Biosynthetic gene cluster for polyene macrolide natural product mandimycin, and natural product and use thereof
By discovering and utilizing mandiimycin biosynthesis gene clusters, constructing the engineered bacteria CPU002 and biosynthesis of a new antifungal antibiotic mandiimycin B, the problems of increasing resistance to existing polyene antifungal drugs and major toxic and side effects are solved, and effective inhibition and low toxicity effects on multidrug-resistant fungi are achieved.
Patent Information
- Application Number
- PCT/CN2024/138651
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-14
- Filing Date
- 2024-12-12
- Publication Date
- 2025-06-26
AI Technical Summary
Due to long-term use of existing polyene antifungal drugs, the fungal resistance has increased, the toxic and side effects are large, and the oral utilization is low, and it is ineffective against multidrug-resistant fungi, limiting its scope of clinical application.
By discovering and utilizing the biosynthetic gene cluster of mandimycin, the key glycosyltransferase gene was knocked out through genetic operation, the engineering bacteria CPU002 was constructed, and a new antifungal antibiotic, mandimycin B was biosynthetic.
mandimycin B has a strong broad-spectrum antifungal activity, is effective against a variety of fungal priority multidrug-resistant pathogenic microorganisms published by WHO, and does not develop drug resistance under laboratory conditions, and has low toxicity and good water solubility.
Smart Images

Figure CN2024138651_26062025_PF_FP_ABST
Abstract
Description
A polyene macrolide natural product mandimycin biosynthetic gene cluster and its natural products and applications Technical Field
[0001] The present invention belongs to the field of microbial natural products, and in particular relates to a polyene macrolide natural product mandimycin biosynthetic gene cluster, and natural products and applications thereof. Background Art
[0002] With the widespread use of antifungal drugs, the increasing number of immunodeficient and immunocompromised patients, and the limited availability of antifungal drugs, fungal infections have become a major safety issue threatening human health. Therefore, there is an urgent need to find new antifungal drugs. Currently, the main antifungal drugs used in clinical practice include echinocandins (such as carbofungin), polyene macrolides (such as amphotericin B), azoles (such as fluconazole), and 5-fluorocytosine (Nature reviews microbiology 2022; 20: 9 557-571). Among them, polyene macrolide antibiotics, represented by amphotericin B, have broad-spectrum, potent antifungal activity and low drug resistance. Since the 1950s, they have been the first-line antifungal drug in clinical practice and are listed in the WHO's list of essential drugs for the treatment of fungal infections (Antibiot Annu. 1955; 3: 587-91; Curr Opin Microbiol. 2022; 70: 102-208). At present, a variety of polyene antibiotics with different structural types have been isolated from nature. Their main skeletons mainly contain 26-ring, 28-ring, 36-ring and 38-ring macrocyclic structures, 3 to 7 double bond structures, and 1-2 deoxy sugar substituent structures (Mol Phylogenet Evol. 2018; 127: 239-247). Currently known polyene antibiotics mainly bind to the steroid molecule ergosterol on the fungal cell membrane to form a transmembrane channel, releasing important intracellular ions and small molecules, thereby killing fungal pathogens and exerting potent antifungal activity (Proc Natl Acad Sci US A. 2012; 109(7): 2234-9; Proc Natl Acad Sci US A. 2011; 108(17): 6733-8).
[0003] Although marketed polyene antifungal drugs (such as amphotericin B, nystatin, and natamycin) possess significant bactericidal activity, a broad spectrum, and relatively low resistance to fungal pathogens, making them potent antifungal agents, long-term use has led to increasing fungal resistance, and their extremely low water solubility and severe toxic side effects have rendered existing polyene antifungal drugs inadequate for clinical use. In addition to its broad-spectrum and potent activity, amphotericin B's prominent advantage is its low resistance potential. However, its disadvantages include its inactivity against clinically emerging multidrug-resistant bacteria, significant toxic side effects, and low oral availability, which limit its clinical application. Summary of the Invention
[0004] Purpose of the Invention: To address the problems existing in the prior art, the present invention aims to provide a gene cluster for the biosynthesis of the polyene macrolide natural product mandimycin. The nucleotide sequence of the mandimycin biosynthetic gene cluster is shown in SEQ ID NO. 1. The gene cluster of the present invention can produce a novel polyene macrolide antifungal natural product. Furthermore, the present invention uses genetic manipulation to knock out a key glycosyltransferase gene in the mandimycin biosynthetic gene cluster to construct an engineered bacterium, CPU002. The CPU002 engineered strain biosynthesizes mandimycin B, a novel antifungal antibiotic natural product lacking atratcynose A. This solves the technical problems currently encountered in clinical practice, such as the limited variety of antifungal drugs, significant toxic side effects, low oral availability, and ineffectiveness against multidrug-resistant fungi, which limit their clinical application. The present invention also provides the polyene macrolide natural products mandimycin and mandimycin B, and their uses.
[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a polyene macrolide natural product mandimycin biosynthetic gene cluster, the nucleotide sequence of the mandimycin biosynthetic gene cluster is shown in SEQ ID NO.1.
[0006] The method for preparing the polyene macrolide natural product mandimycin of the present invention comprises the following steps:
[0007] The strain containing the mandimycin biosynthesis gene cluster is subjected to seed liquid preparation, the seed liquid is fermented and cultured, and the natural product mandimycin is obtained by extraction, separation and purification.
[0008] Wherein, the strain containing the mandimycin biosynthesis gene cluster is Streptomyces netropsis DSM 40259.
[0009] The invention discloses an application of a polyene macrolide natural product mandimycin biosynthesis gene cluster in the preparation of natural product mandimycin and natural product mandimycin B.
[0010] The method for preparing the polyene macrolide antifungal natural product mandimycin B of the present invention comprises the following steps:
[0011] The MandQ gene in the strain containing the mandimycin biosynthetic gene cluster was knocked out to obtain an engineered bacterium, which was prepared into a seed liquid for cultivation, fermentation, extraction, separation and purification to obtain the natural product mandimycin B; the nucleotide sequence of the MandQ gene is shown in SEQ ID NO.2.
[0012] Among them, the MandQ gene in the mandimycin biosynthesis gene cluster in Streptomyces netropsis DSM 40259 was knocked out by indirect transfer between Streptomyces and Escherichia coli to obtain the CPU002 engineered bacterium. The obtained glycosyltransferase-deficient engineered bacterium CPU002 was fermented, extracted, separated and purified to obtain mandimycin B.
[0013] The present invention provides a polyene macrolide natural product mandimycin or mandimycin B and a pharmaceutically acceptable salt thereof. The structural formula of the natural product mandimycin compound is shown in Formula I, and the structural formula of the natural product mandimycin B compound is shown in Formula II:
[0014] Furthermore, the core mother ring of the polyene macrolide natural product mandimycin structural formula or the mandimycin B structural formula is a 38-membered macrolide, wherein: C20-C29 are conjugated pentaene structures, C32 is a monoene structure; C19 is connected to a mycarose; C3, C7, C10, and C13 are connected to a β-hydroxyl group; C15 is connected to an α-hydroxyl group; C13 and C15 are connected through an oxygen bridge; C1 is an ester group; C5 is a ketone group; C34, C36, and C37 are connected to an α-methyl group; and C16 is connected to a formic acid.
[0015] The invention discloses an application of the polyene macrolide natural product mandimycin or mandimycin B and pharmaceutically acceptable salts thereof in the preparation of antifungal drugs.
[0016] Furthermore, the fungus is any one of a variety of key fungal pathogens such as Candida, Aspergillus, Cryptococcus, Mucor and Fusarium.
[0017] Furthermore, the Candida is Candida albicans, Candida auris, Candida glabrata, Candida tropicalis or Candida parapsilosis.
[0018] The present invention provides a pharmaceutical composition of an antifungal drug, comprising the polyene macrolide natural product mandimycin or the natural product mandimycin B and a pharmaceutically acceptable carrier.
[0019] Furthermore, the pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral solution, inhalant, ointment, suppository or patch.
[0020] The invention relates to an application of the antifungal drug composition in the preparation of antifungal drugs.
[0021] Furthermore, the fungus is any one of a variety of key fungal pathogens such as Candida, Aspergillus, Cryptococcus, Mucor and Fusarium.
[0022] The present invention discovered a mandimycin-BGC gene cluster expressing the biosynthesis function of mandimycin from the Microbial Secondary Metabolites Database (MiSM) through a systematic evolution-guided directional mining method.
[0023] mandimycin-BGC contains 6 core genes (mandD, mandE, mandF, mandL, mandM, mandN) encoding 19 polyketide synthase modules.
[0024] Combinatorial biosynthesis has led to the discovery of a natural product, mandimycin, with potent and broad-spectrum anti-multidrug-resistant fungal activity. Mandimycin has a unique chemical structure consisting of three deoxysugar substituents (including a mycosamine at C19, a dideoxysaccharide atratcynose A (α-L-oleandropyranosoyl-(1→4)-β-D-digitoxopyranoside) at C35, a pentaene structural unit at C20, a monoene structural unit at C32, and a 38-membered ring with a keto group at the 5th position.
[0025] The mandimycin compound of the present invention is a natural product produced by fermentation of Streptomyces netropsis DSM 40259. This Streptomyces strain was screened using a targeted mining technique that combines big data analysis, phylogenetic analysis, and cluster analysis. Using the conserved mycosyltransferase as a sequence tag, a hidden Markov model was used to mine all biosynthetic gene clusters expressing the carbonase sugar sequence tag from the Microbial Secondary Metabolites Database (MiSM). This targeted mining, combined with phylogenetic analysis, yielded a novel branch of the biosynthetic gene cluster, mandimycin-BGC. The gene sequence is shown in SEQ ID NO. 1. Analysis of strains potentially harboring this gene cluster revealed this specific Streptomyces strain (DSM 40259), which contains the mandimycin-BGC biosynthetic gene cluster. Mandimycin is unstable in acidic conditions and easily dehydrates and loses side chain sugars. Therefore, neutral or weakly alkaline organic solvents are used to dissolve mandimycin.
[0026] To investigate the compound's mechanism of action, feeding experiments, scanning electron microscopy, ion concentration measurements, and isothermal calorimetric titration were employed. The preparation of mandimycin required exploring fermentation conditions to remove fermentation byproducts, and extracting, separating, and purifying the crude product.
[0027] The present invention discovered a new antifungal drug target. Mandimycin targets the phospholipid molecules in the fungal cell membrane (including phosphatidylinositol, phosphatidylglycerol, phosphatidylserine, phosphatidylethanolamine, phosphatidylcholine, sphingomyelin, and cardiolipin), especially phosphatidylinositol, causing the important intracellular ions (including K + This mechanism has not been reported in antifungal drugs.
[0028] Due to its unique multi-target mechanism of action, mandimycin does not produce drug resistance under laboratory conditions and has potent activity against clinical antifungal drug-resistant strains.
[0029] This study discovered a novel biosynthetic gene cluster from the strain Streptomyces netropsis DSM 40259 through pan-genome mining. Further fermentation, purification, and knockout experiments confirmed that its product is mandimycin. Mandimycin is a polyene macrolide antifungal antibiotic with a novel mechanism of action. It targets phospholipids, particularly phosphatidylinositol structures, on the fungal cell membrane, leading to the excretion of important intracellular ions and small molecules, resulting in fungal death. Mandimycin exhibits potent, broad-spectrum antifungal activity against a variety of key fungal pathogens, including Candida, Aspergillus, Cryptococcus, Mucor, and Fusarium. Furthermore, the present invention utilizes indirect transfer between Streptomyces and Escherichia coli to knock out the glycosyltransferase MandQ in the mandimycin BGC, responsible for the synthesis of atratcynose A, through gene knockout technology. This resulted in an engineered strain, CPU002, lacking the glycosyltransferase. This engineered strain was then used for fermentation to biosynthesize mandimycin B, a novel polyene macrolide natural product. Mandimycin B of the present invention is a natural product produced by fermentation of the engineered strain CPU002, that is, the MandQ gene in the mandimycin biosynthetic gene cluster in Streptomyces netropsis DSM 40259 is knocked out by gene knockout technology, and the obtained CPU002 engineered strain is cultured and fermented in FS / 9 medium.
[0030] During the preparation and synthesis of the natural product mandimycin B, the present invention discovered MandQ, a key enzyme responsible for the synthesis of mandimycin atratcynose A. Through gene knockout, 1072 genes in MandQ were deleted, disrupting the MandQ glycosyltransferase function and generating an engineered strain CPU002 lacking the MandQ enzyme. This engineered strain CPU002 was then used to synthesize a novel mandimycin derivative, mandimycin B, that lacks atratcynose A. Experiments revealed that mandimycin B also exhibits potent and broad-spectrum antifungal activity. Unlike mandimycin, mandimycin B exerts its antifungal activity by binding to ergosterol on fungal cell membranes. The novel mandimycin derivative, mandimycin B, provided by the present invention differs from the mandimycin compound in that, although it shares the same nucleus as mandimycin, it lacks the key disaccharide structure of atratcynose A and therefore lacks the disaccharide structural unit of atratcynose A. Mandimycin B has a different mechanism of action from mandimycin. It exerts its antifungal activity by binding to ergosterol on the fungal cell membrane and has no affinity for the mandimycin-binding target phospholipid molecules.
[0031] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0032] The present invention proposes for the first time a biosynthetic gene cluster of the polyene macrolide natural product mandimycin, and prepares a strain containing the mandimycin biosynthetic gene cluster into a seed liquid for cultivation, fermentation, extraction, separation and purification to obtain the natural product mandimycin.
[0033] The natural product mandimycin obtained by the present invention has potent antibacterial activity and a broad antibacterial spectrum against various WHO-listed priority multidrug-resistant pathogenic microorganisms, including Candida, Aspergillus, and Cryptococcus. The compound exhibits a minimum inhibitory concentration (MIC) of 0.25-1 μg / mL, which is 1-2 times that of clinically used nystatin, and is comparable in activity to amphotericin B, against Candida, particularly multidrug-resistant strains including Candida albicans and Candida auris. The compound also exhibits activity against multidrug-resistant Cryptococcus neoformans, reaching 0.125 μg / mL, 32 times that of carbofungin, 64 times that of fluconazole, and 128 times that of 5-fluorocytosine. It also exhibits activity against multidrug-resistant Aspergillus fumigatus, reaching 2 μg / mL, 32 times that of fluconazole and 16 times that of 5-fluorocytosine. The compound also exhibits excellent antibacterial activity against amphotericin B-resistant strains. This indicates that mandimycin has broad-spectrum antifungal activity and potent antibacterial activity against clinically resistant strains of antifungal drugs. The natural product mandimycin B of the present invention has potent antibacterial activity and a broad antibacterial spectrum against a variety of WHO-listed priority multidrug-resistant pathogenic microorganisms, including Candida, Aspergillus, and Cryptococcus. The minimum inhibitory concentration (MIC) against Candida, especially multidrug-resistant strains including Candida albicans and Candida auris, is between 1 and 2 μg / mL. The activity against multidrug-resistant Cryptococcus neoformans reaches 0.5 μg / mL, and against multidrug-resistant Aspergillus fumigatus reaches 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine.
[0034] The target of the natural product mandimycin of the present invention is different from the target of known antifungal drugs. Instead, it acts on the phospholipid components on the fungal cell membrane. Among them, the phosphatidylinositol on the fungal cell membrane is the target with the best binding force. d The value is 21.9μM; followed by phosphatidylglycerol target, K d The value is 28.2 μM; phosphatidylserine target, K d The value is 30.9 μM; phosphatidylethanolamine target, K d The value is 36.5 μM; phosphatidylcholine target, K d The value is 36.8 μM; sphingomyelin target, K d The value is 50 μM; cardiolipin target, K d The value was 63.6 μM. Furthermore, under laboratory conditions, low concentrations of mandimycin did not produce drug-resistant bacteria. Compared to amphotericin B, the compound of the present invention has better water solubility, which is 9700 times that of amphotericin B.
[0035] Antifungal activity tests in mice showed that mandimycin had significant antifungal activity against multidrug-resistant Candida albicans and multidrug-resistant Candida auris, showing a dose-dependent effect. At a dose of 5 mg / kg, the number of Candida albicans BNCC186382 fungal cells was reduced by 3 log10, and the number of Candida auris BNCC357785 fungal cells was reduced by 2 log10; at a dose of 10 mg / kg, the number of Candida albicans BNCC186382 fungal cells was reduced by 3.6 log10. At a dose of 20 mg / kg, the number of Candida albicans BNCC186382 fungal cells was reduced by 4.2 log10, and the number of Candida auris BNCC357785 fungal cells was reduced by 3 log10. In a model of pan-drug-resistant Candida auris infection resistant to amphotericin B, mandimycin still showed good in vivo activity, with the strain content decreasing by 2.3 log10 at 10 mg / kg. No acute toxicity was observed in in vivo animal experiments at all different concentrations. The natural product mandimycin of the present invention can be used to prepare antifungal drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 shows the mandimycin biosynthesis gene cluster mining process;
[0037] Figure 2 shows the biosynthetic gene cluster and structure of mandimycin;
[0038] Figure 3 shows the predicted biosynthesis process of mandimycin;
[0039] FIG4 is a UV spectrum of mandimycin;
[0040] Figure 5 is a comparison of HPLC and activity of products of mandimycin gene knockout strain and wild-type strain;
[0041] FIG6 is a high-resolution mass spectrum of mandimycin (A: positive ion, B: negative ion);
[0042] Figure 7 shows mandimycin 1 H-NMR (DMSO-d6) nuclear magnetic resonance spectrum;
[0043] Figure 8 shows mandimycin 13 C-NMR (DMSO-d6) nuclear magnetic resonance spectrum;
[0044] FIG9 is a HSQC-NMR (DMSO-d6) nuclear magnetic resonance image of mandimycin;
[0045] Figure 10 is a HMBC-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin;
[0046] Figure 11 is a COSY-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin;
[0047] Figure 12 is a ROESY-NMR (DMSO-d6) nuclear magnetic resonance spectrum of mandimycin;
[0048] Figure 13 shows the structure and two-dimensional NMR signal spectrum of mandimycin;
[0049] FIG14 is a chiral bioinformatics analysis of mandimycin polyketide reductase;
[0050] Figure 15 shows the cytotoxicity of mandimycin to HepG2 cells;
[0051] Figure 16 shows the hemolytic activity of mandimycin;
[0052] Figure 17 shows the in vivo antifungal activity of mandimycin, (A) multidrug-resistant Candida albicans BNCC186382 infection model; (B) multidrug-resistant Candida albicans BNCC357785 infection model; (C) pan-drug-resistant Candida auris AMR05 infection model;
[0053] Figure 18: Mouse model of disseminated candidiasis;
[0054] Figure 19 Invasive candidiasis mouse model;
[0055] Figure 20 Mouse fungal skin infection model;
[0056] Figure 21: Mouse vaginitis infection model;
[0057] Figure 22 In vivo pharmacokinetic study of mandimycin;
[0058] Figure 23: In vivo nephrotoxicity evaluation of mandimycin;
[0059] Figure 24 shows the resistance results of mandimycin and the fold change of activity against other polyene-resistant bacteria, including (A) amphotericin B-resistant bacteria, (B) natamycin-resistant bacteria, and (C) nystatin-resistant bacteria;
[0060] Figure 25 is the bactericidal curve of mandimycin;
[0061] FIG26 shows the state of Candida albicans cells observed under a scanning electron microscope after treatment with mandimycin;
[0062] Figure 27 shows the changes in K + concentration after mandimycin treatment of Candida albicans;
[0063] FIG28 is an inhibition curve of mandimycin activity by different components of fungal cells;
[0064] Figure 29 is the exothermic curve of phospholipid small molecules to mandimycin;
[0065] FIG30 is a 1072 bp fragment of MandQ in the mandimycin gene cluster after gene knockout;
[0066] Figure 31 shows the HPLC determination of mandimycin B;
[0067] Figure 32 shows the expression of mandimycin B. 1 H spectrum;
[0068] Figure 33 shows mandimycin B 13 C spectrum;
[0069] Figure 34 is a HSQC spectrum of mandimycin B;
[0070] Figure 35 is the HMBC spectrum of mandimycin B;
[0071] Figure 36 is a COSY spectrum of mandimycin B;
[0072] Figure 37 is a TOCSY spectrum of mandimycin B;
[0073] FIG38 shows the correlation between the key HMBC and COSY spectra of mandimycin B;
[0074] FIG39 is UV-vis confirmation of mandimycin B target sites;
[0075] FIG40 shows the target site of mandimycin B determined by ITC. DETAILED DESCRIPTION
[0076] The technical solutions of the present invention are further described below with reference to the accompanying drawings. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Experimental methods in the examples where specific conditions are not specified are generally performed under conventional conditions or those recommended by the manufacturer.
[0077] Streptomyces netropsis DSM 40259 was purchased from DSMZ. Casein pancreatic digest (purchased from Guangdong Huankai Microbiology Technology Co., Ltd., catalog number 024048). Soybean digest (purchased from Beijing Hongrun Baoshun Technology Co., Ltd., catalog number Y030A 220816). Beef extract (purchased from Beijing Hongrun Baoshun Technology Co., Ltd., catalog number Y014C 230809) was also used.
[0078] Example 1
[0079] Discovery of the mandimycin biosynthetic gene cluster
[0080] As shown in Figure 1, the mandimycin biosynthesis gene cluster mining process is based on the sequence information of mycosyltransferases of known polyene macrolide natural products (Table 1). The conserved protein structure sequence is analyzed and the hidden Markov model of the unique polyene macrolide mycosyltransferase is constructed. The model is used to scan the sequence similarity of the microbial secondary metabolite database. For the similarity value less than 1e -181 The protein sequence is considered to be a carbonase sugar sequence related to polyolefin natural products, and the functional gene cluster in which it is located is a potential new polyolefin natural product encoding functional gene cluster. Through this method, 280 deduplicated candidate sequences were retrieved, and a phylogenetic tree was constructed for these sequences. The phylogenetic relationship between different sequences was analyzed, as shown in Figure 2. The results showed that a new evolutionary branch was found, encoding a new polyolefin natural product. We named this BGC mandimycin-BGC, and the sequence is shown in SEQ ID NO.1. As shown in Figure 3, the predicted biosynthesis process of mandimycin is shown, and the functional annotations of the biosynthetic genes are shown in Table 2. Further screening found that the biosynthetic gene cluster mandimycin-BGC is contained in the fermentation of Streptomyces netropsis DSM 40259, which can be used for the fermentation of the natural product mandimycin.
[0081] Table 1 Carbonase sugar sequence information of known rare macrolide natural products
[0082] Table 2 Functional annotation of the mandimycin biosynthesis gene cluster
[0083] Example 2
[0084] Biofermentation of mandimycin
[0085] (1) Preparation of spore suspension
[0086] Streptomyces netropsis DSM 40259, which contains the mandimycin biosynthetic gene cluster, was plated on ISP4 solid medium (containing 10.0 g soluble starch, 1.0 g potassium hydrogen phosphate, 1.0 g magnesium sulfate, 1.0 g sodium chloride, 2.0 g ammonium sulfate, 2.0 g calcium sulfate, 0.001 g ferrous sulfate, 0.001 g manganese chloride, 0.001 g zinc sulfate, and 15.0 g agar per liter, pH = 7.2) and cultured at 30°C for 5 days to prepare a spore suspension.
[0087] (2) Preparation of seed solution:
[0088] 1 mL of spore suspension was inoculated into 50 mL of TSB medium (containing 17.0 g of casein pancreatic digest, 3.0 g of soybean digest, 5.0 g of sodium chloride, 2.5 g of potassium hydrogen phosphate, and 2.5 g of glucose monohydrate per liter, pH = 7.3) and placed in a shaker (conditions: speed 200 rpm, temperature 30°C) and cultured for 2 days to prepare seed solution.
[0089] (3) Preparation of fermentation broth:
[0090] 0.5 mL of the seed solution prepared in step (2) of this example was transferred to 50 mL of F2 fermentation medium (containing 69.0 g glucose, 25.0 g beef extract, 9.0 g CaCO3, and 0.1 g KH2PO4 per liter of culture medium) and cultured for 10 days (shaker speed 200 rpm, 30°C) to prepare a fermentation broth.
[0091] Example 3
[0092] Extraction, separation and purification of mandimycin
[0093] After the fermentation, n-butanol was added to the fermentation bottle (the volume ratio of fermentation broth to n-butanol was 1:1) and stirred overnight for extraction (100 rpm). The n-butanol extract was dried using a rotary evaporator and dissolved in methanol to obtain a crude extract. The crude extract was purified by a two-step method. First, isocratic elution was used and YMC-GEL C 18Column chromatography was performed on a powdered (12 nm × 50 μm) column equilibrated with 2 cv of 10% methanol (H₂O:CH₂OH 9:1). The methanol solution was added and eluted with various concentrations of methanol-water (10%, 30%, 50%, 70%, 90%, and 100%), using a 100 mL vial. Fractions were analyzed by UPLC-MS. Fractions containing mandimycin (eluent containing 90% methanol-water) were collected and spin-dried. UPLC-MS conditions were as follows: a C₁8 column (Waters, T3-1.8 μm, 2.1 × 100 mm), mobile phases: phase A (purified water with 0.1% formic acid), phase B (acetonitrile with 0.1% formic acid), flow rate 0.6 mL / min, mobile phase B gradient from 30% to 90% at 10% increments per minute. MS detection range 200–2000 was used in both positive and negative modes. The semi-pure product was then further purified using semi-preparative reversed-phase high-performance liquid chromatography (RP-HPLC). RP-HPLC conditions were as follows: a C18 column (Shimadzu, ShimNet HE C18-AQ, 5μm OBD, 19×250mm column), solvent A: deionized water; solvent B: acetonitrile. The flow rate was 3 mL / min, the gradient of solvent B was 30%-90%, increasing by 1.5% per minute, and full wavelength detection was performed (190 nm-800 nm). As shown in Figure 4, the UV spectrum of mandimycin contains characteristic UV absorption peaks (320, 335, and 352 nm) of conjugated pentaene. Mandimycin natural product (yellow powder) with a purity exceeding 95% was collected as the purified natural product mandimycin, with a yield of 4-6 mg / L fermentation broth.
[0094] Example 4
[0095] In vivo knockout validation of mandimycin
[0096] In order to study the relationship between mandimycin-BGC and conjugated pentaene polyene natural products, genetic manipulation was performed on the Streptomyces that produces this compound. 1 kb homology arms upstream and downstream of mandL were amplified by PCR (primer sequences are shown below) and cloned into the pKC1139 vector to construct the pKC1139-MandL_KO knockout vector. The latter was used to knock out the key 692 base sequences from -334 to +358 of MandL through Streptomyces conjugation transfer experiments (shown in Table 2). A comprehensive comparative analysis of secondary metabolites was performed on the wild-type and knockout strains, as shown in Figure 5, confirming that the conjugated pentaene natural product was the biosynthetic product of mandimycin-BGC, and the compound was named mandimycin.
[0097] Example 5
[0098] Structural identification of mandimycin
[0099] The purified mandimycin in Example 3 was a yellow powder. As shown in FIG6 , OrbiTrap high-resolution analysis showed that its protonated ion was m / z 1198.6344 [M+H] + ; m / z 1196.6228[MH] - , indicating that its molecular formula is C 60 H 95 NO 23 (Δppm-1.97), containing 14 double bond equivalents (DBE). As shown in Figure 4, the UV-visible spectrum of mandimycin in methanol shows that the maximum absorption wavelengths are 320, 335 and 352 nm, respectively, indicating the presence of a conjugated pentaene structure. The mandimycin separated and purified in Example 4 was dissolved in deuterated DMSO, and a 700M nuclear magnetic resonance instrument was used to obtain H spectra, C spectra, and two-dimensional spectra such as HSQC, HMBC, and COSY, as shown in Figures 7-12, to determine the structure of mandimycin. 1 H and 13 C NMR spectroscopy data showed 12 allylic protons (δ H 5.60-6.30, δ C 129.0-136.0), multiple oxygen-containing methylene (δ C 63.0-87.0) and three carbonyl groups (δ C 208.4, 174.8 and 170.1), indicating that mandimycin has a highly oxidized polyene macrocyclic ketone skeleton. A series of 2D NMR techniques (HSQC, HMBC, COSY, ROSEY) were used to analyze and confirm a 38-membered macrocyclic ketone skeleton. In addition, H-3 (δ H 4.29), H-4(δ H 2.53; 2.59) and H-6 (δ H 2.42, 2.47) to C-5 (δ C 208.4), further confirming that C5 was substituted by a keto group, which was different from the hydroxyl or methylene substitution of C5 in other 38-membered macrocyclic ketopolyene antibiotics.
[0100] By corresponding to the three acetal carbons (δ H-1′ 4.49, δ C-1′ 96.8; δ H-1″ 4.42, δ C-1″ 99.5; δ H-1″′ 4.61, δ C-1″′100.0) NMR signals confirmed the presence of three sugar groups in the structure of mandimycin. COSY and HMBC spectral analysis revealed the presence of a mycosamine, a digitoxose, and a 3-O-methyldigitoxose in mandimycin. H 4.49) to C-19(δ C 74.7) was observed, confirming the C-19 connection of mycosamine to the macrocyclic ketone. H 4.42) to C-35(δ C 84.1) supported the HMBC correlation, confirming the connection of digitoxose to C-35. H 4.61) to C-4″(δ C 86.8) confirmed the formation of a glycosidic bond between 3-O-methyldigitoxose and digitoxose at C-1′ and C-4′. This is the first report of a trisaccharide substitution in a polyene macrolide antibiotic. 1 H and 13 The C spectrum (DMSO-d6) NMR data are shown in Table 3.
[0101] Table 3 Mandimycin 1 H and 13 C spectrum (DMSO-d6) NMR data *The assignment of some carbon signals was supported by HSQC and HMBC correlations. # The coupling constants for proton signals were not provided as most signals are highly overlapped or broad.
[0102] Furthermore, based on H spectra, C spectra, HSQC, HMBC, COSY and other two-dimensional spectra (Figures 7-13), as well as chiral bioinformation of mandimycin polyketide synthase (Figure 14), the specific configurations of the natural product mandimycin of the present invention are 2R, 10R, 11S, 12S, 13R, 14R, 16R, and 18R. The natural product mandimycin is shown in Formula I:
[0103] Example 6
[0104] Aqueous solubility of mandimycin
[0105] Methanol stock solutions of amphotericin B (1.2 mg / mL) and mandimycin (12 mg / mL) purified as described in Example 3 were prepared. A 100 μL portion of each stock solution was freeze-dried under vacuum for 24 hours. 50 μL (amphotericin B) or 2 μL (mandimycin) of 10 mmol Tris-HCl buffer (pH = 7.0) was added to the freeze-dried samples, and the solutions were saturated by vortexing for 15 minutes. The supernatants were centrifuged at 12,000 rpm for 3 minutes, and the resulting supernatants were diluted in Tris-HCl buffer (amphotericin B diluted 10-fold; mandimycin diluted 1000-fold). 10 μL of the sample was injected and the concentration of the compound in the solution was determined by measuring the UV absorption spectrum using a Shimadzu PDA detector spectrophotometer. Specifically, amphotericin B and mandimycin were accurately weighed and dissolved in DMSO to prepare a 2 mg / mL stock solution. Amphotericin B was quantified using the peak area of its characteristic UV heptaene peak at a maximum absorbance of 384 nm; mandimycin was quantified using the peak area of its characteristic UV pentaene peak at a maximum absorbance of 334 nm. Standard curves were plotted for the relationship between UV absorption peak area and mass for mandimycin and amphotericin B, respectively, to calculate the solubility of mandimycin and amphotericin B in aqueous solution. As shown in Table 4, the solubility of mandimycin was 8.07 mg / mL, 9700 times that of amphotericin B.
[0106] Table 4 Solubility test of mandimycin
[0107] Example 7
[0108] Bioactivity analysis of mandimycin
[0109] (1) In vitro activity detection against multidrug-resistant bacteria
[0110] The antibacterial activity of mandimycin against priority fungal pathogens published by the WHO was determined using CLSI standards. The results are shown in Table 5 below. Mandimycin has potent and broad-spectrum activity against multidrug-resistant fungi.
[0111] Table 5 Antifungal activity of mandimycin
[0112] Note:CPFR ,Caspofungin resistance;FCA R ,Fluconazole resistance;TBF R ,Terbinafine resistance; 5-FU R ,5-Fluorocytosine resistance;Amp R ,Amphotericin B resistance.All MIC values were measured in duplicate and repeated three independent times with consistent results.
[0113] At the same time, under the same experimental conditions mentioned above, the minimum inhibitory concentration (MIC) of the natural product mandimycin against multidrug-resistant bacteria including Candida albicans and Candida auris was 1-2 times that of the clinically used nystatin A1, and was equivalent to the activity of amphotericin B, ranging from 0.25-1μg / mL; the activity against multidrug-resistant Cryptococcus neoformans reached 0.125μg / mL, which is 32 times that of carbofungin, 64 times that of fluconazole, and 128 times that of 5-fluorocytosine; the activity against multidrug-resistant Aspergillus fumigatus reached 2μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine; and it showed good antibacterial activity against amphotericin B-resistant strains.
[0114] (2) Cytotoxicity of mandimycin
[0115] The cytotoxicity of mandimycin was determined using the MTT (2-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay. HepG2 cells cultured in DMEM (10% fetal bovine serum) were seeded into 96-well flat-bottom microplates (2,500 cells per well) and incubated at 37°C and 5% CO2. After 24 hours, the medium was aspirated and 100 μl of fresh medium containing a concentration series of mandimycin (maximum DMSO concentration less than 0.25%) was added. After incubation at 37°C for 48 hours, the medium was removed and 110 μl of MTT solution (10 μl of 5 mg / ml MTT premixed in mandimycin and 100 μl of DMEM) was added to each well. After incubation at 37°C and 5% CO2 for 3 hours, 100 μl of lysis buffer (40% DMF, 16% SDS, and 2% acetic acid in water) was added to solubilize the precipitate. The absorbance of each well was then measured at an OD of 570 nm using a microplate reader (Epoch Microplate Spectrophotometer, BioTek). Amphotericin B was used as a positive control. IC50 values were calculated (Prism 7.0) as the concentration of each compound required to inhibit cell growth by 50% relative to the no-compound control. The IC50 for mandimycin against Hepg2 cells was 57.56 μM, against HK2 cells was 88.67 μM, against PANC-1 cells was 48.28 μM, and against SK-Hep-1 cells was 76.70 μM. As shown in Figure 15, mandimycin exhibited low toxicity.
[0116] (3) Hemolytic activity of mandimycin
[0117] According to the previously reported method (Kelvin JY Wu et al., 2024, Science, 383(6684), 721-726), the hemolytic activity of mandimycin was detected. Fresh sterile deproteinized sheep blood was centrifuged at 3,000 rpm for 10 minutes at 4°C to separate the precipitated blood cells, which were then resuspended in PBS solution (pH 7.4) to prepare a concentration of 1×10 9 cells / mL suspension. Test compounds were prepared at concentrations ranging from 0.39 μM to 100 μM and mixed with blood cells in a final volume of 500 μL. 0.5% DMSO and 1% Triton X100 were used as negative (0% hemolysis) and positive (100% hemolysis) controls, respectively. After incubation at 37°C for 3 hours, the cells were centrifuged at 3,000 rpm for 20 minutes, the supernatant was collected, and then transferred to a 96-well polypropylene plate. The supernatant was measured at OD using an enzyme-linked immunosorbent assay (ELISA) reader. 540The absorbance at 40 nm was used to determine the degree of hemolysis. As shown in FIG16 , the results showed that mandimycin did not show hemolysis at a high concentration of 100 mM, while amphotericin B showed severe hemolysis at 12.5 μM, indicating that mandimycin had better safety.
[0118] Example 8
[0119] In vivo antibacterial activity evaluation of mandimycin
[0120] (1) Neutrophil-deficient mouse thigh muscle infection model
[0121] Six-week-old, specific pathogen-free female ICR mice weighing 23-27 g were used. Mice were intraperitoneally injected with cyclophosphamide (Sigma-aldrich) 4 days (150 mg / kg) and 1 day (100 mg / kg) before infection. On the first day of infection, 0.05 ml of inoculum (2 x 10 7 CFU / mL of multidrug-resistant Candida albicans BNCC186382, multidrug-resistant Candida auris BNCC357785, and amphotericin B-resistant, pandrug-resistant Candida auris AMR05. Two hours after infection, mice were subcutaneously injected with varying concentrations of mandimycin (20 mg / kg, 10 mg / kg, and 5 mg / kg), prepared in Example 3, every 8 hours for a 24-hour treatment period. Mice were sacrificed by cervical dislocation, and the number of colonies in the thigh muscle tissue was counted. As shown in Figure 17, the mandimycin treatment groups all had significant therapeutic effects. At a dose of 20 mg / kg, the number of Candida albicans BNCC186382 fungal cells decreased by 4.2 log10, and the number of Candida auris BNCC357785 fungal cells decreased by 3 log10. At the minimum dose of 5 mg / kg, the number of Candida albicans BNCC186382 fungal cells also decreased by 3 log10, and the number of Candida auris BNCC357785 fungal cells decreased by 2 log10. This effect was better than that of amphotericin B in the same group. Mandimycin showed good in vivo activity against amphotericin B-resistant pan-resistant Candida auris. At 10 mg / kg, the number of Candida auris AMR05 fungal cells decreased by 2.4 log10. At the same time, both groups of mice did not show acute toxicity at a dose of 20 mg / kg.
[0122] (2) Mouse model of disseminated candidiasis
[0123] Pathogen-free female ICR mice (Hangzhou Medical College, China), 6 weeks old and weighing 23-27 g, were used. Mice were randomly divided into cages, four per cage, and subjected to three days of acclimatization training before the experiment. One colony of Candida albicans BNCC 186382 was inoculated into 5 mL of YPD liquid medium and shaken at 30°C and 220 rpm overnight. The overnight fungal culture was washed three times with 0.9% sterile saline and then diluted to 2 × 10 7 The final concentration of CFU / mL was then injected subcutaneously through the tail vein with 50 μL of the diluted fungal suspension to inoculate approximately 1×10 7 CFU. Six hours after infection, mice received a single subcutaneous injection of 1 mg / kg, 3 mg / kg, 5 mg / kg and 10 mg / kg of mandimycin (prepared with 10% DMSO and 10% Tween 80). Mice in the oral group were orally administered 10 mg / kg of mandimycin, which was prepared in a solution containing 5% DMSO and 10% Tween 80. 24 hours after infection, mice were euthanized, and kidney and lung tissues were aseptically removed, weighed, homogenized, and then cultured on YPD agar and incubated at 30°C for fungal load enumeration using CFU counts. All graphical data are presented as a single data point per group. The results are shown in Figure 18. At doses of 1, 3, 5 and 10 mg / kg mandimycin, the number of MDR Beauveria bassiana cells in kidney sections decreased by 0.93, 2.34, 2.52 and 3.43 log10, respectively, within 24 hours and statistical analysis was performed using GraphPad Prism 9.
[0124] (3) Mouse model of invasive candidiasis
[0125] Pathogen-free female ICR mice (Hangzhou Medical College, China) were used, aged 6 weeks and weighing 23-27 g. The mice were randomly divided into cages, 6 per cage, and adaptive training was performed for 3 days before the experiment. To induce immunosuppression, mice were injected intraperitoneally with cyclophosphamide (200 mg / kg) and subcutaneously with cortisone acetate (500 mg / kg) on days -2 and +3, respectively. To prevent cross-infection, mice were orally administered with enrofloxacin at a concentration of 50 μg / mL in drinking water from day 1 to day 3, and then subcutaneously with ceftazidime (5 μg / dose) from day 0 to day 9. 1×10 6Invasive candidiasis was induced by CFU of Candida albicans BNCC 186382. Treatment began 16 hours after infection and consisted of subcutaneous injection of ceftriaxone, followed by daily single-dose injections of 1 mg / kg, 5 mg / kg, 10 mg / kg, and 20 mg / kg of mandimycin (prepared in 10% DMSO and 10% Tween 80) for four consecutive days, and 10 mg / kg of amphotericin B. Mice were monitored for a total of 20 days, and survival rates were plotted using GraphPad Prism 9. Figure 19 shows that the survival rate of mice receiving 10 mg / kg of mandimycin reached 100%. In contrast, the survival rate in the amphotericin B group was only 80%, demonstrating the superior efficacy of mandimycin in improving survival.
[0126] (4) Mouse fungal skin infection model
[0127] The mouse skin infection model was established to evaluate the efficacy of mandemycin in the treatment of skin fungal infections. BALB / c mice weighing 20-22 g (Hangzhou Medical College, China) were used. The mice were randomly divided into cages, four per cage, and underwent three days of adaptation training before the experiment. Neutropenia was induced by intraperitoneal injection of 50 mg / kg cyclophosphamide on the third and first days before infection. Subsequently, the mice were anesthetized by intraperitoneal injection of 50 mg / kg sodium pentobarbital, and full-thickness skin perforation was performed on the dorsal skin using a biopsy punch with a diameter of 0.8 cm. A suspension of Candida albicans BNCC 186382 (1×10 8 CFU / ml, 50 μL per mouse) was inoculated into the circular wound, and then air was gently blown until the skin appeared moist but without excess fluid. One day after infection, the wound was topically treated with mandimycin (2.5 mg / kg or 7.5 mg / kg), amphotericin B (2.5 mg / kg or 7.5 mg / kg) or vehicle (PBS containing 10% dimethyl sulfoxide and 10% Tween 80). Mice with wound creation but not infected with fungi served as a negative control group and received drug treatment only. All compounds were administered once a day for 5 consecutive days. On days 1, 5, 9 and 11 after infection, the wounds were photographed and their sizes were measured. On day 11, the fungal counts of the wound specimens were recorded and the wound specimens were collected. The results are shown in Figure 20. Mandimycin showed significant activity in the skin infection model. At a dose of 2.5 mg / kg, the fungal burden was reduced by more than 2 log10, and the wound size and inflammation were also significantly reduced.
[0128] (5) Mouse vaginitis infection model
[0129] Female BALB / c mice, weighing 19-21 g, were acclimated for three days before the experiment. Mice were randomly divided into cages, four per cage, and acclimated for three days before the experiment. On day 1, mice were subcutaneously injected with 10 mg / kg estradiol benzoate once a day for 5 consecutive days to induce estrus (40,41). On day 6, mice were inoculated intravaginally with 50 μL of a suspension of Candida albicans BNCC 186382 (1×10 10 CFU / ml) and inverted for 5 minutes after vaginal inoculation. After 3 consecutive days of infection, mice were fed normally for 1 day and then subcutaneously injected with mandimycin (10 mg / kg), amphotericin B (10 mg / kg), rasafungin (10 mg / kg), or isovoconazole (10 mg / kg) once daily for 5 consecutive days. Mice infected with Beauveria bassiana but not treated with the compound served as a control group and were injected with PBS containing 10% DMSO and 10% Tween 80. The day after the last administration, the vagina was repeatedly rinsed with sterile PBS (20 μL). The vaginal rinsate was aspirated with a pipette and the sample was cultured on MRS agar plates to count Beauveria bassiana colonies. Finally, all animals were anesthetized with ether and euthanized, and vaginal tissues were collected. The results are shown in Figure 21. Mandimycin also showed significant efficacy in the treatment of vaginal candidiasis. After 5 days of treatment (10 mg / kg, intravenous injection, once a day), the vaginal fungal burden was significantly reduced by 2.51log10. This efficacy is comparable to other well-known antifungal antibiotics (including amphotericin B, rasafungin, and isothiocyanate). In addition, mice treated with mandimycin showed significantly reduced inflammation and almost complete recovery of the vaginal mucosa.
[0130] It can be seen from Examples 7-8 that the natural product mandimycin of the present invention not only exhibits excellent antifungal activity in vitro and in vivo, but is also non-hemolytic and has no acute toxicity, and can be used to prepare antifungal drugs.
[0131] Example 9
[0132] In vivo pharmacokinetics of mandimycin
[0133] Pathogen-free male Sprague-Dawley rats (180-220 g, 7-8 weeks old, 3 per group) were used in the study. The mice were randomly divided into cages, three per cage, and acclimated for three days before the experiment. The rats were injected subcutaneously with 25 mg / kg of mandenomycin. Blood samples (approximately 0.15 mL) were collected from the jugular vein catheter into a tube containing sodium heparin 5, 10, 20, and 30 minutes before administration, and 1, 2, 4, 6, 8, 12, and 24 hours after administration. After the blood samples were collected, they were placed on ice and then centrifuged (8000 × g, 5 minutes) to separate the plasma. The plasma was then transferred and immediately frozen (-70°C or below) until analysis. Mandimycin in rat plasma was analyzed by liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS / MS) using an AB SCIEX Triple Quad 6500 system coupled to an HPLC system equipped with a Quaternary Solvent Manager-R solvent dispenser and a Sample Manager FTN-R autosampler. Diazepam was used as an internal standard (IS). Multiple reaction monitoring (MRM) in positive ion mode was used for mass quantification of mandimycin from m / z 1198.30 to m / z 725.20 and diazepam from m / z 285.00 to m / z 193.00. Mandimycin and IS were separated by high-performance liquid chromatography (HPLC) on a Waters ACQUITY C18 column, 1.9 μm, 100 × 2.1 mm. An isocratic mobile phase consisting of 80% acetonitrile and 20% (v / v) 5 mM ammonium acetate was passed through the mass spectrometer electrospray ionization chamber at a rate of 0.4 mL / min for 3 minutes. The plasma concentration-time relationship was fitted using GraphPad Prism 9. Maximum plasma concentration (Cmax), time to Cmax (tmax), apparent elimination half-life (t1 / 2), mean residence time (MRT), area under the plasma concentration-time curve (AUC), clearance (CL), and volume of distribution (V) were estimated using Phoenix WinNonlin 8.3 non-compartmental analysis. Bioavailability was calculated as (AUCs.c. / AUCi.v.) × (Dosei.v. / Doses.c.) × 100%. As shown in Figure 22, mandimycin has a favorable kinetic profile, with a half-life of 3.84 hours, a maximum concentration (Cmax) of 55168.20 ng / mL, and an area under the curve (AUC0-∞) of 541692.11 h-ng / mL. These in vitro and in vivo experiments collectively demonstrate that mandimycin has a broad therapeutic window.
[0134] Example 10
[0135] In vivo evaluation of mandimycin nephrotoxicity
[0136] Pathogen-free female ICR mice, 6 weeks old and weighing 23-27 g (Hangzhou Medical College, China) were used. The mice were randomly placed in cages and divided into 12 groups of 4 mice each. The mice underwent three days of acclimatization training before the experiment. Amphotericin B or a solvent without any antibiotics served as a positive control and placebo, respectively. The compound mandimycin was formulated in a solution containing 10% DMSO and 10% Tween 80. Subsequently, each group of mice was subcutaneously injected with 1 mg / kg, 5 mg / kg, 10 mg / kg, and 20 mg / kg of the compound or placebo once a day. The concentrations of toxicity-related biomarkers, including kidney injury molecule 1 (KIM-1), tissue inhibitor of metalloproteinases-1 (TIMP-1), neutrophil gelatinase-associated lipofuscin (NGAL), and bone growth factor (OPN), were then measured using commercial kits (Yun-Clone, China) according to the protocols provided in the kits. Finally, all animals were euthanized, and kidney tissues were collected, fixed, dissected, and subjected to H&E staining. Pathological changes such as tubular degeneration, necrosis, cellular casting, dilatation, congestion, and proteinaceous casting were assessed and scored by clinical pathologists in a double-blind manner. As shown in Figure 23, after administration of mandimycin, in vivo nephrotoxicity-related indicators were comparable to those in the placebo group, while those in the amphotericin B group showed a significant increase. Slice scoring analysis also concluded that mandimycin caused little renal damage. All animal research procedures were approved by the Animal Ethics Committee of China Pharmaceutical University.
[0137] Example 11
[0138] Study on the mechanism of action of mandimycin
[0139] (1) Mandimycin resistance test
[0140] Different Candida species and other fungi were grown overnight in YPD broth with shaking (200 rpm, 30°C) for 16 h. 10The bacterial suspension concentration was 100 CFU / mL, and 0.1 mL of the bacterial suspension was plated onto YPD agar plates containing 8 MIC of mandimycin, amphotericin B, nystatin, and natamycin. These inoculated plates were incubated at 30°C for 2 days to identify resistant colonies. The number of colonies grown in the presence of drugs was calculated. As shown in Figure 24, mandimycin did not produce resistant strains, while amphotericin B produced an average of 6 resistant strains of Candida auris, 5 resistant strains of Candida albicans, 12 resistant strains of Cryptococcus neoformans, 560 resistant strains of Candida tropicalis, and 5 resistant strains of Candida parapsilosis per agar plate; nystatin produced an average of 2 resistant strains of Candida auris, 24 resistant strains of Candida albicans, 3 resistant strains of Cryptococcus neoformans, 55 resistant strains of Candida tropicalis, 2 resistant strains of Candida parapsilosis, and 23 resistant strains of Candida glabrata per agar plate; and natamycin produced an average of 13 resistant strains of Candida auris, 4 resistant strains of Candida albicans, 34 resistant strains of Cryptococcus neoformans, 40 resistant strains of Candida tropicalis, 8 resistant strains of Candida parapsilosis, and 5 resistant strains of Candida glabrata per agar plate. The results show that, unlike many rare antifungal drugs used clinically, mandimycin does not produce drug resistance even under the induction of high bacterial concentrations, suggesting that it is less likely to produce drug-resistant bacteria when used in further clinical applications.
[0141] (2) Bactericidal curve of mandimycin
[0142] Fresh Candida albicans BNCC186382 colonies grown at 30°C and 220 rpm for 16 hours were adjusted to OD600 = 1 with physiological saline, i.e., the bacterial solution concentration was (6.6 × 10 7 CFU / mL), and then diluted 66 times to obtain a standard suspension (1×10 6 CFU / mL). The suspension was diluted with YPD liquid medium and standard compound stock solution to obtain approximately 10 5 Add mandimycin at concentrations of 0.5 μg / mL, 1 μg / mL, 2 μg / mL, 4 μg / mL, 8 μg / mL, and 16 μg / mL to a 4 mL culture (the starting bacterial solution is 10 5 CFU / ml) in a test tube, then continuously shaken and cultured at 30°C and 220rpm, and 0.1mL of samples diluted appropriately were taken out at 0, 2, 4, 6, 8, 24 and 48 hours and spread on three YPD agar plates. After 24 hours of culture, the number of monoclonal colonies was determined by viability counting. In the absence of antifungal agents, growth controls for each organism were prepared and carried out simultaneously. As shown in Figure 25, mandimycin is a potent fungicide. At a high concentration (8μg / mL), the number of bacteria began to decrease after 2 hours, and Candida could be completely killed in 8 hours.
[0143] (3) Scanning electron microscopy observation of Candida albicans bacterial morphology after mandimycin treatment
[0144] Candida albicans BNCC186382 bacterial samples treated with 8×MIC for 0 h, 4 h, and 8 h were selected, and the morphology of the bacteria treated at different times was observed using a scanning electron microscope. The results are shown in Figure 26. Under the action of mandimycin, the cell membrane of Candida albicans was lysed at 2 h, and the membrane completely collapsed at 8 h.
[0145] (4) Determination of changes in ion concentrations in and outside the body after mandimycin treatment
[0146] C. albicans BNCC186382 was cultured overnight in a shaker (200 rpm, 30°C) using 50 ml of YPD liquid medium. The culture was washed three times with 10 mM Tris-acetate buffer containing 100 mM NaCl and pH 7.4. The washed C. albicans (6.6 × 10 8 CFU / ml (OD600 = 1.0)) were resuspended in the buffer to prepare 20 mL of bacterial solution, and 1×MIC (0.5 μg / mL), 4×MIC (2 μg / mL), and 10×MIC (5 μg / mL) of mandimycin were added to the bacterial solution, and K was measured using an Orion SensorLink PCM-700 pH / ISE meter (the electrode was calibrated with a standard solution containing 0.01, 0.1, or 1.0 mM KCl in 100 mM NaCl). + The concentration change of K ion in the bacterial solution treated with the same volume of solvent without mandimycin was used as the control group. As shown in Figure 27, the Candida albicans treated with mandimycin began to excrete a large amount of K + , while the control group had no change, and the drug concentration and ion efflux concentration were dose-dependent.
[0147] (5) Determination of mandimycin binding targets to fungal cell membranes
[0148] The effects of the addition of eukaryotic cell membrane phospholipids (phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, sphingomyelin, and cardiolipin), ergosterol, and cell wall β-1,3-glucan and mannan on the antimicrobial activity of mandimycin were evaluated using Candida albicans BNCC186382 using the broth dilution method. The various membrane components were dissolved in 10% DMSO and prepared at varying concentrations. These components were then added to the mandimycin MIC assay medium to assess the effect of fungal cell membrane components on the MIC of mandimycin. As shown in Figure 28, ergosterol, a known target of the polyene macrolide antifungal antibiotic class, had no inhibitory effect on the antimicrobial activity of mandimycin. Neither did β-1,3-glucan, a target of another class of antifungal drugs, the echinocandins, suggesting that mandimycin may have different mechanisms of action. Further studies found that the phospholipid small molecules of fungal cell membranes (including lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, and phosphatidylglycerol) have a strong inhibitory effect on the activity of mandimycin, and the inhibitory activity shows a dose-response curve. Among them, the inhibitory activity of lecithin on mandimycin increases with the increase of lecithin concentration, and the MIC change fold of mandimycin against Candida albicans increases from 1 to 128; the inhibitory activity of cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, and sphingomyelin on mandimycin increases with the increase of their concentration, and the MIC change fold of mandimycin against Candida albicans increases from 1 to 64; the inhibitory activity of phosphatidylglycerol on mandimycin increases with the increase of phosphatidylglycerol concentration, and the MIC change fold of mandimycin against Candida albicans increases from 1 to 32. This experiment shows that, unlike the known polyolefin natural products that act on the target of ergosterol, mandimycin acts on the phospholipid small molecules on the fungal cell membrane.
[0149] (6) Isothermal calorimetric titration method to determine the target of mandimycin
[0150] 20 mM mandimycin and amphotericin B were diluted to 1 mM in 5.0 mM HEPES (pH 7.4) containing 5% DMSO. Different fungal cell membrane phospholipid components (phosphatidylcholine, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, and phosphatidylglycerol) and ergosterol were dissolved in 5.0 mM HEPES (pH 7.4) containing 5% DMSO to prepare a 600 μM mixture. DOPC phospholipids (Avanti Polar Lipids, 610014-1Ea) were then hydrated with 5.0 mM HEPES (pH 7.4) and 100 nm liposomes were prepared using an Avanti Mini extruder.
[0151] The exothermic relationship between mandimycin and phospholipid binding was measured using a PEAQ-ITC isothermal titration calorimeter. At 25°C, a 1 mM mandimycin solution (40 μl) was placed in an automated sample injector, and a 600 μM liposome suspension (250 μl) was placed in the sample cell. The initial injection volume was 0.23 μl, followed by 18 2 μl injections of the compound, each with an 80-second interval and a stirring speed of 500 rpm. As shown in Figure 29 and Table 6, phospholipid small molecules exhibited favorable binding exotherms for mandimycin. Phosphatidylinositol showed the strongest binding affinity, with a Kd value of 21.9 μM. This was followed by phosphatidylglycerol, with a Kd value of 28.2 μM; phosphatidylserine, with a Kd value of 30.9 μM; phosphatidylethanolamine, with a Kd value of 36.5 μM; phosphatidylcholine, with a Kd value of 36.8 μM; sphingomyelin, with a Kd value of 50 μM; and cardiolipin, with a Kd value of 63.6 μM. In contrast, amphotericin B and nystatin did not bind to phospholipids. Inductively coupled coagulation (ITC) experiments further confirmed that mandimycin does not bind to the traditional ergosterol target, but rather strongly binds to seven phospholipid molecules through its novel target, particularly phosphatidylinositol.
[0152] Table 6 Affinity values of mandimycin and phospholipid components
[0153] As can be seen from Example 8, the natural product mandimycin of the present invention has a target different from that of known polyene antifungal drugs. Instead, it specifically binds to seven phospholipid molecules on the fungal cell membrane, especially phosphatidylinositol, leading to the expulsion of important ions from the fungal cell and the death of the fungal pathogen. This multi-target binding mode not only makes the natural product mandimycin of the present invention have potent and broad-spectrum activity against multidrug-resistant fungi, but also has the excellent property of not producing drug resistance. Based on mandimycin's novel trisaccharide polyene skeleton, potent and broad-spectrum activity against drug-resistant bacteria, novel mechanism of action, and excellent property of not producing drug resistance, mandimycin is expected to be developed into a new generation of antifungal drugs.
[0154] Example 12
[0155] Construction of MandQ knockout engineered strain CPU002
[0156] To obtain mandimycin derivatives lacking atratcynose A, bioinformatics analysis of the mandimycin biosynthetic gene cluster in Streptomyces netropsis DSM 40259 confirmed that MandQ (SEQ ID NO. 2) plays a crucial role in the formation of atratcynose A. To knock out MandQ, upstream and downstream fragments of MandQ were amplified using genomic DNA from Streptomyces netropsis DSM 40259 using the primer pairs MandQ_KOUF / R and MandQ_KODF / R, respectively. These fragments were then cloned into the pKC1139 vector digested with Xba I to generate the plasmid pKC1139-MandQ_KO. The vector was then introduced into Streptomyces netropsis DSM 40259 via indirect transfer between Escherichia coli and Streptomyces to knock out MandQ. The knockout strain was validated using MandQ_TestF / R. The results showed, as shown in Figure 30, that a 1072-base fragment in MandQ was successfully knocked out, resulting in the MandQ knockout engineered strain CPU002. A comprehensive comparative analysis of secondary metabolites in the wild-type and knockout strains, as shown in Figure 31, confirmed the knockout of mandimycin and generated a new conjugated pentaenoic glycosyl knockout natural product, named mandimycin B.
[0157] Primer sequences;
[0158] MandQ_KOUF: gggctgcaggtcgactcacacccgaatcgaccact;
[0159] MandQ_KOUR:atggcttcgacggggctcgggatcatcag;
[0160] MandQ_KODF: gccccgtcgaagccatgcgggagatg;
[0161] MandQ_KODR: cgcggccgcggatcctcgggcagtcatcacaccatc;
[0162] MandQ_TestF:cgacgagtccatggtccg;
[0163] MandQ_TestR:cgccgatgtccaggatcac.
[0164] Example 13
[0165] Biofermentation of modified bacterial strains
[0166] (1) Preparation of seed solution:
[0167] In a 250 mL triangular notch flask, 50 mL of TSB medium (containing 17.0 g of casein pancreatic digest, 3.0 g of soybean digest, 5.0 g of sodium chloride, 2.5 g of potassium hydrogen phosphate, 2.5 g of glucose monohydrate per liter of ddH2O, pH = 7.3) was added, and the CPU002 strain cultured on an ISP4 agar plate (containing 10.0 g of soluble starch, 1.0 g of potassium hydrogen phosphate, 1.0 g of magnesium sulfate, 1.0 g of sodium chloride, 2.0 g of ammonium sulfate, 2.0 g of calcium sulfate, 0.001 g of ferrous sulfate, 0.001 g of manganese chloride, 0.001 g of zinc sulfate, 15.0 g of agar per liter of ddH2O, pH = 7.2) was inoculated into the TSB medium and placed in a shaking incubator (conditions: speed 200 rpm, temperature 30°C) and cultured for 2 days to prepare a seed solution.
[0168] (2) Preparation of fermentation broth:
[0169] 0.5 mL of the seed solution was transferred to a 50 mL (250 mL triangular notch flask) FS / 9 fermentation medium (40.0 g glucose, 30.0 g soy flour, and 10.0 g CaCO₃ per liter of ddH₂O) and cultured for 5 days (shaker speed 200 rpm, 30°C). After fermentation, 1:1 n-butanol was added to the fermentation flask and stirred overnight (100 rpm) for extraction. The n-butanol extract was dried using a rotary evaporator and dissolved in methanol to obtain a crude extract.
[0170] Example 14
[0171] Isolation and purification of mandimycin B
[0172] A two-step purification process was employed. First, the crude extract obtained in Example 10 was separated by column chromatography using a YMC-GEL C18 powder (12 nm × 50 μm) column packed with isocratic elution. The column was equilibrated with 2 cv of 10% methanol (H₂O:CH₂OH 9:1), then dissolved in methanol. Elution was performed using aqueous methanol solutions of varying concentrations (10%, 30%, 50%, 70%, 90%, and 100%), with each 100 mL bottle filled. The components were analyzed using UPLC-MS, and the fraction containing mandimycin B (eluate with 90% aqueous methanol) was collected and spin-dried. UPLC-MS conditions were as follows: a C18 column (Waters, T3-1.8μm, 2.1×100mm), mobile phases: Phase A - pure water (0.1% formic acid), Phase B - acetonitrile (0.1% formic acid), flow rate 0.6 mL / min, mobile phase B gradient from 30% to 90% with 10% increments per minute. MS detection range 200–2000, in both positive and negative modes. The semi-pure product was further purified using semi-preparative reversed-phase high-performance liquid chromatography (RP-HPLC). RP-HPLC conditions were as follows: Solvent A, deionized water; Solvent B, acetonitrile. Flow rate 3 mL / min, solvent B gradient from 30% to 90% with 1.5% increments per minute, full wavelength detection (190 nm–800 nm). UV analysis allowed the collection of mandimycin B with a purity exceeding 95%, yielding 3–4 mg / L of fermentation broth.
[0173] Example 15
[0174] Structural identification of mandimycin B
[0175] Mandimycin B is an amorphous yellow powder. HR-ESI-MS high-resolution analysis shows that its protonated ions are m / z 924.4957 [M+H]+ and m / z 922.4792 [MH]-, indicating that its molecular formula is C 47 H 73 NO 17The UV-visible spectrum of mandimycin B in methanol showed maximum absorption wavelengths at 320, 335, and 352 nm, respectively, indicating the presence of a conjugated pentaene structure. Mandimycin B was dissolved in deuterated DMSO, and two-dimensional spectra, including HSQC, HMBC, COSY, and TOCSY, were acquired using a 700 M NMR instrument, as shown in Figures 32-37, respectively. Comparison of the one-dimensional and two-dimensional NMR data of mandimycin B with those of mandimycin revealed the primary difference between the two, which is the absence of resonances for dimethoxysugars and 3-O-methyldimethoxysugars. This is consistent with the fact that mandimycin B is produced by the glycosyltransferase gene knockout strain CPU002. Significant upshifts at C-35 (ΔδC -7.3) and C-37 (ΔδC -5.6), further confirm this conclusion. Furthermore, a comparison of the 1H and 13C NMR data for the mycamine molecule in PAC-G10 and mandimycin B revealed nearly identical chemical shifts, indicating that the mycamine molecule is retained in mandimycin B. Key HMBC and COSY NMR correlations for mandimycin B are shown in Figure 38 . The structure of mandimycin B was confirmed, and the 1H NMR (700 MHz, DMSO-d6), 13C NMR (700 MHz, DMSO-d6), HMBC, HSQC, and COSY NMR spectra are shown in Table 8.
[0176] Table 8 1H and 13C spectra (DMSO-d6) of mandimycin B
[0177] Based on H spectrum, C spectrum, HSQC, HMBC, COSY and other two-dimensional spectra, as well as chiral bioinformatics analysis of mandimycin B polyketide synthase, the specific configurations of the natural product mandimycin B of the present invention are 2R, 10R, 11S, 12S, 13R, 14R, 16R, and 18R. The natural product mandimycin B is shown in Formula II:
[0178] Example 16
[0179] In vitro activity testing of mandimycin B against multidrug-resistant bacteria
[0180] Using CLSI standards, the antibacterial activity of mandimycin B against priority fungal pathogens published by the WHO was determined according to the method of Example 7. The results are shown in Table 9 below.
[0181] Table 9 Antifungal activity of mandimycin B
[0182] As can be seen from Table 9, mandimycin B has potent and broad-spectrum activity against multidrug-resistant fungi. The minimum inhibitory concentration (MIC) against Candida, especially multidrug-resistant bacteria including Candida albicans and Candida auris, is between 1-2 μg / mL. The activity against multidrug-resistant Cryptococcus neoformans reaches 0.5 μg / mL. The activity against multidrug-resistant Aspergillus fumigatus reaches 2 μg / mL, which is 32 times that of fluconazole and 16 times that of 5-fluorocytosine.
[0183] Example 17
[0184] Mechanism of action of mandimycin B
[0185] (1) Binding curve of mandimycin B with sterol molecules or phospholipid molecules
[0186] In this example, the UV-vis method was used to study the binding of mandimycin B to sterol molecules or phospholipid molecules (Maji, A. Nature 2023, 623, 1079–1085). Mandimycin B was dissolved in DMSO, and 1 mM mandimycin B was mixed with different proportions of sterol solutions (cholesterol, ergosterol) or phospholipid solutions (lecithin, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, phosphatidylglycerol) to a final volume of 1 mL. The mixed solution was allowed to stand at room temperature for 30 minutes, and then the mixture was scanned by UV-Vis (310-400 nm) using a microplate reader FlexA-200. The read values were plotted using Origin plotting software. The results are shown in Figure 39. Mixing different concentrations of phospholipids with mandimycin B does not affect the ultraviolet absorption value of mandimycin B, indicating that different phospholipid molecules do not bind to mandimycin B. However, mixing different concentrations of sterols (including cholesterol or ergosterol) with mandimycin B significantly changes the ultraviolet absorption value of mandimycin B, indicating that mandimycin B binds to sterol molecules (cholesterol or ergosterol).
[0187] (2) Isothermal calorimetric titration to determine the binding affinity of mandimycin B with sterol molecules or phospholipid molecules
[0188] In this example, 20 mM mandimycin B (DMSO as solvent) was diluted to 1 mM using isothermal titration with 5.0 mM HEPES (pH 7.4) containing 5% DMSO. Different phospholipid components (phosphatidylcholine, cardiolipin, phosphatidylinositol, phosphatidylserine, phosphatidylethanolamine, sphingomyelin, phosphatidylglycerol), ergosterol, and cholesterol were dissolved in 5.0 mM HEPES (pH 7.4) containing 5% DMSO to prepare a 600 μM composition. Commercially available liposome membranes were then hydrated with 5.0 mM HEPES (pH 7.4), and the 600 μM suspensions of different phospholipid components and ergosterol were passed through 100 nm polycarbonate filters six times using an Avanti Mini extruder to prepare LUVs. The exothermic relationship between mandimycin B binding to phospholipids or sterols was determined using a PEAQ-ITC isothermal titration calorimeter. At 25°C, a 1 mM (40 μl) mandimycin B solution was placed in an automatic sample injection needle, and a 600 μM LUV (250 μl) suspension was placed in a sample cell. The volume of the first injection was 0.23 μl, and then 18 2 μl injections were performed on the above compound. The interval between each injection was 80 seconds to ensure that the instrument returned to a stable baseline before the next injection. The stirring speed for each experiment was 500 rpm. The results are shown in Figure 40, which shows that phospholipid molecules have no binding curve for mandimycin B, while sterols have obvious binding curves for mandimycin B, among which the Kd value of mandimycin B's binding ability to ergosterol reached 25.9 μM; the Kd value of its binding ability to cholesterol was 28.6 μM, proving that mandimycin B has a different mechanism of action from mandimycin and has a strong binding ability to sterol molecules.
[0189] The present invention divides the nucleotide sequence SEQ ID NO. 1 of the mandimycin biosynthetic gene cluster in the claims and specification into nine sequences in the nucleotide and amino acid sequence listings, which correspond to the combined sequences of SEQ ID NOs. 1-9 in the sequence listing. Simultaneously, the nucleotide sequence SEQ ID NO. 2 of the key gene MandQ in the claims and specification corresponds to SEQ ID NO. 10 in the sequence listing.
[0190] The nucleotide sequence of the mandimycin biosynthetic gene cluster is shown in SEQ ID NO. 1 (115505 bp):
[0191] The nucleotide sequence of the key gene MandQ is shown in SEQ ID NO. 2 (1072 bp):
Claims
1. A polyene macrolide natural product mandimycin biosynthetic gene cluster, characterized in that: The nucleotide sequence of the mandimycin biosynthetic gene cluster is shown in SEQ ID NO.
1.
2. A method for preparing the polyene macrolide natural product mandimycin according to claim 1, characterized in that: The steps include: The strain containing the mandimycin biosynthetic gene cluster is prepared into a seed liquid for cultivation, fermentation, extraction, separation and purification to obtain the natural product mandimycin.
3. The method for preparing mandimycin, a natural product of olefin macrolides according to claim 2, characterized in that: The strain containing the mandimycin biosynthesis gene cluster is Streptomyces netropsis DSM 40259.
4. A method for preparing mandimycin B, a polyene macrolide antifungal natural product, characterized in that: The steps include: The MandQ gene in the strain containing the mandimycin biosynthetic gene cluster according to claim 1 is knocked out to obtain an engineered bacterium, which is prepared into a seed liquid for cultivation, fermentation, extraction, separation and purification to obtain the natural product mandimycin B; the nucleotide sequence of the MandQ gene is shown in SEQ ID NO.
2.
5. The preparation method according to claim 4, characterized in that: Mandimycin B was obtained by knocking out the MandQ gene in the mandimycin biosynthetic gene cluster in Streptomyces netropsis DSM 40259 using indirect transfer between Streptomyces and Escherichia coli to obtain the CPU002 engineered bacterium. The obtained glycosyltransferase-deficient engineered bacterium CPU002 was fermented, extracted, separated and purified to obtain mandimycin B.
6. A polyene macrolide natural product mandimycin or mandimycin B and a pharmaceutically acceptable salt thereof, characterized in that: The structural formula of the natural product mandimycin compound is shown in Formula I, and the structural formula of the natural product mandimycin B compound is shown in Formula II:
7. Use of the polyene macrolide natural product mandimycin or mandimycin B and pharmaceutically acceptable salts thereof according to claim 6 in the preparation of antifungal drugs.
8. The use according to claim 7, characterized in that: The fungus is preferably any one of a variety of key fungal pathogens such as Candida, Aspergillus, Cryptococcus, Mucor and Fusarium.
9. A pharmaceutical composition of an antifungal drug, characterized in that: The invention comprises the polyene macrolide natural product mandimycin or the natural product mandimycin B as claimed in claim 6 and a pharmaceutically acceptable carrier.
10. The pharmaceutical composition according to claim 9, characterized in that: The pharmaceutical composition is a capsule, powder, tablet, granule, pill, injection, syrup, oral solution, inhalant, ointment, suppository or patch.
11. Use of the antifungal drug composition according to claim 9 in the preparation of antifungal drugs.
12. The use according to claim 11, characterized in that: The fungus is any one of a variety of key fungal pathogens such as Candida, Aspergillus, Cryptococcus, Mucor and Fusarium.
Citation Information
Patent Citations
Preparation method of high-purity amphotericin B
CN102382158A
Protein system for tetramycin biosynthesis, gene cluster for coding same
CN102516374A
Streptomyces hygroscopicus 18 strain - naphthoquinone antibiotics producer - a and b astolides with antifufgal and cytotoxic activity and method for producing thereof
RU2681828C1
Cited By
Streptomyces fusiformis AK308 and application thereof
CN120818467A
Streptomyces fusichromogenes AK308 and application thereof
CN120818467B