Recalling and finding antibody via memory b cells

Abstract

Provided is a method for identifying an antibody specific to a target. The method comprises: (a) performing one or more immunizations on an animal using a target antigen; (b) reducing the serum antibody titer of the animal by two or more folds; (c) immunizing the animal by using a recalled antigen, wherein an antibody-binding region of the recalled antigen has at least 30% identity to the target antigen; (d) producing antibody sequences via B cells of the animal 1-20 days after the immunization in step (c); and (e) selecting an antibody from the antibody sequences by means of one or more priority factors.

Description

Antibody discovery through memory B cell recall Technical Field

[0001] The present application relates to the discovery of monoclonal antibodies. Specifically, the present application relates to a method for discovering antibodies directly from B cells using high-throughput sequencing without the need for experimental enrichment of target-specific B cells / antibodies. Background Art

[0002] Monoclonal antibodies have been widely used in therapeutics. Since the first drug was approved in 1986, the FDA has approved over 100 antibody-based drugs. Furthermore, monoclonal antibodies are widely used as research / diagnostic reagents. Various technologies have been developed to discover monoclonal antibodies. Hybridoma technology was invented by Georges Kohler and Cesar Milstein in 1975. It is a method for producing large quantities of monoclonal antibodies, enabling screening and production. Phage display technology was developed by George P Smith and Sir Gregory P Winter in the early 1990s. It is an in vitro display and screening technology that has accelerated the discovery and engineering of monoclonal antibodies. Recently, to address some of the shortcomings of phage display technology, several techniques based on the isolation and culture of single B cells have been developed for antibody development. Typically, the proportion of antigen-specific B cells in the repertoire is very low, necessitating various methods, such as B cell plate sorting, sequencing, and phage plate sorting, to enrich antigen-specific B cells and antibodies prior to screening.

[0003] B cells produce antibodies. Two major types of B cells are responsible for antibody-mediated humoral memory responses: antibody-secreting plasma cells (PCs) and memory B cells (MBCs) with membrane-bound antibodies (B cell receptors). However, only MBCs participate in recall responses. The MBC recall response describes a process in which antigen-specific MBCs encounter the same antigen again, clonally expand, and produce large quantities of antigen-specific antibodies (Figure 1). This is the immune system's natural response to pathogens and other invaders. Detailed studies have shown that during recall, upon novel antigen stimulation via membrane-bound B cell receptors, MBCs may differentiate into short-lived PCs or plasmablasts, proliferate through clonal expansion, or enter germinal centers (GCs) for further affinity maturation and repertoire diversification, with higher affinity for antigen variants and broader epitope coverage for better protection. Three factors influence B cell fate determination: affinity for the antigen, duration of interaction with the antigen and cognate T cells, and survival signals provided by the microenvironment. In general, B cells with higher-affinity BCRs appear to be more likely to differentiate into plasma cells. Indeed, compared to IgM+MBCs, IgG+MBCs have been shown to preferentially differentiate into short-lived PCs upon secondary encounter with the same antigen. PCs are antibody-secreting cells with extremely high rates of antibody gene transcription, translation, and antibody secretion. Based on single-cell expression data from www.proteinatlas.org, the expression of four human IGHG genes (IGHG1, IGHG2, IGHG3, and IGHG4) increases by 5.0, 10.7, 4.1, and 0.4 times, respectively, during B cell differentiation into plasma cells.

[0004] A recent study highlighted how early MBCs (eMBCs) form as early as 2.5 days after antigen encounter. These cells do not undergo somatic hypermutation (SHM), largely fail to undergo class switching, and thus display distinct transcriptional programs compared to their GC-dependent counterparts. Furthermore, the finding that vaccine-specific plasma cell numbers increase as early as day 7 after boosting immunization, along with clonal expansions, and that these expansions lead to increased mutations, along with a reduction in repertoire diversity and CDR3 sequence length, may indicate that these vaccine-specific plasma cells may have already transited through germinal centers or remain short-lived plasma cells, as somatic hypermutation (SHM) and affinity maturation can occur in germinal centers and extrafollicular B cell responses. The type of animal used, the duration between boosters, and the nature or structure of the immunogen can influence the quality and quantity of B cell recall, including the composition of naive B cells, short- (GC-independent) or long-lived MBCs, plasmablasts, and short- (GC-independent) or long-lived PCs (Figure 1C).

[0005] High-throughput sequencing technologies, such as next-generation sequencing (NGS), have been widely used as an efficient sampling method for analyzing the immune repertoire. These technologies can sequence millions of B cells to obtain a profile of the B cell repertoire at a specific time point, providing an efficient and cost-effective sampling method for studying the dynamics of the immune repertoire and tracking longitudinal lineage changes. Summary of the Invention

[0006] This application describes a method for efficient antibody discovery based on MBC recall reactions captured by high-throughput sequencing technology, skipping the experimental selection / enrichment step to identify antibodies from the immune repertoire.

[0007] In one aspect, a method of producing an antibody specific for a target is provided, the method comprising:

[0008] (a) immunizing an animal with a target antigen in one or more rounds,

[0009] (b) the serum antibody titer of the animal is reduced by 2-fold or more compared to the previous immunization,

[0010] (c) immunizing the animal with a recall antigen having an antibody binding region that is at least 30% identical to the target antigen,

[0011] (d) generating antibody sequences from B cells of the animal 1-20 days after the immunization in step (c),

[0012] (e) selecting antibodies from the antibody sequences based on one or more priority factors,

[0013] Optionally f) repeating steps (b) to (e).

[0014] In one or more embodiments, the animal is selected from the group consisting of murine, leporidae, feline, canine, monkey, and camelid.

[0015] In one or more embodiments, the animal is a camelid, including but not limited to alpacas (Vicugna pacos), Bactrian camels (Camelus bactrianus), and llamas (Lama guanicoe).

[0016] In one or more embodiments, step (b) comprises: interrupting the immunization of the animal until the serum antibody titer decreases by 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times or more. A 2-fold decrease in serum antibody titer means that the serum antibody titer is 1 / 2 of the serum antibody titer after the previous immunization. The serum antibody titer after the previous immunization can be measured several days after the previous immunization, for example, 1-20 days, preferably 1-14 days, more preferably 4-11 days, and even more preferably 4-7 days.

[0017] In one or more embodiments, step (b) comprises subjecting the animal to an immunohistochemical break of 21 days or more, e.g., 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days (6 weeks), 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks or more.

[0018] In one or more embodiments, in step (d): antibody sequences are generated from B cells of the animal 1-14 days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days) after immunization in step (c), preferably 4-11 days, and more preferably 4-7 days.

[0019] In one or more embodiments, the method further comprises collecting B cells from the animal immunized in step (c) 1-14 days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days), preferably 4-11 days, and further preferably 4-7 days after the immunization in step (c).

[0020] In one or more embodiments, the animal is an alpaca, and in step (d): antibody sequences are generated from B cells of the animal 1-14 days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days), preferably 4-11 days, and further preferably 4-7 days after the immunization in step (c).

[0021] In one or more embodiments, the animal is a Bactrian camel, and in step (d): antibody sequences are generated from B cells of the animal 1-14 days (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days), preferably 7-14 days after the immunization in step (c).

[0022] In one or more embodiments, the animal is a llama, and in step (d): the antibody sequences are generated from B cells of the animal 1-14 days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days), preferably 4-14 days after the immunization in step (c).

[0023] In one or more embodiments, step (e) comprises grouping the antibody sequences by antibody characteristics selected from one or more of the following: one or more or all CDR sequences, VH sequences, VL sequences, VHH sequences, antibody sequences, lineages and clusters, and selecting groups by one or more priority factors.

[0024] In one or more embodiments, the antibody sequence described in step (d) is a VHH sequence, a VH sequence, a VL sequence, a VH and VL sequence, or a full-length antibody sequence.

[0025] In one or more embodiments, the priority factor is selected from the group consisting of: abundance or frequency of antibody sequences or groups from high to low, increase rate of abundance or frequency of antibody sequences or groups from high to low, change in abundance or frequency of antibody sequences or groups during immunization, antibody affinity maturation, sharing the same naive B cell source between VHHs, avoiding sequences with poor developability, and combinations thereof.

[0026] In one or more embodiments, the rate of increase is the rate of increase in abundance or frequency of antibody sequences or groups in B cells of the animal 1-20 days after immunization in step (c) compared to B cells of the animal after step (b).

[0027] In one or more embodiments, the priority factor is selected from any one or a combination of any two or three of the following: (A) the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400; -1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower, (B) the increase rate of abundance or frequency of the antibody sequence or group reaches 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or higher, and (C) the mutation value of the antibody sequence or group tends to increase compared with before, preferably, the mutation value of the antibody sequence or group satisfies the following relationship: 1-20 days after step (c) immunization>after step (b)>after step (a).

[0028] In one or more embodiments, the mutation value of the antibody sequence or panel is measured by a mismatch score or a bit score.

[0029] In one or more embodiments, the prioritization factor is selected from the group consisting of: antibody sequences or groups that are in the top 500 (e.g., top 400, top 300, top 200, top 100, top 90, top 80, top 70, top 60, top 50, top 40, top 30, top 20, top 10) or higher in abundance or frequency, and / or, an increase in abundance or frequency of antibody sequences or groups that is 5-fold (e.g., 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold) or higher.

[0030] In one or more embodiments, the method further comprises determining the increase in abundance or frequency of the antibody signature in the B cells collected 1-20 days after the immunization of step (c) compared to the B cells of the animal after step (b).

[0031] In one or more embodiments, the antibody selected in (e) is excluded if the growth rate of 1, 2, 3 or 4 selected from the group consisting of antibody sequences, CDR sets, repertoires and clusters is less than 2.

[0032] In one or more embodiments, an antibody selected in (e) is excluded if it has at least one poor developability factor, wherein the at least one developability is immunogenicity, expression, homogeneity, solubility, stability, viscosity, or formulation.

[0033] In one or more embodiments, the antibody feature is one, two or three of the heavy chain CDRs or CDRs of a heavy chain antibody. In one or more embodiments, the antibody feature is one, two or three of the light chain CDRs.

[0034] In one or more embodiments, the antibody selected in (e) is in the top 100, top 200, top 300, top 500 antibody sequences or groups in terms of abundance or frequency. In one or more embodiments, the antibody selected in (e) is in the top 100, top 200, top 300, top 500 CDR groups in terms of abundance or frequency. In one or more embodiments, the antibody selected in (e) is in the top 100, top 200, top 300, top 500 lineages in terms of abundance or frequency. In one or more embodiments, the antibody selected in (d) is in the top 100, top 200, top 300, top 500 clusters in terms of abundance or frequency.

[0035] In one or more embodiments, the antibody is a heavy chain antibody characterized by one, two, or three of CDR1, CDR2, and CDR3 of a heavy chain antibody.

[0036] In one or more embodiments, the priority factors are: top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower, and / or, antibody sequences with an increase in abundance or frequency of 5-fold (e.g., 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold) or more.

[0037] In one or more embodiments, the priority factor is: antibody sequences that are in the top 500 (e.g., top 400, top 300, top 200, top 100, top 90, top 80, top 70, top 60, top 50, top 40, top 30, top 20, top 10) or higher in abundance or frequency, and / or antibody sequences that have increased in abundance or frequency by 5-fold (e.g., 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold) or more.

[0038] In one or more embodiments, the priority factor is: when grouped by CDR sequence (i.e., the antibody sequences in the group have the same CDR), the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000 in terms of abundance or frequency , 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower groups (CDR groups), and / or, groups (CDR groups) with an increase in abundance or frequency of 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0039] In one or more embodiments, the priority factor is: when grouped by CDR sequences, the groups (CDR groups) that are in the top 500 (e.g., top 400, top 300, top 200, top 100, top 90, top 80, top 70, top 60, top 50, top 40, top 30, top 20, top 10) in abundance or frequency or higher, and / or the groups (CDR groups) that have an increase in abundance or frequency of 5 times (e.g., 5.5 times, 6 times, 6 times). 5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0040] In one or more embodiments, the antibody is a heavy chain antibody, the antibody characteristic is VHH, and the priority factor is: the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-100 0, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower, and / or, a group with a sequence abundance or frequency increase of 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0041] In one or more embodiments, the antibody is a single domain antibody, the antibody characteristic is a repertoire, and antibodies in one repertoire map to the same V and J germline genes and have a maximum distance between the closest two CDR3s in the repertoire for a particular CDR3 that is equal to or less than 1, wherein all CDR3s have the same length.

[0042] In one or more embodiments, the priority factor is: the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 110 or lower groups (lineages), and / or groups (lineages) with an increase in abundance or frequency of 5-fold (e.g., 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold) or more.

[0043] In one or more embodiments, the priority factor is: groups (lineages) in the top 500 (e.g., top 400, top 300, top 200, top 100, top 90, top 80, top 70, top 60, top 50, top 40, top 30, top 20, top 10) or more in abundance or frequency, and / or groups (lineages) with an increase in abundance or frequency of 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0044] In one or more embodiments, the antibody is a single domain antibody, the antibody is characterized by a cluster, and the antibodies in the cluster have the same CDR3 length and the closest two CDR3s have greater than or equal to 80% CDR3 identity.

[0045] In one or more embodiments, the priority factors are: top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower groups (clusters), and / or, groups (clusters) with an increase in abundance or frequency of 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0046] In one or more embodiments, the priority factors are: groups (clusters) in the top 500 (e.g., top 400, top 300, top 200, top 100, top 90, top 80, top 70, top 60, top 50, top 40, top 30, top 20, top 10) or higher in abundance or frequency, and / or groups (clusters) with an increase in abundance or frequency of 5 times (e.g., 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times) or more.

[0047] In one or more embodiments, the antibodies are immunoglobulins and the sequences of the VH and / or VL of one repertoire are identical.

[0048] In one or more embodiments, the antibodies are immunoglobulins and the antibodies in one repertoire map to the same V and J germline genes and have a maximum distance between the closest two HCDR3s in the repertoire for a particular HCDR3 that is equal to or less than 1, wherein all HCDR3s have the same length.

[0049] In one or more embodiments, the antibodies are immunoglobulins, and the antibodies in the cluster have the same HCDR3 length, with greater than or equal to 80% CDR3 identity between the two closest CDR3s in the cluster.

[0050] In one or more embodiments, the antibodies are immunoglobulins, and the antibodies in one CDR set comprise the same LCDR1, LCDR2, and LCDR3 sequences, and / or the same HCDR1, HCDR2, and HCDR3 sequences.

[0051] In one or more embodiments, after a panel is selected, antibodies can be further selected from the selected panel based on prioritization factors, such as ranking of abundance or frequency of antibody sequences in the panel and / or avoiding sequences with poor developability.

[0052] In one or more embodiments, the method further comprises distinguishing lineages by VHH characteristics, wherein the VHH characteristics are selected from one or more of the following:

[0053] i) FR2 hydrophilic region,

[0054] ii) extended CDR1,

[0055] iii) additional disulfide bonds between CDR1-CDR3 or FR2-CDR3,

[0056] iv) additional disulfide bonds within CDR3,

[0057] v) long CDR3 (≥15aa),

[0058] vi) additional disulfide bonds within CDR1,

[0059] vii) non-classical VHHs with the same V and J germline as conventional IgG1,

[0060] viii) non-classical VHHs with predetermined sequence characteristics,

[0061] ix) New classical binding ring structures, and

[0062] x) Convergent motifs or sequence features.

[0063] In one or more embodiments, the sequence is generated by sequencing technology. Preferably, the sequence is generated by NGS or single-cell sequencing technology.

[0064] In one or more embodiments, the target is a peptide, protein, hapten (eg, conjugated to a carrier molecule), mRNA, DNA, a viral vector that allows expression of the antigen of interest, or a cell.

[0065] In one or more embodiments, the target comprises one or more selected from the group consisting of: mesothelin, PDL1, UPAR.

[0066] In one or more embodiments, the target antigen is a peptide, protein, hapten (e.g., conjugated to a carrier molecule), mRNA, DNA, a viral vector that allows expression of the antigen of interest, or a cell.

[0067] In one or more embodiments, the target antigen is a target or a fragment of a target comprising one or more functional domains thereof. In one or more embodiments, the recall antigen is a target antigen or a fragment of a target antigen comprising one or more functional domains thereof.

[0068] In one or more embodiments, the target antigen comprises one or more or all epitopes of the target. In one or more embodiments, the target antigen comprises or consists of a fragment of the target that is an epitope.

[0069] In one or more embodiments, the recall antigen comprises one or more or all epitopes of the target antigen. In one or more embodiments, the recall antigen comprises or consists of a fragment of the target antigen that is an epitope.

[0070] In one or more embodiments, the recall antigen is the same as the target antigen.

[0071] In one or more embodiments, the target antigen is or consists of a fragment of mesothelin comprising domains 2 and 3 thereof, and the recall antigen is or consists of a fragment of mesothelin comprising domains 2 and 3 thereof.

[0072] In one or more embodiments, the antibodies are expressed by prokaryotic or eukaryotic cells.

[0073] In one or more embodiments, the antibody is a single domain antibody or an immunoglobulin.

[0074] In one or more embodiments, step (e) further comprises testing the specific binding of the selected antibody to the target. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 is the MBC recall flow chart.

[0076] FIG2 is a schematic diagram of a process according to an embodiment of the present invention.

[0077] FIG3 shows an exemplary process of step g) in FIG2 .

[0078] Figure 4 shows the detailed immunization process (A) and a simplified diagram (B) of immunization of A30 alpacas with mesothelin antigen.

[0079] Figure 5 shows the titers of the blood samples shown in Figure 3. After the immunization was interrupted, the titers (PRE-IM11 and PRE-IM13) decreased. Subsequent immunizations rapidly increased the titers (IM11, IM13-D7, IM13-D11).

[0080] Figure 6 shows that the top lineages with frequencies >= 0.1% in the IM11 sample (MBC recall sample) show a rapid increase compared to samples taken 7 days before IM11 (PRE-IM11) and 14 days after IM12 (A). The growth rate of the top 30 lineages is shown (B).

[0081] Figure 7 shows the dynamics of lineage frequencies based on the top lineages with frequencies >= 0.1% in the IM11 sample (A) and the IM13-D4 sample (B) among the 7 samples. The MBC recall process can be started multiple times and a similar rapid increase is observed.

[0082] Figure 8 shows the MorisitaHorn overlap index of the lineages among the seven samples based on the mapping results.

[0083] Figure 9 shows the cluster frequency dynamics of the top clusters based on frequency >= 0.1% in the IM11 sample (A) and the IM13-D4 sample (B) among the 7 samples.

[0084] Figure 10 shows the MorisitaHorn overlap index among the seven samples based on the cluster mapping results.

[0085] FIG11 shows the CDR group frequency dynamics based on the top CDR groups with frequencies >= 0.1% in IM11 sample (A) and IM13-D4 sample (B) among the 7 samples.

[0086] FIG12 shows the MorisitaHorn overlap index of CDR groups among the seven samples based on the mapping results.

[0087] FIG13 shows the sequence frequency dynamics of the top-ranked sequences based on frequencies >= 0.1% in the IM11 sample (A) and the IM13-D4 sample (B) among the 7 samples.

[0088] FIG14 shows the MorisitaHorn overlap index of the sequences among the seven samples based on the mapping results.

[0089] Figure 15 shows the ELISA binding results of selected sequences from IM11 and IM12. DETAILED DESCRIPTION

[0090] Through the following detailed description, other purposes, features and advantages of the present invention will be apparent. It should be understood that within the scope of the present invention, the above technical features of the present invention and the technical features described in detail below (such as embodiments) can be combined with each other to form a preferred technical solution.

[0091] Unless otherwise indicated, the techniques used in the present invention are standard methods well known to those skilled in the art. These techniques are described and explained throughout the literature, for example, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors).

[0092] The present invention utilizes an MBC recall process, which aims to maximize the proportion of antigen-specific MBCs and PCs through extrafollicular activation and skips the traditional antigen-specific B cell enrichment step to capture these antibodies using high-throughput sequencing technology.

[0093] Generally, the memory B cell repertoire is dominated by large IgM, IgA, and IgG2 clonal families, while the IgG1 family, including families specific for recall antigens, is smaller (Phad, GE et al., 2022). The present invention designs a specific B cell recall strategy and scheme to reduce the "interference" of non-related immune B cell sequences and significantly increase the frequency of antigen-specific B cell sequences.

[0094] definition

[0095] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the terms one, one or more, and at least one are used interchangeably herein.

[0096] The terms "include" and "comprising" and variations thereof do not have a limiting meaning when these terms appear in the specification and claims. Thus, the terms "include" and "comprising" can be used interchangeably.

[0097] "Optional" or "optionally" means that the subsequently described event, circumstance, or component can or cannot occur, and that the description includes instances where the event, circumstance, or component occurs and instances where it does not.

[0098] Herein, ranges may be expressed as from "about" one particular value and / or to "about" another particular value. When expressing such a range, examples include from the one particular value and / or to the other particular value. Similarly, when values ​​are indicated as approximate by use of the antecedent "about," it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.

[0099] Unless explicitly stated otherwise, any method described herein should not be construed as requiring that its steps be performed in a specific order. Therefore, a method claim that does not actually state that its steps follow a certain order, or that does not specifically indicate in any other way in the claims or description that the steps are limited to a specific order, is not intended to imply any specific order. Any single or multiple features or aspects recited in any claim may be combined with or substituted for any other features or aspects recited in any one or more other claims.

[0100] The term "titer" refers to the maximum dilution of the original serum that has a detectable signal (ELISA OD450 value of 0.3).

[0101] Herein, animals include mammals that can produce immune responses, such as murines, lagomorphs, felines, canines, monkeys, and camelids, including alpacas (Vicugna pacos), Bactrian camels (Camelus bactrianus), and llamas (Lama guanicoe).

[0102] As used herein, "frequency" refers to the proportion of the count (abundance) of an event (eg, an antibody sequence) in a library sequence.

[0103] As used herein, the term "expansion ratio" refers to the ratio of the frequency of one situation divided by the frequency of another situation.

[0104] As used herein, "irrelevant immune B cell sequences" or "irrelevant immune B cell sequence interference" are triggered by many body self-defense stimuli, irrelevant pathogens, and long-lived PCs. In order to reduce these "interfering" B cell responses to "almost" background levels, sufficient interruption is necessary. As used herein, "immune interruption" refers to the period of time after target antigen immunization and before recall antigen immunization.

[0105] As used herein, the terms "homology" and "identity" are used interchangeably. In order to determine the identity or homology percentage of two sequences, the sequences can be aligned for optimal comparison. The nucleotides or amino acids are then compared at the corresponding nucleotide or amino acid positions of the two sequences. For example, when the identical nucleotides or amino acids are located at the corresponding positions of the second sequence, the nucleotides or amino acids in the first sequence are considered to be identical to the second sequence. The identity percentage is calculated by determining the number of identical positions divided by the total number of positions (i.e., overlapping positions) multiplied by 100. As defined herein, the term "homology" refers to at least 30%, at least 40% on the other hand, at least 50% on the other hand, at least 60% on the other hand, at least 70% on the other hand, at least 75% on the other hand, at least 80% on the other hand, at least 85% on the other hand, at least 90% on the other hand, at least 95% on the other hand, at least 99% on the other hand, and complete identity on the other hand.

[0106] As used herein, the term "antibody feature" refers to any feature associated with an antibody that groups antibody sequences by certain similar or identical features. These features can be one or more CDR sequences, VH and / or VL sequences, full antibody sequences, pedigrees and / or clusters. For example, if the CDR1, CDR2 and CDR3 sequences of the antibody sequence are identical, the antibody sequence can be grouped according to the CDR sequence (i.e., divided into CDR groups); if the sequence maps to the same V / J germline gene and has a CDR3 of the same length, the antibody sequence can be grouped according to the pedigree, wherein the maximum difference in amino acid sequence does not exceed 1 when the CDR3 length is greater than 4, and the amino acid sequence difference is 0 when the CDR3 length is equal to or less than 4; if the sequence has a CDR3 of the same length and has 80% or more identity in the CDR3 sequence, the antibody sequence can be grouped according to the cluster.

[0107] According to the description of this application, a "recall antigen" can be used to enhance immune animals. The recall antigen can be the same as the original antigen or a part of the original antigen. In principle, any antigen containing a similar epitope in the original immune antigen can be used as a recall antigen.

[0108] As used herein, the term "epitope" can include any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitope determinants are typically composed of chemically active molecular surface groups, such as amino acids or sugar side chains, and typically have specific three-dimensional structural characteristics as well as specific charge characteristics. An antibody is said to specifically bind to an antigen when the equilibrium dissociation constant is ≤1 μM, preferably ≤100 nM, and more preferably ≤10 nM.

[0109] As used herein, an epitope may include a functional domain of a protein. The term "functional domain" may include a domain or a combination of domains having similar or combined functions. For example, the functional domain of mesothelin includes domain 1, domain 2, and / or domain 3, the functional domain of PDL1 includes a distal Ig variable (V) region and a proximal Ig constant (C) region, and the functional domain of UPAR includes an extracellular region.

[0110] The term "KD" refers to the equilibrium dissociation constant for a specific antibody-antigen interaction.

[0111] As used herein, the term "immune response" refers to the action of lymphocytes, antigen presenting cells, phagocytes, granulocytes, and soluble macromolecules (including antibodies, cytokines, and complement) produced by the above-mentioned cells or liver, resulting in selective damage, destruction, or elimination of invading pathogens, cells or tissues infected with pathogens, cancer cells, or (in the case of autoimmunity or pathological inflammation) normal organismal cells or tissues. As used herein, "immunizing" an animal with an antigen refers to the process of contacting the animal with the antigen to the extent that an immune response is produced. Immunization methods known in the art can be used for the immunization.

[0112] As used herein, "antigen-specific T cell response" may refer to a T cell response caused by T cell-specific antigen stimulation of T cells. Non-limiting examples of T cell responses to antigen-specific stimulation include proliferation and cytokine production (eg, IL-2 production).

[0113] As used herein, the term "antibody" refers to (a) intact immunoglobulins, (b) monoclonal or polyclonal antigen-binding fragments with or without an Fc (fragment crystallizable) region or an FcRn-binding fragment of an Fc region ("Fc fragment" or "Fc region"), (c) nanobodies (including naturally occurring camelid nanobodies and heavy chain-only ("VHH") antibodies) or antigen-binding fragments thereof, or (d) IgNAR antibodies found in sharks and other cartilaginous fish. The antigen-binding fragments can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibodies. Antigen-binding fragments include, among others, Fab, Fab', F(ab')2, Fd, Fv, dAb and complementary determining region (CDR) fragments, single-chain antibodies (scFv), single-domain antibodies, chimeric antibodies, diabodies, and polypeptides that contain at least a portion of an immunoglobulin sufficient to confer specific antigen binding properties on the polypeptide. The Fc region includes portions of both heavy chains, constituting two or three classes of antibodies. Fc regions can be produced by recombinant DNA techniques or by enzymatic (eg, papain cleavage) or chemical cleavage of intact antibodies.

[0114] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of an antibody heavy or light chain. The variable domains of the heavy and light chains may be referred to as "V H ” and “V L These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0115] As used herein, "single-chain variable fragment," "single-chain antibody variable fragment," or "scFv" antibody refers to an antibody format that comprises only the variable regions of a heavy chain (VH) and a light chain (VL) connected by a linker peptide. The scFv can be expressed as a single-chain polypeptide. The scFv retains the specificity of the intact antibody from which it is derived. The light and heavy chains can be in any order, for example, VH-linker-VL or VL-linker-VH, as long as the specificity of the scFv for the antigen is retained.

[0116] The term "monoclonal antibody" or "monoclonal antibody composition" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.

[0117] The “heavy chain antibodies” described herein are antibodies derived from camelids or sharks. Compared to the above-mentioned 4-chain antibodies, heavy chain antibodies lack light chains and heavy chain constant region 1 (CH1), and only contain two heavy chains consisting of a variable region (VHH) and other constant regions, wherein the variable region is connected to the constant region by a hinge region-like structure. Each heavy chain of a camel heavy chain antibody contains a variable region (VHH) and two constant regions (CH2 and CH3), and each heavy chain of a shark heavy chain antibody contains a variable region and five constant regions (CH1-CH5). The antigen-binding fragments of heavy chain antibodies include VHH and single-chain heavy chain antibodies. Heavy chain antibodies can have the CH2 and CH3 of human IgG-Fc by fusing with the constant region of human IgG-Fc.

[0118] As used herein, the terms "single domain antibody," "heavy chain variable region domain of a heavy chain antibody," "VHH," and "nanobody" are used interchangeably and all refer to a single domain antibody that specifically recognizes and binds to an antigen. A single domain antibody is a variable region of a heavy chain antibody. Typically, a single domain antibody comprises three CDRs and four FRs. A single domain antibody is the smallest functional antigen-binding fragment.

[0119] The term "isotype" may refer to the antibody class (such as IgM or IgG1) encoded by the heavy chain constant region gene. The antibody may be an immunoglobulin G (IgG), IgM, IgE, IgA or IgD molecule, or be derived from them.

[0120] The term "VHH 2 ”, “VHH 3” and “VH 1 ” represent the heavy chains of camelid IgG isotypes IgG2, IgG3 and IgG1, respectively. VL 1 Represents the light chain of camel IgG1. Camel VL 1 Including but not limited to Vκ and Vλ.

[0121] The term "assess" includes any form of measurement, including whether a particular element is present. The terms "determine," "measure," "assess," "assess," and "determine" are used interchangeably herein and include quantitative and / or qualitative determinations. Assessments can be relative or absolute. "Assessing the presence" includes determining the amount of something present, and / or determining whether it is present.

[0122] The term "peripheral blood mononuclear cells" or "PBMCs" refers to blood cells with a single, approximately round nucleus (as opposed to a lobed nucleus), including lymphocytes (T cells, B cells, and NK cells), monocytes, and macrophages. PBMCs can be enriched from whole blood using a Ficoll density gradient.

[0123] The term "hyperproliferation" refers to an event (eg, a sequence or a group of sequences) with a frequency greater than 1%. Hyperproliferation can be used to describe sequences and groups that are highly amplified in the immune repertoire.

[0124] "Rank," "antibody sequence rank," or "group rank" refers to the order in which antibody sequences or groups are arranged based on priority factors. Priority factors include, but are not limited to, abundance, frequency, growth rate of antibody sequences or groups, dynamic changes in abundance and frequency of antibody sequences or groups during immunization, antibody affinity maturation, antibody sequences with the same naive B cell origin between VHHs and VHs, avoidance of sequences with poor developability, and combinations thereof.

[0125] The term "Hamming distance" refers to the number of positions where corresponding symbols differ between two sequences of equal length.

[0126] As used herein, the terms "antibodies grouped by antibody features", "antibody-feature-related antibodies" and "antibodies associated with antibody features" and grammatically equivalent variants thereof are antibodies produced by cells having a common B cell ancestor. Antibodies associated with antibody features bind to the same epitope of the antigen, and they are generally very similar in sequence, particularly in light and heavy chain CDR3. The heavy and light chain CDR3s of antibodies associated with antibody features can have the same length and almost identical sequence (i.e., differ by a maximum of 5, i.e., 0, 1, 2, 3, 4, or 5 residues). When the antibody feature comprises CDR3, the minimum CDR3 distance of a specific CDR3 is the minimum Hamming distance of the CDR3 compared to all other CDR3s of the same length. In some embodiments, the minimum CDR3 distance is equal to or less than 1. In some cases, the B cell ancestor comprises a genome having a rearranged light chain VIC region and a rearranged heavy chain VDJ region, and produces antibodies that have not yet undergone affinity maturation.

[0127] As used herein, the term "at least CDR3" or "at least a CDR3 sequence" refers only to the CDR3 sequence, to the CDR3 sequence together with the CDR1 and / or CDR2 sequence, or to a sequence comprising CDR3 of at least 50 consecutive amino acids of a variable domain up to the entire length of the variable domain.

[0128] In this application, the term "CDR", also known as "complementarity determining region", generally refers to a region in an antibody variable domain whose sequence is highly variable and / or forms a structurally defined loop. Typically, an antibody comprises six CDRs; three in VH (HCDR1, HCDR2, HCDR3) and three in VL (LCDR1, LCDR2, LCDR3). Heavy chain antibodies consist only of heavy chains (referred to as VHH). Antibody CDRs can be determined by a variety of coding systems, such as CCG, Kabat, AbM, Chothia, IMGT, Kabat / Chothia, etc. These coding systems are known in the art and can be found, for example, at http: / / www.bioinf.org.uk / abs / index.html#kabatnum.

[0129] As used herein, the term "pedigree" refers to a theoretical lineage. A "pedigree" is a type of "group," and sometimes a group of antibodies related to a pedigree is referred to as a "pedigree group." The terms "group" or "pedigree" are exclusive because a sequence can only belong to one group or pedigree.

[0130] As used herein, the term "subgrouping" refers to further grouping of sequences within a pedigree based on unique features or characteristics. "Subgrouping" is not exclusive, meaning that a sequence can be in different subgroups. For example, a sequence can simultaneously possess two, three, four, five, or six unique features. "Subgrouping" applies only to VHHs. Applying VHH sequence features can help better select / narrow test pedigrees (representative sequences), which may lead to better biofunction / bioactivity results.

[0131] As used herein, the term "pedigree analysis" refers to the analysis of the theoretical lineage of an antibody, which is typically accomplished by analyzing a pedigree tree.

[0132] As used herein, the term "sequence read" refers to the nucleotide sequence determined by a sequencer, for example, by base calling software associated with that technology.

[0133] As used herein, the term "obtaining an amino acid sequence" refers to obtaining a file comprising an amino acid sequence. It is well known that a nucleic acid sequence can be translated into an amino acid sequence on a computer.

[0134] As used herein, the term "most abundantly expressed" refers to the most abundant protein sequence in a sample. The abundance of a protein can be determined by counting the sequence reads encoding that protein. The protein encoded by the most sequence reads is the most abundant protein.

[0135] The phrases "monoclonal antibody that recognizes an antigen epitope," "antibody that recognizes an antigen," and "antigen-specific antibody" are used interchangeably herein with the term "antibody that specifically binds to an antigen."

[0136] The term "specific binding" refers to the ability of an antibody to preferentially bind to a particular antigen present in a homogeneous mixture of different molecules. In certain embodiments, the specific binding interaction is able to discriminate between desired and undesired molecules in a sample, in some embodiments by more than about 10 to 100-fold, such as more than about 1000- or 10,000-fold. Specific binding can be detected using any technique known in the art, such as...

[0137] As used herein, the term "does not substantially bind" to a protein or cell may mean that it is unable to bind or does not bind to a protein or cell with high affinity, i.e., with an affinity of 2x10 -6 M or larger, more preferably 1x10 -5 M or larger, more preferably 1x10 -4 M or larger, more preferably 1x10 -3 M or larger, even more preferably 1x10 -2 Binds to proteins or cells with a KD of M or greater.

[0138] "High affinity" for IgG antibodies may refer to antibodies with a 1x10 -6 M or smaller, preferably 1x10 - 7 M or smaller, more preferably 1x10 -8 M or smaller, even more preferably 1x10 -9 M or smaller, even more preferably 1x10 -10 However, “high affinity” binding may vary for other antibody isotypes.

[0139] A "CDR-grafted antibody" is an antibody that comprises one or more CDRs derived from a particular species or isotype and the framework of another antibody of the same or different species or isotype.

[0140] There are differences in one or more amino acid substitutions, deletions and / or additions compared to antibody sequences derived from non-human species. Therefore, compared to non-human antibodies, humanized antibodies are less likely to induce an immune response when administered to a subject, and / or the induced immune response is milder. In one embodiment, certain amino acids in the framework and constant region of the heavy and / or light chains of non-human species antibodies are mutated to produce humanized antibodies. In another embodiment, the constant region from a human antibody is fused with the variable region of a non-human species. In another embodiment, the humanized antibody is a CDR-grafted antibody that comprises one or more CDRs and a human antibody framework derived from a specific species or isotype. In another embodiment, one or more amino acid residues in one or more CDR sequences of a non-human antibody are changed to reduce the possible immunogenicity of the non-human antibody when administered to a human subject, wherein the changed amino acid residues are not critical for the immunospecific binding of the antibody to its antigen, or the changes made to the amino acid sequence are conservative changes so that the binding of the humanized antibody to the antigen is no worse than that of the non-human antibody to the antigen. Examples of how to make humanized antibodies can be found in US Pat. Nos. 6,054,297, 5,886,152, and 5,877,293.

[0141] The term "chimeric antibody" refers to an antibody that comprises one or more regions from one antibody and one or more regions from one or more other antibodies. In one embodiment, one or more CDRs are derived from a human antibody. In another embodiment, all CDRs are derived from human antibodies. In another embodiment, CDRs from more than one human antibody are mixed and matched in a chimeric antibody. For example, a chimeric antibody may comprise CDR1 from a first human antibody light chain, CDR2 and CDR3 from a second human antibody light chain, and CDRs from a third antibody heavy chain. Other combinations are also possible.

[0142] The term "biparatopic antibody" refers to an antibody that binds to two non-overlapping epitopes of an antigen. In some embodiments, the biparatopic antibody comprises a VHH containing only heavy chains and no light chains. In some embodiments, the biparatopic antibody comprises a VHH containing only heavy chains and a conventional VH 1 / VL 1 In some embodiments, a biparatopic antibody comprises two conventional VH 1 / VL 1 In some embodiments, a biparatopic antibody has a first heavy chain and a first light chain from a monoclonal antibody targeting one epitope, and a heavy chain and a light chain from another antibody targeting another epitope. In some embodiments, the other light chain or heavy chain can be different from the first light chain or heavy chain.

[0143] The binding of the antibodies disclosed herein to the antigen can be assessed using one or more techniques commonly used in the art. For example, the antibodies can be tested by ELISA analysis, for example using recombinant antigen protein. Other suitable binding assays include, but are not limited to, flow cytometry assays in which the antibodies are reacted with cell lines expressing human antigens (e.g., HEK293 cells). Alternatively or in addition, the binding of the antibodies, including binding kinetics (e.g., K D Values) and the like can be tested in BIAcore binding assays, Octet Red96 (Pall) and the like.

[0144] The term "single B cell sorting" refers to the sorting of individual and isolated B cells based on antigen specificity. Techniques used for single cell isolation and sorting include, but are not limited to, FACS (fluorescence activated cell sorting, e.g., using fluorescently labeled antigens to isolate antigen-binding cells), ISAAC (immunospot array analysis on chips), LCM (laser capture microdissection), microengraving, and droplet microfluidics.

[0145] The term "rarity score" can refer to a measure of similarity to a human germline sequence. In some embodiments, this value is calculated based on the framework regions of the germline. Prior to calculation, an overview of the percentage usage of each residue in each length of the four framework regions is determined based on all human IGHV germlines. For each VHH sequence, the residue at each position in the four framework regions is compared to the profile of the framework region of the same length, and the rarity score for each position in the framework region is calculated based on the percentage usage of that residue divided by the highest percentage usage at the same position. The rarity score of a sequence is the average of the rarity scores of all framework region residues.

[0146] The term "mismatch score" refers to a metric for determining the SHM rate. It is calculated as the average number of mismatches in a 100 bp alignment with the best matching germline gene.

[0147] The term "bit score" is an output value of the BLAST local sequence alignment search tool, which is used to describe the overall quality of the alignment. The larger the bit score value, the higher the sequence similarity.

[0148] The term "pharmaceutical formulation" refers to a preparation that is in a form that permits the active ingredient contained therein to be biologically effective and that contains no additional ingredients that would be unacceptably toxic to a subject to which the preparation would be administered.

[0149] A "therapeutically effective amount" of an agent (e.g., a pharmaceutical formulation or cell) is an amount effective to achieve a desired therapeutic outcome (e.g., for treating a disease, condition, or disorder) and / or a pharmacokinetic or pharmacodynamic effect of treatment, at a dosage and for a necessary period of time. A therapeutically effective amount may vary depending on factors such as the disease state, age, sex, and weight of the subject, as well as the cell population being administered. In some embodiments, provided methods comprise administering cells and / or compositions in an effective amount (e.g., a therapeutically effective amount).

[0150] method

[0151] The present application provides a method for effectively discovering antibodies, which can identify antibodies from the immune repertoire without the need for experimental selection / enrichment steps. Specifically, a method for producing antibodies specific to a target is provided, the method comprising: (a) immunizing an animal with a target antigen for one or more rounds, (b) reducing the serum antibody titer of the animal by 2 times or more, (c) immunizing the animal with a recall antigen (e.g., one round of immunization), the antibody binding region of the recall antigen having at least 30% homology with the target antigen (d) generating antibody sequences from the B cells of the animal 1-20 days after step (c) immunization, and (e) selecting antibodies from the antibody sequences by one or more priority factors. In one embodiment, more antibodies can be selected by repeating steps (b) to (e).

[0152] The inventors have found that reducing the serum antibody titer of the animal by more than 2 times compared with the last immunization is crucial for the effectiveness of antibodies after recall antigen immunization. Of course, a greater reduction in the titer is more effective (for example, a reduction of 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times or more).

[0153] In one or more embodiments, the serum antibody titer of the animal is reduced by at least 2-fold compared to 1-20 days after the previous immunization. In one or more embodiments, the serum antibody titer of the animal is reduced by at least 2-fold compared to 1-14 days, 4-11 days, or 4-7 days after the previous immunization.

[0154] The method for reducing the serum antibody titer of the animal is not limited, and this effect can usually be achieved by interrupting immunity for a certain period of time. Step (b) may include: subjecting the animal to an immune interruption of 21 days or longer, for example, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days (6 weeks) or longer.

[0155] In one or more embodiments, the method further comprises collecting B cells from the animal within 1-20 days (preferably 1-14 days, more preferably 4-11 days, and even more preferably 4-7 days) after the immunization in step (c) for subsequent antibody sequence grouping.

[0156] In one or more embodiments, the method comprises steps b.1) after step b) and before step c) of collecting first antigen-specific B cells from an animal, and b.2) generating a VHH-containing antigen-specific B cell from the antigen-specific B cell. 2 、VHH 3 and VH 1 and VL 1 In one embodiment, b.2) may include 1) preparing cDNA from antigen-specific B cells; 2) sequencing the cDNA to obtain multiple VHH 2 、VHH 3 、VH 1 Heavy chain sequence and multiple VL 1 (Vκ and Vλ) light chain sequences to generate camelid IgG2 (HcAb), IgG3 (HcAb) and IgG1 (conventional Ab) libraries. In one embodiment, the camelid antibodies generated comprise IgG2. In one embodiment, the camelid antibodies generated comprise IgG3.

[0157] In one or more embodiments, step d) comprises: step d.1): collecting second antigen-specific B cells of the animal 1-20 days after immunization, and step d.2): generating VHH-containing antigen-specific B cells from the antigen-specific B cells. 2 、VHH 3 and VH 1 and VL 1 In one embodiment, d.2) may include 1) preparing cDNA from antigen-specific B cells; 2) sequencing the cDNA to obtain multiple VHH 2 、VHH 3 、VH 1 Heavy chain sequence and multiple VL 1(Vκ and Vλ) light chain sequences to generate camelid IgG2 (HcAb), IgG3 (HcAb) and IgG1 (conventional Ab) repertoires. In one embodiment, the antigen comprises multiple epitopes. In one embodiment, the camelid antibodies generated comprise IgG2. In one embodiment, the camelid antibodies generated comprise IgG3.

[0158] In one or more embodiments, step e) comprises: e.1) grouping the antibody sequences according to antibody characteristics, e.2) grouping the antibody sequences comprising VHH heavy chains (VHH) according to priority factors. 2 、VHH 3 ) and select the top-ranked group; e.3) select representative sequences from the selected group based on the priority factors within the group. The antibody characteristics are selected from one or more of the following: CDR sequence, VH sequence, VL sequence, VHH sequence, antibody sequence, pedigree and cluster. In one or more embodiments, step e.2) includes further selecting an affinity matured group from the top-ranked group. Affinity maturation can be judged as follows: the mutation value of the antibody sequence or group compared to the germline gene has an increasing trend compared to before, for example, the mutation value of the antibody sequence or group compared to the germline gene satisfies the following relationship: 1-20 days after step (c) immunization > after step (b) > after step (a). The mutation value can be measured by a mismatch score or a bit score. The larger the mismatch score, the greater the mutation value. The smaller the bit score, the greater the mutation value.

[0159] The antibodies produced by the present invention can be humanized by replacing the amino acid at one or more substitutable positions of the original antibody with the amino acid at the corresponding position in the human antibody. In one or more embodiments, the method further comprises replacing the amino acid at one or more substitutable positions in the original VHH or VH or VL with the amino acid at the corresponding position in the human antibody. In one embodiment, the substitutable positions are in the CDR region. In one embodiment, the substitutable positions are in the FR region.

[0160] Herein, the priority factors include the abundance or frequency of antibody sequences or groups from high to low, the increase rate of the abundance or frequency of antibody sequences or groups from high to low, the abundance or frequency change of antibody sequences or groups during the immunization process, antibody affinity maturation, sharing the same naive B cell-derived antibody sequences or groups between VHHs, avoiding sequences with poor developability, and combinations thereof. In one or more embodiments, the priority factors are selected from: the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200,1201-1300,1301-1400,1401-1500,1501-1600,1601-1700,1701-1800,1801-1900 or 1901-2000 or less antibody sequences or groups, and / or, an antibody sequence or group with an increase in abundance or frequency of 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times or 10 times or more. In some embodiments, the method further comprises repeating steps (b) to (e) above to identify an antibody, wherein the representative sequence is selected from the group ranked in the top 2,000 to 10,000 in abundance or frequency.

[0161] Herein, the abundance or frequency of a group is the sum of the abundance or frequencies of all antibody sequences (e.g., VH, VL, VHH or full-length antibody sequences) in a certain group. For example, the abundance or frequency of a pedigree is the sum of the abundance or frequencies of all antibody sequences in a certain pedigree group. The abundance or frequency of a cluster is the sum of the abundance or frequencies of all antibody sequences in a certain cluster group. The abundance or frequency of a CDR group is the sum of the abundance or frequencies of all antibody sequences in the group when the antibody sequences are grouped according to the CDR sequence (i.e., the antibody sequences in the group have the same CDR). The growth rate of the abundance or frequency of a group refers to the ratio of the abundance or frequency of a group in a certain situation relative to the abundance or frequency of the group mapped thereto in another situation. The mutation value of a group refers to the average value of the mutation values ​​of all antibody sequences in the group.

[0162] In one or more embodiments, if the developability is poor, the antibody is excluded from further development. Developability can be determined by performing sequence feature analysis on the antibody sequence. Non-limiting examples of poor developability include unpaired cysteines, N-linked glycosylation, methionine oxidation, tryptophan oxidation, asparagine deamidation, aspartate isomerization, lysine glycosylation, N-terminal glutamate, integrin binding, CD11c, fragmentation, immunogenicity, expression, homogeneity, solubility, stability, viscosity, and / or formulation.

[0163] Herein, B cells can be collected by any means known in the art, such as from blood, spleen, lymph nodes or bone marrow. In a preferred embodiment, B cells are collected from blood.

[0164] Herein, sequencing can be performed by any method now known or later discovered. In some embodiments, sequencing is performed by next generation sequencing (NGS). Any NGS method can be used in these embodiments. See, for example, Slatko et al. (2018) for an overview of NGS methods.

[0165] To map sequences to groups from NGS data, the following criteria can be used: if the sequence has the same CDR1 / CDR2 / CDR3 sequence as one of the sequences in the CDR sequence group, the sequence is mapped to the CDR sequence group; if the sequence has the same V / J germline genes as the lineage and has the same CDR3 sequence as one of the sequences in the lineage, the sequence is mapped to the lineage group; if the sequence has the same CDR3 sequence as one of the sequences in the cluster, the sequence is mapped to the cluster group.

[0166] Similarly, groups from one NGS dataset can be mapped to groups from another NGS dataset. If the CDR sequence groups of one NGS dataset share the same CDR1 / CDR2 / CDR3 sequences as the CDR sequence groups of another NGS dataset, they can be mapped to the CDR sequence groups of the other NGS dataset. If the lineage groups of one NGS dataset have the same V / J germline genes and share a common CDR3 as the lineage groups of another NGS dataset, the lineage groups of the one NGS dataset will be mapped to the lineage groups of the other NGS dataset. If the cluster groups of one NGS dataset share a common CDR3 with the cluster groups of another NGS dataset, the cluster groups of the one NGS dataset will be mapped to the cluster groups of the other NGS dataset.

[0167] In some embodiments, the growth rate of each sequence is generated by comparing the antibody signature sequence frequency between the first and second antigen-specific B cells. Sequences can be grouped into CDR groups, for example, if their CDR1, CDR2 and CDR3 sequences are identical. In addition, sequences can be further grouped into pedigrees, for example, if the sequence is mapped to identical V / J germline genes and has CDR3 of the same length, wherein the CDR3 of length greater than 4 has a maximum 1 aa difference and the CDR3 of length equal to or shorter than 4 has 0aa difference. If the sequence has CDR3 of the same length and has 80% or more identity in the CDR3 sequence, the sequence can also be further grouped into cluster groups. The growth rate of group is also calculated. In some embodiments, the growth rate of group refers to the frequency ratio between the group mapped in the sequence library (NGS data set) of the second antigen-specific B cell and the sequence library (NGS data set) of the first specific B cell and the group mapped by the group. In one embodiment, the "growth rate" of a sequence or group refers to the ratio of the frequency of sequences or groups with a particular antibody characteristic among antibody sequences produced by B cells after immunization with the recall antigen divided by the frequency of sequences or groups with the same antibody characteristic among antibody sequences produced by B cells before immunization with the recall antigen.

[0168] Herein, a "target" can be a peptide, protein, hapten (e.g., conjugated to a carrier molecule), mRNA, DNA, a viral vector that allows expression of the target antigen, or a cell. In some embodiments, the target comprises one or more selected from the group consisting of mesothelin, PDL1, and UPAR.

[0169] As used herein, a "target antigen" comprises one or more or all epitopes of the target. A "target antigen" can be a peptide, protein, hapten (e.g., conjugated to a carrier molecule), mRNA, DNA, a viral vector that allows expression of the target antigen, or a cell or a portion thereof that contains an epitope.

[0170] In some embodiments herein, the target antigen comprises a portion of the target as an epitope (e.g., a sequence fragment) or consists of the epitope. For example, the target antigen is a target or a portion of the target comprising one or more functional domains thereof (e.g., a sequence fragment). In other embodiments herein, the target comprises a portion of the target antigen as an epitope (e.g., a sequence fragment) or consists of the epitope. In some embodiments, the target is a target antigen or a portion of the target antigen comprising one or more functional domains thereof (e.g., a sequence fragment).

[0171] Herein, a "recall antigen" comprises one or more or all epitopes of the target antigen."Recall antigen" can be a peptide, protein, hapten (e.g., conjugated to a carrier molecule), mRNA, DNA, a viral vector that allows expression of the target antigen, or a cell or a portion thereof that comprises an epitope.

[0172] In some embodiments herein, the recall antigen comprises or consists of a portion (e.g., a sequence fragment) of the target as an epitope. For example, the recall antigen is a portion (e.g., a sequence fragment) of the target or a target comprising one or more functional domains thereof.

[0173] In some embodiments herein, the recall antigen comprises a portion of a target as an epitope (e.g., a sequence fragment) or consists of the epitope. For example, the recall antigen is a target or a portion of a target comprising one or more functional domains thereof (e.g., a sequence fragment). In other embodiments herein, the target comprises a portion of a recall antigen as an epitope (e.g., a sequence fragment) or consists of the epitope. In some embodiments, the target is a recall antigen or a portion of a recall antigen comprising one or more functional domains thereof (e.g., a sequence fragment).

[0174] In some embodiments herein, the recall antigen comprises a portion of the target antigen as an epitope (e.g., a sequence fragment) or consists of the epitope. For example, the recall antigen is a target antigen or a portion of the target antigen comprising one or more functional domains thereof (e.g., a sequence fragment). In other embodiments herein, the target antigen comprises a portion of the recall antigen as an epitope (e.g., a sequence fragment) or consists of the epitope. In some embodiments, the target antigen is a recall antigen or a portion of the recall antigen comprising one or more functional domains thereof (e.g., a sequence fragment). In one or more embodiments, the recall antigen is the same as the target antigen.

[0175] In some embodiments, the target antigen is or consists of a fragment of mesothelin comprising domains 2 and 3 thereof, and the recall antigen is or consists of a fragment of mesothelin comprising domains 2 and 3 thereof.

[0176] In one or more embodiments, the target antigen is set forth in any one or more of SEQ ID NOs: 1-3, and the recall antigen is set forth in any one or more of SEQ ID NOs: 1-3. In one or more embodiments, the target antigen is set forth in SEQ ID NO: 2, and the recall antigen is set forth in SEQ ID NO: 2. SEQ ID NO: 1 is the full-length human MSLN protein, SEQ ID NO: 2 is domains 2 and 3 of the human MSLN protein, and SEQ ID NO: 3 is domains 2 and 3 of the cynomolgus monkey MSLN protein.

[0177] In one or more embodiments, the target antigen is set forth in SEQ ID NO: 4, the recall antigen is set forth in SEQ ID NO: 4, and SEQ ID NO: 4 is the full length of human PD-L1. In one or more embodiments, the target antigen is set forth in SEQ ID NO: 5, the recall antigen is set forth in SEQ ID NO: 5, and SEQ ID NO: 5 is the full length of human uPAR.

[0178] In one or more embodiments, in the methods described herein for producing antibodies specific for a target, step (a) comprises immunizing an animal with a target antigen for multiple rounds, wherein the target antigen is a homologous sequence in different species or a fragment thereof comprising one or more functional domains. For example, the target antigen can be mesothelin or a fragment thereof comprising a functional domain (e.g., 1, 2, or 3 of domain 1, domain 2, and domain 3) in different species. Exemplarily, the target antigen is as shown in SEQ ID NOs: 2 and 3, and the recall antigen is as shown in SEQ ID NO: 1 or 2. The different species are preferably different species of the same order, such as primates, including but not limited to humans and cynomolgus macaques. In one or more embodiments, step (a) comprises immunizing 1-4 times with the antigen set forth in SEQ ID NO: 2, followed by 1-2 times with the antigen set forth in SEQ ID NO: 3, and then 1-4 times with the antigen set forth in SEQ ID NO: 2.

[0179] The method includes repeating steps (b) to (e) to select more antibodies. When repeating steps (b) to (e), the recall antigen can be the same as or different from the previous one, as long as the recall antigen contains one or more or all epitopes of the target antigen. Exemplarily, the target antigen is set forth in SEQ ID NOs: 2 and 3, the first recall antigen is set forth in SEQ ID NO: 2, and the second recall antigen is set forth in SEQ ID NO: 1.

[0180] In the art, antigens used for immunization may be modified to enhance the immunogenicity of the antigen, and such modifications are common knowledge in the art. For example, an immunoglobulin Fc (e.g., IgG1 or IgG2b Fc) or a His tag may be added to the C-terminus of the antigen. The Fc can be derived from a desired species, such as human, mouse, rat, rabbit, dog, monkey, or camelid. The human IgG1 Fc sequence is shown in SEQ ID NO: 50, and the alpaca (Llama) IgG2b Fc sequence is shown in SEQ ID NO: 51. In some embodiments, the target antigen may or may not contain modifications, and the recall antigen may or may not contain modifications. In one or more embodiments, the target antigen may or may not contain modifications, and the recall antigen may or may not contain modifications. In one or more embodiments, the target antigen may or may not contain an immunoglobulin Fc at the C-terminus, and the recall antigen may or may not contain an immunoglobulin Fc. In one or more embodiments, the target antigen may or may not contain an immunoglobulin Fc at the C-terminus, and the recall antigen may or may not contain an immunoglobulin Fc at the C-terminus. In one or more embodiments, the target antigen may or may not contain an immunoglobulin Fc at the C-terminus, and the recall antigen may or may not contain an immunoglobulin Fc at the C-terminus. In one or more embodiments, the target antigen may or may not contain a His tag at the C-terminus, and the recall antigen may or may not contain a His tag at the C-terminus.

[0181] In one or more embodiments, the target antigen is SEQ ID NO: 2 containing human IgG1 Fc at the C-terminus, and the recall antigen is SEQ ID NO: 2 without modification at the C-terminus. In one or more embodiments, the target antigen is SEQ ID NO: 2 containing human IgG1 Fc at the C-terminus, the first recall antigen is SEQ ID NO: 2 without modification at the C-terminus, and the second recall antigen is SEQ ID NO: 1 containing a His tag at the C-terminus.

[0182] In one or more embodiments, the target antigen is SEQ ID NO: 4 containing an alpaca IgG2b Fc tag at the C-terminus, and the recall antigen is SEQ ID NO: 4 without modification at the C-terminus. In one or more embodiments, the target antigen is SEQ ID NO: 5 containing a His tag at the C-terminus, and the recall antigen is SEQ ID NO: 5 without modification at the C-terminus.

[0183] A schematic diagram of an embodiment of the present application is shown in Figure 2. This embodiment includes: 1) performing one or more rounds of standard immunization using proteins, peptides, DNA, mRNA or cell antigens or immunogens (such as DNA or small molecules containing carrier proteins or peptides or proteins containing carrier proteins or antigen complexes such as cells or tissues), 2) monitoring the antibody titer of the serum, which can reach 256k or higher (Figure 5). 3) Immunization is interrupted for more than 6 weeks. The repertoire is very dynamic, and the titer usually decreases after a few weeks of immunization interruption. 4) Collect PBMC samples before boosting (i.e., immunization with recall antigens) as a baseline for analyzing B cell antibody characteristics. 5) Boost animals with recall antigens. 6) Collect PBMC samples from the boosted animals between 3 and 11 days after boosting to maximize the opportunity to capture GC-independent and antigen-specific MBCs and PCs. 7) Prepare NGS libraries from these PBMC samples using standard procedures and generate antibody sequences using a sequencer or other sequencing technology (methods known in the art). 8) Select sequences from the NGS library. 9) Obtaining antibodies with the selected sequences and testing to determine whether the selected antibodies have a biological function associated with the antigen. In some embodiments, the biological function associated with the antigen is specific binding or neutralization.

[0184] Step 8) An exemplary process for selecting sequences from the NGS library is shown in Figure 3. First, the sequences generated from these PBMC samples are processed to identify the CDR regions and germline sequences of each sequence. The count (abundance), frequency, growth rate, mutation value, etc. of the sequence are calculated. For example, by comparing with the corresponding sequence in the baseline sample (step 4) collected before booster immunization, the growth rate of each sequence is calculated. The mutation value refers to the mutation value of the antibody sequence compared with the germline sequence. As described above, the mutation value can be measured by methods well known in the art such as mismatch score and bit score.

[0185] Sequences were further analyzed and grouped. Sequences were grouped into CDR sequences if their CDR1, CDR2, and CDR3 sequences were identical. Sequences were further grouped into lineages if they mapped to the same V / J germline genes and had CDR3s of the same length, with CDR3s greater than 4 having a maximum of 1 aa difference and CDR3s of length equal to or shorter than 4 having zero difference. Sequences were grouped into clusters if they had CDR3s of the same length and CDR3 sequences had 80% or more identity.

[0186] Then, groups are selected based on the priority factors. In some embodiments, groups with a high abundance or frequency ranking (e.g., top 30, 60, 90, 120, 150), and / or a growth rate of 5 times or more are selected.

[0187] In some embodiments, the sequence data is processed by: i. grouping the Nanobody sequences in the library by CDR sequence (CDR group), repertoire and cluster; and ii. generating growth rates for sequences, CDR groups, repertoires and / or clusters by comparing the sequences in the post-boost and pre-boost NGS data.

[0188] In some embodiments, the top 100 counts and / or sequences or groups with a 5-fold or greater increase in counts by sequence, CDR set, lineage, or cluster are selected for testing.

[0189] By analyzing sequence features, antibodies can be selected or excluded based on sequence features. For example, if an antibody sequence has sequence features that are associated with poor developability, it will be excluded.

[0190] As shown in Figure 2, recall antigens can be reused and PBMC samples collected to discover more antibodies.

[0191] The present invention also provides a method for producing a target-specific antibody, the method comprising the steps of: (i) obtaining an identified antibody according to the method for identifying an antibody according to any embodiment of the present specification, and (ii) testing the specific binding of the antibody obtained in (i) to the target. In one embodiment, (ii) may include 1) synthesizing DNA of a selected representative sequence, 2) constructing a vector comprising the DNA sequence, 3) expressing the vector in a cell, and 4) testing the antibody for affinity and biological activity. In some embodiments, step 4) includes determining the binding affinity, specificity and / or neutralization ability of the antibody to the antigen.

[0192] Partial implementation plan of the present invention:

[0193] Item 1. A method for producing antibodies specific for a target, the method comprising: (a) immunizing an animal with a target antigen in one or more rounds, (b) reducing the serum antibody titer of the animal by 2-fold or more, (c) immunizing the animal with a recall antigen, the antibody binding region of the recall antigen having at least 30% identity with the target antigen, (d) generating antibody sequences from B cells of the animal 1-20 days after immunization in step (c), and (e) selecting antibodies from the antibody sequences based on one or more priority factors, and optionally f) repeating steps (b) to (e).

[0194] Item 2. The method as described in Item 1 is characterized in that step (b) includes: interrupting the immunization of the animal until the serum antibody titer is reduced by 2 times or more.

[0195] Item 3. The method as described in Item 2 is characterized in that step (b) includes: subjecting the animal to an immune interruption of 21 days or longer.

[0196] Item 4. The method as described in Item 3 is characterized in that step (b) includes: subjecting the animal to an immune interruption of 42 days or longer.

[0197] Item 5. The method as described in Item 4 is characterized in that step (b) includes: subjecting the animal to an immune interruption of 156 days or longer.

[0198] Item 6. The method as described in Item 1, characterized in that in step (d): antibody sequences are generated from B cells of animals 4-14 days after immunization in step (c).

[0199] Item 7. The method as described in Item 6, characterized in that in step (d): antibody sequences are generated from B cells of animals 4-11 days after immunization in step (c).

[0200] Item 8. The method as described in Item 7, characterized in that in step (d): antibody sequences are generated from B cells of the animal 4-7 days after immunization in step (c).

[0201] Item 9. The method as described in Item 1 is characterized in that the step (e) comprises: (1) grouping the antibody sequences according to antibody characteristics, preferably, the antibody characteristics are selected from one or more of the following: CDR sequence, VH sequence, VL sequence, VHH sequence, lineage and cluster; and (2) selecting the group by one or more priority factors.

[0202] Item 10. The method as described in Item 1 or 9 is characterized in that the priority factors are selected from: the abundance or frequency of antibody sequences or groups from high to low, the growth rate of the abundance or frequency of antibody sequences or groups from high to low, the change in the abundance or frequency of antibody sequences or groups during the immunization process, antibody affinity maturation, sharing the same naive B cell source between VHHs, avoiding sequences with poor developability, and combinations thereof.

[0203] Item 11. The method as described in Item 10 is characterized in that the growth rate is the growth rate of B cells of the animal 1-20 days after immunization in step (c) compared with the growth rate of B cells of the animal after step (b).

[0204] Item 12. The method of item 10 or 11, characterized in that the priority factor is selected from any one or a combination of any two or three of the following: (A) the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 101-2000, 201-3000, 301-4000, 401-5000, 501-6000, 601-7000, 801-9000, 801-10 ... -800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or lower, (B) the abundance or frequency of the antibody sequence or group increases by 5 times or more, and (C) the mutation value of the antibody sequence or group tends to increase compared with the previous value.

[0205] Item 13. The method as described in Item 12 is characterized in that the mutation value of the antibody sequence or group satisfies the following relationship: 1-20 days after immunization in step (c) > after step (b) > after step (a).

[0206] Item 14. The method as described in Item 1, characterized in that the recall antigen contains one or more or all epitopes of the target antigen.

[0207] Item 15. The method as described in Item 1, characterized in that the target antigen is a peptide, protein, hapten, mRNA, DNA, a viral vector that allows the expression of the target antigen, or a cell.

[0208] Item 16. The method of Item 9, wherein the antibody selected in (e) is excluded if the growth rate of 1, 2, 3 or 4 of the sequences selected from the group consisting of antibody sequences, CDR sequence groups, repertoires and clusters is less than 2.

[0209] Item 17. The method of Item 9, characterized in that if the antibody selected in (e) has at least one poor developability factor, the antibody is excluded, wherein the at least one developability is immunogenicity, expression, homogeneity, solubility, stability, viscosity or formulation.

[0210] Item 18. The method according to Item 1, wherein the antibody is expressed by prokaryotic or eukaryotic cells.

[0211] Item 19. The method according to Item 1, wherein the antibody is a single domain antibody or an immunoglobulin.

[0212] Item 20. A method as described in Item 9, characterized in that the antibody characteristic is a lineage, and the antibodies in a lineage map to the same V and J germline genes and have a maximum distance of a specific CDR3 equal to or less than 1 between the two closest CDR3s in the lineage, wherein all CDR3s have the same length.

[0213] Item 21. The method as described in Item 9 is characterized in that the antibody feature is a cluster, and the antibodies in the cluster have the same CDR3 length, and the CDR3 identity between the two closest CDR3s is greater than or equal to 80%.

[0214] Item 22. The method as described in Item 1, characterized in that the sequence is generated by sequencing technology.

[0215] Item 23. The method as described in Item 22, characterized in that the sequence is generated by NGS or single-cell sequencing technology.

[0216] Item 24. The method according to any one of Items 1 to 23, characterized in that step (e) further comprises testing the specific binding of the selected antibody to the target.

[0217] The present invention is further described below by way of the accompanying drawings and examples. The scope of the present invention is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions, and methods are clearly within the scope of the present invention. Any embodiment of the present invention is applicable, mutatis mutandis, to any other embodiment of the present invention, unless expressly stated otherwise.

[0218] It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 2002), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are calculated by weight.

[0219] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0220] Example

[0221] Example 1. Memory B cell recall and discovery of multiple binders against MSLN

[0222] 1. Immunity

[0223] Mesothelin (MSLN) is a well-known oncology target suitable for CAR-T therapy. In developing antibodies targeting this target, domains 2 and 3 of human MSLN were used to immunize alpacas. The specific immunization method involves the following steps: 1. Remove the protein to be immunized. For the first immunization, pipette a 0.5 mg dose into a 5 mL EP tube according to the immunization schedule. Dilute to 1 mL with DPBS. 1. Pipette an equal volume of 1mL of Freund's complete adjuvant and add it to the protein solution to be immunized. When immunizing subsequently, the dose of the immunogen is halved and emulsified with Freund's incomplete adjuvant at the same time; 2. Use a handheld homogenizer and adjust it to gear 4 to slowly emulsify the protein adjuvant mixed solution until it is completely emulsified; 3. Slowly aspirate the emulsified antigen solution into a 1mL syringe for later use; 4. Bind the alpaca and select the subcutaneous junction of the alpaca's neck and forelegs, the hind leg groin, and about ten points on the back as immunization points. The distance between the points should be more than 5cm. Use a wool razor to shave a small area of ​​the immunization point to expose the epidermis; 5. Use iodine tincture / alcohol cotton balls to wipe, clean and disinfect the immunization points; 6. Take out the antigen emulsion emulsified in step 4 and use intradermal injection to immunize the selected immunization points. The immunization dose is 200μL per point; 7. Observe whether the immunization point is bleeding and gently wipe and disinfect it with iodine tincture / alcohol again.

[0224] The detailed immunization schedule is shown in Figure 4. After 10 rounds of immunization, an immune break of 156 days and recall antigen immunization (IM11 on July 14, 2022) was performed, followed by another 132-day immune break and recall antigen immunization (IM13 on December 7, 2022). Detailed titer data for some collected blood are shown in Figure 5. The sequence of NBL501-AgD23 is shown in SEQ ID NO: 2. The sequence of NBL501-cynoAgD23 is shown in SEQ ID NO: 3.

[0225] The titer detection method has the following steps: 1. Antigen coating: dilute the corresponding antigen to 1μg / mL with coating solution, 100μL per well, and coat overnight at 4℃; 2. Wash: 250μL PBST / well, wash 3 times; 3. Blocking: After washing, add 200μL 3% BSA blocking solution to each well and incubate at 37℃ for 2 hours; 4. Wash: 250μL PBST / well, wash 3 times; 5. Sample incubation: take out the alpaca serum to be tested, dilute it with 1% BSA at a two-fold ratio of 1 / 1000, 1 / 2000... 11 gradients, add them to the antigen-coated 96-well enzyme-labeled plate, 100μL per well, and incubate at room temperature for 1 hour; 6. Wash the plate: 250μL PBST / well, wash 3 times; 7. Add enzyme-labeled antibody incubation: take out Gaot pAb to Llama IgG After dilution, add 100 μL of H&L (HRP) (ab112786) secondary antibody to each well of the ELISA plate and incubate at room temperature for 0.5 h. 8. Color development: Wash three times with 250 μL of PBST per well, add 100 μL of TMB to each well, and develop for approximately 5 min. 9. Stop and read the plate: Add 50 μL of hydrochloric acid to each well to stop the reaction, and read the plate at a dual wavelength of 450 / 650.

[0226] As shown in Figure 5, after three rounds of immunization, the titer was the highest (1024K). The titer of the last immunization before the immunization interruption (IMI0) was 128K. On July 14, 2022, 156 days after the immunization interruption, the titer before the booster immunization (Pre-IM11) was 64K, which was much lower than the peak titer and was 1 / 2 of the last immunization (IM10). After the booster immunization, the titer increased to 128K after 7 days and reached 512K after 14 days. In order to show whether the recall requires an immunization interruption, a second immunization was performed 14 days after the first booster. The titer (IM12 collected 7 days after the second immunization) did not increase further after the second immunization (as shown in Figure 5).

[0227] 2. Sequencing and Library Construction

[0228] Three PBMC samples (Pre-IM11: before the first booster immunization; IM11: 7 days after the first booster immunization; IM12: 7 days after the second booster immunization, i.e., 21 days after the first booster immunization) were sequenced using NGS technology to obtain three NGS sequence data (sequence libraries).

[0229] The PBMC collection method is as follows: 1) Take fresh anticoagulated whole blood and dilute it with 1× diluent wash buffer at a 1:1 ratio (to reduce blood viscosity). Gently mix and set aside. 2) Add an appropriate amount of mononuclear cell separation buffer to a sterile centrifuge tube and layer the diluted blood sample evenly on top of the separation buffer (separation buffer: diluted whole blood = 1:2), maintaining a clear interface between the two liquids. 3) Centrifuge at 800g for 20-30 minutes at room temperature (note: use slow acceleration and deceleration). 4) After centrifugation, discard the plasma layer and carefully aspirate the PBMC layer (i.e., the buffy coat layer) and transfer it to a 15mL centrifuge tube. After centrifugation, the tube should contain, from top to bottom, the diluted plasma layer, the PBMC layer, the separation buffer layer, and the red blood cell layer. 5) Add 10mL of 1× diluent wash buffer to resuspend the cells in the centrifuge tube. Centrifuge at 250g for 10 minutes at room temperature and discard the supernatant. Repeat this step one to two times before use in subsequent experiments.

[0230] The specific steps for NGS library construction and sequencing are as follows:

[0231] 1. RNA extraction using Trizol method:

[0232] (1) Take PBMC soaked in Trizol from -80℃ freezer;

[0233] (2) Add chloroform (20% of the total volume of Trizol) and invert 15 times until the solution turns milky white. Mix thoroughly and let stand at room temperature for 3 minutes.

[0234] (3) Centrifuge in a refrigerated centrifuge at 4°C and 12,000 g for 15 min, and remove the upper aqueous phase to a new centrifuge tube;

[0235] (4) Estimate the total volume of the supernatant from the previous step, add an equal volume of isopropanol, mix thoroughly, and let stand at room temperature for 10 min;

[0236] (5) Centrifuge at 12,000 g for 10 min at 4°C to precipitate total RNA;

[0237] (6) Remove the supernatant, add 500 μL of pre-chilled 75% ethanol, gently shake the centrifuge tube to suspend the precipitate, centrifuge in a refrigerated centrifuge at 4°C and 7500 rpm for 1 min, remove the supernatant, and centrifuge again at 4°C and 7500 rpm for 1 min to remove all ethanol;

[0238] (7) Open the lid and let it stand at room temperature to dry. Add about 200 μL of RNase-Free Water to dissolve the RNA.

[0239] 2. Reverse transcription: by Takara's PrimeScript TMReverse transcription was performed using II 1st Strand cDNA Synthesis Kit (Cat: 6210A).

[0240] 3. Target fragment amplification: Using the reverse transcribed cDNA as a template, perform PCR reaction with upstream and downstream primers specific to alpaca, cut the gel to recover the target fragment for NGS sequencing. The upstream and downstream primers can specifically amplify the nanobody gene of B cells

[0241] Forward primers (SEQ ID NO: 45-47): LeaderMix:

[0242] PME207-LPVH1 gcagtggctgcaggtgtccactcg

[0243] PME207-LPVH4 gcaggtccccaaggtgtcctgtcc

[0244] PME207-LPVH3 ggtggtcctggctgctct

[0245] Reverse primer (SEQ ID NO: 48-49): HingMix:

[0246] PME207-Hig2b-R gtttttgttcctggcctcccgggccactagtttgtggttttggtgtcttggg

[0247] PME207-Hig2c-R gtttttgttcctggcctcccgggccactagtggggtcttcgctgtggtgcgc

[0248] 4. Library construction and sequencing: Vazyme's VAHTS was used for library construction TM Universal DNA Library Prep Kit for V3 kit; sequencing was performed using Illumina Miseq.

[0249] 3. Sequence Grouping and Sorting

[0250] The CDR regions were identified for the sequences in the sequence library and the sequence abundance, frequency, growth rate, and mutation value were calculated. The sequence growth rate was the ratio of the sequence frequency after the boost to the sequence frequency before the boost.

[0251] There are three specific grouping methods for grouping sequences: ① Grouping by CDR: Antibody sequences in a CDR group have the same CDR (3 CDRs for single-domain antibodies); ② Grouping by lineage: Antibodies in a lineage map to the same V and J germline genes, and have a maximum distance of a specific CDR3 equal to or less than 1 between the two closest CDR3s in the lineage, where all CDR3s have the same length; ③ Grouping by cluster: Antibodies in a cluster have the same CDR3 length, and the two closest CDR3s have a CDR3 identity greater than or equal to 80%.

[0252] For each group, the group abundance, group frequency, group growth rate, and group mutation value (in this embodiment, the mutation value is the mismatch score) are calculated. As described above, the group abundance is the sum of the abundances of all sequences in the group, the group frequency is the sum of the frequencies of all sequences in the group, the group growth rate is the ratio of the group frequency after the boost to the group frequency mapped to the group before the boost, and the group mismatch score is the average of the mismatch scores of all sequences in the group.

[0253] The summary of NGS data processing for the three samples is shown in Table 1.

[0254] Table 1

[0255] By sequence, CDR group, lineage, or cluster, the groups with the top ranking counts or those with a 5-fold or greater increase in counts were selected.

[0256] Select representative sequences from the group, generally choosing the most abundant sequence. If this sequence has issues with developability, choose the second most abundant sequence, and so on. The selected sequences are synthesized and affinity tested. Affinity testing is performed using methods known in the art, such as ELISA.

[0257] 4. Mapping using identified binders

[0258] For this project, hundreds of MSLN binders were identified in the blood of this animal during the first 10 rounds of immunization using traditional screening methods (phage display). If memory B cell recall is effective, we expect that some of these binders will reappear. To identify potential such cases, we mapped MSLN binders to lineages in three samples based on the following criteria: the binder and the lineage share the same V and J genes, and the binder's CDR3 sequence is identical to a sequence in the lineage. The results for these three samples are summarized in Table 2. In Table 2, A30 represents the animal number, NBL501 represents the project number, and the values ​​in the table represent the number of lineages covered when the identified MSLN binders are mapped to the top 30, top 60, top 90, top 120, and top 150 lineages.

[0259] Table 2

[0260] Based on previous experience, PBMCs typically contain 0.1-5% antigen-specific B cells. Without antigen-specific enrichment, we are generally unlikely to observe binders among the top-ranked lineages, likely because these B cells are induced by various pathogens or non-relevant immunogens, and long-lived PCs typically predominate. However, as shown in Table 1, the sample on day 7 after boost (IM11) contained 25 binder-mapped lineages among the top 150 lineages analyzed, indicating that many of the top-ranked lineages in the IM11 sample are binders. Notably, 11 of the top 30 lineages were binder-mapped lineages, representing a high proportion of 36.7%.

[0261] We also mapped the identified MSLN binders to clusters of three samples based on the following criterion: the binder and one of the sequences in the cluster had the same CDR3 sequence. The results are summarized in Table 3, where the values ​​are the number of clusters covered when the identified MSLN binders were mapped to the top 30, top 60, top 90, top 120, and top 150 clusters.

[0262] Table 3

[0263] As shown in Table 3 , the sample at day 7 after boost (IM11) contained 23 binder-mapped lineages among the top 150 clusters analyzed, indicating that many of the top-ranked clusters in the IM11 sample were binders.

[0264] We also mapped MSLN binders to the CDR groups of the three samples based on the following criteria: the binder had identical CDR1, CDR2, and CDR3 sequences to one of the sequences in the CDR group. The results are summarized in Table 4, where the values ​​are the number of CDR groups covered when the identified MSLN binders were mapped to the top 30, top 60, top 90, top 120, and top 150 CDR groups.

[0265] Table 4

[0266] As shown in Table 4 , the sample at day 7 post-boost (IM11) contained 15 binder-mapped lineages among the top 150 CDR groups analyzed, indicating that many of the top-ranked CDR groups in the IM11 sample are binders.

[0267] To examine whether the top-ranked lineages that did not map binders in IM11 contained binders, sequences from these lineages were synthesized and tested. Sequence selection was performed as follows: the most abundant sequence was selected. If this sequence presented issues with developability, the second-most abundant sequence was selected, and so on. Specifically, one sequence was tested from each of the top 30 lineages to which no binders had previously been found (SEQ ID NOs: 6-24, NBL501#283-NBL501#301). Six of these sequences failed expression. Using an OD value greater than 0.5 at 100 nM as the binding criterion, 12 of the remaining 13 clones bound antigen (as shown in Figure 15 ), for a 92% positive rate (as shown in Table 5 ). For control purposes, clones from the top-ranked lineages were also tested in IM12. Specifically, one sequence from each of the top 20 lineages was tested (SEQ ID NOs: 25-44, NBL501#302-NBL501#321, amino acid sequences are provided at the end of the article). Two sequences failed expression. Using an OD value greater than 0.5 at 100 nM as the binding standard, three of the remaining 18 sequences bound to the antigen (as shown in Figure 15), for a positive rate of only 17% (as shown in Table 5). Since the IM12 sample was collected 7 days after the second boost and no titer increase was observed after the boost, this result suggests that successful recall of memory B cells requires an interruption in immunization to reduce the titer. This result is consistent with our expectations, as a large amount of antibodies (high titer) in the serum will bind to the boost antigen and prevent them from activating memory B cells.

[0268] Table 5

[0269] To analyze the repertoire dynamics during memory B cell recall, we compared the frequency changes of the top-ranked lineages with a frequency ≥ 0.1% in the IM11 sample across the three samples (Figure 6, A). The results showed that the process of lineage growth and contraction during B cell recall was very dynamic: most of these top-ranked lineages grew after the boost immunization and rapidly contracted to low levels in the IM12 sample (i.e., 21 days after the boost immunization). Figure 6, B shows the growth rates of the top 30 lineages in IM11 and the corresponding lineages in the PRE-IM11 sample. Most of them showed an increase of more than 20 times, and some of them were hyper-proliferated lineages with a frequency of 1% or more. Table 6 shows the number of hyper-proliferated lineages in the three samples. IM11 had the majority of hyper-proliferated lineages.

[0270] Table 6

[0271] 5. Second Recall

[0272] On December 7, 2022, 132 days after the previous immunization, a second memory B cell recall booster immunization was performed. Four PBMC samples (IM13-D4, IM13-D7, IM13-D11, and IM13-D14) were collected on the 4th, 7th, 11th, and 14th days after the second recall booster immunization. Figure 5, B shows the titers of these four samples and the titers of the pre-boost samples (PRE-IM13). Compared with the titers after IM12 immunization, the titers dropped from 512K to 32K 132 days after the interruption of immunization, a decrease of more than 10 times. The booster immunization restored the titer to 512K within 11 days (Figure 5, B). Mapping the available MSLN binders to these samples showed that IM13-D4 and IM13-D7 had the most mapped binders among the top-ranked lineages (Table 7, where the values ​​are the number of lineages covered when the identified MSLN binders were mapped to the top 30, top 60, top 90, top 120, and top 150 lineages), indicating that many of the top-ranked lineages in these two samples are binders. These two samples also had the most hyperproliferative lineages (Table 7).

[0273] Table 7

[0274] To analyze the dynamics of repertoire changes during the two memory B cell recall cycles, we compared the changes in the frequencies of the top-ranked lineages with a frequency ≥0.1% in the IM11 sample (Figure 7, A) with those in the IM13-D4 sample (Figure 7, B). The results revealed that some lineages were enriched during both recall cycles, while others were enriched in only one of the two recall cycles. Given the dynamic nature of the repertoire, these results may not be surprising. However, they do demonstrate the value of multiple recall cycles in identifying more binders. To quantitatively assess the similarity of the seven repertoires, we calculated the Morisita Horn repertoire overlap index (Rempala and Seweryn, 2013) across these samples (Figure 8). The overlap indices between IM11, IM12, and PRE-IM11 were all below 10%, indicating rapid repertoire changes during memory B cell recall. IM13-D4 and D7 showed high similarity, with an overlap index of 81.32%, while IM13-D11 and D14 showed high similarity, with an overlap rate of 72.47%. IM13-D7 and IM13-D11 showed low similarity, with an overlap index of only 11.79%, indicating that the repertoires between D7 and D11 changed rapidly. Interestingly, although the samples of IM11 and IM13-D4 / D7 were collected approximately 5 months apart, their repertoires showed considerable similarity, with overlap indices of 48.21% and 27.98%, respectively. These results demonstrate the robustness of the memory B cell recall method.

[0275] Similar dynamic changes were found based on clusters (Figures 9, 10), CDR groups (Figures 11, 12), and full-length sequences (Figures 13, 14).

[0276] Example 2: Memory B cell recall in more animals immunized with different antigens

[0277] To further confirm the reproducibility of this approach, we performed memory B cell recall in a larger number of animals immunized with different antigens. Table 8 summarizes the PBMC sample information, titers, corresponding binder mapping data, and the number of hyperproliferating lineages from these experiments. For NBL501, the antigen was MSLN; for NBL518, the antigen was PDL1; and for NBL521, the antigen was UPAR.

[0278] The sources of antigens used in the examples are as follows:

[0279] Human Mesothelin (C-6His); Cat: CP51-1mg; Novoprotein / Nearshore;

[0280] hPD-L1, Llama IgG2b Fc; Cat: H211118604; Huakang Biotechnology;

[0281] Human uPAR,His Tag; Cat: #UPR-H5226; Acro.

[0282] The antigen sequence is as follows:

[0283] Table 8

[0284] As shown in Table 8, memory B cell recall was efficient across antigens and animals. Specifically, samples from several days after boost all contained multiple binder-mapped lineages among the top-ranked lineages analyzed, indicating that many of the top-ranked lineages in these samples were binders. Overall, samples with more binders among the top-ranked lineages also had more hyperproliferating lineages, suggesting a rapid expansion of antigen-specific clones and lineages during memory B cell recall.

[0285] To test whether the top-ranked lineages not mapped by any binders were binders, we selected sequences from some of these lineages for testing. The results of these experiments are summarized in Table 9. Overall, Day 4 / 7 samples had a high rate of binder positivity in the top-ranked lineages, consistent with the binder mapping data.

[0286] Table 9

[0287] To investigate the relationship between lineage growth rate, high abundance, and binders, we summarized the number of lineages with growth rates greater than or less than 5-fold in the top 30, 60, and 90 lineages by abundance and the corresponding number of binder-mapped lineages (Table 10). The results showed that compared with lineages in the pre-boosted sample, the number of lineages with growth rates greater than 5-fold was greater than the number with growth rates less than 5-fold, and the majority of binder-mapped lineages were found in lineages with growth rates greater than 5-fold. Comparing the data for all D7, top 90 lineages, 27% of the binder-mapped lineages had growth rates greater than 5-fold, while only 3% had growth rates less than 5-fold. These data demonstrate the value of using a 5-fold growth rate for lineage selection.

[0288] Table 10

[0289] The above-described embodiments merely represent several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art may make several modifications and improvements without departing from the scope of the present invention, and these modifications and improvements fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be based on the appended claims. At the same time, all documents mentioned in this application are cited as references in this application, just as if each document was cited as a reference individually.

[0290] References

[0291] Daisuke Kitamura,Mechanisms for the regulation of memory B-cell recall responses in mice,International Immunology,Volume 33,Issue 12,December 2021,Pages 791-796

[0292] DeKosky, BJet al., High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire. Nature Biotechnology, 31(2), 166-169(2013).

[0293] Dogan I,Bertocci B,Vilmont V,Delbos F,Mégret J,Storck S,et al.Multiple layers of b cell memory with different effector functions.Nat Immunol(2009)10:1292-9.

[0294] Fesseha,H.(2020).Monoclonal Antibody and its Diagnostic Application-Review.Biomedical Journal of Scientific & Technical Research,30(4)

[0295] Glaros,V.,Rauschmeier,R.,Artemov,A.V.,Reinhardt,A.,Ols,S.,Emmanouilidi,A.,Gustafsson,C.et al.,Limited access to antigen drives generation of early B cell memory while restraining the plasmablast response.Immunity 2021.54:2005-2023.e2010

[0296] Heo,Y.S.(2022).Recent Advances in Antibody Therapeutics.In International Journal of Molecular Sciences(Vol.23,Issue 7)

[0297] Inoue,T.,&Kurosaki,T.(2023).Memory B cells.Nature Reviews Immunology.Jacob D.Galson,Johannes Trück,Anna Fowler,Elizabeth A.Clutterbuck,Márton Münz,Vincenzo Cerundolo,Claudia Reinhard,Robbert van der Most,Andrew J.Pollard,Gerton Lunter,Dominic F.Kelly.Analysis of B Cell Repertoire Dynamics Following Hepatitis B Vaccination in Humans,and Enrichment of Vaccine-specific Antibody Sequences.EBioMedicine 2(2015)2070-2079

[0298] NJ,Suan D,Butt D,Bourne K,Hermes JR,Chan TD,Sundling C,Kaplan W,Schofield P,Jackson J,Basten A,Christ D,Brink R.Differentiation of germinal center B cells into plasma cells is initiated by high-affinity antigen and completed by Tfh cells.J Exp Med.2017 May 1;214(5):1259-1267

[0299] Milstein,C(1999).″The hybridoma revolution:an offshoot of basic research".BioEssays.21(11):966-73

[0300] Parmley SF,Smith GP(1988)."Antibody-selectable filamentous fd phage vectors:affinity purification of target genes".Gene.73(2):305-318.

[0301] Pedrioli,A.,& Oxenius,A.(2021).Single B cell technologies for monoclonal antibody discovery.In Trends in Immunology(Vol.42,Issue 12,pp.1143-1158).Elsevier Ltd

[0302] Phad,G.E.et al.,Clonal structure,stability and dynamics of human memory B cells and circulating plasmablasts.Nature Immunology,23(7),1-10(2022).

[0303] Radbruch A,Muehlinghaus G,Luger EO,Inamine A,Smith KGC, 1 / 2rner T,et al.Competence and competition:the challenge of becoming a long-lived plasma cell.Nat Rev Immunol(2006)6:741-50

[0304] Rebecca A.Elsner1 and Mark J.Shlomchik,Germinal Center and Extrafollicular B Cell Responses in Vaccination,Immunity,and Autoimmunity,Immunity 53,December 15,2020

[0305] Rempala GA,Seweryn M.Methods for diversity and overlap analysis in T-cell receptor populations.J Math Biol.2013 Dec;67(6-7):1339-68

[0306] Valeri,V.,Sochon,A.,Ye,C.,Mao,X.,Lecoeuche,D.,Fillatreau,S.,Weill,J.C.,Reynaud,C.A.,&Hao,Y.(2022).B cell intrinsic and extrinsic factors impacting memory recall responses to SRBC challenge.Frontiers in Immunology,13.

[0307] Tellier,J.and Nutt,S.L.(2019),Plasma cells:The programming of an antibody-secreting machine.Eur.J.Immunol.,49:30-37

Claims

1. A method for producing an antibody specific for a target, the method comprising: (a) immunizing an animal with a target antigen in one or more rounds, (b) reduce the serum antibody titer of the animal by 2-fold or more, (c) immunizing an animal with a recall antigen, the antibody binding region of the recall antigen having at least 30% identity with the target antigen, (d) generating antibody sequences from B cells of the animal 1-20 days after the immunization in step (c), and (e) selecting antibodies from the antibody sequences based on one or more priority factors, and Optional f) repeating steps (b) to (e).

2. The method according to claim 1, characterized in that Step (b) comprises: interrupting the immunity of the animal until the serum antibody titer decreases by 2 times or more.

3. The method according to claim 2, characterized in that Step (b) comprises: Animals were subjected to an immunodeficiency break of 21 days or more.

4. The method according to claim 3, characterized in that Step (b) comprises: Animals were subjected to an immunodeficiency break of 42 days or more.

5. The method according to claim 4, characterized in that Step (b) comprises: Animals were subjected to an immunodeficiency break of 156 days or more.

6. The method according to claim 1, characterized in that In step (d): generating antibody sequences from B cells of the animal 4-14 days after immunization in step (c).

7. The method according to claim 6, characterized in that In step (d): generating antibody sequences from B cells of the animal 4-11 days after immunization in step (c).

8. The method according to claim 7, characterized in that In step (d): generating antibody sequences from B cells of the animal 4-7 days after immunization in step (c).

9. The method according to claim 1, characterized in that The step (e) comprises: (1) grouping the antibody sequences according to antibody characteristics, preferably, the antibody characteristics are selected from one or more of the following: CDR sequence, VH sequence, VL sequence, VHH sequence, repertoire and cluster; and (2) Selecting groups based on one or more priority factors.

10. The method according to claim 1 or 9, characterized in that: The priority factors are selected from: abundance or frequency of antibody sequences or groups from high to low, increase rate of abundance or frequency of antibody sequences or groups from high to low, changes in abundance or frequency of antibody sequences or groups during immunization, antibody affinity maturation, sharing the same naive B cell source between VHHs, avoiding sequences with poor developability, and combinations thereof.

11. The method according to claim 10, characterized in that The growth rate is the growth rate of B cells of the animal 1-20 days after the immunization in step (c) compared to the growth rate of B cells of the animal after step (b).

12. The method according to claim 10 or 11, characterized in that The priority factors are selected from any one or a combination of any two or three of the following: (A) the top 10-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, 91-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 or less in abundance or frequency, (B) the abundance or frequency of an antibody sequence or group increases by 5-fold or more, (C) The mutation value of the antibody sequence or group tends to increase compared with the previous one.

13. The method according to claim 12, characterized in that The mutation value of the antibody sequence or group satisfies the following relationship: 1-20 days after immunization in step (c) > after step (b) > after step (a).

14. The method according to claim 1, wherein: The recall antigen comprises one or more or all epitopes of the target antigen.

15. The method according to claim 1, wherein: The target antigen is a peptide, protein, hapten, mRNA, DNA, a viral vector that allows expression of the target antigen, or a cell.

16. The method according to claim 9, characterized in that If the growth rate of 1, 2, 3 or 4 of the selected antibody sequences, CDR sequence groups, repertoires and clusters is less than 2, the antibody selected in (e) is excluded.

17. The method according to claim 9, characterized in that If the antibody selected in (e) has at least one poor developability factor, the antibody is excluded, wherein the at least one developability is immunogenicity, expression, homogeneity, solubility, stability, viscosity or formulation.

18. The method of claim 1, wherein: The antibodies are expressed by prokaryotic or eukaryotic cells.

19. The method of claim 1, wherein: The antibody is a single domain antibody or an immunoglobulin.

20. The method of claim 9, wherein: The antibody signature is a repertoire, and antibodies in a repertoire map to the same V and J germline genes and have a maximum distance for a particular CDR3 between the closest two CDR3s in the repertoire that is equal to or less than 1, wherein all CDR3s have the same length.

21. The method of claim 9, wherein: The antibody feature is a cluster, and the antibodies in the cluster have the same CDR3 length, and the CDR3 identity between the two closest CDR3s is greater than or equal to 80%.

22. The method of claim 1, wherein: The sequence is generated by sequencing technology.

23. The method of claim 22, wherein: The sequences are generated by NGS or single-cell sequencing technology.

24. The method according to any one of claims 1 to 23, characterized in that The step (e) further comprises testing the specific binding of the selected antibody to the target.

Images