfUfG SEQ ID CCUCGGUGACUGC SEQ ID S00003161 mCmCmUmGmGmUmUmAmAm NO: 1123 CUGGUUAA NO: 571 ETX- iaiaCmsAmsUmCmGmUmCmAmUfCfAfG SEQ ID CAUCGUCAUCAGC SEQ ID S00003165 mCmUmGmGmAmUmGmAmUm NO: 1124 UGGAUGAU NO: 572 ETX- iaiaUmsUmsUmCmAmGmUmCmAfCfUfC SEQ ID UUUCAGUCACUCC SEQ ID S00003169 mCmUmGmAmUmAmAmAmUm NO: 1125 UGAUAAAU NO: 573 ETX- iaiaUmsGmsGmAmUmGmAmUmCfGfCfA SEQ ID UGGAUGAUCGCAC SEQ ID S00003173 mCmAmGmAmCmUmGmUmCm NO: 1126 AGACUGUC NO: 574 ETX- iaiaGmsCmsAmAmUmAmCmAmAfAfGfG SEQ ID GCAAUACAAAGGC SEQ ID S00003177 mCmAmUmUmAmUmAmGmAm NO: 1127 AUUAUAGA NO: 575 ETX- iaiaGmsCmsCmUmCmGmGmUmGfAfCfU SEQ ID GCCUCGGUGACUG SEQ ID S00003181 mGmCmCmUmGmGmUmUmAm NO: 1128 CCUGGUUA NO: 576 ETX- iaiaCmsUmsUmUmAmAmCmGmUfGfUfC SEQ ID CUUUAACGUGUCU SEQ ID S00003185 mUmGmUmGmCmAmGmGmGm NO: 1129 GUGCAGGG NO: 577 ETX- iaiaAmsAmsAmGmGmCmAmUmUfAfUfA SEQ ID AAAGGCAUUAUAG SEQ ID S00003189 mGmAmCmUmGmCmGmUmGm NO: 1130 ACUGCGUG NO: 578 ETX- iaiaGmsUmsGmAmAmCmAmGmGfCfAfU SEQ ID GUGAACAGGCAUG SEQ ID S00003193 mGmUmUmGmUmAmUmUmAm NO: 1131 UUGUAUUA NO: 579 ETX- iaiaAmsGmsGmCmUmUmUmAmAfCfGfU SEQ ID AGGCUUUAACGUG SEQ ID S00003201 mGmUmCmUmGmUmGmCmAm NO: 1133 UCUGUGCA NO: 581 ETX- iaiaGmsCmsAmGmUmCmAmGmGfGfCfG SEQ ID GCAGUCAGGGCGC SEQ ID S00003205 mCmAmAmAmGmGmAmAmCm NO: 1134 AAAGGAAC NO: 582 ETX- iaiaGmsAmsUmGmAmUmCmGmCfAfCfA SEQ ID GAUGAUCGCACAG SEQ ID S00003209 mGmAmCmUmGmUmCmAmCm NO: 1135 ACUGUCAC NO: 583 ETX- iaiaAmsGmsGmCmAmUmUmAmUfAfGfA SEQ ID AGGCAUUAUAGAC SEQ ID S00003213 mCmUmGmCmGmUmGmGmUm NO: 1136 UGCGUGGU NO: 584 ETX- iaiaUmsGmsAmUmCmGmCmAmCfAfGfA SEQ ID UGAUCGCACAGAC SEQ ID S00003217 mCmUmGmUmCmAmCmUmGm NO: 1137 UGUCACUG NO: 585 ETX- iaiaCmsUmsGmCmGmUmGmGmUfCfCfG SEQ ID CUGCGUGGUCCGU SEQ ID S00003221 mUmAmUmUmCmCmCmAmAm NO: 1138 AUUCCCAA NO: 586 ETX- iaiaCmsAmsAmUmAmCmAmAmAfGfGfC SEQ ID CAAUACAAAGGCA SEQ ID S00003225 mAmUmUmAmUmAmGmAmCm NO: 1139 UUAUAGAC NO: 587 ETX- iaiaCmsAmsUmCmAmGmCmUmGfGfAfU SEQ ID CAUCAGCUGGAUG SEQ ID S00003229 mGmAmUmCmGmCmAmCmAm NO: 1140 AUCGCACA NO: 588 ETX- iaiaAmsUmsUmAmUmAmGmAmCfUfGfC SEQ ID AUUAUAGACUGCG SEQ ID S00003233 mGmUmGmGmUmCmCmGmUm NO: 1141 UGGUCCGU NO: 589 ETX- iaiaUmsUmsUmGmCmCmCmGmUfAfCfC SEQ ID UUUGCCCGUACCC SEQ ID S00003237 mCmGmUmCmUmAmGmCmAm NO: 1142 GUCUAGCA NO: 590 ETX- iaiaAmsCmsAmUmCmGmUmCmAfUfCfA SEQ ID ACAUCGUCAUCAG SEQ ID S00003241 mGmCmUmGmGmAmUmGmAm NO: 1143 CUGGAUGA NO: 591 ETX- iaiaUmsCmsUmUmGmAmUmUmUfUfGfC SEQ ID UCUUGAUUUUGCC SEQ ID S00003245 mCmCmGmUmAmCmCmCmGm NO: 1144 CGUACCCG NO: 592 ETX- iaiaAmsUmsAmGmAmCmUmGmCfGfUfG SEQ ID AUAGACUGCGUGG SEQ ID S00003249 mGmUmCmCmGmUmAmUmUm NO: 1145 UCCGUAUU NO: 593 ETX- iaiaCmsGmsCmCmUmAmCmUmUfCfGfG SEQ ID CGCCUACUUCGGU SEQ ID S00003253 mUmAmUmCmUmAmUmGmAm NO: 1146 AUCUAUGA NO: 594 ETX- iaiaGmsAmsCmUmGmCmGmUmGfGfUfC SEQ ID GACUGCGUGGUCC SEQ ID S00003257 mCmGmUmAmUmUmCmCmCm NO: 1147 GUAUUCCC NO: 595 ETX- iaiaUmsCmsAmUmCmAmGmCmUfGfGfA SEQ ID UCAUCAGCUGGAU SEQ ID S00003261 mUmGmAmUmCmGmCmAmCm NO: 1148 GAUCGCAC NO: 596 ETX- iaiaUmsUmsAmUmAmGmAmCmUfGfCfG SEQ ID UUAUAGACUGCGU SEQ ID S00003265 mUmGmGmUmCmCmGmUmAm NO: 1149 GGUCCGUA NO: 597 ETX- iaiaCmsCmsUmAmCmUmUmCmGfGfUfA SEQ ID CCUACUUCGGUAU SEQ ID S00003269 mUmCmUmAmUmGmAmCmAm NO: 1150 CUAUGACA NO: 598 ETX- iaiaGmsUmsCmAmUmCmAmGmCfUfGfG SEQ ID GUCAUCAGCUGGA SEQ ID S00003277 mAmUmGmAmUmCmGmCmAm NO: 1152 UGAUCGCA NO: 600 ETX- iaiaAmsUmsUmUmUmGmCmCmCfGfUfA SEQ ID AUUUUGCCCGUAC SEQ ID S00003281 mCmCmCmGmUmCmUmAmGm NO: 1153 CCGUCUAG NO: 601 ETX- iaiaCmsAmsAmAmGmGmGmAmAfUfGfC SEQ ID CAAAGGGAAUGCU SEQ ID S00003285 mUmUmCmCmGmGmAmUmCm NO: 1154 UCCGGAUC NO: 602 ETX- iaiaAmsAmsGmGmCmUmUmUmAfAfCfG SEQ ID AAGGCUUUAACGU SEQ ID S00003289 mUmGmUmCmUmGmUmGmCm NO: 1155 GUCUGUGC NO: 603 ETX- iaiaAmsAmsGmGmCmAmUmUmAfUfAfG SEQ ID AAGGCAUUAUAGA SEQ ID S00003293 mAmCmUmGmCmGmUmGmGm NO: 1156 CUGCGUGG NO: 604 ETX- iaiaUmsUmsGmAmUmUmUmUmGfCfCfC SEQ ID UUGAUUUUGCCCG SEQ ID S00003297 mGmUmAmCmCmCmGmUmCm NO: 1157 UACCCGUC NO: 605 ETX- iaiaCmsGmsAmGmCmCmGmCmCfUfAfC SEQ ID CGAGCCGCCUACU SEQ ID S00003301 mUmUmCmGmGmUmAmUmCm NO: 1158 UCGGUAUC NO: 606 ETX- iaiaAmsUmsCmAmUmCmUmAmCfCfGfA SEQ ID AUCAUCUACCGAG SEQ ID S00003305 mGmCmCmGmCmCmUmAmCm NO: 1159 CCGCCUAC NO: 607 ETX- iaiaUmsGmsAmUmUmUmUmGmCfCfCfG SEQ ID UGAUUUUGCCCGU SEQ ID S00003309 mUmAmCmCmCmGmUmCmUm NO: 1160 ACCCGUCU NO: 608 ETX- iaiaUmsAmsUmCmAmUmCmUmAfCfCfG SEQ ID UAUCAUCUACCGA SEQ ID S00003313 mAmGmCmCmGmCmCmUmAm NO: 1161 GCCGCCUA NO: 609 ETX- iaiaCmsAmsUmCmUmAmCmCmGfAfGfC SEQ ID CAUCUACCGAGCC SEQ ID S00003317 mCmGmCmCmUmAmCmUmUm NO: 1162 GCCUACUU NO: 610 ETX- iaiaCmsUmsCmUmUmAmAmCmUfUfCfG SEQ ID CUCUUAACUUCGC SEQ ID S00003321 mCmCmUmUmCmAmAmAmGm NO: 1163 CUUCAAAG NO: 611 ETX- iaiaCmsCmsAmCmCmCmAmGmGfCfUfC SEQ ID CCACCCAGGCUCU SEQ ID S00003325 mUmUmAmAmCmUmUmCmGm NO: 1164 UAACUUCG NO: 612 ETX- iaiaCmsCmsGmUmAmUmUmCmCfCfAfA SEQ ID CCGUAUUCCCAAG SEQ ID S00003329 mGmGmAmGmCmAmGmGmGm NO: 1165 GAGCAGGG NO: 613 ETX- iaiaGmsAmsGmCmAmGmGmGmAfGfUfU SEQ ID GAGCAGGGAGUUC SEQ ID S00003333 mCmUmGmUmCmCmUmUmCm NO: 1166 UGUCCUUC NO: 614 ETX- iaiaUmsCmsCmCmAmAmGmGmAfGfCfA SEQ ID UCCCAAGGAGCAG SEQ ID S00003337 mGmGmGmAmGmUmUmCmUm NO: 1167 GGAGUUCU NO: 615 ETX- iaiaUmsCmsCmGmUmAmUmUmCfCfCfA SEQ ID UCCGUAUUCCCAA SEQ ID S00003341 mAmGmGmAmGmCmAmGmGm NO: 1168 GGAGCAGG NO: 616 ETX- iaiaGmsCmsAmGmGmGmAmGmUfUfCfU SEQ ID GCAGGGAGUUCUG SEQ ID S00003345 mGmUmCmCmUmUmCmUmGm NO: 1169 UCCUUCUG NO: 617 ETX- iaiaGmsUmsCmCmGmUmAmUmUfCfCfC SEQ ID GUCCGUAUUCCCA SEQ ID S00003349 mAmAmGmGmAmGmCmAmGm NO: 1170 AGGAGCAG NO: 618 ETX- iaiaAmsGmsCmAmGmGmGmAmGfUfUfC SEQ ID AGCAGGGAGUUCU SEQ ID S00003353 mUmGmUmCmCmUmUmCmUm NO: 1171 GUCCUUCU NO: 619 ETX- iaiaGmsGmsAmGmCmAmGmGmGfAfGfU SEQ ID GGAGCAGGGAGUU SEQ ID S00003357 mUmCmUmGmUmCmCmUmUm NO: 1172 CUGUCCUU NO: 620 ETX- iaiaUmsUmsCmCmCmAmAmGmGfAfGfC SEQ ID UUCCCAAGGAGCA SEQ ID S00003361 mAmGmGmGmAmGmUmUmCm NO: 1173 GGGAGUUC NO: 621 ETX- iaiaAmsGmsGmAmGmCmAmGmGfGfAfG SEQ ID AGGAGCAGGGAGU SEQ ID S00003365 mUmUmCmUmGmUmCmCmUm NO: 1174 UCUGUCCU NO: 622 ETX- iaiaCmsCmsCmAmCmCmCmAmGfGfCfU SEQ ID CCCACCCAGGCUC SEQ ID S00003369 mCmUmUmAmAmCmUmUmCm NO: 1175 UUAACUUC NO: 623 ETX- iaiaUmsCmsUmUmAmAmCmUmUfCfGfC SEQ ID UCUUAACUUCGCC SEQ ID S00003373 mCmUmUmCmAmAmAmGmAm NO: 1176 UUCAAAGA NO: 624 ETX- iaiaUmsUmsCmAmGmUmCmAmCfUfCfC SEQ ID UUCAGUCACUCCU SEQ ID S00003377 mUmGmAmUmAmAmAmUmAm NO: 1177 GAUAAAUA NO: 625 ETX- iaiaCmsAmsGmUmCmAmCmUmCfCfUfG SEQ ID CAGUCACUCCUGA SEQ ID S00003381 mAmUmAmAmAmUmAmAmCm NO: 1178 UAAAUAAC NO: 626 ETX- iaiaUmsCmsAmGmUmCmAmCmUfCfCfU SEQ ID UCAGUCACUCCUG SEQ ID S00003385 mGmAmUmAmAmAmUmAmAm NO: 1179 AUAAAUAA NO: 627 ETX- iaiaUmsGmsAmUmGmGmGmAmCfUfCfA SEQ ID UGAUGGGACUCAA SEQ ID S00003389 mAmUmUmGmUmAmUmUmUm NO: 1180 UUGUAUUU NO: 628 ETX- iaiaGmsAmsUmGmGmGmAmCmUfCfAfA SEQ ID GAUGGGACUCAAU SEQ ID S00003393 mUmUmGmUmAmUmUmUmUm NO: 1181 UGUAUUUU NO: 629 ETX- iaiaCmsAmsCmUmCmCmUmGmAfUfAfA SEQ ID CACUCCUGAUAAA SEQ ID S00003397 mAmUmAmAmCmAmAmAmUm NO: 1182 UAACAAAU NO: 630 ETX- iaiaAmsUmsUmCmAmUmCmUmGfAfCfC SEQ ID AUUCAUCUGACCA SEQ ID S00003401 mAmGmUmUmUmUmCmUmCm NO: 1183 GUUUUCUC NO: 631 ETX- iaiaAmsAmsCmAmGmGmCmAmUfGfUfU SEQ ID AACAGGCAUGUUG SEQ ID S00003405 mGmUmAmUmUmAmUmAmUm NO: 1184 UAUUAUAU NO: 632 ETX- iaiaAmsGmsGmGmAmAmUmGmCfUfUfC SEQ ID AGGGAAUGCUUCC SEQ ID S00003409 mCmGmGmAmUmCmCmCmAm NO: 1185 GGAUCCCA NO: 633 ETX- iaiaGmsGmsGmAmAmUmGmCmUfUfCfC SEQ ID GGGAAUGCUUCCG SEQ ID S00003413 mGmGmAmUmCmCmCmAmAm NO: 1186 GAUCCCAA NO: 634 ETX- iaiaCmsGmsAmGmGmCmCmUmCfGfGfU SEQ ID CGAGGCCUCGGUG SEQ ID S00003417 mGmAmCmUmGmCmCmUmGm NO: 1187 ACUGCCUG NO: 635 ETX- iaiaAmsCmsAmGmGmCmAmUmGfUfUfG SEQ ID ACAGGCAUGUUGU SEQ ID S00003421 mUmAmUmUmAmUmAmUmAm NO: 1188 AUUAUAUA NO: 636 ETX- iaiaAmsAmsUmAmCmAmAmAmGfGfCfA SEQ ID AAUACAAAGGCAU SEQ ID S00003425 mUmUmAmUmAmGmAmCmUm NO: 1189 UAUAGACU NO: 637 ETX- iaiaAmsUmsUmUmCmAmGmUmCfAfCfU SEQ ID AUUUCAGUCACUC SEQ ID S00003429 mCmCmUmGmAmUmAmAmAm NO: 1190 CUGAUAAA NO: 638 ETX- iaiaAmsUmsGmAmUmGmGmGmAfCfUfC SEQ ID AUGAUGGGACUCA SEQ ID S00003433 mAmAmUmUmGmUmAmUmUm NO: 1191 AUUGUAUU NO: 639 ETX- iaiaCmsUmsGmAmCmCmAmGmUfUfUfU SEQ ID CUGACCAGUUUUC SEQ ID S00003437 mCmUmCmUmUmAmAmAmGm NO: 1192 UCUUAAAG NO: 640 ETX- iaiaUmsGmsAmCmCmAmGmUmUfUfUfC SEQ ID UGACCAGUUUUCU SEQ ID S00003441 mUmCmUmUmAmAmAmGmCm NO: 1193 CUUAAAGC NO: 641 ETX- iaiaGmsAmsUmAmAmGmCmAmAfUfAfC SEQ ID GAUAAGCAAUACA SEQ ID S00003445 mAmAmAmGmGmCmAmUmUm NO: 1194 AAGGCAUU NO: 642 ETX- iaiaAmsUmsAmAmGmCmAmAmUfAfCfA SEQ ID AUAAGCAAUACAA SEQ ID S00003449 mAmAmGmGmCmAmUmUmAm NO: 1195 AGGCAUUA NO: 643 ETX- iaiaUmsUmsAmAmCmGmUmGmUfCfUfG SEQ ID UUAACGUGUCUGU SEQ ID S00003453 mUmGmCmAmGmGmGmUmAm NO: 1196 GCAGGGUA NO: 644 ETX- iaiaUmsAmsAmCmGmUmGmUmCfUfGfU SEQ ID UAACGUGUCUGUG SEQ ID S00003457 mGmCmAmGmGmGmUmAmUm NO: 1197 CAGGGUAU NO: 645 ETX- iaiaUmsCmsAmCmAmUmCmGmUfCfAfU SEQ ID UCACAUCGUCAUC SEQ ID S00003461 mCmAmGmCmUmGmGmAmUm NO: 1198 AGCUGGAU NO: 646 ETX- iaiaUmsGmsAmUmGmAmUmGmGfGfAfC SEQ ID UGAUGAUGGGACU SEQ ID S00003465 mUmCmAmAmUmUmGmUmAm NO: 1199 CAAUUGUA NO: 647 ETX- iaiaAmsCmsUmGmCmGmUmGmGfUfCfC SEQ ID ACUGCGUGGUCCG SEQ ID S00003469 mGmUmAmUmUmCmCmCmAm NO: 1200 UAUUCCCA NO: 648 ETX- iaiaGmsAmsAmCmAmGmGmCmAfUfGfU SEQ ID GAACAGGCAUGUU SEQ ID S00003473 mUmGmUmAmUmUmAmUmAm NO: 1201 GUAUUAUA NO: 649 ETX- iaiaUmsAmsUmUmUmCmAmGmUfCfAfC SEQ ID UAUUUCAGUCACU SEQ ID S00003477 mUmCmCmUmGmAmUmAmAm NO: 1202 CCUGAUAA NO: 650 ETX- iaiaUmsAmsAmGmCmAmAmUmAfCfAfA SEQ ID UAAGCAAUACAAA SEQ ID S00003481 mAmGmGmCmAmUmUmAmUm NO: 1203 GGCAUUAU NO: 651 ETX- iaiaAmsCmsUmCmAmCmAmUmCfGfUfC SEQ ID ACUCACAUCGUCA SEQ ID S00003485 mAmUmCmAmGmCmUmGmGm NO: 1204 UCAGCUGG NO: 652 ETX- iaiaCmsCmsGmCmCmUmAmCmUfUfCfG SEQ ID CCGCCUACUUCGG SEQ ID S00003489 mGmUmAmUmCmUmAmUmGm NO: 1205 UAUCUAUG NO: 653 ETX- iaiaCmsAmsCmAmUmCmGmUmCfAfUfC SEQ ID CACAUCGUCAUCA SEQ ID S00003493 mAmGmCmUmGmGmAmUmGm NO: 1206 GCUGGAUG NO: 654 ETX- iaiaGmsCmsCmUmAmCmUmUmCfGfGfU SEQ ID GCCUACUUCGGUA SEQ ID S00003497 mAmUmCmUmAmUmGmAmCm NO: 1207 UCUAUGAC NO: 655 ETX- iaiaUmsUmsUmAmAmCmGmUmGfUfCfU SEQ ID UUUAACGUGUCUG SEQ ID S00003501 mGmUmGmCmAmGmGmGmUm NO: 1208 UGCAGGGU NO: 656 ETX- iaiaUmsCmsGmCmCmGmCmCmGfCfAfU SEQ ID UCGCCGCCGCAUG SEQ ID S00003505 mGmAmUmGmAmUmGmCmAm NO: 1209 AUGAUGCA NO: 657 ETX- iaiaCmsAmsUmUmAmUmAmGmAfCfUfG SEQ ID CAUUAUAGACUGC SEQ ID S00003509 mCmGmUmGmGmUmCmCmGm NO: 1210 GUGGUCCG NO: 658 ETX- iaiaUmsGmsCmGmUmGmGmUmCfCfGfU SEQ ID UGCGUGGUCCGUA SEQ ID S00003513 mAmUmUmCmCmCmAmAmGm NO: 1211 UUCCCAAG NO: 659 ETX- iaiaAmsUmsCmUmAmCmCmGmAfGfCfC SEQ ID AUCUACCGAGCCG SEQ ID S00003517 mGmCmCmUmAmCmUmUmCm NO: 1212 CCUACUUC NO: 660 ETX- iaiaUmsUmsGmCmCmCmGmUmAfCfCfC SEQ ID UUGCCCGUACCCG SEQ ID S00003521 mGmUmCmUmAmGmCmAmGm NO: 1213 UCUAGCAG NO: 661 ETX- iaiaCmsUmsCmAmCmAmUmCmGfUfCfA SEQ ID CUCACAUCGUCAU SEQ ID S00003525 mUmCmAmGmCmUmGmGmAm NO: 1214 CAGCUGGA NO: 662 ETX- iaiaUmsAmsUmAmGmAmCmUmGfCfGfU SEQ ID UAUAGACUGCGUG SEQ ID S00003529 mGmGmUmCmCmGmUmAmUm NO: 1215 GUCCGUAU NO: 663 ETX- iaiaGmsGmsCmCmUmCmGmGmUfGfAfC SEQ ID GGCCUCGGUGACU SEQ ID S00003533 mUmGmCmCmUmGmGmUmUm NO: 1216 GCCUGGUU NO: 664 ETX- iaiaGmsGmsAmUmGmAmUmCmGfCfAfC SEQ ID GGAUGAUCGCACA SEQ ID S00003537 mAmGmAmCmUmGmUmCmAm NO: 1217 GACUGUCA NO: 665 ETX- iaiaGmsAmsUmUmUmUmGmCmCfCfGfU SEQ ID GAUUUUGCCCGUA SEQ ID S00003541 mAmCmCmCmGmUmCmUmAm NO: 1218 CCCGUCUA NO: 666 ETX- iaiaGmsAmsUmCmGmCmAmCmAfGfAfC SEQ ID GAUCGCACAGACU SEQ ID S00003545 mUmGmUmCmAmCmUmGmCm NO: 1219 GUCACUGC NO: 667 ETX- iaiaAmsUmsGmAmUmCmGmCmAfCfAfG SEQ ID AUGAUCGCACAGA SEQ ID S00003549 mAmCmUmGmUmCmAmCmUm NO: 1220 CUGUCACU NO: 668 ETX- iaiaUmsUmsUmUmGmCmCmCmGfUfAfC SEQ ID UUUUGCCCGUACC SEQ ID S00003553 mCmCmGmUmCmUmAmGmCm NO: 1221 CGUCUAGC NO: 669 ETX- iaiaUmsCmsAmUmCmUmAmCmCfGfAfG SEQ ID UCAUCUACCGAGC SEQ ID S00003557 mCmCmGmCmCmUmAmCmUm NO: 1222 CGCCUACU NO: 670 ETX- iaiaUmsAmsGmAmCmUmGmCmGfUfGfG SEQ ID UAGACUGCGUGGU SEQ ID S00003561 mUmCmCmGmUmAmUmUmCm NO: 1223 CCGUAUUC NO: 671 ETX- iaiaCmsUmsGmCmAmGmAmUmAfAfGfC SEQ ID CUGCAGAUAAGCA SEQ ID S00003565 mAmAmUmAmCmAmAmAmGm NO: 1224 AUACAAAG NO: 672 ETX- iaiaAmsCmsUmGmCmAmGmAmUfAfAfG SEQ ID ACUGCAGAUAAGC SEQ ID S00003569 mCmAmAmUmAmCmAmAmAm NO: 1225 AAUACAAA NO: 673 ETX- iaiaCmsAmsCmUmGmCmAmGmAfUfAfA SEQ ID CACUGCAGAUAAG SEQ ID S00003573 mGmCmAmAmUmAmCmAmAm NO: 1226 CAAUACAA NO: 674 ETX- iaiaGmsCmsAmAmGmCmAmGmAfUfCfA SEQ ID GCAAGCAGAUCAC SEQ ID S00003577 mCmUmGmCmAmGmAmUmAm NO: 1227 UGCAGAUA NO: 675 ETX- iaiaAmsUmsCmAmCmUmGmCmAfGfAfU SEQ ID AUCACUGCAGAUA SEQ ID S00003581 mAmAmGmCmAmAmUmAmCm NO: 1228 AGCAAUAC NO: 676 ETX- iaiaUmsCmsAmCmUmGmCmAmGfAfUfA SEQ ID UCACUGCAGAUAA SEQ ID S00003585 mAmGmCmAmAmUmAmCmAm NO: 1229 GCAAUACA NO: 677 ETX- iaiaGmsCmsAmGmAmUmCmAmCfUfGfC SEQ ID GCAGAUCACUGCA SEQ ID S00003589 mAmGmAmUmAmAmGmCmAm NO: 1230 GAUAAGCA NO: 678 ETX- iaiaCmsAmsGmAmUmCmAmCmUfGfCfA SEQ ID CAGAUCACUGCAG SEQ ID S00003593 mGmAmUmAmAmGmCmAmAm NO: 1231 AUAAGCAA NO: 679 ETX- iaiaAmsGmsCmAmAmGmCmAmGfAfUfC SEQ ID AGCAAGCAGAUCA SEQ ID S00003597 mAmCmUmGmCmAmGmAmUm NO: 1232 CUGCAGAU NO: 680 ETX- iaiaGmsAmsUmCmAmCmUmGmCfAfGfA SEQ ID GAUCACUGCAGAU SEQ ID S00003601 mUmAmAmGmCmAmAmUmAm NO: 1233 AAGCAAUA NO: 681 ETX- iaiaAmsUmsAmAmAmUmAmAmCfAfAfA SEQ ID AUAAAUAACAAAU SEQ ID S00003605 mUmUmUmGmGmAmGmAmAm NO: 1234 UUGGAGAA NO: 682 ETX- iaiaUmsCmsCmUmGmAmUmAmAfAfUfA SEQ ID UCCUGAUAAAUAA SEQ ID S00003609 mAmCmAmAmAmUmUmUmGm NO: 1235 CAAAUUUG NO: 683 ETX- iaiaGmsAmsAmAmGmGmGmAmAfUfUfC SEQ ID GAAAGGGAAUUCC SEQ ID S00003613 mCmGmAmGmGmCmCmUmCm NO: 1236 GAGGCCUC NO: 684 ETX- iaiaGmsUmsUmGmUmAmUmUmAfUfAf SEQ ID GUUGUAUUAUAUA SEQ ID S00003617 UmAmAmCmAmUmAmUmCmUm NO: 1237 ACAUAUCU NO: 685 ETX- iaiaUmsUmsCmCmGmAmGmGmCfCfUfC SEQ ID UUCCGAGGCCUCG SEQ ID S00003621 mGmGmUmGmAmCmUmGmCm NO: 1238 GUGACUGC NO: 686 ETX- iaiaAmsAmsAmGmGmGmAmAmUfUfCfC SEQ ID AAAGGGAAUUCCG SEQ ID S00003625 mGmAmGmGmCmCmUmCmGm NO: 1239 AGGCCUCG NO: 687 ETX- iaiaUmsGmsUmAmUmUmAmUmAfUfAf SEQ ID UGUAUUAUAUAAC SEQ ID S00003629 AmCmAmUmAmUmCmUmUmGm NO: 1240 AUAUCUUG NO: 688 ETX- iaiaAmsAmsUmUmCmCmGmAmGfGfCfC SEQ ID AAUUCCGAGGCCU SEQ ID S00003633 mUmCmGmGmUmGmAmCmUm NO: 1241 CGGUGACU NO: 689 ETX- iaiaGmsGmsGmAmAmUmUmCmCfGfAfG SEQ ID GGGAAUUCCGAGG SEQ ID S00003637 mGmCmCmUmCmGmGmUmGm NO: 1242 CCUCGGUG NO: 690 ETX- iaiaAmsGmsCmUmGmAmAmAmGfGfGfA SEQ ID AGCUGAAAGGGAA SEQ ID S00003641 mAmUmUmCmCmGmAmGmGm NO: 1243 UUCCGAGG NO: 691 ETX- iaiaGmsGmsAmGmCmUmGmAmAfAfGfG SEQ ID GGAGCUGAAAGGG SEQ ID S00003645 mGmAmAmUmUmCmCmGmAm NO: 1244 AAUUCCGA NO: 692 ETX- iaiaCmsUmsGmAmAmAmGmGmGfAfAfU SEQ ID CUGAAAGGGAAUU SEQ ID S00003649 mUmCmCmGmAmGmGmCmCm NO: 1245 CCGAGGCC NO: 693 ETX- iaiaGmsAmsGmCmUmGmAmAmAfGfGfG SEQ ID GAGCUGAAAGGGA SEQ ID S00003653 mAmAmUmUmCmCmGmAmGm NO: 1246 AUUCCGAG NO: 694 ETX- iaiaGmsCmsUmGmAmAmAmGmGfGfAfA SEQ ID GCUGAAAGGGAAU SEQ ID S00003657 mUmUmCmCmGmAmGmGmCm NO: 1247 UCCGAGGC NO: 695 ETX- iaiaGmsCmsAmUmGmUmUmGmUfAfUfU SEQ ID GCAUGUUGUAUUA SEQ ID S00003661 mAmUmAmUmAmAmCmAmUm NO: 1248 UAUAACAU NO: 696 ETX- iaiaUmsUmsGmUmAmUmUmAmUfAfUf SEQ ID UUGUAUUAUAUAA SEQ ID S00003665 AmAmCmAmUmAmUmCmUmUm NO: 1249 CAUAUCUU NO: 697 ETX- iaiaGmsUmsAmUmUmAmUmAmUfAfAfC SEQ ID GUAUUAUAUAACA SEQ ID S00003669 mAmUmAmUmCmUmUmGmAm NO: 1250 UAUCUUGA NO: 698 ETX- iaiaGmsGmsCmAmUmGmUmUmGfUfAfU SEQ ID GGCAUGUUGUAUU SEQ ID S00003673 mUmAmUmAmUmAmAmCmAm NO: 1251 AUAUAACA NO: 699 ETX- iaiaAmsAmsGmGmGmAmAmUmUfCfCfG SEQ ID AAGGGAAUUCCGA SEQ ID S00003677 mAmGmGmCmCmUmCmGmGm NO: 1252 GGCCUCGG NO: 700 ETX- iaiaGmsAmsAmUmUmCmCmGmAfGfGfC SEQ ID GAAUUCCGAGGCC SEQ ID S00003681 mCmUmCmGmGmUmGmAmCm NO: 1253 UCGGUGAC NO: 701 ETX- iaiaAmsGmsGmGmAmAmUmUmCfCfGfA SEQ ID AGGGAAUUCCGAG SEQ ID S00003685 mGmGmCmCmUmCmGmGmUm NO: 1254 GCCUCGGU NO: 702 ETX- iaiaGmsGmsAmAmUmUmCmCmGfAfGfG SEQ ID GGAAUUCCGAGGC SEQ ID S00003689 mCmCmUmCmGmGmUmGmAm NO: 1255 CUCGGUGA NO: 703 ETX- iaiaGmsCmsUmUmGmUmCmUmUfGfUfA SEQ ID GCUUGUCUUGUAU SEQ ID S00003693 mUmGmAmUmGmAmAmAmUm NO: 1256 GAUGAAAU NO: 704 ETX- iaiaUmsCmsGmCmCmUmUmCmAfAfAfG SEQ ID UCGCCUUCAAAGA SEQ ID S00003697 mAmUmAmAmAmUmAmCmAm NO: 1257 UAAAUACA NO: 705 ETX- iaiaGmsCmsCmUmGmGmUmUmAfAfGfA SEQ ID GCCUGGUUAAGAU SEQ ID S00003701 mUmCmUmAmCmAmAmAmUm NO: 1258 CUACAAAU NO: 706 ETX- iaiaUmsCmsUmAmUmGmAmCmAfCfUfG SEQ ID UCUAUGACACUGC SEQ ID S00003705 mCmAmAmAmGmGmGmAmAm NO: 1259 AAAGGGAA NO: 707 ETX- iaiaUmsUmsUmGmUmGmCmUmUfGfUfC SEQ ID UUUGUGCUUGUCU SEQ ID S00003709 mUmUmGmUmAmUmGmAmUm NO: 1260 UGUAUGAU NO: 708 ETX- iaiaUmsGmsAmCmUmGmCmCmUfGfGfU SEQ ID UGACUGCCUGGUU SEQ ID S00003713 mUmAmAmGmAmUmCmUmAm NO: 1261 AAGAUCUA NO: 709 ETX- iaiaGmsAmsCmAmCmUmGmCmAfAfAfG SEQ ID GACACUGCAAAGG SEQ ID S00003717 mGmGmAmAmUmGmCmUmUm NO: 1262 GAAUGCUU NO: 710 ETX- iaiaCmsGmsGmUmAmUmCmUmAfUfGfA SEQ ID CGGUAUCUAUGAC SEQ ID S00003721 mCmAmCmUmGmCmAmAmAm NO: 1263 ACUGCAAA NO: 711 ETX- iaiaUmsUmsCmAmUmCmUmGmAfCfCfA SEQ ID UUCAUCUGACCAG SEQ ID S00003725 mGmUmUmUmUmCmUmCmUm NO: 1264 UUUUCUCU NO: 712 ETX- iaiaUmsUmsCmGmGmUmAmUmCfUfAfU SEQ ID UUCGGUAUCUAUG SEQ ID S00003729 mGmAmCmAmCmUmGmCmAm NO: 1265 ACACUGCA NO: 713 ETX- iaiaGmsGmsUmUmAmAmGmAmUfCfUfA SEQ ID GGUUAAGAUCUAC SEQ ID S00003733 mCmAmAmAmUmCmUmGmAm NO: 1266 AAAUCUGA NO: 714 ETX- iaiaAmsGmsGmGmUmGmCmAmUfGfGfU SEQ ID AGGGUGCAUGGUC SEQ ID S00003741 mCmCmAmAmUmGmUmUmCm NO: 1268 CAAUGUUC NO: 716 ETX- iaiaAmsUmsCmUmAmCmAmAmAfUfCfU SEQ ID AUCUACAAAUCUG SEQ ID S00003745 mGmAmUmGmGmGmAmUmUm NO: 1269 AUGGGAUU NO: 717 ETX- iaiaCmsUmsUmCmGmGmUmAmUfCfUfA SEQ ID CUUCGGUAUCUAU SEQ ID S00003749 mUmGmAmCmAmCmUmGmCm NO: 1270 GACACUGC NO: 718 ETX- iaiaUmsGmsGmGmUmGmGmUmGfCfUfU SEQ ID UGGGUGGUGCUUU SEQ ID S00003753 mUmUmGmUmGmCmUmUmGm NO: 1271 UGUGCUUG NO: 719 ETX- iaiaUmsAmsUmUmAmUmCmAmUfCfUfA SEQ ID UAUUAUCAUCUAC SEQ ID S00003757 mCmCmGmAmGmCmCmGmCm NO: 1272 CGAGCCGC NO: 720 ETX- iaiaGmsUmsGmGmUmCmCmGmUfAfUfU SEQ ID GUGGUCCGUAUUC SEQ ID S00003761 mCmCmCmAmAmGmGmAmGm NO: 1273 CCAAGGAG NO: 721 ETX- iaiaCmsUmsAmUmGmAmCmAmCfUfGfC SEQ ID CUAUGACACUGCA SEQ ID S00003765 mAmAmAmGmGmGmAmAmUm NO: 1274 AAGGGAAU NO: 722 ETX- iaiaCmsUmsUmUmUmGmUmGmCfUfUfG SEQ ID CUUUUGUGCUUGU SEQ ID S00003769 mUmCmUmUmGmUmAmUmGm NO: 1275 CUUGUAUG NO: 723 ETX- iaiaUmsAmsCmCmAmAmGmGmCfUfUfU SEQ ID UACCAAGGCUUUA SEQ ID S00003773 mAmAmCmGmUmGmUmCmUm NO: 1276 ACGUGUCU NO: 724 ETX- iaiaGmsUmsGmCmAmUmGmGmUfCfCfA SEQ ID GUGCAUGGUCCAA SEQ ID S00003777 mAmUmGmUmUmCmUmCmAm NO: 1277 UGUUCUCA NO: 725 ETX- iaiaCmsCmsUmUmCmAmAmAmGfAfUfA SEQ ID CCUUCAAAGAUAA SEQ ID S00003781 mAmAmUmAmCmAmAmGmCm NO: 1278 AUACAAGC NO: 726 ETX- iaiaGmsGmsGmUmAmUmUmAmUfCfAfU SEQ ID GGGUAUUAUCAUC SEQ ID S00003785 mCmUmAmCmCmGmAmGmCm NO: 1279 UACCGAGC NO: 727 ETX- iaiaUmsAmsCmUmUmCmGmGmUfAfUfC SEQ ID UACUUCGGUAUCU SEQ ID S00003789 mUmAmUmGmAmCmAmCmUm NO: 1280 AUGACACU NO: 728 ETX- iaiaUmsGmsCmAmGmGmGmUmAfUfUfA SEQ ID UGCAGGGUAUUAU SEQ ID S00003797 mUmCmAmUmCmUmAmCmCm NO: 1282 CAUCUACC NO: 730 ETX- iaiaUmsCmsUmGmAmUmGmGmGfAfUfU SEQ ID UCUGAUGGGAUUA SEQ ID S00003801 mAmAmGmGmGmCmCmUmGm NO: 1283 AGGGCCUG NO: 731 ETX- iaiaCmsUmsGmUmGmCmAmGmGfGfUfA SEQ ID CUGUGCAGGGUAU SEQ ID S00003805 mUmUmAmUmCmAmUmCmUm NO: 1284 UAUCAUCU NO: 732 ETX- iaiaUmsGmsAmUmGmGmGmAmUfUfAf SEQ ID UGAUGGGAUUAAG SEQ ID S00003809 AmGmGmGmCmCmUmGmUmAm NO: 1285 GGCCUGUA NO: 733 ETX- iaiaCmsCmsAmAmGmGmCmUmUfUfAfA SEQ ID CCAAGGCUUUAAC SEQ ID S00003813 mCmGmUmGmUmCmUmGmUm NO: 1286 GUGUCUGU NO: 734 ETX- iaiaUmsAmsUmUmCmAmUmCmUfGfAfC SEQ ID UAUUCAUCUGACC SEQ ID S00003817 mCmAmGmUmUmUmUmCmUm NO: 1287 AGUUUUCU NO: 735 ETX- iaiaAmsCmsUmGmCmCmUmGmGfUfUfA SEQ ID ACUGCCUGGUUAA SEQ ID S00003821 mAmGmAmUmCmUmAmCmAm NO: 1288 GAUCUACA NO: 736 ETX- iaiaGmsUmsUmGmAmCmUmUmCfCfUfA SEQ ID GUUGACUUCCUAU SEQ ID S00003825 mUmCmCmAmUmUmUmGmAm NO: 1289 CCAUUUGA NO: 737 ETX- iaiaUmsAmsUmGmAmCmAmCmUfGfCfA SEQ ID UAUGACACUGCAA SEQ ID S00003829 mAmAmGmGmGmAmAmUmGm NO: 1290 AGGGAAUG NO: 738 ETX- iaiaUmsUmsAmAmGmAmUmCmUfAfCfA SEQ ID UUAAGAUCUACAA SEQ ID S00003833 mAmAmUmCmUmGmAmUmGm NO: 1291 AUCUGAUG NO: 739 ETX- iaiaAmsGmsGmGmUmAmUmUmAfUfCfA SEQ ID AGGGUAUUAUCAU SEQ ID S00003837 mUmCmUmAmCmCmGmAmGm NO: 1292 CUACCGAG NO: 740 ETX- iaiaUmsGmsCmCmUmGmGmUmUfAfAfG SEQ ID UGCCUGGUUAAGA SEQ ID S00003841 mAmUmCmUmAmCmAmAmAm NO: 1293 UCUACAAA NO: 741 ETX- iaiaCmsUmsGmAmUmGmGmGmAfUfUfA SEQ ID CUGAUGGGAUUAA SEQ ID S00003845 mAmGmGmGmCmCmUmGmUm NO: 1294 GGGCCUGU NO: 742 ETX- iaiaGmsGmsUmAmUmCmUmAmUfGfAfC SEQ ID GGUAUCUAUGACA SEQ ID S00003849 mAmCmUmGmCmAmAmAmGm NO: 1295 CUGCAAAG NO: 743 ETX- iaiaAmsCmsCmCmGmUmCmUmAfGfCfA SEQ ID ACCCGUCUAGCAG SEQ ID S00003853 mGmCmUmGmAmUmGmUmGm NO: 1296 CUGAUGUG NO: 744 ETX- iaiaUmsAmsUmCmUmAmUmGmAfCfAfC SEQ ID UAUCUAUGACACU SEQ ID S00003857 mUmGmCmAmAmAmGmGmGm NO: 1297 GCAAAGGG NO: 745 ETX- iaiaCmsUmsGmAmUmGmUmGmGfGfUfA SEQ ID CUGAUGUGGGUAA SEQ ID S00003861 mAmAmGmCmUmGmGmAmGm NO: 1298 AGCUGGAG NO: 746 ETX- iaiaUmsCmsUmAmGmCmAmGmCfUfGfA SEQ ID UCUAGCAGCUGAU SEQ ID S00003865 mUmGmUmGmGmGmUmAmAm NO: 1299 GUGGGUAA NO: 747 ETX- iaiaGmsGmsGmCmCmUmGmUmAfCfCfA SEQ ID GGGCCUGUACCAA SEQ ID S00003869 mAmGmGmCmUmUmUmAmAm NO: 1300 GGCUUUAA NO: 748 ETX- iaiaCmsCmsCmGmUmAmCmCmCfGfUfC SEQ ID CCCGUACCCGUCU SEQ ID S00003873 mUmAmGmCmAmGmCmUmGm NO: 1301 AGCAGCUG NO: 749 ETX- iaiaCmsAmsGmCmUmGmAmUmGfUfGfG SEQ ID CAGCUGAUGUGGG SEQ ID S00003877 mGmUmAmAmAmGmCmUmGm NO: 1302 UAAAGCUG NO: 750 ETX- iaiaCmsCmsGmUmAmCmCmCmGfUfCfU SEQ ID CCGUACCCGUCUA SEQ ID S00003881 mAmGmCmAmGmCmUmGmAm NO: 1303 GCAGCUGA NO: 751 ETX- iaiaGmsCmsUmGmAmUmGmUmGfGfGfU SEQ ID GCUGAUGUGGGUA SEQ ID S00003885 mAmAmAmGmCmUmGmGmAm NO: 1304 AAGCUGGA NO: 752 ETX- iaiaGmsGmsUmAmUmUmAmUmCfAfUfC SEQ ID GGUAUUAUCAUCU SEQ ID S00003889 mUmAmCmCmGmAmGmCmCm NO: 1305 ACCGAGCC NO: 753 ETX- iaiaUmsUmsAmUmCmAmUmCmUfAfCfC SEQ ID UUAUCAUCUACCG SEQ ID S00003893 mGmAmGmCmCmGmCmCmUm NO: 1306 AGCCGCCU NO: 754 ETX- iaiaGmsUmsAmCmCmCmGmUmCfUfAfG SEQ ID GUACCCGUCUAGC SEQ ID S00003897 mCmAmGmCmUmGmAmUmGm NO: 1307 AGCUGAUG NO: 755 ETX- iaiaGmsAmsUmGmGmGmAmUmUfAfAf SEQ ID GAUGGGAUUAAGG SEQ ID S00003901 GmGmGmCmCmUmGmUmAmCm NO: 1308 GCCUGUAC NO: 756 ETX- iaiaGmsUmsCmUmGmUmGmCmAfGfGfG SEQ ID GUCUGUGCAGGGU SEQ ID S00003905 mUmAmUmUmAmUmCmAmUm NO: 1309 AUUAUCAU NO: 757 ETX- iaiaGmsCmsGmUmGmGmUmCmCfGfUfA SEQ ID GCGUGGUCCGUAU SEQ ID S00003909 mUmUmCmCmCmAmAmGmGm NO: 1310 UCCCAAGG NO: 758 ETX- iaiaCmsGmsUmGmGmUmCmCmGfUfAfU SEQ ID CGUGGUCCGUAUU SEQ ID S00003913 mUmCmCmCmAmAmGmGmAm NO: 1311 CCCAAGGA NO: 759 ETX- iaiaUmsGmsGmUmUmAmAmGmAfUfCfU SEQ ID UGGUUAAGAUCUA SEQ ID S00003917 mAmCmAmAmAmUmCmUmGm NO: 1312 CAAAUCUG NO: 760 ETX- iaiaAmsUmsGmAmUmGmAmAmAfUfCfA SEQ ID AUGAUGAAAUCAA SEQ ID S00003921 mAmGmAmAmGmUmAmCmAm NO: 1313 GAAGUACA NO: 761 ETX- iaiaGmsAmsUmCmUmAmCmAmAfAfUfC SEQ ID GAUCUACAAAUCU SEQ ID S00003925 mUmGmAmUmGmGmGmAmUm NO: 1314 GAUGGGAU NO: 762 ETX- iaiaGmsUmsGmCmAmGmGmGmUfAfUfU SEQ ID GUGCAGGGUAUUA SEQ ID S00003929 mAmUmCmAmUmCmUmAmCm NO: 1315 UCAUCUAC NO: 763 ETX- iaiaGmsUmsAmCmCmAmAmGmGfCfUfU SEQ ID GUACCAAGGCUUU SEQ ID S00003933 mUmAmAmCmGmUmGmUmCm NO: 1316 AACGUGUC NO: 764 ETX- iaiaGmsCmsAmGmCmUmGmAmUfGfUfG SEQ ID GCAGCUGAUGUGG SEQ ID S00003937 mGmGmUmAmAmAmGmCmUm NO: 1317 GUAAAGCU NO: 765 ETX- iaiaAmsUmsGmGmGmUmGmGmUfGfCfU SEQ ID AUGGGUGGUGCUU SEQ ID S00003941 mUmUmUmGmUmGmCmUmUm NO: 1318 UUGUGCUU NO: 766 ETX- iaiaCmsGmsGmUmGmAmCmUmGfCfCfU SEQ ID CGGUGACUGCCUG SEQ ID S00003945 mGmGmUmUmAmAmGmAmUm NO: 1319 GUUAAGAU NO: 767 ETX- iaiaCmsUmsAmGmCmAmGmCmUfGfAfU SEQ ID CUAGCAGCUGAUG SEQ ID S00003949 mGmUmGmGmGmUmAmAmAm NO: 1320 UGGGUAAA NO: 768 ETX- iaiaUmsAmsCmAmAmAmUmCmUfGfAfU SEQ ID UACAAAUCUGAUG SEQ ID S00003953 mGmGmGmAmUmUmAmAmGm NO: 1321 GGAUUAAG NO: 769 ETX- iaiaAmsCmsUmUmCmGmGmUmAfUfCfU SEQ ID ACUUCGGUAUCUA SEQ ID S00003957 mAmUmGmAmCmAmCmUmGm NO: 1322 UGACACUG NO: 770 ETX- iaiaAmsGmsCmUmGmAmUmGmUfGfGfG SEQ ID AGCUGAUGUGGGU SEQ ID S00003961 mUmAmAmAmGmCmUmGmGm NO: 1323 AAAGCUGG NO: 771 ETX- iaiaUmsCmsUmGmUmGmCmAmGfGfGfU SEQ ID UCUGUGCAGGGUA SEQ ID S00003969 mAmUmUmAmUmCmAmUmCm NO: 1325 UUAUCAUC NO: 773 ETX- iaiaUmsGmsCmUmUmGmUmCmUfUfGfU SEQ ID UGCUUGUCUUGUA SEQ ID S00003973 mAmUmGmAmUmGmAmAmAm NO: 1326 UGAUGAAA NO: 774 ETX- iaiaAmsCmsCmAmAmGmGmCmUfUfUfA SEQ ID ACCAAGGCUUUAA SEQ ID S00003977 mAmCmGmUmGmUmCmUmGm NO: 1327 CGUGUCUG NO: 775 ETX- iaiaGmsGmsGmUmGmCmAmUmGfGfUfC SEQ ID GGGUGCAUGGUCC SEQ ID S00003981 mCmAmAmUmGmUmUmCmUm NO: 1328 AAUGUUCU NO: 776 ETX- iaiaGmsAmsCmUmGmCmCmUmGfGfUfU SEQ ID GACUGCCUGGUUA SEQ ID S00003985 mAmAmGmAmUmCmUmAmCm NO: 1329 AGAUCUAC NO: 777 ETX- iaiaGmsAmsUmGmUmGmGmGmUfAfAf SEQ ID GAUGUGGGUAAAG SEQ ID S00003989 AmGmCmUmGmGmAmGmCmUm NO: 1330 CUGGAGCU NO: 778 ETX- iaiaUmsGmsGmUmCmCmGmUmAfUfUfC SEQ ID UGGUCCGUAUUCC SEQ ID S00003993 mCmCmAmAmGmGmAmGmCm NO: 1331 CAAGGAGC NO: 779 ETX- iaiaAmsCmsAmCmUmGmCmAmAfAfGfG SEQ ID ACACUGCAAAGGG SEQ ID S00003997 mGmAmAmUmGmCmUmUmCm NO: 1332 AAUGCUUC NO: 780 ETX- iaiaGmsAmsUmUmAmAmGmGmGfCfCfU SEQ ID GAUUAAGGGCCUG SEQ ID S00004001 mGmUmAmCmCmAmAmGmGm NO: 1333 UACCAAGG NO: 781 ETX- iaiaUmsGmsUmGmCmAmGmGmGfUfAfU SEQ ID UGUGCAGGGUAUU SEQ ID S00004005 mUmAmUmCmAmUmCmUmAm NO: 1334 AUCAUCUA NO: 782 ETX- iaiaAmsAmsCmGmUmGmUmCmUfGfUfG SEQ ID AACGUGUCUGUGC SEQ ID S00004009 mCmAmGmGmGmUmAmUmUm NO: 1335 AGGGUAUU NO: 783 ETX- iaiaGmsGmsCmCmUmGmUmAmCfCfAfA SEQ ID GGCCUGUACCAAG SEQ ID S00004013 mGmGmCmUmUmUmAmAmCm NO: 1336 GCUUUAAC NO: 784 ETX- iaiaUmsGmsAmCmAmCmUmGmCfAfAfA SEQ ID UGACACUGCAAAG SEQ ID S00004017 mGmGmGmAmAmUmGmCmUm NO: 1337 GGAAUGCU NO: 785 ETX- iaiaUmsCmsGmGmUmGmAmCmUfGfCfC SEQ ID UCGGUGACUGCCU SEQ ID S00004021 mUmGmGmUmUmAmAmGmAm NO: 1338 GGUUAAGA NO: 786 ETX- iaiaGmsCmsUmUmUmUmGmUmGfCfUfU SEQ ID GCUUUUGUGCUUG SEQ ID S00004025 mGmUmCmUmUmGmUmAmUm NO: 1339 UCUUGUAU NO: 787 ETX- iaiaGmsGmsUmGmGmUmGmCmUfUfUfU SEQ ID GGUGGUGCUUUUG SEQ ID S00004029 mGmUmGmCmUmUmGmUmCm NO: 1340 UGCUUGUC NO: 788 ETX- iaiaCmsGmsUmCmUmAmGmCmAfGfCfU SEQ ID CGUCUAGCAGCUG SEQ ID S00004033 mGmAmUmGmUmGmGmGmUm NO: 1341 AUGUGGGU NO: 789 ETX- iaiaAmsGmsGmGmCmCmUmGmUfAfCfC SEQ ID AGGGCCUGUACCA SEQ ID S00004037 mAmAmGmGmCmUmUmUmAm NO: 1342 AGGCUUUA NO: 790 ETX- iaiaGmsUmsGmCmUmUmGmUmCfUfUfG SEQ ID GUGCUUGUCUUGU SEQ ID S00004041 mUmAmUmGmAmUmGmAmAm NO: 1343 AUGAUGAA NO: 791 ETX- iaiaAmsAmsAmUmCmUmGmAmUfGfGfG SEQ ID AAAUCUGAUGGGA SEQ ID S00004045 mAmUmUmAmAmGmGmGmCm NO: 1344 UUAAGGGC NO: 792 ETX- iaiaCmsUmsAmCmAmAmAmUmCfUfGfA SEQ ID CUACAAAUCUGAU SEQ ID S00004049 mUmGmGmGmAmUmUmAmAm NO: 1345 GGGAUUAA NO: 793 ETX- iaiaCmsAmsGmGmGmUmAmUmUfAfUfC SEQ ID CAGGGUAUUAUCA SEQ ID S00004053 mAmUmCmUmAmCmCmGmAm NO: 1346 UCUACCGA NO: 794 ETX- iaiaCmsUmsGmUmAmCmCmAmAfGfGfC SEQ ID CUGUACCAAGGCU SEQ ID S00004057 mUmUmUmAmAmCmGmUmGm NO: 1347 UUAACGUG NO: 795 ETX- iaiaAmsGmsAmUmCmUmAmCmAfAfAfU SEQ ID AGAUCUACAAAUC SEQ ID S00004061 mCmUmGmAmUmGmGmGmAm NO: 1348 UGAUGGGA NO: 796 ETX- iaiaUmsUmsUmUmGmUmGmCmUfUfGfU SEQ ID UUUUGUGCUUGUC SEQ ID S00004065 mCmUmUmGmUmAmUmGmAm NO: 1349 UUGUAUGA NO: 797 ETX- iaiaAmsCmsAmAmAmUmCmUmGfAfUfG SEQ ID ACAAAUCUGAUGG SEQ ID S00004069 mGmGmAmUmUmAmAmGmGm NO: 1350 GAUUAAGG NO: 798 ETX- iaiaCmsAmsAmGmGmGmUmGmCfAfUfG SEQ ID CAAGGGUGCAUGG SEQ ID S00004073 mGmUmCmCmAmAmUmGmUm NO: 1351 UCCAAUGU NO: 799 ETX- iaiaGmsGmsAmUmUmAmAmGmGfGfCfC SEQ ID GGAUUAAGGGCCU SEQ ID S00004077 mUmGmUmAmCmCmAmAmGm NO: 1352 GUACCAAG NO: 800 ETX- iaiaUmsCmsGmGmUmAmUmCmUfAfUfG SEQ ID UCGGUAUCUAUGA SEQ ID S00004081 mAmCmAmCmUmGmCmAmAm NO: 1353 CACUGCAA NO: 801 ETX- iaiaCmsAmsAmGmGmCmUmUmUfAfAfC SEQ ID CAAGGCUUUAACG SEQ ID S00004085 mGmUmGmUmCmUmGmUmGm NO: 1354 UGUCUGUG NO: 802 ETX- iaiaCmsAmsUmGmGmGmUmGmGfUfGfC SEQ ID CAUGGGUGGUGCU SEQ ID S00004089 mUmUmUmUmGmUmGmCmUm NO: 1355 UUUGUGCU NO: 803 ETX- iaiaUmsAmsAmGmAmUmCmUmAfCfAfA SEQ ID UAAGAUCUACAAA SEQ ID S00004093 mAmUmCmUmGmAmUmGmGm NO: 1356 UCUGAUGG NO: 804 ETX- iaiaCmsCmsCmGmUmCmUmAmGfCfAfG SEQ ID CCCGUCUAGCAGC SEQ ID S00004097 mCmUmGmAmUmGmUmGmGm NO: 1357 UGAUGUGG NO: 805 ETX- iaiaAmsUmsGmAmCmAmCmUmGfCfAfA SEQ ID AUGACACUGCAAA SEQ ID S00004101 mAmGmGmGmAmAmUmGmCm NO: 1358 GGGAAUGC NO: 806 ETX- iaiaUmsAmsGmCmAmGmCmUmGfAfUfG SEQ ID UAGCAGCUGAUGU SEQ ID S00004105 mUmGmGmGmUmAmAmAmGm NO: 1359 GGGUAAAG NO: 807 ETX- iaiaGmsCmsAmAmAmGmGmGmAfAfUfG SEQ ID GCAAAGGGAAUGC SEQ ID S00004109 mCmUmUmCmCmGmGmAmUm NO: 1360 UUCCGGAU NO: 808 ETX- iaiaGmsCmsCmCmGmUmAmCmCfCfGfU SEQ ID GCCCGUACCCGUC SEQ ID S00004113 mCmUmAmGmCmAmGmCmUm NO: 1361 UAGCAGCU NO: 809 ETX- iaiaGmsUmsAmUmUmAmUmCmAfUfCfU SEQ ID GUAUUAUCAUCUA SEQ ID S00004117 mAmCmCmGmAmGmCmCmGm NO: 1362 CCGAGCCG NO: 810 ETX- iaiaCmsUmsCmUmUmGmAmUmUfUfUfG SEQ ID CUCUUGAUUUUGC SEQ ID S00004121 mCmCmCmGmUmAmCmCmCm NO: 1363 CCGUACCC NO: 811 ETX- iaiaUmsAmsCmCmCmGmUmCmUfAfGfC SEQ ID UACCCGUCUAGCA SEQ ID S00004125 mAmGmCmUmGmAmUmGmUm NO: 1364 GCUGAUGU NO: 812 ETX- iaiaCmsAmsAmAmUmCmUmGmAfUfGfG SEQ ID CAAAUCUGAUGGG SEQ ID S00004129 mGmAmUmUmAmAmGmGmGm NO: 1365 AUUAAGGG NO: 813 ETX- iaiaGmsUmsAmCmCmCmUmCmUfUfGfA SEQ ID GUACCCUCUUGAU SEQ ID S00004133 mUmUmUmUmGmCmCmCmGm NO: 1366 UUUGCCCG NO: 814 ETX- iaiaCmsCmsUmGmUmAmCmCmAfAfGfG SEQ ID CCUGUACCAAGGC SEQ ID S00004137 mCmUmUmUmAmAmCmGmUm NO: 1367 UUUAACGU NO: 815 ETX- iaiaUmsGmsGmGmAmUmUmAmAfGfGf SEQ ID UGGGAUUAAGGGC SEQ ID S00004141 GmCmCmUmGmUmAmCmCmAm NO: 1368 CUGUACCA NO: 816 ETX- iaiaAmsUmsUmAmUmCmAmUmCfUfAfC SEQ ID AUUAUCAUCUACC SEQ ID S00004145 mCmGmAmGmCmCmGmCmCm NO: 1369 GAGCCGCC NO: 817 ETX- iaiaGmsCmsCmUmGmUmAmCmCfAfAfG SEQ ID GCCUGUACCAAGG SEQ ID S00004149 mGmCmUmUmUmAmAmCmGm NO: 1370 CUUUAACG NO: 818 ETX- iaiaAmsUmsGmGmGmAmUmUmAfAfGf SEQ ID AUGGGAUUAAGGG SEQ ID S00004153 GmGmCmCmUmGmUmAmCmCm NO: 1371 CCUGUACC NO: 819 ETX- iaiaAmsCmsGmUmGmUmCmUmGfUfGfC SEQ ID ACGUGUCUGUGCA SEQ ID S00004157 mAmGmGmGmUmAmUmUmAm NO: 1372 GGGUAUUA NO: 820 ETX- iaiaGmsGmsCmAmUmUmAmUmAfGfAfC SEQ ID GGCAUUAUAGACU SEQ ID S00004161 mUmGmCmGmUmGmGmUmCm NO: 1373 GCGUGGUC NO: 821 ETX- iaiaUmsUmsCmCmCmCmAmCmCfCfAfG SEQ ID UUCCCCACCCAGG SEQ ID S00004165 mGmCmUmCmUmUmAmAmCm NO: 1374 CUCUUAAC NO: 822 ETX- iaiaAmsUmsGmUmCmAmUmCmAfGfAfU SEQ ID AUGUCAUCAGAUA SEQ ID S00004169 mAmCmUmUmCmCmCmCmAm NO: 1375 CUUCCCCA NO: 823 ETX- iaiaGmsUmsCmAmUmCmAmGmAfUfAfC SEQ ID GUCAUCAGAUACU SEQ ID S00004173 mUmUmCmCmCmCmAmCmCm NO: 1376 UCCCCACC NO: 824 ETX- iaiaUmsGmsUmCmAmUmCmAmGfAfUfA SEQ ID UGUCAUCAGAUAC SEQ ID S00004177 mCmUmUmCmCmCmCmAmCm NO: 1377 UUCCCCAC NO: 825 ETX- iaiaAmsAmsUmGmUmCmAmUmCfAfGfA SEQ ID AAUGUCAUCAGAU SEQ ID S00004181 mUmAmCmUmUmCmCmCmCm NO: 1378 ACUUCCCC NO: 826 ETX- iaiaCmsUmsUmCmCmCmCmAmCfCfCfA SEQ ID CUUCCCCACCCAG SEQ ID S00004185 mGmGmCmUmCmUmUmAmAm NO: 1379 GCUCUUAA NO: 827 ETX- iaiaCmsUmsAmCmCmGmAmGmCfCfGfC SEQ ID CUACCGAGCCGCC SEQ ID S00004189 mCmUmAmCmUmUmCmGmGm NO: 1380 UACUUCGG NO: 828 As used herein, and in particular in Tables 3 and 4, the following abbreviations are used for modified nucleosides: A – adenosine C – cytidine G – guanosine T – thymidine m – 2’-O-methyl f – 2’fluro s – phosphorothioate bond o - thermally destabilised nucleoside ia - inverted abasic nucleoside Am stands for 2'-O-methyl-adenosine, Cm stands for 2'-O-methyl-cytidine, Gm stands for 2'-O-methyl- guanosine, Um stands for 2'-O-methyl-uridine, Af stands for 2'-Fluoro-adenosine, Cf stands for 2'-Fluoro- cytidine, Gf stands for 2'-Fluoro-guanosine and Uf stands for 2'-Fluoro-uridine. Furthermore, the letter “s” is used as abbreviation for a phosphorothioate linkage between two consecutive (modified) nucleosides. For example, the abbreviation “AmsAm” is used for two consecutive 2'-O-methyl- adenosine nucleosides that are linked via a 3’5’ phosphorothioate linkage. No abbreviation is used for nucleosides that are linked via a standard 3’5’ phosphodiester linkage. For example, the abbreviation “AmAm” is used for two consecutive 2'-O-methyl-adenosine nucleosides that are linked via a 3’5’ phosphodiester linkage. Some of the modified second strand sequences as illustrated above in Table 4 include the preferred 5’ iaia motif. However, it should also be understood that the scope of these modified second strand sequences additionally includes the Me / F modified second strand in the absence of the 5’iaia motif. In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO: 829-1104; and a second strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:1105-1380. Preferred combinations of complementary modified antisense (first) and sense (second) strands are listed below in Table 5. Table 5 identifies duplexes with Duplex IDs referencing the modified antisense and sense IDs from previous Tables 3 and 4. Table 5 Duplex ID First (Antisense) strand ID Second (Sense) strand ID ETX-M00001351 ETX-S00003090 ETX-S00003089 ETX-M00001352 ETX-S00003094 ETX-S00003093 ETX-M00001353 ETX-S00003098 ETX-S00003097 ETX-M00001354 ETX-S00003102 ETX-S00003101 ETX-M00001355 ETX-S00003106 ETX-S00003105 ETX-M00001356 ETX-S00003110 ETX-S00003109 ETX-M00001357 ETX-S00003114 ETX-S00003113 ETX-M00001358 ETX-S00003118 ETX-S00003117 ETX-M00001359 ETX-S00003122 ETX-S00003121 ETX-M00001360 ETX-S00003126 ETX-S00003125 ETX-M00001361 ETX-S00003130 ETX-S00003129 ETX-M00001362 ETX-S00003134 ETX-S00003133 ETX-M00001363 ETX-S00003138 ETX-S00003137 ETX-M00001364 ETX-S00003142 ETX-S00003141 ETX-M00001365 ETX-S00003146 ETX-S00003145 ETX-M00001366 ETX-S00003150 ETX-S00003149 ETX-M00001367 ETX-S00003154 ETX-S00003153 ETX-M00001368 ETX-S00003158 ETX-S00003157 ETX-M00001369 ETX-S00003162 ETX-S00003161 ETX-M00001370 ETX-S00003166 ETX-S00003165 ETX-M00001371 ETX-S00003170 ETX-S00003169 ETX-M00001372 ETX-S00003174 ETX-S00003173 ETX-M00001373 ETX-S00003178 ETX-S00003177 ETX-M00001374 ETX-S00003182 ETX-S00003181 ETX-M00001375 ETX-S00003186 ETX-S00003185 ETX-M00001376 ETX-S00003190 ETX-S00003189 ETX-M00001377 ETX-S00003194 ETX-S00003193 ETX-M00001378 ETX-S00003198 ETX-S00003197 ETX-M00001379 ETX-S00003202 ETX-S00003201 ETX-M00001380 ETX-S00003206 ETX-S00003205 ETX-M00001381 ETX-S00003210 ETX-S00003209 ETX-M00001382 ETX-S00003214 ETX-S00003213 ETX-M00001383 ETX-S00003218 ETX-S00003217 ETX-M00001384 ETX-S00003222 ETX-S00003221 ETX-M00001385 ETX-S00003226 ETX-S00003225 ETX-M00001386 ETX-S00003230 ETX-S00003229 ETX-M00001387 ETX-S00003234 ETX-S00003233 ETX-M00001388 ETX-S00003238 ETX-S00003237 ETX-M00001389 ETX-S00003242 ETX-S00003241 ETX-M00001390 ETX-S00003246 ETX-S00003245 ETX-M00001391 ETX-S00003250 ETX-S00003249 ETX-M00001392 ETX-S00003254 ETX-S00003253 ETX-M00001393 ETX-S00003258 ETX-S00003257 ETX-M00001394 ETX-S00003262 ETX-S00003261 ETX-M00001395 ETX-S00003266 ETX-S00003265 ETX-M00001396 ETX-S00003270 ETX-S00003269 ETX-M00001397 ETX-S00003274 ETX-S00003273 ETX-M00001398 ETX-S00003278 ETX-S00003277 ETX-M00001399 ETX-S00003282 ETX-S00003281 ETX-M00001400 ETX-S00003286 ETX-S00003285 ETX-M00001401 ETX-S00003290 ETX-S00003289 ETX-M00001402 ETX-S00003294 ETX-S00003293 ETX-M00001403 ETX-S00003298 ETX-S00003297 ETX-M00001404 ETX-S00003302 ETX-S00003301 ETX-M00001405 ETX-S00003306 ETX-S00003305 ETX-M00001406 ETX-S00003310 ETX-S00003309 ETX-M00001407 ETX-S00003314 ETX-S00003313 ETX-M00001408 ETX-S00003318 ETX-S00003317 ETX-M00001409 ETX-S00003322 ETX-S00003321 ETX-M00001410 ETX-S00003326 ETX-S00003325 ETX-M00001411 ETX-S00003330 ETX-S00003329 ETX-M00001412 ETX-S00003334 ETX-S00003333 ETX-M00001413 ETX-S00003338 ETX-S00003337 ETX-M00001414 ETX-S00003342 ETX-S00003341 ETX-M00001415 ETX-S00003346 ETX-S00003345 ETX-M00001416 ETX-S00003350 ETX-S00003349 ETX-M00001417 ETX-S00003354 ETX-S00003353 ETX-M00001418 ETX-S00003358 ETX-S00003357 ETX-M00001419 ETX-S00003362 ETX-S00003361 ETX-M00001420 ETX-S00003366 ETX-S00003365 ETX-M00001421 ETX-S00003370 ETX-S00003369 ETX-M00001422 ETX-S00003374 ETX-S00003373 ETX-M00001423 ETX-S00003378 ETX-S00003377 ETX-M00001424 ETX-S00003382 ETX-S00003381 ETX-M00001425 ETX-S00003386 ETX-S00003385 ETX-M00001426 ETX-S00003390 ETX-S00003389 ETX-M00001427 ETX-S00003394 ETX-S00003393 ETX-M00001428 ETX-S00003398 ETX-S00003397 ETX-M00001429 ETX-S00003402 ETX-S00003401 ETX-M00001430 ETX-S00003406 ETX-S00003405 ETX-M00001431 ETX-S00003410 ETX-S00003409 ETX-M00001432 ETX-S00003414 ETX-S00003413 ETX-M00001433 ETX-S00003418 ETX-S00003417 ETX-M00001434 ETX-S00003422 ETX-S00003421 ETX-M00001435 ETX-S00003426 ETX-S00003425 ETX-M00001436 ETX-S00003430 ETX-S00003429 ETX-M00001437 ETX-S00003434 ETX-S00003433 ETX-M00001438 ETX-S00003438 ETX-S00003437 ETX-M00001439 ETX-S00003442 ETX-S00003441 ETX-M00001440 ETX-S00003446 ETX-S00003445 ETX-M00001441 ETX-S00003450 ETX-S00003449 ETX-M00001442 ETX-S00003454 ETX-S00003453 ETX-M00001443 ETX-S00003458 ETX-S00003457 ETX-M00001444 ETX-S00003462 ETX-S00003461 ETX-M00001445 ETX-S00003466 ETX-S00003465 ETX-M00001446 ETX-S00003470 ETX-S00003469 ETX-M00001447 ETX-S00003474 ETX-S00003473 ETX-M00001448 ETX-S00003478 ETX-S00003477 ETX-M00001449 ETX-S00003482 ETX-S00003481 ETX-M00001450 ETX-S00003486 ETX-S00003485 ETX-M00001451 ETX-S00003490 ETX-S00003489 ETX-M00001452 ETX-S00003494 ETX-S00003493 ETX-M00001453 ETX-S00003498 ETX-S00003497 ETX-M00001454 ETX-S00003502 ETX-S00003501 ETX-M00001455 ETX-S00003506 ETX-S00003505 ETX-M00001456 ETX-S00003510 ETX-S00003509 ETX-M00001457 ETX-S00003514 ETX-S00003513 ETX-M00001458 ETX-S00003518 ETX-S00003517 ETX-M00001459 ETX-S00003522 ETX-S00003521 ETX-M00001460 ETX-S00003526 ETX-S00003525 ETX-M00001461 ETX-S00003530 ETX-S00003529 ETX-M00001462 ETX-S00003534 ETX-S00003533 ETX-M00001463 ETX-S00003538 ETX-S00003537 ETX-M00001464 ETX-S00003542 ETX-S00003541 ETX-M00001465 ETX-S00003546 ETX-S00003545 ETX-M00001466 ETX-S00003550 ETX-S00003549 ETX-M00001467 ETX-S00003554 ETX-S00003553 ETX-M00001468 ETX-S00003558 ETX-S00003557 ETX-M00001469 ETX-S00003562 ETX-S00003561 ETX-M00001470 ETX-S00003566 ETX-S00003565 ETX-M00001471 ETX-S00003570 ETX-S00003569 ETX-M00001472 ETX-S00003574 ETX-S00003573 ETX-M00001473 ETX-S00003578 ETX-S00003577 ETX-M00001474 ETX-S00003582 ETX-S00003581 ETX-M00001475 ETX-S00003586 ETX-S00003585 ETX-M00001476 ETX-S00003590 ETX-S00003589 ETX-M00001477 ETX-S00003594 ETX-S00003593 ETX-M00001478 ETX-S00003598 ETX-S00003597 ETX-M00001479 ETX-S00003602 ETX-S00003601 ETX-M00001480 ETX-S00003606 ETX-S00003605 ETX-M00001481 ETX-S00003610 ETX-S00003609 ETX-M00001482 ETX-S00003614 ETX-S00003613 ETX-M00001483 ETX-S00003618 ETX-S00003617 ETX-M00001484 ETX-S00003622 ETX-S00003621 ETX-M00001485 ETX-S00003626 ETX-S00003625 ETX-M00001486 ETX-S00003630 ETX-S00003629 ETX-M00001487 ETX-S00003634 ETX-S00003633 ETX-M00001488 ETX-S00003638 ETX-S00003637 ETX-M00001489 ETX-S00003642 ETX-S00003641 ETX-M00001490 ETX-S00003646 ETX-S00003645 ETX-M00001491 ETX-S00003650 ETX-S00003649 ETX-M00001492 ETX-S00003654 ETX-S00003653 ETX-M00001493 ETX-S00003658 ETX-S00003657 ETX-M00001494 ETX-S00003662 ETX-S00003661 ETX-M00001495 ETX-S00003666 ETX-S00003665 ETX-M00001496 ETX-S00003670 ETX-S00003669 ETX-M00001497 ETX-S00003674 ETX-S00003673 ETX-M00001498 ETX-S00003678 ETX-S00003677 ETX-M00001499 ETX-S00003682 ETX-S00003681 ETX-M00001500 ETX-S00003686 ETX-S00003685 ETX-M00001501 ETX-S00003690 ETX-S00003689 ETX-M00001502 ETX-S00003694 ETX-S00003693 ETX-M00001503 ETX-S00003698 ETX-S00003697 ETX-M00001504 ETX-S00003702 ETX-S00003701 ETX-M00001505 ETX-S00003706 ETX-S00003705 ETX-M00001506 ETX-S00003710 ETX-S00003709 ETX-M00001507 ETX-S00003714 ETX-S00003713 ETX-M00001508 ETX-S00003718 ETX-S00003717 ETX-M00001509 ETX-S00003722 ETX-S00003721 ETX-M00001510 ETX-S00003726 ETX-S00003725 ETX-M00001511 ETX-S00003730 ETX-S00003729 ETX-M00001512 ETX-S00003734 ETX-S00003733 ETX-M00001513 ETX-S00003738 ETX-S00003737 ETX-M00001514 ETX-S00003742 ETX-S00003741 ETX-M00001515 ETX-S00003746 ETX-S00003745 ETX-M00001516 ETX-S00003750 ETX-S00003749 ETX-M00001517 ETX-S00003754 ETX-S00003753 ETX-M00001518 ETX-S00003758 ETX-S00003757 ETX-M00001519 ETX-S00003762 ETX-S00003761 ETX-M00001520 ETX-S00003766 ETX-S00003765 ETX-M00001521 ETX-S00003770 ETX-S00003769 ETX-M00001522 ETX-S00003774 ETX-S00003773 ETX-M00001523 ETX-S00003778 ETX-S00003777 ETX-M00001524 ETX-S00003782 ETX-S00003781 ETX-M00001525 ETX-S00003786 ETX-S00003785 ETX-M00001526 ETX-S00003790 ETX-S00003789 ETX-M00001527 ETX-S00003794 ETX-S00003793 ETX-M00001528 ETX-S00003798 ETX-S00003797 ETX-M00001529 ETX-S00003802 ETX-S00003801 ETX-M00001530 ETX-S00003806 ETX-S00003805 ETX-M00001531 ETX-S00003810 ETX-S00003809 ETX-M00001532 ETX-S00003814 ETX-S00003813 ETX-M00001533 ETX-S00003818 ETX-S00003817 ETX-M00001534 ETX-S00003822 ETX-S00003821 ETX-M00001535 ETX-S00003826 ETX-S00003825 ETX-M00001536 ETX-S00003830 ETX-S00003829 ETX-M00001537 ETX-S00003834 ETX-S00003833 ETX-M00001538 ETX-S00003838 ETX-S00003837 ETX-M00001539 ETX-S00003842 ETX-S00003841 ETX-M00001540 ETX-S00003846 ETX-S00003845 ETX-M00001541 ETX-S00003850 ETX-S00003849 ETX-M00001542 ETX-S00003854 ETX-S00003853 ETX-M00001543 ETX-S00003858 ETX-S00003857 ETX-M00001544 ETX-S00003862 ETX-S00003861 ETX-M00001545 ETX-S00003866 ETX-S00003865 ETX-M00001546 ETX-S00003870 ETX-S00003869 ETX-M00001547 ETX-S00003874 ETX-S00003873 ETX-M00001548 ETX-S00003878 ETX-S00003877 ETX-M00001549 ETX-S00003882 ETX-S00003881 ETX-M00001550 ETX-S00003886 ETX-S00003885 ETX-M00001551 ETX-S00003890 ETX-S00003889 ETX-M00001552 ETX-S00003894 ETX-S00003893 ETX-M00001553 ETX-S00003898 ETX-S00003897 ETX-M00001554 ETX-S00003902 ETX-S00003901 ETX-M00001555 ETX-S00003906 ETX-S00003905 ETX-M00001556 ETX-S00003910 ETX-S00003909 ETX-M00001557 ETX-S00003914 ETX-S00003913 ETX-M00001558 ETX-S00003918 ETX-S00003917 ETX-M00001559 ETX-S00003922 ETX-S00003921 ETX-M00001560 ETX-S00003926 ETX-S00003925 ETX-M00001561 ETX-S00003930 ETX-S00003929 ETX-M00001562 ETX-S00003934 ETX-S00003933 ETX-M00001563 ETX-S00003938 ETX-S00003937 ETX-M00001564 ETX-S00003942 ETX-S00003941 ETX-M00001565 ETX-S00003946 ETX-S00003945 ETX-M00001566 ETX-S00003950 ETX-S00003949 ETX-M00001567 ETX-S00003954 ETX-S00003953 ETX-M00001568 ETX-S00003958 ETX-S00003957 ETX-M00001569 ETX-S00003962 ETX-S00003961 ETX-M00001570 ETX-S00003966 ETX-S00003965 ETX-M00001571 ETX-S00003970 ETX-S00003969 ETX-M00001572 ETX-S00003974 ETX-S00003973 ETX-M00001573 ETX-S00003978 ETX-S00003977 ETX-M00001574 ETX-S00003982 ETX-S00003981 ETX-M00001575 ETX-S00003986 ETX-S00003985 ETX-M00001576 ETX-S00003990 ETX-S00003989 ETX-M00001577 ETX-S00003994 ETX-S00003993 ETX-M00001578 ETX-S00003998 ETX-S00003997 ETX-M00001579 ETX-S00004002 ETX-S00004001 ETX-M00001580 ETX-S00004006 ETX-S00004005 ETX-M00001581 ETX-S00004010 ETX-S00004009 ETX-M00001582 ETX-S00004014 ETX-S00004013 ETX-M00001583 ETX-S00004018 ETX-S00004017 ETX-M00001584 ETX-S00004022 ETX-S00004021 ETX-M00001585 ETX-S00004026 ETX-S00004025 ETX-M00001586 ETX-S00004030 ETX-S00004029 ETX-M00001587 ETX-S00004034 ETX-S00004033 ETX-M00001588 ETX-S00004038 ETX-S00004037 ETX-M00001589 ETX-S00004042 ETX-S00004041 ETX-M00001590 ETX-S00004046 ETX-S00004045 ETX-M00001591 ETX-S00004050 ETX-S00004049 ETX-M00001592 ETX-S00004054 ETX-S00004053 ETX-M00001593 ETX-S00004058 ETX-S00004057 ETX-M00001594 ETX-S00004062 ETX-S00004061 ETX-M00001595 ETX-S00004066 ETX-S00004065 ETX-M00001596 ETX-S00004070 ETX-S00004069 ETX-M00001597 ETX-S00004074 ETX-S00004073 ETX-M00001598 ETX-S00004078 ETX-S00004077 ETX-M00001599 ETX-S00004082 ETX-S00004081 ETX-M00001600 ETX-S00004086 ETX-S00004085 ETX-M00001601 ETX-S00004090 ETX-S00004089 ETX-M00001602 ETX-S00004094 ETX-S00004093 ETX-M00001603 ETX-S00004098 ETX-S00004097 ETX-M00001604 ETX-S00004102 ETX-S00004101 ETX-M00001605 ETX-S00004106 ETX-S00004105 ETX-M00001606 ETX-S00004110 ETX-S00004109 ETX-M00001607 ETX-S00004114 ETX-S00004113 ETX-M00001608 ETX-S00004118 ETX-S00004117 ETX-M00001609 ETX-S00004122 ETX-S00004121 ETX-M00001610 ETX-S00004126 ETX-S00004125 ETX-M00001611 ETX-S00004130 ETX-S00004129 ETX-M00001612 ETX-S00004134 ETX-S00004133 ETX-M00001613 ETX-S00004138 ETX-S00004137 ETX-M00001614 ETX-S00004142 ETX-S00004141 ETX-M00001615 ETX-S00004146 ETX-S00004145 ETX-M00001616 ETX-S00004150 ETX-S00004149 ETX-M00001617 ETX-S00004154 ETX-S00004153 ETX-M00001618 ETX-S00004158 ETX-S00004157 ETX-M00001619 ETX-S00004162 ETX-S00004161 ETX-M00001620 ETX-S00004166 ETX-S00004165 ETX-M00001621 ETX-S00004170 ETX-S00004169 ETX-M00001622 ETX-S00004174 ETX-S00004173 ETX-M00001623 ETX-S00004178 ETX-S00004177 ETX-M00001624 ETX-S00004182 ETX-S00004181 ETX-M00001625 ETX-S00004186 ETX-S00004185 ETX-M00001626 ETX-S00004190 ETX-S00004189 For duplexes of Table 5: ETX-M00001351 – ETX-M00001626 preferably have a duplex structure according to Figure 8b. In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Duplex ID Modified first strand Modified second strand ETX-S00003198 ETX-S00003197 ETX-M00001378 (SEQ ID NO: 856) (SEQ ID NO: 1132) ETX-S00003274 ETX-S00003273 ETX-M00001397 (SEQ ID NO: 875) (SEQ ID NO: 1151) ETX-S00003738 ETX-S00003737 ETX-M00001513 (SEQ ID NO: 991) (SEQ ID NO: 1267) ETX-S00003794 ETX-S00003793 ETX-M00001527 (SEQ ID NO: 1005) (SEQ ID NO: 1281) ETX-S00003966 ETX-S00003965 ETX-M00001570 (SEQ ID NO: 1048) (SEQ ID NO: 1324) In an even more preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Duplex ID Modified first strand Modified second strand ETX-S00003198 ETX-S00003197 ETX-M00001378 (SEQ ID NO: 856) (SEQ ID NO: 1132) In case of ambiguity between the sequences in this specification and the sequences in the attached sequence listing, the sequences provided herein are considered to be the correct sequences. ABASIC NUCLEOTIDES In certain embodiments, there are 1, e.g.2, e.g.3, e.g.4 or more abasic nucleosides present in nucleic acids according to the invention. Abasic nucleosides are modified nucleosides because they lack the base normally seen at position 1 of the sugar moiety. Typically, there will be a hydrogen at position 1 of the sugar moiety of the abasic nucleosides present in a nucleic acid according to the present invention. The abasic nucleosides are in the terminal region of the second strand, preferably located within the terminal 5 nucleosides of the end of the strand. The terminal region may be the terminal 5 nucleosides, which includes abasic nucleosides. The second strand may comprise, as preferred features (which are all specifically contemplated in combination unless mutually exclusive): 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides; and / or 2, or more than 2, consecutive abasic nucleosides in either the 5’ or 3’ terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides in either the 5’ or 3’ terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5’ or 3’ terminal region of the second strand; and / or an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or abasic nucleosides as the 2 terminal nucleosides connected via a 5’-3’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the 2 terminal nucleosides connected via a 3’-5’ linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5’ reversed linkage or a 3’-3’ reversed linkage; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3’ reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5’3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. Preferably there is an abasic nucleoside at the terminus of the second strand. Preferably there are 2 or at least 2 abasic nucleosides in the terminal region of the second strand, preferably at the terminal and penultimate positions. Preferably 2 or more abasic nucleosides are consecutive, for example all abasic nucleosides may be consecutive. For example, the terminal 1 or terminal 2 or terminal 3 or terminal 4 nucelotides may be abasic nucleosides. An abasic nucleoside may also be linked to an adjacent nucleoside through a 5’-3’ phosphodiester linkage or reversed linkage unless there is only 1 abasic nucleoside at the terminus, in which case it will have a reversed linkage to the adjacent nucleoside. A reversed linkage (which may also be referred to as an inverted linkage, which is also seen in the art), comprises either a 5’-5’, a 3-’3’, a 3’-2’ or a 2’-3’ phosphodiester linkage between the adjacent sugar moieties of the nucleosides. Abasic nucleosides which are not terminal will have 2 phosphodiester bonds, one with each adjacent nucleoside, and these may be a reversed linkage or may be a 5’-3 phosphodiester bond or may be one of each. A preferred embodiment comprises 2 abasic nucleosides at the terminal and penultimate positions of the second strand, and wherein the reversed internucleoside linkage is located between the penultimate (abasic) nucleoside and the antepenultimate nucleoside. Preferably there are 2 abasic nucleosides at the terminal and penultimate positions of the second strand and the penultimate nucleoside is linked to the antepenultimate nucleoside through a reversed internucleoside linkage and is linked to the terminal nucleoside through a 5’-3’ or 3’-5’ phosphodiester linkage (reading in the direction of the terminus of the molecule). Preferably a nucleic acid according to the present invention comprises one or more abasic nucleosides, optionally wherein the one or more abasic nucleosides are in a terminal region of the second strand, and / or wherein at least one abasic nucleoside is linked to an adjacent basic nucleoside through a reversed internucleoside linkage. Different preferred features are as follows: The reversed internucleoside linkage is a 3’-3’ reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal phosphate of the second strand. The reversed internucleoside linkage is a 5’-5’ reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 3’ terminal hydroxide of the second strand. In certain embodiments, the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 5-5’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 5’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand. Alternatively the second strand comprises 2 consecutive abasic nucleosides preferably in an overhang in the 3’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 3’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 3’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 3’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 3-3’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 5’-3’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 3’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 3’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 3’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 5’ terminal region of the second strand. Examples of the structures are as follows (where the specific RNA nucleosides shown are not limiting and could be any RNA nucleoside): A A 3’-3’ reversed bond (and also showing the 5’-3 direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule) B Illustrating a 5’-5’ reversed bond (and also showing the 3’-5’ direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule)

[0003] The abasic nucleoside or abasic nucleosides present in the nucleic acid are provided in the presence of a reversed internucleoside linkage or linkages, namely a 5’-5’ or a 3’-3’ reversed internucleoside linkage. A reversed linkage occurs as a result of a change of orientation of an adjacent nucleoside sugar, such that the sugar will have a 3’ – 5’ orientation as opposed to the conventional 5’ – 3’ orientation (with reference to the numbering of ring atoms on the nucleoside sugars). The abasic nucleoside or nucleosides as present in the nucleic acids of the invention preferably include such inverted nucleoside sugars. In the case of a terminal nucleoside having an inverted orientation, then this will result in an “inverted” end configuration for the overall nucleic acid. Whilst certain structures drawn and referenced herein are represented using conventional 5’ - 3’ direction (with reference to the numbering of ring atoms on the nucleoside sugars), it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 3’-3’ reversed linkage, will result in a nucleic acid having an overall 5’- 5’ end structure (i.e. the conventional 3’ end nucleoside becomes a 5’ end nucleoside). Alternatively, it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 5’-5’ reversed linkage will result in a nucleic acid with an overall 3’- 3’ end structure. The proximal 3’-3’ or 5’-5’ reversed linkage as herein described, may comprise the reversed linkage being directly adjacent / attached to a terminal nucleoside having an inverted orientation, such as a single terminal nucleoside having an inverted orientation. Alternatively, the proximal 3’-3’ or 5’-5’ reversed linkage as herein described, may comprise the reversed linkage being adjacent 2, or more than 2, nucleosides having an inverted orientation, such as 2, or more than 2, terminal region nucleosides having an inverted orientation, such as the terminal and penultimate nucleosides. In this way, the reversed linkage may be attached to a penultimate nucleoside having an inverted orientation. While a skilled addressee will appreciate that inverted orientations as described above can result in nucleic acid molecules having overall 3’ - 3’ or 5’- 5’ end structures as described herein, it will also be appreciated that with the presence of one or more additional reversed linkages and / or nucleosides having an inverted orientation, then the overall nucleic acid may have 3’ - 5’ end structures corresponding to the conventionally positioned 5’ / 3’ ends. In one aspect the nucleic acid may have a 3’-3’ reversed linkage, and the terminal sugar moiety may comprise a 5’ OH rather than a 5’ phosphate group at the 5’ position of that terminal sugar. A skilled person would therefore clearly understand that 5’-5’, 3’-3’ and 3’-5’ (reading in the direction of that terminus) end variants of the more conventional 5’-3’ structures (with reference to the numbering of ring atoms on the end nucleoside sugars) drawn herein are included in the scope of the disclosure, where a reversed linkage or linkages is / are present. In the situation of e.g. a reversed internucleoside linkage and / or one or more nucleosides having an inverted orientation creating an inverted end, and where the relative position of a linkage (e.g. to a linker) or the location of an internal feature (such as a modified nucleoside) is defined relative to the 5’ or 3’ end of the nucleic acid, then the 5’ or 3’ end is the conventional 5’ or 3’ end which would have existed had a reversed linkage not been in place, and wherein the conventional 5’ or 3’ end is determined by consideration of the directionality of the majority of the internal nucleoside linkages and / or nucleoside orientation within the nucleic acid. It is possible to tell from these internal bonds and / or nucleoside orientation which ends of the nucleic acid would constitute the conventional 5’ and 3’ ends (with reference to the numbering of ring atoms on the end nucleoside sugars) of the molecule absent the reversed linkage. For example, in the structure shown below there are abasic residues in the first 2 positions located at the “5’” end. Where the terminal nucleoside has an inverted orientation then the “5’” end indicated in the diagram below, which is the conventional 5’ end, can in fact comprise a 3’ OH in view of the inverted nucleoside at the terminal position. Nevertheless the majority of the molecule will comprise conventional internucleoside linkages that run from the 3’ OH of the sugar to the 5’ phosphate of the next sugar, when reading in the standard 5’ [PO4] to 3’ [OH] direction of a nucleic acid molecule (with reference to the numbering of ring atoms on the nucleoside sugars), which can be used to determine the conventional 5’ and 3’ ends that would be found absent the inverted end configuration. A 5’ A-A-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me 3’ The reversed bond is preferably located at the end of the nucleic acid e.g. RNA which is distal to a ligand moiety, such as a GalNAc containing portion, of the molecule. GalNAc-siRNA constructs with a 5’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. GalNAc-siRNA constructs with a 3’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. In some embodiments, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif wherein: B represents a nucleoside base, T represent H, OH or a 2’ ribose modification, Z represents the remaining nucleosides of said second strand. In some embodiments, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif

[0004] wherein: B represents a nucleoside base, T represents H, OH or a 2’ ribose modification (preferably a 2’ ribose modification, more preferably a 2’Me or 2’F ribose modification), V represents O or S (preferably O), R represents H or C1-4alkyl (preferably H), Z represents the remaining nucleosides of said second strand, more preferably the following 5’ terminal motif

[0005] wherein: B represents a nucleoside base, T represents a 2’ ribose modification (preferably a 2’Me or 2’F ribose modification), Z represents the remaining nucleosides of said second strand. The reversed bond is preferably located at the end of the nucleic acid eg RNA which is distal to a ligand moiety, such as a GalNAc containing portion, of the molecule. GalNAc-siRNA constructs with a 5’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. GalNAc-siRNA constructs with a 3’-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand. In a preferred embodiment, the second (sense) strand of the nucleic acid according to the invention comprises 2 consecutive abasic nucleosides in the 5’ terminal region as shown in the following 5’ terminal motif

[0006] wherein: B represents a nucleoside base, T represent H, OH or a 2’ ribose modification (preferably a 2’ ribose modification, more preferably a 2’Me or 2’F ribose modification), V represent O or S (preferably O), R represent H or C1-4alkyl (preferably H), Z comprises 11 to 26 contiguous nucleosides, preferably 15 to 21 contiguous nucleosides, and more preferably 19 contiguous nucleosides, more preferably the following 5’ terminal motif

[0007] wherein: B represents a nucleoside base, T represents a 2’ ribose modification (preferably a 2’Me or 2’F ribose modification), Z comprises 19 contiguous nucleosides. NUCLEIC ACID LENGTHS In one aspect the i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides. Typically, the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 nucleosides in length. Similarly, the region of complementarity between the first strand and the portion of RNA transcribed from the SLC25A5 gene is between 17 and 30 nucleosides in length. Generally, the duplex structure of the nucleic acid e.g. an iRNA is about 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. Similarly, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is about 15 to 30 nucleosides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20- 24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. In certain preferred embodiments, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is at least 17 nucleosides in length. For example, the region of complementarity between the antisense strand and the target is 19 to 21 nucleosides in length, for example, the region of complementarity is 21 nucleosides in length. In preferred embodiments, each strand is no more than 30 nucleosides in length. In certain preferred embodiments, the duplex structure of the nucleic acid e.g. an siRNA is 19 or 21 base pairs in length. In particularly preferred embodiment, the duplex may have one of the following structures: e.g., ETX-M00001351 – ETX-M00001626 A nucleic acid e.g. a dsRNA as described herein can further include one or more single-stranded nucleoside overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleosides. A nucleoside overhang can comprise or consist of a nucleoside / nucleoside analog, including a deoxynucleoside / nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleoside(s) of an overhang can be present on the 5'-end, 3'- end, or both ends of an antisense or sense strand of a nucleic acid e.g. a dsRNA. In certain preferred embodiments, at least one strand comprises a 3' overhang of at least 1 nucleoside, e.g., at least one strand comprises a 3' overhang of at least 2 nucleosides. The overhang is suitably on the antisense / guide strand and / or the sense / passenger strand. NUCLEIC ACID MODIFICATIONS In certain embodiments, the nucleic acid e.g. an RNA of the invention e.g., a dsiRNA, does not comprise further modifications, e.g., chemical modifications or conjugations known in the art and described herein. In other preferred embodiments, the nucleic acid e.g. RNA of the invention, e.g., a dsiRNA, is further chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the invention, substantially all of the nucleosides are modified. The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3 '-end modifications (conjugation, DNA nucleosides within an RNA, or RNA nucleosides within a DNA, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, conjugated bases; sugar modifications (e.g. , at the 2'-position or 4'- position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of nucleic acids such as siRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. Nucleic acids such as RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleic acids e.g. RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified nucleic acid e.g. an siRNA will have a phosphorus atom in its internucleoside backbone. Modified nucleic acid e.g. RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 5'-3' or 5'-2'. Various salts, mixed salts and free acid forms are also included. Modified nucleic acids e.g. RNAs can also contain one or more substituted sugar moieties. The nucleic acids e.g. siRNAs, e.g., dsiRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted. 2’ O- methyl and 2’-F are preferred modifications. In certain preferred embodiments, the nucleic acid comprises at least one modified nucleoside. The nucleic acid of the invention may comprise one or more modified nucleosides on the first strand and / or the second strand. In some embodiments, substantially all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification. In some embodiments, all of the nucleosides of the sense strand and substantially all of the nucleosides of the antisense strand comprise a modification. In some embodiments, all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification. In one embodiment, at least one of the modified nucleosides is selected from the group consisting of a deoxy- nucleoside, a 3 '-terminal deoxy-thymine (dT) nucleoside, a 2'-O-methyl modified nucleoside (also called herein 2’-Me, where Me is a methoxy) , a 2'-fluoro modified nucleoside, a 2'-deoxy- modified nucleoside, a locked nucleoside, an unlocked nucleoside, a conformationally restricted nucleoside, a constrained ethyl nucleoside, an abasic nucleoside, a 2' -amino- modified nucleoside, a 2'-O-allyl- modified nucleoside, 2' -C-alkyl- modified nucleoside, 2'-hydroxly-modified nucleoside, a 2'- methoxyethyl modified nucleoside, a 2'-O-alkyl-modified nucleoside, a morpholino nucleoside, a phosphoramidate, a non-natural base comprising nucleoside, a tetrahydropyran modified nucleoside, a 1 ,5-anhydrohexitol modified nucleoside, a cyclohexenyl modified nucleoside, a nucleoside comprising a phosphorothioate group, a nucleoside comprising a methylphosphonate group, a nucleoside comprising a 5 '-phosphate, and a nucleoside comprising a 5 '-phosphate mimic. In another embodiment, the modified nucleosides comprise a short sequence of 3 '-terminal deoxy-thymine nucleosides (dT). Modifications on the nucleosides may preferably be selected from the group including, but not limited to, LNA, HNA, CeNA, 2 -methoxyethyl, 2'-O-alkyl, 2-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In another embodiment, the modifications on the nucleosides are 2 -O-methyl (“2- Me”) or 2'-fluoro modifications. One preferred modification is a modification at the 2’-OH group of the ribose sugar, optionally selected from 2'-Me or 2’-F modifications. In certain embodiments, the nucleic acid e.g. RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. For example the phosphorothioate or methylphosphonate internucleoside linkage can be at the 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkage is at the 5 'terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. In certain embodiments, a phosphorothioate or a methylphosphonate internucleoside linkage is at both the 5'- and 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand. Any nucleic acid may comprise one or more phosphorothioate (PS) modifications within the nucleic acid, such as at least two PS internucleoside bonds at the ends of a strand. At least one of the oligoribonucleoside strands preferably comprises at least two consecutive phosphorothioate modifications in the last 3 nucleosides of the oligonucleoside. The invention therefore also relates to: A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions, such as in a 5’ and / or 3’ terminal region and / or near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located. A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions in a 5’ and / or 3’ terminal region of the first strand, whereby preferably the terminal position at the 5’ and / or 3’ terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage. The nucleic acid strand may be an RNA comprising a phosphorothioate internucleoside linkage between the three nucleosides contiguous with 2 terminally located abasic nucleosides. A preferred nucleic acid is a double stranded RNA comprising 2 adjacent abasic nucleosides at the 5’ terminus of the second strand and a ligand moiety comprising one or more GalNAc ligand moieties at the opposite 3’ end of the second strand. Further preferred, the same nucleic acid may also comprise a phosphorothioate bond between nucelotides at positions 3-4 and 4-5 of the second strand, reading from the position 1 of the second strand. Position 1 of the first or the second strand is the nucleoside which is the closest to the end of the nucleic acid (ignoring any abasic nucleosides) and that is joined to an adjacent nucleoside (at Position 2) via a 3’ to 5’ internal bond, with reference to the bonds between the sugar moieties of the backbone, and reading in a direction away from that end of the molecule. It can therefore be seen that “position 1 of the sense strand” is the 5’ most nucleoside (not including abasic nucleosides) at the conventional 5’ end of the sense strand. Typically, the nucleoside at this position 1 of the sense strand will be equivalent to the 5’ nucleoside of the selected target nucleic acid sequence, and more generally the sense strand will have equivalent nucleosides to those of the target nucleic acid sequence starting from this position 1 of the sense strand, whilst also allowing for acceptable mismatches between the sequences. As used herein, “position 1 of the antisense strand” is the 5’ most nucleoside (not including abasic nucleosides) at the conventional 5’ end of the antisense strand. As hereinbefore described, there will be a region of complementarity between the sense and antisense strands, and in this way the antisense strand will also have a region of complementarity to the target nucleic acid sequence as referred to above. Preferred modifications that can be used with sequences according to the present invention can be as follows: Modification 1: First strand modification: NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNfNfNfNfNfNmNmNmNmNmNmNmNfNmNm (5’ to 3’) Modification 2: First strand modification: NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNfNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 3: First strand modification: NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 4: First strand modification: NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 5: First strand modification: NmsNfsNmNmNmNfNmNmNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 6: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 7: First strand modification: NmsNfsNmNmNmNyNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 8: First strand modification: NmsNfsNmNmNmNyNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 9: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 10: First strand modification: NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 11: First strand modification: NmsNfsNmNfNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 12: First strand modification: NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) Modification 13: First strand modification: NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmNfNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) wherein in each of the above modifications: ia represents an inverted abasic nucleoside; Nm represents a 2’Me ribose modified nucleoside; Nf represents a 2’F ribose modified nucleoside; Ny represents a nucleoside with a thermally destabilizing modification, preferably wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), more preferably a glycol nucleic acid, most preferably an (S)-glycol nucleic acid; s represents a phosphorothioate internucleoside bond. A particularly preferred modification that can be used with sequences according to the present invention can be: Modification 6: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNfNmNmNmsNmsNm (5’ to 3’) Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm (5’ to 3’) wherein in each of the above modifications: ia represents an inverted abasic nucleoside; Nm represents a 2’Me ribose modified nucleoside; and s represents a phosphorothioate internucleoside bond. CONJUGATION OF NUCLEIC ACID TO LIGAND Another modification of a nucleic acid e.g. RNA e.g. an siRNA of the invention involves linking the nucleic acid e.g. the siRNA to one or more ligand moieties e.g. to enhance the activity, cellular distribution, or cellular uptake of the nucleic acid e.g. siRNA e.g., into a cell. In certain embodiments, the inhibitor according to the invention is conjugated to a ligand moiety that enables and / or facilitates targeting of hepatocytes. In certain embodiments, targeting of hepatocytes is achieved using N-acetylgalactosamine (GalNAc) conjugates as described in more detail herein below. That is, in certain embodiments, the inhibitor according to the invention is an siRNA-GalNAc conjugate. In some embodiments, the ligand moiety described can be attached to a nucleic acid e.g. an siRNA oligonucleoside, via a linker that can be cleavable or non-cleavable. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. The ligand can be attached to the 3' or 5’ end of the sense strand. The ligand is preferably conjugated to 3’ end of the sense strand of the nucleic acid e.g. an siRNA agent. The invention therefore relates in a further aspect to a conjugate for inhibiting expression of a target e.g. a target gene, in a cell, said conjugate comprising a nucleic acid portion and one or more ligand moieties, said nucleic acid portion comprising a nucleic acid as disclosed herein. In one aspect the second strand of the nucleic acid is conjugated directly or indirectly (e.g. via a linker) to the one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3’ terminal region thereof. In certain embodiments, the ligand moiety comprises a GalNAc or GalNAc derivative attached to the nucleic acid e.g. dsiRNA through a linker. Therefore, the invention relates to a conjugate wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands conjugated to said nucleic acid through a linker. Said GalNAc ligand may be conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3’ terminal region thereof. GalNAc ligands are well known in the art and described in, inter alia, EP3775207A1. In some embodiments, the ligand moiety comprises one or more ligands. In some embodiments, the ligand moiety comprises one or more carbohydrate ligands. In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and / or polysaccharide. In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and / or one or more mannose moieties. In some embodiments, the one or more carbohydrates comprise one or more N-Acetyl-Galactosamine moieties. In some embodiments, the compounds as described anywhere herein comprise two or three N- AcetylGalactosamine moieties. In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker. Exemplary linear configurations and Exemplary branched configurations are shown in Figures 1a and 1b: In Fig 1a, (linear), (a) and / or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups. In Fig 1b, (branched), in some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration. Linker Exemplary compounds of the invention comprise a ‘linker moiety’, such as that as depicted in Formula (I), that is part of an overall ‘linker’. Formula I wherein: R1at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligonucleoside moiety. As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other. The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above. As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist. The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I). Tether moiety of Formula I In relation to Formula (I), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety. In some embodiments, R1is hydrogen at each occurrence. In some embodiments, R1is methyl. In some embodiments, R1is ethyl. In some embodiments, R2is hydroxy. In some embodiments, R2is halo. In some embodiments, R2is fluoro. In some embodiments, R2is chloro. In some embodiments, R2is bromo. In some embodiments, R2is iodo. In some embodiments, R2is nitro. In some embodiments, X1is methylene. In some embodiments, X1is oxygen. In some embodiments, X1is sulfur. In some embodiments, X2is methylene. In some embodiments, X2is oxygen. In some embodiments, X2is sulfur. In some embodiments, m = 3. In some embodiments, n = 6. In some embodiments, X1is oxygen and X2is methylene. In some embodiments, both X1and X2are methylene. In some embodiments, q = 1, r = 2, s = 1, t = 1, v = 1. In some embodiments, q = 1, r = 3, s = 1, t = 1, v = 1. In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is fluoro, X2is methylene, v = 1, t = 1, s = 1, X1is methylene, q = 1 and r = 2. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (IV) In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is fluoro, X2is methylene, v = 1, t = 1, s = 1, X1is oxygen, q = 1 and r = 2. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (II) Alternative tether moieties During the synthesis of compounds of the present invention, alternative tether moiety structures may arise. In some embodiments, alternative tether moieties have a change of one or more atoms in the tether moiety of the overall linker compared to tether moieties described anywhere herein. In some embodiments, the alternative tether moiety is a compound of Formula (I) as described anywhere herein, wherein R2is hydroxy. In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is hydroxy, X2is methylene, v = 1, t = 1, s = 1, X1is methylene, q = 1 and r = 2. Thus, in some embodiments, compounds of the invention comprise the following structure: Formula (V) In some embodiments, R1is hydrogen at each occurrence, n = 6, m = 3, R2is hydroxy, X2is methylene, v = 1, t = 1, s = 1, X1is oxygen, q = 1 and r = 2. Thus, in some embodiments, compounds of the invention comprise the following structure: Formula (III) Linker moiety In relation to Formula (I), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein. In some embodiments: as depicted in Formula (I) as described anywhere herein is any of Formulae (VIa), (VIb) or (VIc), preferably Formula (VIa): Formula (VIa) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or Formula (VIb) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or Formula (VIc) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10. In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa): Formula (VIa) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3. In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII): Formula (VII) wherein: AIis hydrogen; a is an integer of 2 or 3, preferably 3. Other exemplary compounds of the invention comprise a ‘linker moiety’, as depicted in Formula (I*), that is part of an overall ‘linker’. Formula I* Where: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleoside moiety. As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby ‘links’ the oligonucleoside moiety and the ligand moiety to each other. The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the ‘linker moiety’ as represented in Formula (I*) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I*) can also often be referred to as the ‘ligand arm or arms’ of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the ‘tether moiety’ of the overall linker, ‘tethering’ the oligonucleoside moiety to the remainder of the conjugated compound. Such ‘ligand arms’ and / or ‘linker moieties’ and / or ‘tether moieties’ can be envisaged by reference to the linear and / or branched configurations as set out above. As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist. The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a ‘tether moiety’ as hereinbefore described, wherein the ‘tether moiety’ is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I). Tether moiety In relation to Formula (I*), the ‘tether moiety’ comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety. In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6. In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12. In some embodiments, r is 12 and s is 6. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (II*) In some embodiments, r is 6 and s is 6. Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Formula (III*) Linker moiety In relation to Formula (I*), the ‘linker moiety’ as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein. In some embodiments, the moiety: as depicted in Formula (I*) as described anywhere herein is any of Formulae (IV*), (V*) or (VI*), preferably Formula (IV*): Formula (IV*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or Formula (V*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or Formula (VI*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10. In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa*):

[0008] Formula (VIa*) wherein: AIis hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3. In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII*): Formula (VII*) wherein: AIis hydrogen; a is an integer of 2 or 3. In some embodiments, a = 2. In some embodiments, a = 3. In some embodiments, b = 3. In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 6 (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Accordingly, the "oligonucleotide" may comprise other bonds than a phosphodiester bond, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the invention is a double stranded oligonucleoside as defined herein and the linker is conjugated to the second strand, more preferably to the 3' terminal region of the second strand, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:553 to SEQ ID NO:828, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:553 to SEQ ID NO:828, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:553 to SEQ ID NO:828, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one SEQ ID NO:553 to SEQ ID NO:828, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 or SEQ ID NO:772, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 5 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in any one of the linkers shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, preferably wherein the linker is conjugated to the 3' terminal region of the second strand, i.e., to the 3' terminal region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, via a phosphodiester bond. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figures 2 to 5 or Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, wherein the second strand has the following structure

[0009] wherein: T represents a 2’Me ribose modification, B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and Z represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, respectively. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 6 (Formula XI), wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, wherein the second strand has the following structure

[0010] wherein: T represents a 2’Me ribose modification, B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and Z represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, respectively. In some embodiments, the GalNAc ligand is comprised in the linker shown in Figure 4, wherein the "oligonucleotide" represents a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, wherein the second strand has the following structure

[0011] wherein: T represents a 2’Me ribose modification, B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, and Z represents the remaining 19 contiguous basic nucleosides of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324, respectively. VECTOR AND CELL In one aspect, the invention provides a cell containing a nucleic acid, such as inhibitory RNA [RNAi] as described herein. In one aspect, the invention provides a cell comprising a vector as described herein. In one aspect the invention provides a vector comprising an oligonucleotide inhibitor, e.g.an iRNA e.g. siRNA. PHARMACEUTICALLY ACCEPTABLE COMPOSITIONS In one aspect, the invention provides a pharmaceutical composition for inhibiting expression of a target gene, the composition comprising an inhibitor such as an oligomer such as a nucleic acid as disclosed herein. The pharmaceutically acceptable composition may comprise an excipient and or carrier. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen- free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g. , magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g. , starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc). Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like. Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non- parenteral administration which do not deleteriously react with nucleic acids can be used. In one embodiment, the nucleic acid or composition is administered in an unbuffered solution. In certain embodiments, the unbuffered solution is saline or water. In other embodiments, the nucleic acid e.g. RNAi agent is administered in a buffered solution. In such embodiments, the buffer solution can comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. For example, the buffer solution can be phosphate buffered saline (PBS). DOSAGES The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a gene or modify the expression or function of a target. In general, where the composition comprising a nucleic acid, a suitable dose of a nucleic acid e.g. an siRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of a nucleic acid e.g. an siRNA of the invention will be in the range of about 0.1 mg / kg to about 5.0 mg / kg, e.g., about 0.3 mg / kg and about 3.0 mg / kg. A repeat-dose regimen may include administration of a therapeutic amount of a nucleic acid e.g. siRNA on a regular basis, such as every other day or once a year. In certain embodiments, the nucleic acid e.g. siRNA is administered about once per month to about once per quarter (i.e., about once every three months). In various embodiments, the nucleic acid e.g. siRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid e.g. siRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered at a dose selected from about 0.5 mg / kg 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered about once per week, once per month, once every other two months, or once a quarter (i.e., once every three months) at a dose of about 0.1 mg / kg to about 5.0 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered to the subject once a week. In certain embodiments, the nucleic acid e.g. siRNA agent is administered to the subject once a month. In certain embodiments, the nucleic acid e.g. siRNA agent is administered once per quarter (i.e., every three months). After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months, or a year; or longer. The pharmaceutical composition can be administered once daily, or administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the nucleic acid e.g. siRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the nucleic acid e.g. siRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bimonthly. In certain embodiments, the siRNA is administered about once per month to about once per quarter (i.e., about once every three months), or even every 6 months or 12 months. Estimates of effective dosages and in vivo half-lives for the individual nucleic acid e.g. siRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as known in the art. The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular administration. In certain preferred embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In one embodiment, the nucleic acid e.g. siRNA agent is administered to the subject subcutaneously. The inhibitor e.g. nucleic acid e.g. siRNA can be delivered in a manner to target a particular tissue (e.g. in particular liver cells). METHODS FOR INHIBITING GENE EXPRESSION OR INHIBITION OF TARGET EXPRESSION OR FUNCTION IN VITRO The present invention also provides methods of inhibiting expression of SLC25A5 gene in a cell. The methods include contacting a cell with a nucleic acid of the invention e.g. siRNA agent, such as double stranded siRNA agent, in an amount effective to inhibit expression of the SLC25A5 gene in the cell, thereby inhibiting expression of the SLC25A5 gene in the cell. It is to be noted that a nucleic acid “for inhibiting the expression of SLC25A5” is a nucleic acid that is capable of inhibiting SLC25A5 expression, preferably as described herein below. Contacting of a cell with the nucleic acid e.g. an siRNA, such as a double stranded siRNA agent, may be done in vitro or in vivo. Contacting a cell in vivo with nucleic acid e.g. includes contacting a cell or group of cells within a subject, e.g., a human subject, with the nucleic acid e.g. siRNA. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand moiety, including any ligand moiety described herein or known in the art. In preferred embodiments, the targeting ligand moiety is a carbohydrate moiety, e.g. a GalNAc3 ligand, or any other ligand moiety that directs the siRNA agent to a site of interest. The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating", "suppressing", and other similar terms, and includes any level of inhibition. In some embodiments of the methods of the invention, expression or activity of a gene or an inhibition target is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay, preferably when determined by qPCR as described herein and / or when the siRNA is introduced into the target cell by transfection. In certain embodiments, the methods include a clinically relevant inhibition of expression of a target gene e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of the gene and / or activity of the target. In some embodiments, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an IC50 value below a defined threshold value. In some embodiments, the threshold value may be 2500 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM or 100 pM, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)- qPCR, as described herein. In a preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an IC50 value lower than 2500 pM. In a more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an IC50 value lower than 1000 pM. In an even more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an IC50 value lower than 500 pM. In a most preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an IC50 value lower than 100 pM. Inhibition of the SLC25A5 gene may be quantified by the following method: Huh7 cells (human hepatocyte-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS and 1% non-essential amino acids at 37˚C in an atmosphere of 5% CO2. Cells may then be transfected with siRNA duplexes targeting SLC25A5 mRNA or a negative control siRNA (siRNA-control; sense strand 5’-GCCTGTACCAAGGCTTTAA-3’ (SEQ ID NO: 1383), antisense strand 5’-TTAAAGCCTTGGTACAGGC-3’ (SEQ ID NO: 1382)) using six 10-fold serial dilutions over a finalduplex concentration range of 3 nM to 0.03 pM. Transfection may be carried out by adding 9.7 µL Opti- MEM (ThermoFisher) plus 0.3 µL Lipofectamine RNAiMAX (ThermoFisher) to 10 µL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 µL of complete growth medium containing 20,000 Huh7 cells. Cells may be incubated for 24 hours at 37˚C / 5% CO2prior to total RNA purification using a RNeasy 96 Kit (Qiagen). Each duplex may be tested by transfection in duplicate wells in a single experiment. cDNA synthesis may be performed using FastKing RT (with gDNase) Kit (Tiangen). Real-time quantitative PCR (qPCR) may be performed on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific forhuman SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO:1384), reverse:ACCCATGCCTCTGAGAACATT (SEQ ID NO:1385)) and human GAPDH (forward:GAAGGTGAAGGTCGGAGTC (SEQ ID NO:1386), reverse:GAAGATGGTGATGGGATTTC (SEQ IDNO:1387)) using a SensiFAST SYBR Hi-ROX kit (Meridian).qPCR may be performed in duplicate on cDNA derived from each well and the mean cycle threshold (Ct) calculated. Relative SLC25A5 expression may be calculated from mean Ct values using the comparative Ct (∆∆Ct) method, normalised to GAPDH and relative to untreated cells. Maximum percent inhibition of SLC25A5 expression and IC50 values may be calculated using a four parameter (variable slope) model using GraphPad Prism 9. In some embodiments, when transfected into the cells, the nucleic acid of the invention inhibits expression of the SLC25A5 gene with an pEC50 value lower than 5, 6, 7, 8, 9 or 10, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein. For that, Huh7 cells (human hepatocyte-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS and 1% non- essential amino acids at 37˚C, 5% CO2, 95% humidity. Cells may be transfected with siRNA duplexes targeting either SLC25A5 mRNA or a negative control siRNA (siRNA-control; sense strand 5’-GCCTGTACCAAGGCTTTAA-3’ (SEQ ID NO:1383), antisense strand 5’-TTAAAGCCTTGGTACAGGC-3’ (SEQ ID NO:1382)) in a 6-point, log dose response curve to give finalin assay concentrations of 3nM to 0.03pM. Transfection may be carried out by diluting Lipofectamine RNAiMAX (ThermoFisher) in Opti-MEM (ThermoFisher) medium at a ratio of 48.5:1.5. This solution may be added to an equal volume of siRNA, diluted to the required concentration in phosphate buffered saline. The lipofectamine RNAiMAX and siRNA mixture may be incubated at room temperature for 15 minutes before 20 µL may be added to wells of a 96 well plate. Huh7 cells may be dissociated from flasks using trypsin and resuspended at a density of 200,000 cells / mL. 100 µL of Huh7 cell suspension may be added to each well of the siRNA-containing 96-well plates. Cells may be incubated for 24 hours at 37˚C, 5% CO2,95% humidity. Each siRNA may be tested in triplicate wells and on two separate days for a total of six replicates. Intracellular RNA may be isolated using an Rneasy kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis may be performed using a FastKing RT kit, with gDNase (Tiangen). Target cDNA may be the quantified by qPCR on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO:1384),reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO:1385)) and human GAPDH (forward:GAAGGTGAAGGTCGGAGTC (SEQ ID NO:1386), reverse:GAAGATGGTGATGGGATTTC (SEQ IDNO:1387)) using a SensiFAST SYBR Hi-ROX kit (Meridian).qPCR may be performed in duplicate on cDNA derived from each well and the mean Ct calculated. Relative SLC25A5 expression may be calculated from mean Ct values using the comparative Ct (∆∆Ct) method, normalised to GAPDH and relative to untreated cells. Maximum percent inhibition of SLC25A5 expression and pEC50 values (-log10of the EC50) may be calculated using a four parameter (variable slope) model using NumPy (Python). Alternatively or in addition, inhibition of expression of the SLC25A5 gene may be characterized by a reduction of mean relative expression of the SLC25A5 gene. In some embodiments, when cells are transfected with 0.1 nM of the nucleic acid of the invention, the mean relative expression of SLC25A5 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, or 0.4, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein. In some embodiments, when cells are transfected with 5 nM of the nucleic acid of the invention, the mean relative expression of SLC25A5 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein. Mean relative expression of the SLC25A5 gene may be quantified by the following method: Huh7 cells (human hepatocyte-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS at 37˚C in at atmosphere of 5% CO2. Cells may be transfected with siRNA duplexes targeting SLC25A5 mRNA or a negative controlsiRNA (siRNA-control; sense strand 5’-GCCTGTACCAAGGCTTTAA-3’ (SEQ ID NO:1383), antisensestrand 5’-TTAAAGCCTTGGTACAGGC-3’ (SEQ ID NO:1382)) at a final duplex concentration of 5 nMand 0.1 nM. Transfection may be carried out by adding 9.7 µL Opti-MEM (ThermoFisher) plus 0.3 µL Lipofectamine RNAiMAX (ThermoFisher) to 10 µL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 µL of complete growth medium containing 20,000 Huh7 cells. Cells may be incubated for 24 hours at 37˚C / 5% CO2prior to total RNA purification using a Rneasy 96 Kit (Qiagen). Each duplex may be tested by transfection in duplicate wells in two independent experiments. cDNA ...

Claims

CLAIMS 1. An inhibitor of expression and / or function of SLC25A5 / ANT2, wherein said inhibitor is conjugated to one or more ligand moieties, preferably wherein the ligand moiety allows targeting of hepatocytes.

2. An inhibitor according to claim 1, wherein said inhibitor is an siRNA oligomer.

3. An inhibitor of expression and / or function of SLC25A5 / ANT2, wherein said inhibitor is an siRNA oligomer.

4. An inhibitor according to claim 3, wherein said inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties, preferably wherein the ligand moiety allows targeting of hepatocytes.

5. An inhibitor according to claim 1, 2 or 4, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one more GalNAc ligand derivatives.

6. An inhibitor according to claim 1, 2 or 4 wherein said one or more ligand moieties comprise one or more GalNAc ligand derivatives.

7. An inhibitor according to one or more preceding claims, wherein the target of the inhibitor is SLC25A5 / ANT2.

8. An inhibitor according to one or more preceding claims, wherein the inhibitor is a nucleic acid for inhibiting expression of SLC25A5 comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from SEQ ID NO: 280 or SEQ ID NO:

304.

9. An inhibitor according to one or more preceding claims, wherein the inhibitor is a nucleic acid for inhibiting expression of SLC25A5 comprising a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the SLC25A5 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from SEQ ID NO: 832 or SEQ ID NO:

856.

10. An inhibitor according claim 8 or 9, wherein the first strand comprises nucleosides 2-18 of any one of the sequences defined in claim 8 or 9.

11. An inhibitor according to claim 8, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from SEQ ID NO: 556 or SEQ ID NO: 580, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.

12. An inhibitor according to claim 9, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from SEQ ID NO: 1108 or SEQ ID NO: 1132, and wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.

13. An inhibitor according to claim 8, wherein the first strand comprises SEQ ID NO: 280 or SEQ ID NO:

304.

14. An inhibitor according to claim 9, wherein the first strand comprises SEQ ID NO: 832 or SEQ ID NO:

856.

15. An inhibitor according to claim 11, wherein the second strand comprises SEQ ID NO: 556 or SEQ ID NO:

580.

16. An inhibitor according to claim 12, wherein the second strand comprises SEQ ID NO: 1108 or SEQ ID NO: 1132.

17. An inhibitor according any one of claims 8 and 11, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Unmodified first strand Unmodified second strand SEQ ID NO: 280 SEQ ID NO: 556 SEQ ID NO: 304 SEQ ID NO: 580 18. An inhibitor according any one of claims 9 and 12, comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following combinations of first and second sequences: Modified first strand Modified second strand SEQ ID NO: 832 SEQ ID NO: 1108 SEQ ID NO: 856 SEQ ID NO: 113219. An inhibitor according any one of claims 8 to 18, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.

20. An inhibitor according any one of claims 8 to 19, wherein the second strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.

21. An inhibitor according any one of claims 8 to 20, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 or 23 nucleosides in length.

22. An inhibitor according any one of claims 8 to 21, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the SLC25A5 gene is between 17 and 30 nucleosides in length.

23. An inhibitor according any one of claims 8 to 22, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3’ terminus of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.

24. An inhibitor according any one of claims 8 to 23, wherein the nucleic acid is an siRNA oligonucleoside.

25. An inhibitor according to any one of claims 8 to 24, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage.

26. An inhibitor according to any one of claims 8 to 25, wherein the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5’ terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5’ terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5’ near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 5-5’ reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3’5’ when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.

27. An inhibitor, or inhibitor for use, according claim 25 or 26, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5’ terminal region of the second strand, or at a terminal region which is distal to the 3’ terminal region of the second strand.

28. An inhibitor according to claim 26, wherein (i) the first strand and the second strand each has a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 5’ near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5’ near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5’ near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5’ and 3’ terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5’ and 3’ terminal regions of said first strand is each attached to a respective 5’ and 3’ adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5’ and 3’ penultimate nucleoside is attached to a respective 5’ and 3’ adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3’ terminal region of the second strand.

29. An inhibitor according to claim 26 or 28, wherein the 2 consecutive inverted abasic nucleosides in the 5’ terminal region of the second strand present as the following 5’ terminal motifwherein: T represents a 2’Me ribose modification, B represents the nucleoside bases of the first two basic nucleosides in the 5' terminal region of the second strand, and Z represents the remaining 19 contiguous basic nucleosides of said second strand.

30. An inhibitor according to any one of claims 8 to 29, wherein the nucleic acid is conjugated directly or indirectly to one or more ligand moieties, optionally wherein said ligand moiety is present at a terminal region of the second strand, preferably at the 3’ terminal region thereof.

31. An inhibitor according to claim 30, wherein the ligand moiety comprises: (i) one or more N-acetyl galactosamine (GalNAc) ligands, and / or (ii) one or more N-acetyl galactosamine (GalNAc) ligand derivatives.

32. An inhibitor according to claim 31, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5’ or 3’ terminal region of the second strand of the nucleic acid, preferably at the 3’ terminal region thereof.

33. An inhibitor according to any one of claims 30 to 32, comprising the structure:wherein: R1at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R2is selected from the group consisting of hydrogen, hydroxy, -OC1-3alkyl, -C(=O)OC1-3alkyl, halo and nitro; X1and X2at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligonucleoside moiety.

34. An inhibitor according to claim 33, comprising the structure, wherein oligonucleotide represents the contiguous nucleosides of the second strand.

35. An inhibitor according to any one of claims 30 to 32, comprising the structure:wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleoside moiety.

36. An inhibitor according to claim 35, comprising the structure, wherein oligonucleotide represents the contiguous nucleosides of the second strand.

37. An inhibitor according to any one of claims 34 or 36, wherein the structure is conjugated to the 3’ terminal region of the second strand.

38. An inhibitor according to any one of claims 18, 29, 34 and 37.

39. An inhibitor according to any one of claims 18, 29, 36 and 37.

40. An inhibitor according to one or more preceding claims, formulated as a pharmaceutical composition with an excipient and / or carrier.

41. A pharmaceutical composition comprising an inhibitor according to one or more preceding claims, in combination with a pharmaceutically acceptable excipient or carrier.

42. An inhibitor according to any one of claims 1 to 40 or a pharmaceutical composition according to claim 41, for use in therapy.

43. An inhibitor according to any one of claims 1 to 40 or a pharmaceutical composition according to claim 41, for use in prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or for use in reducing adipogenesis.

44. Use of SLC25A5 / ANT2 as a target for identifying one or more therapeutic agents for the prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or for reducing adipogenesis.

45. A method of treating or preventing a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or obesity and / or a disease or disorder associated with adipogenesis and / or a method of reducing adipogenesis, which comprisesadministering to a patient an inhibitor of SLC25A5 / ANT2, such as an inhibitor as defined according to any one of claims 1 to 40, or a pharmaceutical composition comprising an inhibitor of SLC25A5 / ANT2, such as a composition as defined according to claim 41.

46. Use of an inhibitor according to any one of claims 1 to 40 or a pharmaceutical composition according to claim 41, in the preparation of a medicament for the treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis and / or for reducing adipogenesis.

47. SLC25A5 / ANT2 for use as a biomarker of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis.

48. SLC25A5 / ANT2 for use in an in vivo method of predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis, typically by monitoring the sequence and / or level of expression and / or function of SLC25A5 / ANT2 in a sample obtained from a patient.

49. A method of predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis, and optionally treating said metabolic disease or disorder, in a patient, said method comprising: (a) obtaining a sample from the patient, (b) detecting the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient, (c) predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD) and / or obesity and / or a disease or disorder associated with adipogenesis, based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient, (d) preferably administering to the diagnosed patient an effective amount of an inhibitor of SLC25A5 / ANT2, preferably an inhibitor of SLC25A5 / ANT2 according to any one of claims 1 to 40, or of a pharmaceutical composition comprising an inhibitor of SLC25A5 / ANT2, such as a composition as defined according to claim 41.

Citation Information

Patent Citations

  • Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna

    KR1020150086442A

  • Compositions and methods for enhancing production of a biological product

    WO2011005786A2

  • Oligonucleotide compounds comprising non-nucleotide overhangs

    WO2011084193A1

  • Chinese hamster ovary (CHO) cell transcriptome, corresponding sirnas and uses thereof

    WO2012005898A2

  • Rnai agents and compositions for inhibiting expression of apolipoprotein c-iii (APOC3)

    WO2019051402A1