Modifications of polynucleic acid molecules and uses thereof
Modified polynucleic acid molecules with nucleotide analogues in specific positions address the challenge of off-target effects, enhancing stability and efficacy while maintaining safety and effectiveness.
Patent Information
- Application Number
- PCT/US2024/060593
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-05
- Filing Date
- 2024-12-17
- Publication Date
- 2025-06-26
AI Technical Summary
Existing polynucleic acid molecules face challenges in achieving effective modification to reduce off-target effects without compromising stability, efficacy, or increasing cytotoxicity.
The development of modified polynucleic acid molecules incorporating nucleotide analogues, such as acyclic L-threoninol nucleic acid-thymine-3'-phosphate and 2'-fluoro-2-thiouridine-3'-phosphate, in specific positions of the guide strand to enhance stability and reduce off-target effects.
These modifications improve the stability and efficacy of the polynucleic acid molecules while effectively reducing off-target effects, maintaining cytotoxicity at safe levels, and ensuring in vivo stability.
Smart Images

Figure US2024060593_26062025_PF_FP_ABST
Abstract
Description
WSGR Docket No.61382-729.601 MODIFICATIONS OF POLYNUCLEIC ACID MOLECULES AND USES THEREOF CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No.63 / 612,254, filed on December 19, 2023; U.S. Provisional Application No.63 / 619,633, filed on January 10, 2024; and U.S. Provisional Application No.63 / 549,871, filed on February 5, 2024, which are incorporated herein by references in their entirety. BACKGROUND OF THE DISCLOSURE
[0002] Chemical modification to the inhibitory polynucleic acid molecules is designed and optimized to increase stability and efficacy of the inhibitory polynucleic acid molecules as well as to reduce miRNA-like off target effect. Various modification motifs or patterns with ribose modifications (e.g., 2’-modifications on the ribose moiety), base modifications, and / or internucleotide linkage modifications have been designed and tested, yet there is an ongoing effort to develop more modification motifs or patterns that reduce off-target effects without reducing the efficacy of the inhibitory polynucleic acid, increasing cytotoxicity, or decreasing stability of the polynucleic acid molecule in vivo. INCORPORATION BY REFERENCE
[0003] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material. SUMMARY OF THE DISCLOSURE
[0004] To meet the need for a more effective modification of polynucleic acid molecules, disclosed herein, in certain aspects, are modified polynucleic acid molecules for modulating expression of a target gene, wherein the modification of polynucleic acid molecule comprises a nucleotide analogue.
[0005] In one aspect, the present disclosure provides an inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a nucleotide analogue selected from a group consisting of acyclic L-WSGR Docket No.61382-729.601 threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2- thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
[0006] In another aspect, the present disclosure provides an inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a formula: 5’- (A)n1-(B) n2-(C) n3-(D) n4-(E) n5 -3’ wherein A comprises one or more nucleotides selected from 2′-O-alkyl modified nucleotide, 2′- alkoxy modified nucleotide, 2′- alkyl modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, and n1 is 1-7; B comprises one or more nucleotide analogue selected from a group consisting of acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i), and n2 is 1-5; C is selected from DNA, RNA, 2′-O-alkyl modified nucleotide and 2′-halo modified nucleotide and consists of nucleotides with unmodified or same modification, and n3 is 0-6; D is selected from 2′-O-alkyl modified nucleotide and 2′-halo modified nucleotide and comprises nucleotides that are differently modified from their adjacent nucleotides, and n4 is 4-8; and E is selected from 2′-O-alkyl modified nucleotide, 2′-alkoxy modified nucleotide, 2′- halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, and n5 is 3-10.
[0007] In some instances, the inhibitory polynucleic acid molecule is an siRNA.
[0008] In some instances, the nucleotide analogue is located at the seed region of the guide strand (positions 2-8) from the 5’ end. In some instances, the nucleotide analogue is located at any one of positions 4-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 5-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 6-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand.WSGR Docket No.61382-729.601
[0009] In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 7, 12, 14, 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0010] In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 12, 14, and 16 from the 5’ end.
[0011] In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0012] In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide are selected from DNA, RNA, and 2′-O-alkyl modified nucleotide. In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide are 2’-O-methyl modified nucleotides.
[0013] In some instances, the guide strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises two phosphorothioate modified internucleotide linkages at the 5’end and two phosphorothioate modified internucleotide linkages at the 3’ end.
[0014] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methylWSGR Docket No.61382-729.601 modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L- threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acidWSGR Docket No.61382-729.601(GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).
[0015] In some instances, the passenger strand comprises at least two, at least three, or at least four 2’-F modified nucleotides. In some instances, the passenger strand comprises three 2’-F modified nucleotides. In some instances, the passenger strand comprises 2’-F modified nucleotides at at least one of positions 7, 9, and 11 from the 5’ end. In some instances, the passenger strand comprises 2’- F modified nucleotides at positions 7, 9, and 11 from the 5’ end.
[0016] In some instances, the nucleotides in the passenger strand that are not 2’-F modified nucleotide are any one of 2′-O-alkyl modified nucleotide, 2′-alkoxy modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, and UNA. In some instances, the nucleotides in the passenger strand that are not 2’-F modified nucleotide are 2’-O-methyl modified nucleotides.
[0017] In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end.
[0018] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine- glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro- 2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmmXmmmmFmFmFmmmmmmm-3’, and the passenger strandWSGR Docket No.61382-729.601 comprises 5’-mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L- threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine- glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro- 2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid- 3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).WSGR Docket No.61382-729.601
[0019] In some instances, the passenger strand is conjugated with a targeting moiety. In some instances, the targeting moiety is an asialoglycoprotein receptor targeting moiety. In some instances, the asialoglycoprotein receptor targeting moiety comprises N-Acetylgalactosamine (GalNAc) or galactose.
[0020] In some instances, the targeting moiety is conjugated via a linker. In some instances, the linker comprises formula (IV) below,, wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule. In some instances, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in:WSGR Docket No.61382-729.601Z in formula (V’), (V’’’’), (V’’’’’), or (V’’’’’’) is -H, -OH, -O-Methyl, -F, or -O-methoxyethyl, andWSGR Docket No.61382-729.601R in formula (V’), (V’’’’), (V’’’’’), or (V’’’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
[0021] In one aspect, the present disclosure provides a method of modulating mRNA expression or protein expression level of a target gene in a cell or a subject in need thereof, comprising: contacting the cell or administering to the subject the inhibitory polynucleic acid molecule described herein, thereby modulating the mRNA expression or protein expression level of a target gene in the subject.
[0022] In another aspect, the present disclosure provides a method for suppressing off-target effects caused by a guide strand of an inhibitory polynucleic acid molecule in a cell, comprising introducing the inhibitory polynucleic acid molecule described herein to the cell. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative aspects, in which the principles of the disclosure are utilized, and the accompanying drawings below.
[0024] FIG.1 depicts the in vivo efficacy of modified siRNAs targeting AGT mRNA in HuAoGen Mice. The results are shown as relative human AGT mRNA expression on day 35 following siRNA treatment.
[0025] FIG.2 depicts the in vivo efficacy of additional modified siRNAs targeting AGT mRNA in HuAoGen Mice. The results are shown as relative human AGT mRNA expression on day 35 following siRNA treatment.
[0026] FIG.3 depicts the in vivo efficacy of modified siRNAs targeting AGT mRNA in HuAoGen Mice. The results are shown as relative human AGT mRNA expression on day 42 following siRNA treatment.
[0027] FIG.4 depicts the in vivo efficacy of modified siRNAs targeting AGT mRNA in cynomolgus monkeys. The results are shown as % change in serum AGT following siRNA treatment on Day 1.
[0028] FIG.5 depicts the inhibition efficacies of selected ANGPTL3 siRNAs for in vivo testing in mice in the Example 5. The results are shown in the average % change in serum hANGPTL3 protein levels relative to the vehicle control group. The results correspond to the data in Table 10.
[0029] FIG.6 depicts the in vivo efficacy of modified siRNAs conjugated with a GalNAc targeting Lp(a) mRNA in cynomolgus monkeys at a dosage of 1 mg / kg. The results are shown as % changeWSGR Docket No.61382-729.601 in serum Lp(a) protein levels relative to the pre-dose (day 1) timepoint. The results correspond to the data in Table 12.
[0030] FIG.7 depicts the in vivo efficacy of modified siRNAs conjugated with a GalNAc targeting Lp(a) mRNA in cynomolgus monkeys at a dosage of 0.5 mg / kg. The results are shown as % change in serum Lp(a) protein levels relative to the pre-dose (day 1) timepoint. The results correspond to the data in Table 14.
[0031] FIG.8 depicts the in vivo efficacy of modified siRNAs targeting Lp(a) mRNA in cynomolgus monkeys at a dosage of 0.5 mg / kg. The results are shown as % change in serum Lp(a) protein levels relative to the pre-dose (day 1) timepoint. The results correspond to the data in Table 16.
[0032] FIG.9 depicts the in vivo efficacy of modified siRNAs targeting ApoC3 mRNA in transgenic mice at a dosage of 0.5 mg / kg. The results are shown as plasma hApoC3 protein levels relative to the vehicle group. The results correspond to the data in Table 18. DETAILED DESCRIPTION OF THE DISCLOSURE
[0033] Polynucleic acid molecule, such as an inhibitory polynucleic acid molecule, can be utilized to suppress expression of target genes. In some instances, for example, an inhibitory polynucleic acid molecule, e.g., short interfering RNA (siRNA), can act in the RNA interference (RNAi) pathway. Short interfering RNA or siRNA is a double-stranded synthetic RNA that comprises two RNA strands, which are an antisense (or guide) strand and a sense (or passenger) strand. These two RNA strands can form a double-stranded siRNA, and, in some instances, with overhangs at one end of one of the strands or both. When the siRNA is present in the cell, the siRNA-induced gene silencing is initiated by the assembly of the RNA-induced silencing complex (RISC), which comprises the guide strand and other proteins, such as enzymes. The guide strand directs the RISC to complementary sequence region of the target RNA, which, in some instances, initiates the cleavage of the phosphodiester bond between two nucleotides on the target RNA, thereby generating RNA fragments that are further degraded by cellular enzymes, e.g., exonucleases.
[0034] Chemical modification to the inhibitory polynucleic acid molecules is designed and optimized to increase stability and efficacy of the inhibitory polynucleic acid molecules as well as to reduce miRNA-like off target effect. In one aspect, the present disclosure provides modifications of the polynucleic acid molecule described herein by incorporating a nucleotide analogue into the polynucleic acid molecule. In some instances, the polynucleic acid molecule comprises an inhibitory polynucleic acid molecule. In some instances, the inhibitory polynucleic acid molecule comprises siRNA. In some instances, the inhibitory polynucleic acid moleculeWSGR Docket No.61382-729.601 comprises a single-stranded inhibitory polynucleic acid molecule. In some instances, the single- stranded inhibitory polynucleic acid molecule is an antisense oligonucleotide (ASO). In some instances, the inhibitory polynucleic acid molecule comprises a double-stranded inhibitory polynucleic acid molecule. In some instances, the double-stranded inhibitory polynucleic acid molecule comprises a guide strand (an antisense strand) or a passenger strand (a sense strand).
[0035] In some instances, the modifications of polynucleic acid molecule can suppress off-target effects caused by a guide strand (or an antisense strand) of the inhibitory polynucleic acid molecule. In some instances, the modifications of polynucleic acid molecule can improve stability of the polynucleic acid molecule. In some instances, the modifications of polynucleic acid molecule can improve efficacy of the polynucleic acid molecule. In some instances, the modifications of polynucleic acid molecule can suppress off-target effects without compromising the efficacy of the inhibitory polynucleic acid molecule. In some instances, the modifications of polynucleic acid molecule can suppress off-target effects without increasing cytotoxicity of the inhibitory polynucleic acid molecule. In some instances, the modifications of polynucleic acid molecule can suppress off-target effects without decreasing stability of the inhibitory polynucleic acid molecule.
[0036] In some aspects, provided herein are the conjugates of the inhibitory polynucleic acid molecule described herein. In some instances, the inhibitory polynucleic acid molecule is coupled to one or more targeting moiety that targets or delivers the polynucleic acid molecule to a preferred tissue, organ, or cell in the body of the subject. In some instances, the targeting moiety comprises a galactose moiety. In some instances, the targeting moiety comprises a GalNAc moiety. In some instances, the targeting moiety is conjugated or coupled to the inhibitory polynucleic acid molecule via a linker.
[0037] In another aspect, the present disclosure provides a method of modulating mRNA expression or protein expression level of a target in a cell or a subject in need thereof by contacting the cell or administering to the subject the polynucleic acid molecule described herein. Also, provided herein is a method for suppressing off-target effects caused by a guide strand of an inhibitory polynucleic acid molecule described herein. In an aspect, provided herein is a method for improving stability of an inhibitory polynucleic acid molecule described herein. In another aspect, provided herein is a method for improving efficacy of an inhibitory polynucleic acid molecule described herein. Definitions
[0038] The singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixturesWSGR Docket No.61382-729.601 thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B.”
[0039] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0040] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0041] “Percent (%) sequence identity” or “Percent (%) identity” with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acid in a candidate sequence that are identical with the nucleic acid sequence being compared, after aligning the sequences considering any conservative substitutions as part of the sequence identity.
[0042] All ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, and so forth. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, and the like. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub- ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the polynucleic acidWSGR Docket No.61382-729.601 molecules, the polynucleic acid molecule conjugates, the pharmaceutical compositions, the methods and other aspects belong.
[0044] As used herein, the term “complementary” indicates a sufficient degree of complementarity between two nucleic acid molecules that bind stably and specifically to avoid nonspecific binding.
[0045] As used herein, the term “polynucleic acid” and the term “polynucleotide” are interchangeably used to refer a chain of nucleotides. The term “nucleotide” includes a sequence “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base. In some instances, the “nucleotide” can refer to a modified nucleotide (e.g., with modified sugar moiety, modified base, modified internucleotide linkage, or combination thereof, including, but not limited to 2’-modified nucleotide, LNA, ENA, BNA, UNA, GNA etc.) In some instances, the “nucleotide” can refer to a modified nucleotide with a non- canonical base (e.g. including, but not limited to, 2-thiouridine, 2-thiothymidine, inosine, 2- aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).
[0046] As described herein, “phosphoramidites” or “amidites” refers to building block units that are used in chemical synthesis of oligonucleotides such as polynucleic acid molecule described herein. During the synthesis of oligonucleotides, sequential chemical reactions occur using amidites to produce nucleotide chain or polynucleic acid molecule.
[0047] As used herein, a “subject” can be any mammal, including a human and a non-human primate.
[0048] As used herein, the term “treat,” “treating” or “treatment” of any disease or disorder refers, in one instance, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another instance, “treat”, “treating” or “treatment” refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another instance, “treat”, “treating” or “treatment” refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
[0049] The terms “prevent,” “preventing,” and “prevention,” as used herein, refer to a decrease in the occurrence of pathology of a condition in a subject, who does not have, but is at risk of or susceptible to developing a disease or condition. The prevention may be complete, e.g., the total absence of pathology of a condition in a subject. The prevention may also be partial, such that the occurrence of pathology of a condition in a subject is less than that which would have occurred without the present disclosure.WSGR Docket No.61382-729.601
[0050] “Administering” and its grammatical equivalents as used herein can refer to providing pharmaceutical compositions described herein to a subject or a patient. Conventional methods, known to those of ordinary skill in the art of medicine, can be used to administer the composition to the subject, depending upon the type of disease to be treated or the site of the disease. For example, the composition can be administered, e.g., orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, via an implanted reservoir, or via infusion. One or more such routes can be employed.
[0051] The terms “pharmaceutical composition” and its grammatical equivalents as used herein can refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient together with one or more pharmaceutically acceptable excipients, carriers, and / or a therapeutic agent to be administered to a subject, e.g., a human in need thereof.
[0052] The term “pharmaceutically acceptable” and its grammatical equivalents as used herein can refer to an attribute of a material which is useful in preparing a pharmaceutical composition that is generally safe, non–toxic, and neither biologically nor otherwise undesirable and is acceptable for veterinary as well as human pharmaceutical use. “Pharmaceutically acceptable” can refer a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, i.e., the material may be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the pharmaceutical composition in which it is contained.
[0053] A “pharmaceutically acceptable excipient” refers to an excipient that can be administered to a subject, together with an agent, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the agent.
[0054] The term “therapeutic agent” can refer to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. Therapeutic agents can also be referred to as “actives” or “active agents.” Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.
[0055] As used herein, the term “sense strand” can be interchangeably used with the term “passenger strand”, and the tern “antisense strand” can be interchangeably used with the term “guide strand”. In some instances, a nucleic acid sequence described herein for a sense strand and a passenger strand can be interchangeably used. Also, in some instances, a nucleic acid sequence described herein for an antisense strand and a guide strand can be interchangeably used.
[0056] As used herein, the term “consecutive sequence” refers to a sequence contains a number of consecutive nucleotides from a reference sequence. For example, if a reference sequence isWSGR Docket No.61382-729.601N1N2N3N4N5N6N7, a consecutive sequence can be N1N2N3N4or N3N4N5N6, but a sequence of N1N3N4N5 or N3N4N7 cannot be a consecutive sequence.
[0057] As used herein, the term “negative control” refers to a subject or a cell receiving no treatment or placebo.
[0058] It is appreciated that certain features of the polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace operable processes and / or compositions. In addition, all sub-combinations listed in the embodiments describing such variables are also specifically embraced by the present polynucleic acid molecules, and / or polynucleic acid molecule conjugates, pharmaceutical composition comprising the polynucleic acid molecules or the polynucleic acid molecule conjugates, methods and other aspects and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein. Nucleotide Analogue
[0059] In some aspects, the present disclosure provides an inhibitory polynucleic acid molecule incorporating a nucleotide analogue.
[0060] In some instances, modifications of the nucleotide with the nucleotide analogue described herein can alter base pairings and structural changes of the inhibitory polynucleic acid molecule. In some instances, the nucleotide analogue can be incorporated into the inhibitory polynucleic acid molecule, thereby suppressing off-target effects. In some instances, the nucleotide analogue can be incorporated into the inhibitory polynucleic acid molecule, thereby improving stability and / or efficacy of the polynucleic acid molecule. In some instances, the nucleotide analogue described herein can be incorporated into a guide strand, a passenger strand, or a combination thereof.
[0061] In some instances, the nucleotide analogue can be placed in the inhibitory polynucleic acid molecule or be a substitute for a nucleotide in the inhibitory polynucleic acid molecule, therebyWSGR Docket No.61382-729.601 suppressing the off-target effects. In some instances, the nucleotide analogue can be substituted for a nucleotide in the inhibitory polynucleic acid molecule, thereby improving stability and / or efficacy of the inhibitory polynucleic acid molecule. In some instances, the nucleotide analogue described herein can be placed in a guide strand, a passenger strand, or both.
[0062] In some aspects, the present disclosure provides an inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a nucleotide analogue as described herein. In some instances, the nucleotide analogue comprises acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L- threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco- adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'- phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’- phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), or 2'-O-methylinosine-3'- phosphate (i). In some instance, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2- thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine- 3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’- phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the nucleotide analogue is selected from a group consisting of the nucleotide analogue selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2- thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), 2'-deoxy-2- thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
[0063] In some instances, the acyclic L-threoninol nucleic acid- 3'-phosphate (T-T) has a generic representation shown as below, where the base can be any suitable base or modified base that can make Watson-Crick binding with the base on the opposite strand:WSGR Docket No.61382-729.601.
[0064] In some instances, the amidite structure of acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T) is shown as below:.
[0065] In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T) is incorporated into the siRNA. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is incorporated into a guide strand. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is incorporated into a passenger strand. In some instances, an incorporated acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) has structure shown as below:.WSGR Docket No.61382-729.601
[0066] In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) is placed in the inhibitory polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) substitutes one or more nucleotide in siRNA. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T) substitutes one or more nucleotide in a guide strand.
[0067] In some instances, the amidite structure of acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A) is shown as below:.
[0068] In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the acyclic L- threoninol nucleic acid-adenine-3’-phosphate (T-A) is incorporated into the siRNA. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A)is incorporated into a guide strand. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) is incorporated into a passenger strand. In some instances, an incorporated acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) has structure shown as below:.WSGR Docket No.61382-729.601
[0069] In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) is placed in the inhibitory polynucleic acid molecule. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) substitutes one or more nucleotide in siRNA. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A) substitutes one or more the nucleotide in a guide strand.
[0070] In some instances, the amidite structure of acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) is shown as below:.
[0071] In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T- NAc) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) is incorporated into the siRNA. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) is incorporated into a guide strand. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) is incorporated into a passenger strand. In some instances, an incorporated acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) has structure shown as below:.
[0072] In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T- NAc) is placed in the inhibitory polynucleic acid molecule. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) substitutes one or more nucleotide inWSGR Docket No.61382-729.601 siRNA. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T- NAc) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) substitutes one or more nucleotide in a passenger strand. In some instances, the acyclic N-Acetyl L-threoninol abasic nucleic acid-3’-phosphate (T-NAc) substitutes one or more nucleotide in a guide strand.
[0073] In some instances, the amidite structure of 1’,2’-Dideoxyribose-3’-phosphate (dAB) is shown as below:.
[0074] In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into the siRNA. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into a guide strand. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) is incorporated into a passenger strand. In some instances, an incorporated 1’,2’- Dideoxyribose-3’-phosphate (dAB) has structure shown as below:.
[0075] In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) is placed in the inhibitory polynucleic acid molecule. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) substitutes one or more nucleotide in siRNA. In some instances, the 1’,2’-Dideoxyribose-3’- phosphate (dAB) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) substitutes one or more nucleotide in a passenger strand. In some instances, the 1’,2’-Dideoxyribose-3’-phosphate (dAB) substitutes one or more nucleotide in a guide strand.
[0076] In some instances, the amidite structure of thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is shown as below:WSGR Docket No.61382-729.601.
[0077] In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into the siRNA. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into a guide strand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is incorporated into a passenger strand. In some instances, an incorporated thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) has structure shown as below:.
[0078] In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) is placed in the inhibitory polynucleic acid molecule. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in siRNA. In some instances, the thymidine- glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a passenger strand. In some instances, the thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) substitutes one or more nucleotide in a guide strand.
[0079] In some instances, the amidite structure of 2’-O-methyl-2-thiouridine-3’-phosphate (u3) is shown as below:WSGR Docket No.61382-729.601.
[0080] In some instances, the 2’-O-methyl-2-thiouridine-3’-phosphate (u3) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the 2’-O-methyl-2-thiouridine-3’- phosphate (u3) is incorporated into the siRNA. In some instances, the 2’-O-methyl-2-thiouridine- 3’-phosphate (u3) is incorporated into a guide strand. In some instances, the 2’-O-methyl-2- thiouridine-3’-phosphate (u3) is incorporated into a passenger strand. In some instances, an incorporated 2’-O-methyl-2-thiouridine-3’-phosphate (u3) has structure shown as below:.
[0081] In some instances, the 2’-O-methyl-2-thiouridine-3’-phosphate (u3) is placed in the inhibitory polynucleic acid molecule. In some instances, the 2’-O-methyl-2-thiouridine-3’- phosphate (u3) substitutes one or more nucleotide in siRNA. In some instances, the 2’-O-methyl-2- thiouridine-3’-phosphate (u3) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2’-O-methyl-2-thiouridine-3’-phosphate (u3) substitutes one or more nucleotide in a passenger strand. In some instances, the 2’-O-methyl-2-thiouridine-3’- phosphate (u3) substitutes one or more nucleotide in a guide strand.
[0082] In some instances, the amidite structure of 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is shown as below:WSGR Docket No.61382-729.601.
[0083] In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is incorporated into the siRNA. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is incorporated into a guide strand. In some instances, the 2’-fluoro-2-thiouridine-3’- phosphate (U3f) is incorporated into a passenger strand. In some instances, an incorporated 2’- fluoro-2-thiouridine-3’-phosphate (U3f) has structure shown as below:.
[0084] In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) is placed in the inhibitory polynucleic acid molecule. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) substitutes one or more nucleotide in siRNA. In some instances, the 2’-fluoro-2-thiouridine-3’- phosphate (U3f) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) substitutes one or more the nucleotide in a passenger strand. In some instances, the 2’-fluoro-2-thiouridine-3’-phosphate (U3f) substitutes one or more the nucleotide in a guide strand.
[0085] In some instances, the amidite structure of 2-amino-2’-O-methyladenosine-3’-phosphate (a1) is shown as below:WSGR Docket No.61382-729.601.
[0086] In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (a1) is incorporated into the inhibitory polynucleic acid molecule. In some instances, the 2-amino-2’-O- methyladenosine-3’-phosphate (a1) is incorporated into the siRNA. In some instances, the 2-amino- 2’-O-methyladenosine-3’-phosphate (a1) is incorporated into a guide strand. In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (a1) is incorporated into a passenger strand. In some instances, an incorporated 2-amino-2’-O-methyladenosine-3’-phosphate (a1) has structure shown as below:.
[0087] In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (a1) is placed in the inhibitory polynucleic acid molecule. In some instances, the 2-amino-2’-O-methyladenosine-3’- phosphate (a1) substitutes one or more nucleotide in siRNA. In some instances, the 2-amino-2’-O- methyladenosine-3’-phosphate (a1) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the 2-amino-2’-O-methyladenosine-3’-phosphate (a1) substitutes one or more nucleotide in a passenger strand. In some instances, the 2-amino-2’-O- methyladenosine-3’-phosphate (a1) substitutes one or more nucleotide in a guide strand.
[0088] In some instances, the amidite structure of C3-spacer (Pr) is shown as below:WSGR Docket No.61382-729.601.
[0089] In some instances, the C3-spacer (Pr) is incorporated into the polynucleic acid molecule. In some instances, the C3-spacer (Pr) is incorporated into the siRNA. In some instances, the C3- spacer (Pr) is incorporated into a guide strand. In some instances, the C3-spacer (Pr) is incorporated into a passenger strand. In some instances, an incorporated C3-spacer (Pr) has structure shown as below:.
[0090] In some instances, the C3-spacer (Pr) is placed in the polynucleic acid molecule. In some instances, the C3-spacer (Pr) substitutes one or more nucleotide in siRNA. In some instances, the C3-spacer (Pr) substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the C3-spacer (Pr) substitutes one or more nucleotide in a passenger strand. In some instances, the C3-spacer (Pr) substitutes one or more nucleotide in a guide strand.
[0091] In some instances, the 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'- phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2) is shown as below:WSGR Docket No.61382-729.601
[0092] In some instances, the A2, G2, C2, or U2 is incorporated into the polynucleic acid molecule. In some instances, the A2, G2, C2, or U2 is incorporated into the siRNA. In some instances, the A2, G2, C2, or U2 is incorporated into a guide strand. In some instances, the A2, G2, C2, or U2 is incorporated into a passenger strand. In some instances, an incorporated A2, G2, C2, or U2 has structure shown as below:WSGR Docket No.61382-729.601
[0093] In some instances, the A2, G2, C2, or U2 is placed in the polynucleic acid molecule. In some instances, the A2, G2, C2, or U2 substitutes one or more nucleotide in siRNA. In some instances, the A2, G2, C2, or U2 substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the A2, G2, C2, or U2 substitutes one or more nucleotide in a passenger strand. In some instances, the A2, G2, C2, or U2 substitutes one or more nucleotide in a guide strand.
[0094] In some instances, the amidite structure of 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3) and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3) is shown as below:
[0095] In some instances, the 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3) or 2'-deoxy-2- thiothymidine-3'-phosphate (dT3) is incorporated into the polynucleic acid molecule. In some instances, the dA3 or dT3 is incorporated into the siRNA. In some instances, the dA3 or dT3 is incorporated into a guide strand. In some instances, the dA3 or dT3 is incorporated into a passenger strand. In some instances, an incorporated dA3 or dT3 has structure shown as below:WSGR Docket No.61382-729.601
[0096] In some instances, the dA3 or dT3 is placed in the polynucleic acid molecule. In some instances, the dA3 or dT3 substitutes one or more nucleotide in siRNA. In some instances, the dA3 or dT3 substitutes one or more nucleotide in a passenger strand and / or a guide strand. In some instances, the dA3 or dT3 substitutes one or more nucleotide in a passenger strand. In some instances, the dA3 or dT3 substitutes one or more nucleotide in a guide strand.
[0097] In some instances, the nucleotide analogue comprises hypoxanthine nucleobase-containing nucleoside (e.g., inosine). In some instances, the nucleotide analogue comprises 2’-O- methylinosine-3’-phosphate (“i”).
[0098] In some aspects, the present disclosure provides an inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand). In some instances, the guide strand comprises a formula: 5’- (A)n1-(B)n2-(C)n3-(D)n4-(E)n5-3’ where A comprises one or more nucleotides selected from 2′-O-alkyl modified nucleotide, 2′- alkoxy modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, in some instances, n1 is 1, 2, 3, 4, 5, 6, or 7 (1-7); B comprises one or more nucleotide analogue selected from a group consisting of the nucleotide analogue is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2- thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine- 3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-WSGR Docket No.61382-729.601 phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i), in some instances, n2 is 1, 2, 3, 4, or 5 (1-5); C is selected from DNA, RNA, 2′-O-alkyl modified nucleotide and 2′-halo modified nucleotide and consists of nucleotides with unmodified or same modification, in some instances, n3 is 0, 1, 2, 3, 4, 5, or 6 (0-6); D is selected from 2′-Oalkyl modified nucleotide and 2′-halo modified nucleotide and comprises nucleotides that are differently modified from their adjacent nucleotides, in some instances, n4 is 4, 5, 6, 7, or 8 (4-8); and E is selected from 2′-O-alkyl modified nucleotide, 2′- alkoxy modified nucleotide, 2′- halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, in some instances, n5 is 3, 4, 5, 6, 7, 8, 9, or 10 (3-10).
[0099] In some instances, B comprises one or more nucleotide analogue selected from a group consisting of acyclic L-threoninol nucleic acid-thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid- 3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), 2’-deoxy-2-thiothymidine-3’- phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
[0100] In some instances, n1 is 1 to 7, 2 to 7, 3 to 7, 4 to 7, 5 to 7, or 6 to 7. In some instances, n1 is 1, 2, 3, 4, 5, 6, or 7.
[0101] In some instances, n2 is 1 to 5, 2 to 5, 3 to 5, or 4 to 5. In some instances, n2 is 1, 2, 3, 4, or 5.
[0102] In some instances, n3 is 0 to 6, 1 to 6, 2 to 6, 3 to 6, 4 to 6, or 5 to 6. In some instances, n3 is 0, 1, 2, 3, 4, 5, or 6.
[0103] In some instances, n4 is 1 to 8, 2 to 8, 3 to 8, 4 to 8, 5 to 8, 6 to 8, or 7 to 8. In some instances, n4 is 1, 2, 3, 4, 5, 6, 7, or 8.
[0104] In some instances, n5 is 1 to 10, 2 to 10, 3 to 10, 4 to 10, 5 to 10, 6 to 10, 7 to 10, 8 to 10, or 9 to 10. In some instances, n5 is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Modification of Polynucleic Acid Molecule
[0105] In some instances, the inhibitory polynucleic acid molecule is modified in one or more different structures of the polynucleotide acid molecule described herein (e.g., modifications on sugar ring(s), backbone(s) or internucleotide linkage(s), base(s)). In some instances, the inhibitory polynucleic acid molecule comprises a modified nucleotide, which is a nucleotide withWSGR Docket No.61382-729.601 modifications on sugar ring(s), backbone(s) or internucleotide linkage(s), and / or base(s). In some instances, the inhibitory polynucleic acid molecule is further modified to incorporate a nucleotide analogue described herein. In some instances, the inhibitory polynucleic acid molecule comprises a modified nucleotide, which is a nucleotide with modifications on sugar ring(s), backbone(s) or internucleotide linkage(s), and / or base(s), and a nucleotide analogue described herein. In some instances, the modifications described herein comprise incorporation of the nucleotide analogue described herein in the inhibitory polynucleic acid molecule. In some instances, the modifications described herein comprise substitution of one or more nucleotides in the inhibitory polynucleic acid molecule with the nucleotide analogue described herein.
[0106] In some aspects, the inhibitory polynucleic acid molecule is a single-stranded nucleic acid molecule that hybridizes to certain regions of a target RNA, e.g., mRNA or lncRNA. In some aspects, the inhibitory polynucleic acid molecule is a double-stranded nucleic acid molecule. In some instances, the inhibitory polynucleic acid molecule is an siRNA. In some instances, the inhibitory polynucleic acid molecule comprises a guide strand and a passenger strand, and wherein the guide strand hybridizes to certain regions of the target RNA.
[0107] In some aspects, the inhibitory polynucleic acid molecule described herein is 100% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is not 100% complementary to the target region of target RNA. In some instances, the inhibitory polynucleic acid molecule described herein is about 95% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is about 90% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is about 85% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is about 80% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is about 75% complementary to the target region of target RNA. In some aspects, the inhibitory polynucleic acid molecule described herein is about 70% complementary to the target region of target RNA.
[0108] In some aspects, the inhibitory polynucleic acid molecule described herein comprises about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some aspects, the inhibitory polynucleic acid molecule described herein comprises about 15, 16, 17, 18, 19, 20 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises about 21, 22, 23, 24, 25 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises about 26, 27, 28, 29, 30 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described hereinWSGR Docket No.61382-729.601 comprises 19 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises 21 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises 23 nucleotides long.
[0109] In some aspects, the inhibitory polynucleic acid molecule is double stranded, and in some instances, comprises a guide strand and a passenger strand. In some instances, the guide strand (or antisense strand) described herein is 100% complementary to the target region of target RNA. In some aspects, the guide strand described herein is not 100% complementary to the target region of target RNA. In some instances, the guide strand described herein is about 95% complementary to the target region of target RNA. In some aspects, the guide strand described herein is about 90% complementary to the target region of target RNA. In some aspects, the guide strand described herein is about 85% complementary to the target region of target RNA. In some aspects, the guide strand described herein is about 80% complementary to the target region of target RNA. In some aspects, the guide strand described herein is about 75% complementary to the target region of target RNA. In some aspects, the guide strand described herein is about 70% complementary to the target region of target RNA.
[0110] In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19- 23, 20-23, or 21-23 nucleotides in length. In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 15, 16, 17, 18, 19, 20 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 21, 22, 23, 24, 25 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand and a guide strand of about 26, 27, 28, 29, 30 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand of 19 nucleotides long, and a guide strand of about 21 nucleotides long. In some aspects, the inhibitory polynucleic acid molecule described herein comprises a passenger strand of 21 nucleotides long, and a guide strand of about 23 nucleotides long.
[0111] In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 3’ overhang on the guide strand. In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 5’ overhang on the guide strand. In some aspects, the passenger strand and the guide strand described herein are reverse complementary to each other and form a duplex with a 3’ overhang on the passenger strand. In some aspects, the passenger strandWSGR Docket No.61382-729.601 and the guide strand described herein are reverse complementary to each other and form a duplex with a 5’ overhang on the passenger strand.
[0112] In some aspects, the polynucleic acid molecule is modified with a nucleotide analogue described herein by incorporating the nucleotide analogue in a seed region of the guide strand (positions 2-8 from 5’ end of the guide strand). As described herein, “seed region” refers to a region on the polynucleic acid molecule that comprises sequence that is essential for the binding of the polynucleic acid molecule described herein to the target RNA.
[0113] In some instances, the polynucleic acid molecule is modified with a nucleotide analogue described herein at positions 3-8, positions 4-8, positions 5-8, positions 6-8, or positions 7-8 from the 5’ end of the guide strand. In some instances, the polynucleic acid molecule is modified with a nucleotide analogue described herein at position 2, position 3, position 4, position 5, position 6, position 7, position 8, from the 5’ end of the guide strand or combination thereof. In some instances, the polynucleic acid molecule is modified with one, two, three, four, five, six, or seven nucleotide analogues. In some instances, two or more consecutive positions in the guide strand of the polynucleic acid molecule are modified with nucleotide analogues. In some instances, two or more nucleotide analogue modifications can be placed in the polynucleic acid molecule at alternative positions (e.g., positions 3 and 5, positions 4 and 6, positions 5 and 7, etc.).
[0114] In some instances, the polynucleic acid molecule comprises an inhibitory polynucleic acid molecule. In some instances, the inhibitory polynucleic acid molecule is an siRNA comprising a guide strand and a passenger strand. In some instances, the nucleotide analogue is located at the seed region of the guide strand at positions 2-8 from the 5’ end. In some instances, the nucleotide analogue is located at at positions 3-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 4-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 5-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 6-8 from the 5’ end. the nucleotide analogue is located at positions 6-7 from the 5’ end. In some instances, the nucleotide analogue is located at positions 7-8 from the 5’ end. In some instances, the nucleotide analogue is located at positions 10-14, 10-13, 11-14, 11-13 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 12 from the 5’ end of the guide strand. In some instances, at least one nucleotide analogue is located at the seed region of the guide strand at positions 2-8 from the 5’ end and another nucleotide analogue is located at positions 10-14, 10-13, 11-14, 11-13 from the 5’ end of the guide strand. In some instances, at least one nucleotide analogue is located at the seed region of the guide strand at positions 6-8 from the 5’ end and another nucleotide analogue is located at position 12 from the 5’ end of the guide strand. In some instances, one nucleotide analogue is located at the seed region of the guide strand atWSGR Docket No.61382-729.601 positions 7 from the 5’ end and another nucleotide analogue is located at position 12 from the 5’ end of the guide strand.
[0115] In some instances, the nucleotide analogue is located at any one of positions 2-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 3-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 4-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 5-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 6-8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 6-7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at any one of positions 7-8 from the 5’ end of the guide strand.
[0116] In some instances, the nucleotide analogue is located at position 1 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 2 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 4 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 5 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 9 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 10 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 11 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 12 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 13 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 14 from the 5’ end of the guide strand.
[0117] Sugar-modified nucleotide
[0118] In some instances, the sugar-modified nucleotide comprises a modification at a 2’ hydroxyl group of the ribose moiety. In some instances, the sugar-modified nucleotide comprises modification with an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. In some aspects, the sugar-modified nucleotide comprises a 2’-O-alkyl modified nucleotide (e.g., 2’-O-methyl modified nucleotide). In some aspects, the sugar-modified nucleotide is a 2’-O- methyl modified nucleotide or 2’-alkoxy modified nucleotide (e.g., 2’-methoxy modifiedWSGR Docket No.61382-729.601 nucleotide). In some instances, 2' hydroxyl group modification comprises 2'-deoxy, 2'-deoxy-2'- fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O- dimethylaminopropyl (2'-O-DMAP), 2'-O- dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-O- N-methylacetamido (2'-O-NMA). In some instances, the alkyl moiety comprises a hetero substitution. In some instances, the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur. In some aspects, the sugar-modified nucleotide is a 2’- amino modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2’- azido modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2’- deoxy modified nucleotide. In some aspects, the sugar-modified nucleotide is a 2’-O-methoxythyl (2’-MOE). In some aspects, the sugar- modified nucleotide is a locked nucleic acid (LNA). In some aspects, the sugar-modified nucleotide is a bridged nucleic acid (BNA). In some aspects, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some aspects, the sugar-modified nucleotide is a (S)- constrained ethyl (cEt). In some aspects, the sugar-modified nucleotide is a tricyclo-DNA (tcDNA). In some aspects, the sugar-modified nucleotide is a 2’-NH2 nucleic acid. In some aspects, the sugar-modified nucleotide is an unlocked nucleic acid (UNA). In some aspects, the sugar-modified nucleotide comprises 2’-O-alkyl modified nucleotide, 2’-alkoxy modified nucleotide, 2’-alkly modified nucleotide, 2’-halo modified nucleotide, ENA, BNA, LNA, or UNA. In some aspects, the polynucleotide acid molecule described herein comprises modified nucleotides comprising one or more sugarphosphate-modified nucleotide. In some aspects, the modified sugarphosphate is phosphorodiamidate morpholino (PMO). In some aspects, the modified sugarphosphate is phosphoramidate. In some instances, the heterocyclic substitution comprises imidazole, and pyrrolidino. In some aspects, the modified sugarphosphate is thiophosphoramidate. In some aspects, the modified sugarphosphate is peptide nucleic acid (PNA).
[0119] In some aspects, the polynucleotide acid molecule described herein comprises modified nucleotides comprising one or more sugar-modified nucleotide. In some aspects, the sugar- modified nucleotide is a 2’-fluoro (2’-F) modified nucleotide. In some instances, the 2’-F modified nucleotide comprises thio-modified base containing nucleotide, e.g., 2'-fluoro-2-thiouridine-3'- phosphate (U3f). In some instances, the polynucleotide acid molecule comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight 2’- fluoro (2’-F) modified nucleotides. In some instances, the polynucleotide acid molecule comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight 2’-fluoro (2’-F) modified nucleotides. In some instances, the polynucleotide acid molecule comprises from one to eight, from two to eight, from three to eight, from four to eight, from five to eight, from six to eight, or from seven to eight 2’-fluoro (2’-F) modified nucleotides. InWSGR Docket No.61382-729.601 some instances, the polynucleotide acid molecule comprises one, two, three, four, five, six, seven, or eight 2’-fluoro (2’-F) modified nucleotides. In some instances, the polynucleotide acid molecule comprises three 2’-F modified nucleotides. In some instances, the polynucleotide acid molecule comprises five 2’-F modified nucleotides.
[0120] In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 2 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the polynucleic acid molecule comprises 2’-fluoro modified nucleotides at position 12 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 14 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 16 from the 5’ end. In other aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at positions 2, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at positions 2, 7, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at at least three of positions 2, 12, 14, and 16 from the 5’ end. In other aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end.
[0121] In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at position 9 from the 5’ end. In some aspects, the polynucleic acid molecule comprises 2’-fluoro modified nucleotides at position 11 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at at least one of positions 7, 9, and 11 from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at positions 7, 9, 11, or combination thereof from the 5’ end. In some aspects, the polynucleic acid molecule comprises a 2’-fluoro modified nucleotide at positions 7, 9, and 11 from the 5’ end.
[0122] Modified internucleotide linkage
[0123] In some instances, the modifications described herein comprises internucleotide linkage modification. In some aspects, the modified backbone is a methylphosphonate. In some aspects, the modified internucleotide linkage is phosphorothioate internucleotide linkage. In some aspects, the modified internucleotide linkage is a guanidinopropyl phosphoramidate internucleotide linkage. In some aspects, the modified internucleotide linkage e is a mesyl-phosphoramidate (MsPA) internucleotide linkage. In some instances, the modified internucleotide linkage comprises one orWSGR Docket No.61382-729.601 more of phosphorodithioates, methylphosphonates, 5’- alkylenephosphonates, 5’- methylphosphonate, 3’-alkylene phosphonates, borontrifluoridates, borano phosphate esters and selenophosphates of 3’-5’ linkage or 2’-5’ linkage, phosphotriesters, thionoalkylphosphotriesters, hydrogen phosphonate linkages, alkyl phosphonates, alkylphosphonothioates, arylphosphonothioates, phosphoroselenoates, phosphoramidates.
[0124] In some instances, the modifications comprise phosphorothioate modified internucleotide linkage. As described herein, in some instances, phosphorothioate modified internucleotide linkage refers to phosphorothioate bond that connects two nucleotides or modified nucleotides described herein instead of phosphodiester bond. In some instances, the polynucleic acid molecule described herein comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the polynucleic acid molecule described herein comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the polynucleic acid molecule described herein comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the polynucleic acid molecule described herein comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the polynucleic acid molecule described herein comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the polynucleic acid molecule described herein comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified internucleotide linkages.
[0125] In some instances, the polynucleic acid molecule described herein comprises one phosphorothioate modified internucleotide linkage at the 5’- end and one phosphorothioate modified internucleotide linkage at the 3’- end. In some instances, the polynucleic acid molecule described herein comprises two phosphorothioate modified internucleotide linkages at the 5’- end and two phosphorothioate modified internucleotide linkages at the 3’- end. In some instances, the polynucleic acid molecule described herein comprises three phosphorothioate modified internucleotide linkages at the 5’- end and three phosphorothioate modified internucleotide linkages at the 3’- end. In some instances, the polynucleic acid molecule described herein comprises four phosphorothioate modified internucleotide linkages at the 5’- end and four phosphorothioate modified internucleotide linkages at the 3’- end.
[0126] In some instances, the guide strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at least two, at least three,WSGR Docket No.61382-729.601 or at least four phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end and at least one phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the guide strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end and two phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the guide strand comprises two consecutive phosphorothioate modified internucleotide linkage at the 5’ end and two consecutive phosphorothioate modified internucleotide linkage at the 3’ end. In some aspects, the modified backbone is phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain aspects, the guide strand comprises at least one stereochemically enriched phosphorothioate. In some aspects, the guide strand comprises at least 1, 2, or 3 stereochemically enriched phosphorothioates. In some aspects, the guide strand comprises only 1, 2, 3, or 4 stereochemically enriched phosphorothioates. In further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 5’ end nucleosides of the guide strand. In yet further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 3’ end nucleosides of the guide strand. In still further aspects, one stereochemically enriched phosphorothioate is covalently bonded to the first nucleoside and the second nucleoside from the 5’ end within the guide strand. In some aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty first nucleoside and the twenty second nucleoside from the 5’ end within the guide strand. In certain aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty second nucleoside and the twenty third nucleoside from the 5’ end within the guide strand. In particular aspects, the stereochemically enriched phosphorothioate has RP stereochemical identity. In certain aspects, the stereochemically enriched phosphorothioate has SPstereochemical identity.
[0127] In some instances, the passenger strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least two, at leastWSGR Docket No.61382-729.601 three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises two consecutive phosphorothioate modified internucleotide linkage at the 5’ end. In some aspects, the modified backbone is phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain aspects, the passenger strand comprises at least one stereochemically enriched phosphorothioate. In some aspects, the passenger strand comprises at least 1, 2, or 3 stereochemically enriched phosphorothioates. In some aspects, the passenger strand comprises only 1, 2, 3, or 4 stereochemically enriched phosphorothioates. In further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 5’ end nucleosides of the passenger strand. In yet further aspects, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of six 3’ end nucleosides of the passenger strand. In still further aspects, one stereochemically enriched phosphorothioate is covalently bonded to the first nucleoside and the second nucleoside from the 5’ end within the passenger strand. In some aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty first nucleoside and the twenty second nucleoside from the 5’ end within the passenger strand. In certain aspects, one stereochemically enriched phosphorothioate is covalently bonded to the twenty second nucleoside and the twenty third nucleoside from the 5’ end within the passenger strand. In particular aspects, the stereochemically enriched phosphorothioate has RP stereochemical identity. In certain aspects, the stereochemically enriched phosphorothioate has SP stereochemical identity.
[0128] In some aspects, the polynucleic acid molecules described herein comprises one or more (e.g., from 1 to 20, from 1 to 10, or from 1 to 5) stereochemically enriched phosphorothioate internucleotide linkages (e.g., having diastereomeric excess of at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, e.g., up to about 99%, for the P-stereogenicWSGR Docket No.61382-729.601 center). The polynucleic acid molecules described herein comprises one or more (e.g., from 1 to 20, from 1 to 10, or from 1 to 5; e.g., internucleoside) phosphorodithioate internucleotide linkages. The phosphorodithioates may be non-P-stereogenic in the polynucleic acid molecules described herein. Phosphorothioates and phosphorodithioates may enhance the stability of the polynucleic acid molecules described herein to exonuclease activity of serum. Non-P-stereogenic phosphorodithioates may simplify the synthesis of the polynucleic acid molecule described herein by reducing the number of diastereomers. Typically, the phosphorothioate or phosphorodithioate may connect two contiguous nucleosides within the six 3’-terminal nucleosides and the six 5’- terminal nucleosides of the polynucleic acid molecules described herein. In some aspects, the stereochemically enriched phosphorothioate (e.g., RP-enriched phosphorothioate) may be covalently bonded to the first nucleoside (e.g., the 3’-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5’-carbon atom of the second nucleoside) from the 5’ end of the guide strand. Additionally or alternatively, the stereochemically enriched phosphorothioate (e.g., SP- enriched phosphorothioate) may be covalently bonded to the 21stnucleoside (e.g., the 3’-carbon atom of the 21stnucleoside) from the 5’ end and the 22ndnucleoside (e.g., the 5’-carbon atom of the 22ndnucleoside) of the guide strand. Further, additionally or alternatively, the stereochemically enriched phosphorothioate (e.g., SP-enriched phosphorothioate or Rp-enriched phosphorothioate) may be covalently bonded to the 22ndnucleoside (e.g., the 3’-carbon atom of the 22ndnucleoside) and the 23rdnucleoside (e.g., the 5’-carbon atom of the 23rdnucleoside) from the 5’ end of the guide strand. Combinations of a 5’ RP-enriched phosphorothioate (e.g., RP-enriched phosphorothioate covalently bonded to the first nucleoside (e.g., the 3’-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5’-carbon atom of the second nucleoside) from the 5’-end and a 3’ SP-enriched phosphorothioate (e.g., SP-enriched phosphorothioate covalently bonded to the 21stnucleoside (e.g., the 3’-carbon atom of the 21stnucleoside) and the 22ndnucleoside (e.g., the 5’-carbon atom of the 22ndnucleoside) from the 5’-end in an antisense strand can produce superior efficacy and / or duration of action, e.g., as measured by the reduction in the activity of the target relative to a reference guide strand that lacks the combination of a 5’ RP- enriched phosphorothioate and a 3’ SP-enriched phosphorothioate, or a 5’ Rp-enriched phosphorothioate and a 3’ Sp and Rp-enriched phosphorothioate. In some embodiments, the stereochemically enriched phosphorothioate may comprise RpRpSpSp (RpRp at the positions 1 and 2 of the guide strand and SpSpat the positions 21 and 22 of the guide strand) or RpRpSpRp(RpRpat the positions 1 and 2 of the guide strand and SpRp at the positions 21 and 22 of the guide strand). In some aspects, the polynucleotide molecules described herein comprises four stereochemically enriched phosphorothioates: (1) a Rp-enriched phosphorothioate covalently bonded to the 1stWSGR Docket No.61382-729.601 nucleoside (e.g., the 3'-carbon atom of the 1stnucleoside) and the 2ndnucleoside (e.g., the 5'-carbon atom of the 2ndnucleoside) from the 5'-end of the antisense strand; (2) a Rp-enriched phosphorothioate covalently bonded to the 2ndnucleoside (e.g., the 3'-carbon atom of the 2ndnucleoside) and the 3rdnucleoside (e.g., the 5'-carbon atom of the 3rdnucleoside) from the 5'-end of the antisense strand; (3) a Sp-enriched phosphorothioate covalently bonded to the 21stnucleoside (e.g., the 3'-carbon atom of the 21stnucleoside) and the 22thnucleoside (e.g., the 5'-carbon atom of the 22thnucleoside) from the 5'-end of the antisense strand; and (4) a Sp-enriched phosphorothioate covalently bonded to the 22thnucleoside (e.g., the 3'-carbon atom of the 22thnucleoside) and the 23rdnucleoside (e.g., the 5'-carbon atom of the 23rdnucleoside) from the 5'-end of the antisense strand. In some aspects, the polynucleotide molecules described herein comprises four stereochemically enriched phosphorothioates: (1) a Rp-enriched phosphorothioate covalently bonded to the 1stnucleoside (e.g., the 3'-carbon atom of the 1stnucleoside) and the 2ndnucleoside (e.g., the 5'-carbon atom of the 2ndnucleoside) from the 5'-end of the antisense strand; (2) a Rp- enriched phosphorothioate covalently bonded to the 2ndnucleoside (e.g., the 3'-carbon atom of the 2ndnucleoside) and the 3rdnucleoside (e.g., the 5'-carbon atom of the 3rdnucleoside) from the 5'- end of the antisense strand; (3) a Sp-enriched phosphorothioate covalently bonded to the 21stnucleoside (e.g., the 3'-carbon atom of the 21stnucleoside) and the 22thnucleoside (e.g., the 5'- carbon atom of the 22thnucleoside) from the 5'-end of the antisense strand; and (4) a Rp-enriched phosphorothioate covalently bonded to the 22thnucleoside (e.g., the 3'-carbon atom of the 22thnucleoside) and the 23rdnucleoside (e.g., the 5'-carbon atom of the 23rdnucleoside) from the 5'-end of the antisense strand.
[0129] Base modified nucleotide
[0130] In some aspects, the polynucleic acid molecule described herein comprises modified nucleotides comprising one or more purine modification. In some aspects, the purine modification described herein is 2,6-diaminopurine. In some aspects, the purine modification described herein is 3-deaza-adenine. In some aspects, the purine modification described herein is 7-deaza-guanine. In some aspects, the purine modification described herein is 8-azido-adenine. In some aspects, the modified nucleotide comprises a modified guanine (e.g., inosine) or one or more of any types of unnatural nucleic acids.
[0131] In some aspects, the polynucleic acid molecule described herein comprises modified nucleotides comprising one or more pyrimidine modification. In some aspects, the pyrimidine modification described herein is 2-thio-thymidine. In some aspects, the pyrimidine modification described herein is 5-carboxamide-uracil. In some aspects, the pyrimidine modification describedWSGR Docket No.61382-729.601 herein is 5-methyl-cytosine. In some aspects, the pyrimidine modification described herein is 5- ethynyl uracil.
[0132] Abasic modified nucleotide
[0133] In some aspects, the polynucleic acid molecule described herein comprises modified nucleotides comprising an abasic modified nucleotide. The inclusion of one or more (e.g., one or two) abasic substitutions in the hybridized polynucleotide constructs may reduce or even eliminate miRNA-like off-target effects, as the abasic substitutions lack nucleobases that are capable of engaging in base-pairing interactions and alleviate steric hindrance. Thus, the polynucleic acid molecule disclosed herein may comprise one or more (e.g., one or two) abasic substitutions. In some aspects, abasic substitution is at the 5thnucleotide from the 5’ end of the guide strand described herein. In some aspects, abasic substitution is at the 7thnucleotide from the 5’ end of the guide strand described herein.
[0134] When the polynucleic acid molecule disclosed herein comprises two or more of the abasic substitutions, their structures may be same or different. In certain aspects, a passenger strand comprises one abasic substitution (e.g., a guide strand may be free of abasic substitutions). In other aspects, a guide strand comprises one abasic substitution (e.g., a passenger strand may be free of abasic substitutions). In yet other aspects, a guide strand comprises one abasic substitution, and a passenger strand comprises one abasic substitution. In further aspects, a passenger strand comprises an abasic substitution between a nucleoside number (x) and a nucleoside number (x+1), where x is an integer from 2 to 7. In yet further aspects, a guide strand comprises an abasic substitution between a nucleoside number (x) and a nucleoside number (x+1), where x is an integer from 2 to 7.
[0135] The abasic substitution may be of formula (III): ,where L is a sugar analogue, or is substituted with a heteroacyl from A, U ,C, G, or is any other substituted nucleic acid (e.g., locked or unlocked nucleic acid, glycol nucleic acid, etc.); each X4is independently O or S; each X5is independently O, S, NH, or a bond; each R9is independently H, optionally substituted C1-6 alkyl, optionally substituted C2-6 alkenyl, optionally substituted C2-6alkynyl, optionally substituted (C1-9heterocyclyl)-C1-6-alkyl,WSGR Docket No.61382-729.601 optionally substituted (C6-10aryl)-C1-6-alkyl, optionally substituted (C3-8cycloalkyl)-C1-6-alkyl, – LinkA(–T)p, or a conjugation moiety; each LinkA is independently a multivalent linker (e.g., including –C(O)–N(H)–); each T is independently an auxiliary moiety; R10is a bond to a 3’-carbon atom of a nucleoside (x) in the strand; R11is a bond to a 5’-oxygen atom of a nucleoside (x+1) in the strand; p is an integer from 1 to 6; and t is an integer from 1 to 6. In some aspects, the abasic substitution described herein is attached to the guide strand of the polynucleic acid molecule described herein. In particular aspects, an abasic substitution (e.g., an internucleotide, abasic spacer of formula (III) in which t is 1) may be included in the guide strand described herein (e.g., within the seed region of the guide strand). In some aspects, an abasic substitution (e.g., an internucleotide, abasic spacer of formula (III) in which t is 1) may be bonded to the 3’ carbon atom of the second, third, fourth, or fifth nucleoside from the 5’ end of the guide strand described herein. In certain aspects, an abasic substitution (e.g., an internucleotide, abasic spacer of formula (III) in which t is 1) may be bonded to the 3’ carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5’ end of the guide strand described herein. In some aspects, an abasic substitution fourth, fifth, sixth, seventh, eighth, and / or ninth nucleoside from the 5’ end of the guide strand described herein.
[0136] In some aspects, the polynucleic acid molecule described herein comprises one or more type of modifications as described above. Accordingly, in some aspects, about 10% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 20% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 30% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 40% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 50% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 60% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 70% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 80% of the nucleotides from the polynucleic acidWSGR Docket No.61382-729.601 molecule described herein are modified with one or more type of modifications as described above. In other aspects, about 90% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above. In other aspects, 100% of the nucleotides from the polynucleic acid molecule described herein are modified with one or more type of modifications as described above.
[0137] In some aspects, the one or more types of modifications described herein occurs at different positions within the polynucleic acid molecule described herein. In some aspects, the one or more types of modifications described herein occurs in the seed region within the polynucleic acid molecule described herein. In some aspects, the one or more types of modifications described herein occurs at 3’ end of the polynucleic acid molecule described herein. In some aspects, the one or more types of modifications described herein occurs at 5’ end of the polynucleic acid molecule described herein. In some aspects, the one or more types of modifications described herein occurs dispersedly within the polynucleic acid molecule described herein. In some aspects, the one or more types of modifications described herein occurs in clusters within the polynucleic acid molecule described herein. Guide strand
[0138] In one aspect, described herein is a specific modification motif or pattern for the double- stranded inhibitory polynucleic acid molecule comprising a passenger strand and a guide strand.
[0139] In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 2 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises 2’-fluoro modified nucleotides at position 12 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 14 from the 5’ end. In some aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at position 16 from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at positions 2, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at positions 2, 7, 12, 14, 16, or combination thereof from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoroWSGR Docket No.61382-729.601 modified nucleotide at at least three of positions 2, 12, 14, and 16 from the 5’ end. In other aspects, the guide strand comprises a nucleotide analogue at one of positions 2-8 from the 5’ end, and further comprises a 2’-fluoro modified nucleotide at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end.
[0140] In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2-thiouridine-3’-phosphate nucleotide. In some instances, the nucleotide analogue located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2’-O-methyl-2-thiouridine-3’-phosphate (u3). In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises at least one, at least two, at least three, or at least four 2’-F modified nucleotides. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2’-F modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 3 from the 5’ end of the guide strand, and the guide strand further comprises 2’-F modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0141] In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least two of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0142] In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least one of positions 2, 6, 8, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least one of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of theWSGR Docket No.61382-729.601 guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least two of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’- fluoro (2’-F) modified nucleotides at at least three of positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at positions 2, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 6, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 8, 12, 14, and 16 from the 5’ end.
[0143] In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least one of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least two of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end. In some instances, the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand further comprises 2’-fluoro (2’-F) modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
[0144] In some instances, the nucleotides of the guide strand comprise DNA or RNA. As described herein, in some instances, the DNA nucleotide comprises an unmodified DNA comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified thymine nucleotide (T), or an unmodified cytosine nucleotide (C). As described herein, in some instances, the RNA comprises an unmodified RNA comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified uracil nucleotide (U), or an unmodified cytosine nucleotide (C).
[0145] In some instances, the nucleotides of the guide strand comprise the DNA, RNA, nucleotide analogue, 2’-F modified nucleotide, or 2’-O-alkyl modified nucleotide. In some instances, the 2’-O- alkly modified nucleotide comprises 2’-O-methyl modified nucleotides. In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide areWSGR Docket No.61382-729.601 selected from DNA nucleotide, RNA nucleotide, and 2’-O-alkly modified nucleotide. In some instances, the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide are 2’-O-methyl modified nucleotides.
[0146] In some instances, the guide strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the guide strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified internucleotide linkages.
[0147] In some instances, the guide strand comprises one phosphorothioate modified internucleotide linkages at the 5’ end and one phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the guide strand comprises two phosphorothioate modified internucleotide linkages at the 5’ end and two phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the guide strand comprises three phosphorothioate modified internucleotide linkages at the 5’ end and three phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the guide strand comprises four phosphorothioate modified internucleotide linkages at the 5’ end and four phosphorothioate modified internucleotide linkages at the 3’ end.
[0148] In some instances, the guide strand comprises 2’-O-methyl modified nucleotide, 2’-F modified nucleotide, and / or nucleotide analogue described herein. In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmXFmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-fluoro (2’-F) modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid- 3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco- adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'- phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-WSGR Docket No.61382-729.601 phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-fluoro (2’-F) modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0149] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmmXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0150] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmFXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i) . In some instances, the guide strand comprises a nucleic acidWSGR Docket No.61382-729.601 sequence of 5’- mFmmmFXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0151] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXFmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXFmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0152] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmmFXmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-WSGR Docket No.61382-729.601 thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0153] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFmmmmXmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFmmmmXmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn) and 2’-fluoro-2-thiouridine-3’- phosphate (U3f).
[0154] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFXmmmFmmmmFmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFXmmmFmmmmFmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclicWSGR Docket No.61382-729.601N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), and 2’-fluoro-2-thiouridine-3’-phosphate (U3f).
[0155] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmFXmmmmXmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmFXmmmmXmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), and 2’-fluoro-2-thiouridine-3’-phosphate (U3f).
[0156] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmXmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2’-O- methylinosine-3’-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmXmFmFmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclicWSGR Docket No.61382-729.601N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T-NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), and 2’-O-methylinosine-3’-phosphate (i).
[0157] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- mFmmmmXmmmmYmFmFmmmmmmm -3’ wherein m stands for a 2’-O- methyl modified nucleotide, F stands for a 2’-F modified nucleotide, X is selected from acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'-phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and Y is selected from 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'- phosphate (U3f), 2’-deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2-thiothymidine-3'- phosphate (dT3).
[0158] In some instances, the guide strand comprises 2’-O-methyl modified nucleotide, 2’-F modified nucleotide, nucleotide analogue described herein, or phosphorothioate internucleotide linkage. In some instances, the guide strand comprises one or more phosphorothioate modified internucleotide linkages at the 5’ end and one or more phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the guide strand comprises two phosphorothioate modified internucleotide linkages at the 5’ end and two phosphorothioate modified internucleotide linkages at the 3’ end.
[0159] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected fromWSGR Docket No.61382-729.601 acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0160] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0161] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-WSGR Docket No.61382-729.601 msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0162] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmFXmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmFXmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0163] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFmmmmXmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-WSGR Docket No.61382-729.601 deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFmmmmXmFmFmmmmmsmsm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), and 2’-fluoro-2-thiouridine-3’-phosphate (U3f).
[0164] In some instances, the nucleotide analogue is located at at least one of positions 2-12 from the 5’ end of the guide strand, and the nucleotide analogue comprises 2’-O-methyl-2-thiouridine- 3’-phosphate (u3) or 2’-fluoro-2-thiouridine-3’-phosphate (U3f). In some instances, the nucleotide analogue that is located at position 12 of the 5’ end of the guide strand, and the nucleotide analogue consists of 2’-fluoro-2-thiouridine-3’-phosphate (U3f). In some instances, the nucleotide analogue is located at position 3 of the 5’ end of the guide strand, and the nucleotide analogue comprises 2’- O-methyl-2-thiouridine-3’-phosphate (u3). In some instances, the nucleotide analogue is located at position 3 of the 5’ end of the guide strand, and the nucleotide analogue consists of 2’-O-methyl-2- thiouridine-3’-phosphate (u3). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmmFXmmmF’mFmFmmmmmmm-3’, where m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and F’ is 2’-fluoro-2-thiouridine-3’-phosphate (U3f). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmFXmmmF’mFmFmmmmmsmsm-3’, where m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose- 3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and F’ is 2’-fluoro- 2-thiouridine-3’-phosphate (U3f).
[0165] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsXmmmFmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-WSGR Docket No.61382-729.601 adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFXmmmFmmmmFmFmFmmmmmmm-3’, where m is 2’-O-methyl modified nucleotide, F is 2’- F modified nucleotide, and X is 2’-O-methyl-2-thiouridine-3’-phosphate (u3). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsXmmmFmmmmFmFmFmmmmmsmsm-3’, where m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is 2’-O-methyl-2- thiouridine-3’-phosphate (u3).
[0166] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmFXmmmmXmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmFXmmmmXmFmFmmmmmsmsm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and 2’-fluoro-2-thiouridine-3’-phosphate (U3f).
[0167] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmXFmmmmXmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, FWSGR Docket No.61382-729.601 is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmXFmmmmXmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), and 2'-O-methylinosine-3'-phosphate (i).
[0168] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmFmmmmYmFmFmmmmmsmsm -3’ wherein m stands for a 2’- O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and Y is selected from 2'-O-methyl-2-thiouridine-3'- phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), 2’-deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3).
[0169] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmIFmmmmYmFmFmmmmmsmsm -3’ wherein m stands for a 2’-O- methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, I stands for 2'-O-methylinosine-3'-phosphate (i), and Y is selected from 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), 2’-deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3).
[0170] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXmmmmmmFmFmmmmmsmsm -3’ wherein m stands for a 2’- O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclicWSGR Docket No.61382-729.601N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0171] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXmmmmYmFmFmmmmmsmsm -3’ wherein m stands for a 2’- O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'-phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and Y is selected from 2'-O- methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), 2’- deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3).
[0172] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmFXmmmmFmFmFmmmmmsmsm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmFXmmmmFmFmFmmmmmsmsm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'-phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0173] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXFmmmFmFmFmmmmmsmsm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-WSGR Docket No.61382-729.601NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXFmmmFmFmFmmmmmsmsm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'-phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn).
[0174] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmFmmmmFmFmFmmmmmsmsm -3’ wherein m stands for a 2’-O- methyl modified nucleotide, F stands for a 2’-F modified nucleotide, and s stands for a phosphorothioate internucleotide linkage. Passenger Strand
[0175] In some aspects, described herein is a specific modification motif of pattern for the double- stranded inhibitory polynucleic acid molecule comprising a passenger strand and a guide strand. In some aspects, described herein is a specific modification pattern of the passenger strand.
[0176] In some instances, the passenger strand comprises one or more nucleotide analogue. In some instances, the passenger strand comprises one or more nucleotide analogue at locations opposite to the seed region of the guide strand. In some instances, the passenger strand comprises one or more nucleotide analogue at locations 12-22 from the 5’ end. In some instances, the passenger strand comprises one or more nucleotide analogue at locations 2-10 from the 3’ end. In some instances, the passenger strand comprises one or more 2-amino-2’-O-methyladenosine-3’- phosphate (a1). In some instances, the passenger strand comprises 2-amino-2’-O-methyladenosine- 3’-phosphate (a1) at location 11, 12, 13, 14, or 15 from the 5’ end. In some instances, the passenger strand comprises 2-amino-2’-O-methyladenosine-3’-phosphate (a1) at location 13 from the 5’ end. In some instances, the passenger strand comprises 2-amino-2’-O-methyladenosine-3’-phosphate (a1) at location 14 from the 5’ end. In some instances, the passenger strand comprises 2-amino-2’- O-methyladenosine-3’-phosphate (a1) at location 15 from the 5’ end.WSGR Docket No.61382-729.601
[0177] In some instances, the passenger strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight 2’-fluoro (2’-F) modified nucleotides. In some instances, the passenger strand comprises at least two, at least three, or at least four 2’-F modified nucleotides. In some instances, the passenger strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight 2’- fluoro (2’-F) modified nucleotides. In some instances, the passenger strand comprises from one to eight, from two to eight, from three to eight, from four to eight, from five to eight, from six to eight, or from seven to eight 2’-fluoro (2’-F) modified nucleotides. In some instances, the passenger strand comprises one, two, three, four, five, six, seven, or eight 2’-fluoro (2’-F) modified nucleotides. In some instances, the passenger strand comprises one 2’-F modified nucleotides. In some instances, the passenger strand comprises two 2’-F modified nucleotides. In some instances, the passenger strand comprises three 2’-F modified nucleotides. In some instances, the passenger strand comprises four 2’-F modified nucleotides. In some instances, the passenger strand comprises five 2’-F modified nucleotides.
[0178] In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at position 7 from the 5’ end. In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at position 9 from the 5’ end. In some aspects, the passenger strand comprises 2’-fluoro modified nucleotides at position 11 from the 5’ end. In some aspects, the passenger strand comprises a 2’- fluoro modified nucleotide at at least one of positions 7, 9, and 11 from the 5’ end. In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at positions 7, 9, 11, or combination thereof from the 5’ end. In some aspects, the passenger strand comprises a 2’-fluoro modified nucleotide at positions 7, 9, and 11 from the 5’ end.
[0179] In some instances, the nucleotides of the passenger strand comprise DNA nucleotide or RNA nucleotide. As described herein, in some instances, the DNA nucleotide comprises an unmodified DNA nucleotide comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified thymine nucleotide (T), or an unmodified cytosine nucleotide (C). As described herein, in some instances, the RNA nucleotide comprises an unmodified RNA nucleotide comprising: an unmodified adenine nucleotide (A), an unmodified guanine nucleotide (G), an unmodified uracil nucleotide (U), or an unmodified cytosine nucleotide (C).
[0180] In some instances, the nucleotides of the passenger strand comprise the DNA nucleotide, RNA nucleotide, nucleotide analogue, 2’-F modified nucleotide, or 2’-O-alkyl modified nucleotide. In some instances, the 2’-O-alkly modified nucleotide comprises 2’-O-methyl modified nucleotides. In some instances, the nucleotides of the passenger strand that are not the nucleotideWSGR Docket No.61382-729.601 analogue or 2’-F modified nucleotide are selected from 2′-O-alkyl modified nucleotide, 2′-alkoxy modified nucleotide, 2′-alkyl modified nucleotide, 2′-halo modified nucleotide, DNA nucleotide, RNA nucleotide, ENA, BNA, LNA, and UNA. In some instances, the nucleotides in the passenger strand that are not 2’-F modified nucleotide are 2’-O-methyl modified nucleotides.
[0181] In some instances, the passenger strand comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage. In some instances, the passenger strand comprises at most one, at most two, at most three, at most four, at most five, at most six, at most seven, or at most eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises one, two, three, four, five, six, seven, or eight phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 8, from 2 to 8, from 3 to 8, from 4 to 8, from 5 to 8, or from 6 to 8 phosphorothioate modified internucleotide linkages. In some instances, the passenger strand comprises from 1 to 4, from 2 to 4, or from 3 to 4 phosphorothioate modified internucleotide linkages.
[0182] In some instances, the passenger strand comprises at least one, at least two, at least three, or at least four phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises at least one, at least two, at least three, or at least four phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 3’ end.
[0183] In some instances, the passenger strand comprises one phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises three phosphorothioate modified internucleotide linkage at the 5’ end. In some instances, the passenger strand comprises four phosphorothioate modified internucleotide linkage at the 5’ end.
[0184] In some instances, the passenger strand comprises one phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 3’ end. In some instances, the passenger strand comprises three phosphorothioate modified internucleotide linkage at the 3’ end. In someWSGR Docket No.61382-729.601 instances, the passenger strand comprises four phosphorothioate modified internucleotide linkage at the 3’ end.
[0185] In some instances, the passenger strand comprises one phosphorothioate modified internucleotide linkages at the 5 end and one phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the passenger strand comprises two phosphorothioate modified internucleotide linkages at the 5’ end and two phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the passenger strand comprises three phosphorothioate modified internucleotide linkages at the 5’ end and three phosphorothioate modified internucleotide linkages at the 3’ end. In some instances, the passenger strand comprises four phosphorothioate modified internucleotide linkages at the 5’ end and four phosphorothioate modified internucleotide linkages at the 3’ end.
[0186] In some instances, the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, 5’- mmmmmmFmFmFmmX’mmmmmmm-3’, 5’- msmsmmmmFmFmFmmX’mmmmmmm-3’, 5’- mmmmmmFmFmFmmmX’mmmmmm -3’, or 5’- msmsmmmmFmFmFmmmX’mmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some aspects, described herein is a modified polynucleic acid molecule comprising a guide strand and a passenger strand, and the passenger strand comprises 5’-mmmmmmFmFmFmmmmmmmmmm-3’, 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, 5’-mmmmmmFmFmFmmX’mmmmmmm-3’, 5’- msmsmmmmFmFmFmmX’mmmmmmm-3’, 5’- mmmmmmFmFmFmmmX’mmmmmm -3’, or 5’- msmsmmmmFmFmFmmmX’mmmmmm -3’, wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). Double-Stranded Polynucleic Acid Molecule
[0187] In some aspects, described herein is a specific modification pattern for a double-stranded polynucleic nucleic acid molecule comprising a passenger strand and a guide strand. In some instances, the guide strand comprises a nucleic acid sequence of mFmmmXFmmmmFmFmFmmmmmmm, and the passenger strand comprises mmmmmmFmFmFmmmmmmmmmm, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine- glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-WSGR Docket No.61382-729.6012-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco- cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside- 3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises mmmmmmFmFmFmmmmmmmmmm, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine- glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmXFmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’-mmmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’- phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'- phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'- deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2’-O-methylinosine-3’-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmXFmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’- F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1).WSGR Docket No.61382-729.601
[0188] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’- phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O- methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’- O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'- phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine- 3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O- methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclicWSGR Docket No.61382-729.601N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), and X’ is 2-amino-2’-O- methyladenosine-3’-phosphate (a1).
[0189] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine- glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro- 2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco- cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside- 3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine- glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm -3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’- phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'- phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'- deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmXmmmmFmFmFmmmmmmm -3’, and the passenger strand comprises 5’-WSGR Docket No.61382-729.601 msmsmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), or 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2’-O-methylinosine-3’-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1).
[0190] In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'- phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), 2'-O-methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm -3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetylWSGR Docket No.61382-729.601L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1).
[0191] In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine- glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro- 2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco- cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside- 3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphateWSGR Docket No.61382-729.601(T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine- glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’-mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’- phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'- phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'- deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2’-O-methylinosine-3’-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’- mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1).
[0192] In some instances, wherein the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-WSGR Docket No.61382-729.601 amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco- uridine-3'-phosphate (U2), 2'-deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2- thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). In some instances, wherein the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T- NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), and thymidine-glycol nucleic acid (GNA) S-isomer (Tgn). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmX’mmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmX’mmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2-WSGR Docket No.61382-729.601 aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i), and X’ is 2-amino-2’-O-methyladenosine-3’-phosphate (a1).
[0193] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmFmmmmYmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, Y is selected from 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro- 2-thiouridine-3'-phosphate (U3f), 2’-deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2- thiothymidine-3'-phosphate (dT3).
[0194] In some instances, described herein is a specific modification pattern, wherein the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFmmmmXmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i). In some instances, the guide strand comprises a nucleic acid sequence of 5’- msFsmmmmFmmmmXmFmFmmmmmsmsm -3’, and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid- 3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), and 2’-fluoro-2-thiouridine- 3’-phosphate (U3f).
[0195] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmIFmmmmYmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioateWSGR Docket No.61382-729.601 internucleotide linkage, I stands for 2'-O-methylinosine-3'-phosphate (i), and Y is selected from 2'- O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro-2-thiouridine-3'-phosphate (U3f), 2’- deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2-thiothymidine-3'-phosphate (dT3).
[0196] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXmmmmmmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i).
[0197] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXmmmmYmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, Y is selected from 2'-O-methyl-2-thiouridine-3'-phosphate (u3), 2'-fluoro- 2-thiouridine-3'-phosphate (U3f), 2’-deoxythymidine-3’-phosphate (dT), and 2'-deoxy-2- thiothymidine-3'-phosphate (dT3), and X is selected from acyclic L-threoninol nucleic acid- thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’- phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'- phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'- deoxy-2-aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
[0198] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmFXmmmmFmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methylWSGR Docket No.61382-729.601 modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i).
[0199] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’- msFsmmmmXFmmmFmFmFmmmmmsmsm -3’ and the passenger strand comprises 5’- msmsmmmmFmFmFmmmmmmmmmm -3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, s stands for a phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2-amino-2’-O-methyladenosine-3’-phosphate (a1), C3-spacer (Pr), 2',3'-seco-adenosine-3'-phosphate (A2), 2',3'-seco-guanosine-3'-phosphate (G2), 2',3'-seco-cytidine-3'-phosphate (C2), 2',3'-seco-uridine-3'-phosphate (U2), 2'-deoxy-2- aminopurine riboside-3’-phosphate (dA3), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O- methylinosine-3'-phosphate (i).
[0200] In some aspects, described herein is a specific modification pattern, wherein the guide strand comprises 5’-msFsmmmmFmmmmFmFmFmmmmmsmsm-3’ and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’ wherein m stands for a 2’-O-methyl modified nucleotide, F stands for a 2’-F modified nucleotide, and s stands for a phosphorothioate internucleotide linkage. Conjugation Targeting Moiety
[0201] In certain aspects, the polynucleotide molecule described herein is coupled or conjugated with one or more targeting moieties to form a polynucleotide-targeting moiety conjugate molecule. In some instances, a targeting moiety is selected based on its ability to target the conjugateWSGR Docket No.61382-729.601 molecule described herein to a desired cell population, tissue, or an organ selectively or preferably. In some instances, the targeting moiety targets the cell, tissue, or an organ that expresses the corresponding binding partner (e.g., either the corresponding receptor or ligand) of the targeting moiety. For example, the polynucleotide molecule conjugated with N-acetyl galactosamine (GalNAc) can target hepatocytes expressing asialoglycoprotein (ASGP-R). Any suitable GalNAc molecules that are known in the art to be used as a targeting moiety are contemplated. Exemplary GalNAc molecule includes a triantennary GalNAc (e.g., L96). A further example of the targeting moiety is galactose. The targeting moiety can also be a lipid, peptide, or small molecule.
[0202] A targeting moiety (i.e., an intracellular targeting moiety) that targets a desired site within the cell (e.g., endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) may be included in the hybridized polynucleotide constructs disclosed herein. Non-limiting examples of the intracellular targeting moieties are provided in WO 2015 / 069932 and in WO 2015 / 188197; the disclosure of the intracellular targeting moieties in WO 2015 / 069932 and in WO 2015 / 188197 is incorporated herein by reference.
[0203] The polynucleotide molecule described herein, thus, may include one or more targeting moieties selected from the group consisting of intracellular targeting moieties, extracellular targeting moieties, and combinations thereof. Thus, the inclusion of one or more targeting moieties (e.g., extracellular targeting moieties including targeting moieties independently selected from the group consisting of folate, mannose, N-acetyl galactosamine, and prostate specific membrane antigen) and one or more intracellular targeting moiety (e.g., a moiety targeting endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecule described herein can facilitate the delivery of the polynucleotides to a specific site within the specific cell population. In some aspects, the targeting moiety contains one or more mannose carbohydrates. Mannose targets the mannose receptor, which is a 175 KDa membrane-associated receptor that is expressed on sinusoidal liver cells and antigen presenting cells (e.g., macrophages and dendritic cells). It is a highly effective endocytotic / recycling receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et. al. J. Biol. Chem.262:9942-9944,1987; Taylor et. al. J. Biol. Chem.265:12156-62, 1990).
[0204] Some of the targeting moieties are described herein. In some aspects, the targeting moiety contains or specifically binds to a protein selected from the group including insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF; e.g., IGF 1 or 2), mesenchymal epithelial transition factor receptor (c-met; also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet-WSGR Docket No.61382-729.601 derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNF-α), TNF-β, folate receptor (FOLR), folate, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, an integrin (e.g., an α4 integrin or a β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronate receptor, leukocyte function antigen-1 (LFA-1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule 1 (VCAM1), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), IL-1ra, IL- 2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, ephrin (Eph) receptor, mucosal addressin cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof. In further aspects, the targeting moiety contains erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor; ErbB2 receptor; ErbB3 receptor; and ErbB4 receptor). In some aspects, the targeting moiety contains one or more (e.g., from 1 to 6) N-acetyl galactosamines (GalNAc). In certain aspects, the targeting moiety contains one or more (e.g., from 1 to 6) galactose. In certain aspects, the targeting moiety contains one or more (e.g., from 1 to 6) mannoses. In other aspects, the targeting moiety contains a folate ligand. The folate ligand has the structure:. Certain targeting moieties may include bombesin, gastrin, gastrin-releasing peptide, tumor growth factors (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non- peptidyl targeting moieties can also be used in the targeting moieties and may include, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include a polypeptide, such as somatostatin or somatostatin analog (e.g., octreotide or lanreotide), bombesin, or an antibody or antigen-binding fragment thereof. Antibodies may be of any recognized class or subclass, e.g., IgG, IgA, IgM, IgD, or IgE. Typical are those antibodies which fall within the IgG class. The antibodies can be derived from any species according to techniques known in the art.WSGR Docket No.61382-729.601Typically, however, the antibody is of human, murine, or rabbit origin. In addition, the antibody may be polyclonal or monoclonal, but is typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used in targeting moieties. Targeting moieties may include an antigen-binding fragment of an antibody. Such antibody fragments may include, for example, the Fab’, F(ab’)2, Fv, or Fab fragments, single domain antibody, ScFv, or other antigen-binding fragments. Fc fragments may also be employed in targeting moieties. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, for example, by pepsin or papain digestion, reductive alkylation, or recombinant techniques. The materials and methods for preparing antibody fragments are well-known to those skilled in the art. See, e.g., Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.
[0205] Other peptides for use as a targeting auxiliary moiety in polynucleotide molecule described herein can be selected from KiSS peptides and analogs, urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptide, neurotensin, calcitonin, glutathione, YIGSR (leukocyte-avid peptides, e.g., P483H, which contains the heparin-binding region of platelet factor-4 (PF-4) and a lysine-rich sequence), atrial natriuretic peptide (ANP), β-amyloid peptides, delta-opioid antagonists (such as ITIPP(psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl- leucyl-phenylalanine-lysine (fMLFK), GP IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitor (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitor, antimicrobial peptides, apticide (P280 and P274), thrombospondin receptor (including analogs such as TP-1300), bitistatin, pituitary adenylyl cyclase type I receptor (PAC1), fibrin α-chain, peptides derived from phage display libraries, and conservative substitutions thereof.
[0206] One or more (e.g., from 1 to 6) targeting moieties can be linked to MOIETY or to X2 in formula (V’, V’’, V’’’, V’’’’, V’’’’’, V’’’’’’) through –LinkA–.
[0207] In some instances, the targeting moiety comprises an asialoglycoprotein receptor targeting moiety. In some instances, the asialoglycoprotein receptor targeting moiety comprises N- Acetylgalactosamine (GalNAc) or galactose. In some aspects, the targeting moiety includes one or more (e.g., from 1 to 6 or from 1 to 3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some aspects, an asialoglycoprotein receptor ligand (e.g., GalNAc) is attached to –LinkA– through an anomeric carbon (e.g., where the anomeric carbon is the carbon atom in an acetal or a hemiaminal). In some aspects, an asialoglycoprotein receptor ligand (e.g., GalNAc) comprises an anomeric carbon bonded to trivalent, tetravalent linker, pentavalent, or hexavalent linker, wherein the anomeric carbon is part of a hemiaminal group. An asialoglycoprotein receptor ligand (e.g.,WSGR Docket No.61382-729.601GalNAc) attached to a linker through a hemiaminal may produce a hybridized polynucleotide construct having superior efficacy in gene silencing as compared to hybridized polynucleotide constructs having the asialoglycoprotein receptor ligand (e.g., GalNAc) attached to a linker through an acetal.
[0208] In some instances, the targeting moiety is conjugated via a linker. In some aspects, the linker and three asialoglycoprotein receptor targeting moieties, each of which comprises GalNAc, are as shown in Formula (V). In some instances, the conjugate described herein only comprises one asialoglycoprotein receptor targeting moiety, so the conjugate comprises a structure of Formula (V) with any two of the targeting moieties removed. In some instances, the conjugate described herein only comprises two asialoglycoprotein receptor targeting moieties, so the conjugate described herein comprises a structure of Formula (V) with any one of the targeting moieties removed.wherein one of Y1 and Y2 is nucleotide, or wherein both Y1 and Y2 are nucleotides and Y1 and Y2 are consecutive or neighboring nucleotides from the polynucleic acid molecule described herein.
[0209] In some aspects, the linker and the targeting moieties described herein are conjugated to 3’ end of the passenger strand (e.g., as shown in Formula (V’, V’’’’, V’’’’’, V’’’’’’)). In some aspects, the linker and the targeting moieties described herein are conjugated to 5’ end of the passenger strand (e.g., as shown in Formula (V’’) or (V’’’)). In some aspects, the linker and the targeting moieties described herein are conjugated to 3’ end of the guide strand (e.g., as shown in Formula (V’), (V’’’’), (V’’’’’), (V’’’’’’)). In some aspects, the linker and the targeting moieties described herein are conjugated to 5’ end of the guide strand (e.g., as shown in Formula (V’’) or (V’’’)).WSGR Docket No.61382-729.601wherein Z in formula (V’) corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O- Methyl, -F, or -O-methoxyethyl), and R in formula (V’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.wherein Z in formula (V’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (V’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.WSGR Docket No.61382-729.601 wherein Z in formula (V’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (V’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.(V’’’’), wherein Z in formula (V’’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (V’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.wherein Z in formula (V’’’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (V’’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.WSGR Docket No.61382-729.601(V’’’’’’), wherein Z in formula (V’’’’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (V’’’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
[0210] In some instances, the 3’ end of passenger strand (or sense strand) of a polynucleic acid molecule (e.g., passenger strand sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2-GalNAc (see Formula (V), (V’), (V’’’’), (V’’’’’), (V’’’’’’)). In some instances, the 5’ end of passenger strand (or sense strand) of a polynucleic acid molecule (e.g., passenger strand sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2-GalNAc (see Formula (V), (V’’), or (V’’’)). In some instances, a nucleic acid within passenger strand (or sense strand) (not at the 5’ or 3’ end) (e.g., passenger strand sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2- GalNAc (see Formula (V)). In some instances, the 3’ end of guide strand (or antisense strand) of a polynucleic acid molecule (e.g., guide strand sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2-GalNAc (see Formula (V), (V’), (V’’’’), (V’’’’’), (V’’’’’’)). In some instances, the 5’ end of guide strand (or antisense strand) of a polynucleic acid molecule (e.g., guide strand sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2-GalNAc (see Formula (V), (V’’), or (V’’’)). In some instances, a nucleic acid within guide strand (or antisense strand) (not at the 5’ or 3’ end) of a polynucleic acid molecule (e.g., guide strandWSGR Docket No.61382-729.601 sequences from Table 1, Table 3, Table 5, Table 7, Table 9, Table 11, Table 13, Table 15, or Table 17) is conjugated with X2-GalNAc (see Formula (V)).
[0211] In some instances, one or more endosomal escape moieties (e.g., from 1 to 6 or from 1 to 3) can be attached to a polynucleotide construct or a hybridized polynucleotide construct disclosed herein as an auxiliary moiety. Exemplary endosomal escape moieties include chemotherapeutics (e.g., quinolones such as chloroquine); fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)); and polymers such as polyethylenimine (PEI); poly(beta-amino ester)s; polypeptides, such as polyarginines (e.g., octaarginine) and polylysines (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains as described herein. For example, fusogenic peptides can be derived from the M2 protein of influenza A viruses; peptide analogs of the influenza virus hemagglutinin; the HEF protein of the influenza C virus; the transmembrane glycoprotein of filoviruses; the transmembrane glycoprotein of the rabies virus; the transmembrane glycoprotein (G) of the vesicular stomatitis virus; the fusion protein of the Sendai virus; the transmembrane glycoprotein of the Semliki forest virus; the fusion protein of the human respiratory syncytial virus (RSV); the fusion protein of the measles virus; the fusion protein of the Newcastle disease virus; the fusion protein of the visna virus; the fusion protein of murine leukemia virus; the fusion protein of the HTL virus; and the fusion protein of the simian immunodeficiency virus (SIV). Other moieties that can be employed to facilitate endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. Specific examples of endosomal escape moieties including moieties suitable for conjugation to the hybridized polynucleotide constructs disclosed herein are provided, e.g., in WO 2015 / 188197; the disclosure of these endosomal escape moieties is incorporated by reference herein.
[0212] One or more endosomal escape moieties (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula (V’, V’’, V’’’, V’’’’, V’’’’’, or V’’’’’’) through –LinkA–, as described herein.
[0213] One or more cell penetrating peptides (CPP) (e.g., from 1 to 6 or from 1 to 3) can be attached to a polynucleotide construct or a hybridized polynucleotide construct disclosed herein as an auxiliary moiety. The CPP can be linked to the hybridized polynucleotide bioreversibly through a disulfide linkage, as disclosed herein. Thus, upon delivery to a cell, the CPP can be cleaved intracellularly, e.g., by an intracellular enzyme (e.g., protein disulfide isomerase, thioredoxin, or a thioesterase) and thereby release the polynucleotide.
[0214] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv.2, 43-51). Specific examples of CPPs including moieties suitable for conjugation toWSGR Docket No.61382-729.601 the hybridized polynucleotide constructs disclosed herein are provided, e.g., in WO 2015 / 188197; the disclosure of these CPPs is incorporated by reference herein.
[0215] CPPs are positively charged peptides that are capable of facilitating the delivery of biological cargo to a cell. It is believed that the cationic charge of the CPPs is essential for their function. Moreover, the transduction of these proteins does not appear to be affected by cell type, and these proteins can efficiently transduce nearly all cells in culture with no apparent toxicity (Nagahara et al., Nat. Med.4:1449-52, 1998). In addition to full-length proteins, CPPs have also been used successfully to induce the intracellular uptake of DNA (Abu-Amer, supra), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem.11:762-71, 2000) and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem.13:264-8, 2002; Lewin et al., Nat. Biotechnol.18:410-4, 2000; Josephson et al., Bioconjug. Chem.10:186-91, 1999) suggesting that there is considerable flexibility in particle size in this process.
[0216] In one embodiment, a CPP useful in the methods and compositions as described herein includes a peptide featuring substantial alpha-helicity. It has been discovered that transfection is optimized when the CPP exhibits significant alpha-helicity. In another embodiment, the CPP includes a sequence containing basic amino acid residues that are substantially aligned along at least one face of the peptide. A CPP described herein may be a naturally occurring peptide or a synthetic peptide.
[0217] One or more cell penetrating peptides (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula ( V’, V’’, V’’’, V’’’’, V’’’’’, V’’’’’’) through –LinkA–, as described herein.
[0218] The polynucleotide constructs and the hybridized polynucleotide constructs disclosed herein can also comprise covalently attached neutral polymer-based auxiliary moieties. Neutral polymers include poly(C1-6 alkylene oxide), e.g., poly(ethylene glycol) and poly(propylene glycol) and copolymers thereof, e.g., di- and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinyl pyrrolidone), poly(ethyloxazoline), poly(alkylacrylates), poly(acrylamide), poly(N-alkylacrylamides), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N- isopropylacrylamide polymers, and poly(N,N-dialkylacrylamides). Exemplary polymer auxiliaryWSGR Docket No.61382-729.601 moieties may have molecular weights of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.
[0219] One or more polymers (e.g., from 1 to 6 or from 1 to 3) can be attached to a MOIETY or X2 in formula ( V’, V’’, V’’’, V’’’’, V’’’’’, V’’’’’’) through –LinkA–, as described herein. Conjugation Linkers
[0220] In some aspects, the polynucleic acid molecules described herein comprises a guide strand or a passenger strand bonded to at least one group of formula (I)or a salt thereof, or a stereoisomer thereof, where each X1is independently O or S; each X2is independently O, S, NH, or a bond; MOIETY is optionally substituted C2-10 alkane-tetrayl or a group –M1–M2–M3–, wherein each M1and each M3is independently absent or optionally substituted C1-6alkylene, and M2is optionally substituted C3-9 heterocycle-tetrayl, optionally substituted C6-10 arene-tetrayl, or optionally substituted C3-8 cycloalkane-tetrayl; each R1and each R2is independently H, optionally substituted C1-16alkyl, optionally substituted C2-16heteroalkyl, a conjugation moiety, or –LinkA(–T)p, provided that at least one R1or at least one R2is a conjugation moiety or –LinkA(–T)p; each R3is independently H, optionally substituted C1-16 alkyl, optionally substituted C2-16 heteroalkyl, optionally substituted C2-16alkenyl, optionally substituted C2-16alkynyl, optionally substituted (C1-9 heterocyclyl)-C1-6-alkyl, optionally substituted (C6-10 aryl)-C1-6-alkyl, optionally substituted (C3-8 cycloalkyl)-C1-6-alkyl, a conjugation moiety, or –LinkA(–T)p; R4is H, optionally substituted C1-6alkyl, –LinkA(–T)p, or –Sol; each LinkA is independently a multivalent linker (e.g., including –C(O)–N(H)– (e.g., at least one multivalent linker including –C(O)–N(H)– bonded to T)); each T is independently an auxiliary moiety; Sol is solid support; m is an integer from 1 to 6;WSGR Docket No.61382-729.601 each n is independently 0 or 1; each p is independently an integer from 1 to 6; and q is an integer from 0 to 3. The at least one group of formula (I) may be bonded to a 5’-terminus, 3’-terminus, internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate of the polynucleotide. When the at least one group of formula (I) is bonded to the internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate, q is 0. The polynucleotide construct contains no more than one Sol.
[0221] Group –LinkA– can comprise from 0 to 3 multivalent monomers (e.g., optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, or trivalent nitrogen atom) and one or more divalent monomers (e.g., from 1 to 40), where each divalent monomer is independently optionally substituted C1-6 alkylene; optionally substituted C2-6 alkenylene; optionally substituted C2-6 alkynylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(O)m, wherein m is 0, 1, or 2. In some aspects, each monomer is independently optionally substituted C1-6 alkylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). In certain aspects, each monomer is independently optionally substituted C1-6 alkylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted N; O; or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). The non-bioreversible linker connecting the auxiliary moiety to the conjugating moiety or to the reaction product thereof can include from 2 to 500 (e.g., from 2 to 300 or from 2 to 200) of such monomers. Group –LinkA– may include a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene oxide), polybutylene oxide, poly(tetramethylene oxide), and diblock or triblock co-polymers thereof). In some aspects, the non-bioreversible linker includes polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight of less than 1 kDa).WSGR Docket No.61382-729.601
[0222] Group –LinkA(–T)p in formula (I) may be prepared by a process described in the sections below. In some instances, –LinkA(–T)p is of formula (II): –Q1–Q2([–Q3–Q4–Q5]s–Q6–T)p, (II) where each s is independently an integer from 0 to 20 (e.g., from 0 to 10), where the repeating units are the same or different; Q1is a conjugation linker (e.g., [–Q3–Q4–Q5]s–QC–, where QCis optionally substituted C2-12 heteroalkylene (e.g., a heteroalkylene containing –C(O)–N(H)–, –N(H)–C(O)–, –S(O)2–N(H)–, or –N(H)–S(O)2–), optionally substituted C1-12 thioheterocyclylene (e.g.,,optionally substituted C1-12heterocyclylene (e.g., 1,2,3-triazole-1,4-diylcyclobut-3-ene-1,2-dione-3,4- diyl, or pyrid-2-yl hydrazone); Q2is a linear group (e.g., [–Q3–Q4–Q5]s–), if p is 1, or a branched group (e.g., [–Q3–Q4– Q5]s–Q7([–Q3–Q4–Q5]s–(Q7)p1)p2, where p1 is 0 or 1, p2 is 0, 1, 2, or 3), if p is an integer from 2 to 6; each Q3and each Q6is independently absent, –CO–, –NH–, –O–, –S–, –SO2–, –OC(O)–, –COO–, –NHC(O)–, –C(O)NH–, –CH2–, –CH2NH–, –NHCH2–, –CH2O–, or –OCH2–; each Q4is independently absent, optionally substituted C1-12alkylene, optionally substituted C2-12alkenylene, optionally substituted C2-12alkynylene, optionally substituted C2-12heteroalkylene, optionally substituted C6-10 arylene, optionally substituted C1-9 heteroarylene, or optionally substituted C1-9heterocyclylene; each Q5is independently absent, –CO–, –NH–, –O–, –S–, –SO2–, –CH2–, –C(O)O–, – OC(O)–, –C(O)NH–, –NH–C(O)–, –NH–CH(Ra)–C(O)–, or –C(O)–CH(Ra)–NH–;WSGR Docket No.61382-729.601 each Q7is independently optionally substituted C1-6alkane-triyl, optionally substituted C1-6alkane-tetrayl, optionally substituted C2-6 heteroalkane-triyl, or optionally substituted C2-6 heteroalkane-tetrayl; and each Rais independently H or an amino acid side chain; provided that at least one of Q3, Q4, and Q5is present.
[0223] In some aspects, each Q4is independently absent, optionally substituted C1-12 alkylene, optionally substituted C2-12alkenylene, optionally substituted C2-12alkynylene, optionally substituted C2-12 heteroalkylene, or optionally substituted C1-9 heterocyclylene. In certain aspects, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0224] Thus, in formula (II), LinkA may include a single branching point, if each p1 is 0, or multiple branching points, if at least one p1 is 1.
[0225] In formula (II), Q1may be –O–QL–QC–, where QLis optionally substituted C2-12 heteroalkylene, optionally substituted C1-12 alkylene, or –(optionally substituted C1-6 alkylene)– (optionally substituted C6-10arylene)–. In some aspects, QLis optionally substituted C2-12heteroalkylene or optionally substituted C1-12 alkylene. In formula (II), QCmay be:
[0226] In formula (II), Q2may be a linear group of formula [–Q3–Q4–Q5]s–, where Q3, Q4, and Q5are as defined for formula (II). Alternatively, Q2may be a branched group [–Q3–Q4–Q5]s–Q7([– Q3–Q4–Q5]s–(Q7)p1)p2, where each Q7is independently optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, optionally substituted C2-6 heteroalkane-triyl, or optionally substituted C2-6heteroalkane-tetrayl; where p1 is 0 or 1; p2 is 0, 1, 2, or 3; where, when p1 is 0, LinkA is a trivalent or tetravalent linker, and, when p1 is 1, LinkA is a tetravalent, pentavalent, or hexavalent linker. In certain aspects, p1 is 0.WSGR Docket No.61382-729.601In some aspects, Q7is:
[0227] Compounds that may be used in the preparation of group –LinkA(–T)p in formula (I) are described herein as well as in WO 2015 / 188197. Non-limiting examples of –LinkA include:WSGR Docket No.61382-729.601 ,WSGR Docket No.61382-729.601where R18is a bond to MOIETY, each R19is independently a bond to auxiliary moiety, each m5 is independently an integer from 1 to 20, each m6 is independently an integer from 1 to 10,WSGR Docket No.61382-729.601 m7 is an integer from 1 to 6, and each X6is independently O or S. In formula (II), when the conjugation linker is of formula [–Q3–Q4–Q5]s–QC–, –Q2([–Q3– Q4–Q5]s–Q6–T)p may be: ,WSGR Docket No.61382-729.601, or (xxiv)WSGR Docket No.61382-729.601where R20is a bond to QCin Q1, each R19is independently a bond to an auxiliary moiety, each m5 is independently an integer from 1 to 20, each m6 is independently an integer from 1 to 10, m7 is an integer from 1 to 6, and each X6is independently O or S.
[0228] In some aspects, the linker described herein is cleavable. In some aspects, the linker described herein is non-cleavable.
[0229] In some aspects, the polynucleic acid molecule described herein comprises a guide strand or a passenger strand bonded to at least one group of formula (IV),(IV), wherein at least one of Y1 or Y2 is a nucleotide from the polynucleic acid molecule. In some instances, the linker comprises formula (IV). In some instances, the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in (V’), (V’’’’), (V’’’’’), or (V’’’’’’) as described herein.
[0230] In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of one of the strands of the polynucleic acid molecule. In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of the passenger strand of theWSGR Docket No.61382-729.601 polynucleic acid molecule . In some instances, the Y1 is the last nucleotide on the 3’ end or the first nucleotide on the 5’ end of the passenger strand of the polynucleic acid molecule, and the Y2 is a 3-hydroxy-propoxy group. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of one of the strands of the polynucleic acid molecule. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule. In some instances, the Y2 is the first nucleotide on the 5’ end or the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule, and the Y1 is a 3-hydroxy-propoxy group. In other instances, the Y1 and Y2 are two consecutive nucleotides in one of the strands of the polynucleic acid molecule.
[0231] In some aspects, the targeting moiety described herein is conjugated to 3’ end of the passenger strand (e.g., formula (IV’)). In some aspects, the targeting moiety described herein is conjugated to 5’ end of the passenger strand (e.g., formula (IV’’) or (IV’’’)). In some aspects, the targeting moiety described herein is conjugated to 3’ end of the guide strand (e.g., formula (IV’)). In some aspects, the targeting moiety described herein is conjugated to 5’ end of the guide strand (e.g., formula (IV’’) or (IV’’’)).wherein Z in formula (IV’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.WSGR Docket No.61382-729.601wherein Z in formula (IV’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.wherein Z in formula (IV’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
[0232] wherein Z in formula (IV’’’’) is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-Methyl, -F, or -O-methoxyethyl) and R in formula (IV’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.WSGR Docket No.61382-729.601
[0233] In some aspects, the linker conjugated with one or more targeting moieties as shown in Formula (IV’’) or (IV’’’) is added to the first nucleotide on the 5’ end. In some aspects, the linker conjugated with one or more GalNAc as shown in Formula (V’’) or (V’’’) is added to the first nucleotide on the 5’ end. In some aspects, the modification pattern comprises one or more phosphorothioate modified internucleotide linkages. In some aspects, the modification pattern is shown in Formula (VII). In some aspects, the 5’ end modification known in the art is applied to the one or more inverted nucleotides. Pharmaceutical Compositions
[0234] Delivery of the polynucleic acid molecules described herein can be achieved by contacting a cell with the construct using a variety of methods. In particular aspects, the polynucleic acid molecule described herein is formulated with various excipients, vehicles, and carriers, as described more fully elsewhere herein.
[0235] A pharmaceutical composition described herein can be prepared to comprise a hybridized polynucleotide construct disclosed herein, into a form suitable for administration to a subject using carriers, excipients, and vehicles. Frequently used excipients comprise magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol, and polyhydric alcohols. Intravenous vehicles comprise fluid and nutrient replenishers. Preservatives comprise antimicrobial, anti-oxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles comprise aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington: The Science and Practice of Pharmacy, 21st Ed., Gennaro, Ed., Lippencott Williams & Wilkins (2005), and The United States Pharmacopeia: The National Formulary (USP 36 NF31), published in 2013. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics.
[0236] The pharmaceutical compositions described herein may be administered locally or systemically. The therapeutically effective amounts may vary according to factors, such as the degree of infection in a subject, the age, sex, and weight of the individual. Dosage regimes can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.WSGR Docket No.61382-729.601
[0237] The pharmaceutical composition can be administered in a convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, and the like), oral administration, ophthalmic application, inhalation, topical application, or rectal administration. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
[0238] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The composition will typically be sterile and fluid to the extent that easy syringability exists. Typically the composition will be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size, in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols, such as mannitol, sorbitol, or sodium chloride are used in the composition. Prolonged absorption of the injectable compositions can be brought about by comprising in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0239] Sterile injectable solutions can be prepared by incorporating the pharmaceutical composition in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
[0240] It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein, refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containingWSGR Docket No.61382-729.601 a predetermined quantity of pharmaceutical composition is calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The specification for the dosage unit forms is related to the characteristics of the pharmaceutical composition and the particular therapeutic effect to be achieve. The principal pharmaceutical composition is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable vehicle in an acceptable dosage unit. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the ingredients.
[0241] The pharmaceutical composition can be orally administered, for example, in a carrier, e.g., in an enteric-coated unit dosage form. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft-shell gelatin capsule or compressed into tablets. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, and the like. Such compositions and preparations may comprise at least 1% by weight of active compound. The percentage of the compositions and preparations can, of course, be varied and can conveniently be between about 5% to about 80% of the weight of the unit. The tablets, troches, pills, capsules, and the like can also contain the following: a binder, such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid, and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin, or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier. Various other materials can be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules can be coated with shellac, sugar, or both. A syrup or elixir can contain the agent, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring, such as cherry or orange flavor. Any material used in preparing any dosage unit form may be of pharmaceutically acceptable purity and substantially non-toxic in the amounts employed. In addition, the pharmaceutical composition can be incorporated into sustained-release preparations and formulations.
[0242] The pharmaceutical composition described herein may comprise one or more permeation enhancer that facilitates bioavailability of the polynucleic acid molecule described herein. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are herein incorporated by reference in its entirety. In some aspects, the permeation enhancer is intestinal. In some aspects, the permeation enhancer is transdermal. In some aspects, the permeation enhancer is to facilitate crossing the brain-bloodWSGR Docket No.61382-729.601 barrier. In some aspects, the permeation enhancer improves the permeability in the oral, nasal, buccal, pulmonary, vaginal, or corneal delivery model. In some aspects, the permeation enhancer is a fatty acid or a derivative thereof. In some aspects, the permeation enhancer is a surfactant or a derivative thereof. In some aspects, the permeation enhancer is a bile salt or a derivative thereof. In some aspects, the permeation enhancer is a chelating agent or a derivative thereof. In some aspects, the permeation enhancer is a non-chelating non-surfactant or a derivative thereof. In some aspects, the permeation enhancer is an ester or a derivative thereof. In some aspects, the permeation enhancer is an ether or a derivative thereof. In some aspects, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1- dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof. In one specific aspect, the permeation enhancer is sodium caprate (C10). In some aspects, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate or sodium glycodihydrofusidate. In some aspects, the permeation enhancer is polyoxyethylene-9-lauryl ether, or polyoxyethylene-20-cetyl ether.
[0243] For the polynucleic acid molecule described herein, suitable pharmaceutically acceptable salts comprise (i) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (ii) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like; and (iii) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like.
[0244] While the hybridized polynucleotide constructs described herein may not require the use of excipients for delivery to the target cell, the use of excipients may be advantageous in some aspects. Thus, for delivery to the target cell, the hybridized polynucleic acid molecule described herein can non-covalently bind an excipient to form a complex. The excipient can be used to alter biodistribution after delivery, to enhance uptake, to increase half-life or stability of the strands in the hybridized polynucleotide constructs (e.g., improve nuclease resistance), and / or to increase targeting to a particular cell or tissue type.WSGR Docket No.61382-729.601
[0245] Exemplary excipients comprise a condensing agent (e.g., an agent capable of attracting or binding a nucleic acid through ionic or electrostatic interactions); a fusogenic agent (e.g., an agent capable of fusing and / or being transported through a cell membrane); a protein to target a particular cell or tissue type (e.g., thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, or any other protein); a lipid; a lipopolysaccharide; a lipid micelle or a liposome (e.g., formed from phospholipids, such as phosphotidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterols, or any combination thereof); a nanoparticle (e.g., silica, lipid, carbohydrate, or other pharmaceutically-acceptable polymer nanoparticle); a polyplex formed from cationic polymers and an anionic agent (e.g., a CRO), where exemplary cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethylene imine); cholesterol; a dendrimer (e.g., a polyamidoamine (PAMAM) dendrimer); a serum protein (e.g., human serum albumin (HSA) or low-density lipoprotein (LDL)); a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); a lipid; a synthetic polymer, (e.g., polylysine (PLL), polyethylenimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolic) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine); a cationic moiety (e.g., cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or alpha helical peptide); a multivalent sugar (e.g., multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N- acetyl-glucosamine, multivalent mannose, or multivalent fucose); a vitamin (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, biotin, or pyridoxal); a cofactor; or a drug to disrupt cellular cytoskeleton to increase uptake (e.g., taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin).
[0246] Other therapeutic agents as described herein may be incorporated in a pharmaceutical composition described herein in combination with a polynucleic acid molecule described herein. Methods
[0247] In some aspects, described herein is a method of modulating expression of target gene in a subject, comprising: administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the expression of target gene in the subject. In some aspects, described herein is a method of modulating expression of target RNA in a subject, comprising: administeringWSGR Docket No.61382-729.601 to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating the expression of target RNA in the subject.
[0248] In some aspects, described herein is a method of modulating mRNA expression or protein expression level of a target gene in a cell, comprising: contacting the cell the inhibitory polynucleic acid molecule described herein, thereby modulating the mRNA expression or protein expression level of a target gene in the cell. In some aspects, described herein is a method of modulating mRNA expression or protein expression level of a target gene in a subject in need thereof, comprising: administering to the subject the inhibitory polynucleic acid molecule described herein or a pharmaceutical composition described herein, thereby modulating the mRNA expression or protein expression level of a target gene in the subject.
[0249] In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 10% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 20% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 30% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 40% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 50% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 60% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 70% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 80% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about or at least 90% compared to a negative control. In some aspects, the method described herein reduces expression of target gene in a subject by about 100% compared to a negative control.
[0250] In some aspects, the method described herein achieves an IC50 value of about 5nM. In some aspects, the method described herein achieves an IC50 value of about 10nM. In some aspects, the method described herein achieves an IC50 value of about 15nM. In some aspects, the method described herein achieves an IC50 value of about 20nM. In some aspects, the method described herein achieves an IC50 value of about 25nM. In some aspects, the method described herein achieves an IC50 value of about 30nM. In some aspects, the method described herein achieves an IC50 value of about 35nM. In some aspects, the method described herein achieves anWSGR Docket No.61382-729.601IC50 value of about 40nM. In some aspects, the method described herein achieves an IC50 value of about 45nM. In some aspects, the method described herein achieves an IC50 value of about 50nM. In some aspects, the method described herein achieves an IC50 value of about 55nM. In some aspects, the method described herein achieves an IC50 value of about 60nM. In some aspects, the method described herein achieves an IC50 value of about 65nM. In some aspects, the method described herein achieves an IC50 value of about 70nM. In some aspects, the method described herein achieves an IC50 value of about 75nM. In some aspects, the method described herein achieves an IC50 value of about 80nM. In some aspects, the method described herein achieves an IC50 value of about 85nM. In some aspects, the method described herein achieves an IC50 value of about 90nM. In some aspects, the method described herein achieves an IC50 value of about 95nM. In some aspects, the method described herein achieves an IC50 value of about 100nM.
[0251] In one aspect, provided herein is a method for suppressing off-target effects caused by a guide strand of an inhibitory polynucleic acid molecule in a cell, comprising introducing the inhibitory polynucleic acid molecule described herein to the cell. In another aspect, provided herein is a method for suppressing off-target effects caused by a guide strand of an inhibitory polynucleic acid molecule in a subject, comprising administering to the subject the inhibitory polynucleic acid molecule described herein. In some instances, provided herein is a method for improving stability and efficacy of a guide strand of an inhibitory polynucleic acid molecule in a cell, comprising introducing the inhibitory polynucleic acid molecule described herein to the cell. In some instances, provided herein is a method for improving stability and efficacy of a guide strand of an inhibitory polynucleic acid molecule in a subject, comprising administering to the subject the inhibitory polynucleic acid molecule described herein. EXAMPLES
[0252] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. For all of the sequences presented herein, oligonucleotide structure representation reads from left to right (5' to 3'). Monomer codes present in the oligonucleotide code are linked by 5'-3' phosphodiester bonds unless specified (succeeded by 3' internucleotide linkage reading left to right). Abbreviations of nucleotide monomers used in oligonucleotide structure representation are as follows. “A” stands for Adenosine-3'-phosphate; “a” stands for 2'-O- methyladenosine-3'-phosphate; “Af” stands for 2'-fluoroadenosine-3'-phosphate; “dA” stands for 2'- deoxyadenosine-3'-phosphate; “dA3” stands for 2’-deoxy-2-aminopurine riboside-3’-phosphate; "a1" stands for 2-Amino-2'-O-methyladenosine-3'-phosphate; “A2” stands for 2’,3’-seco-WSGR Docket No.61382-729.601 adenosine-3’-phosphate; “C” stands for Cytidine-3'-phosphate; “c” stands for 2'-O-methylcytidine- 3'-phosphate; “Cf” stands for 2'-fluorocytidine-3'-phosphate; “dC” stands for 2'-deoxycytidine-3'- phosphate; “C2” stands for 2’,3’-seco-cytidine-3’-phosphate; “G” stands for Guanosine-3'- phosphate; “g” stands for 2'-O-methylguanosine-3'-phosphate; “Gf” stands for 2'-fluoroguanosine- 3'-phosphate; “dG” stands for 2'-deoxyguanosine-3'-phosphate; "G2” stands for 2’,3’-seco- guanosine-3’-phosphate; "i" stands for 2'-O-methylinosine-3'-phosphate; “U” stands for Uridine-3'- phosphate; “u” stands for 2'-O-methyluridine-3'-phosphate; “Uf” stands for 2'-fluorouridine-3'- phosphate; "u3" stands for 2'-O-methyl-2-thiouridine-3'-phosphate; "U3f" stands for 2'-fluoro-2- thiouridine-3'-phosphate; “dU” stands for 2'-deoxyuridine-3'-phosphate; “U2” stands for 2',3'-seco- uridine-3'-phosphate; “T” stands for 5-methyluridine-3'-phosphate; “t” stands for 2'-O-methyl-5- methyluridine-3'-phosphate; “Tf” stands for 2'-fluoro-5-methyluridine-3'-phosphate; “dT” stands for thymidine-3'-phosphate; “dT3” stands for 2'-deoxy-2-thiothymidine-3'-phosphate; “s” stands for 3'-phosphorothioate; “(Pr)” stands for C3-spacer; “(T-T)” stands for acyclic L-threoninol nucleic acid-thymine-3’-phosphate; “(T-A)” stands for acyclic L-threoninol nucleic acid-adenine-3’- phosphate; “(T-NAc)” stands for acyclic N-acetyl L-threoninol abasic nucleic acid-3’phosphate; “(dAB)” stands for 1’,2’-Dideoxyribose-3’-phosphate; and “(Tgn)” stands for thymidine-glycol nucleic acid (GNA) S-isomer. Example 1 – Testing AGT siRNAs in Transgenic Mice
[0253] Sequences of siRNAs evaluated are specified in Table 1 with the 3’ end of each passenger strand (or sense strand) conjugated with a GalNAc via X2 (see Formula (V’)). Seed region modifications of parent sequence SRS-001711 were evaluated. Transgenic AGT mice (HuAoGen Mice, B6.Cg-Tg(hAGT)2041Sig / J, Jackson Laboratory) were assigned to treatment groups (n=5, 3 males, 2 females). Each treatment group was administered a single 3 mg / kg subcutaneous injection of AGT siRNA on day 0. Blood samples were collected pre-dose (days -7, 0), and on days 7, 14, 21, 28, and 35. Blood was processed to plasma, and AGT circulating protein levels in all plasma samples were analyzed using an AGT ELISA assay (IBL America, #27412). Results for each individual were calculated as a percentage of circulating AGT protein remaining relative to the pre- dose average (Day -7, Day 0), and group mean values are listed in Table 2. In addition, liver hAGT mRNA was measured by qPCR (normalized to mouse ACTB) on day 35 using specific primers. As shown in FIG.1, expression relative to the saline control group is presented as mean ± standard deviation. Taken together, these results demonstrate that these seed region modified siRNAs effectively reduce human AGT mRNA in the liver and reduce AGT protein in plasma. ForWSGR Docket No.61382-729.601 example, SRS-002055, SRS-002060, and SRS-002061 reduced plasma AGT and liver AGT mRNA to levels similar to those of SRS-001711. Example 2 – Testing AGT siRNAs in Transgenic Mice
[0254] Sequences of siRNAs evaluated are specified in Table 3 with the 3’ end of each passenger strand (or sense strand) conjugated with a GalNAc via X2 (see Formula (V'''')). Seed region modifications of parent sequences SRS-002085, SRS-002088, and SRS-002093 were evaluated. Transgenic AGT mice (HuAoGen Mice, B6.Cg-Tg(hAGT)2041Sig / J, Jackson Laboratory) were assigned to treatment groups (n=4 or 5, 1-2 males, 2-3 females). Each treatment group was administered a single 3 mg / kg subcutaneous injection of AGT siRNA on day 0. Blood samples were collected pre-dose (days -7, 0), and day 28. Blood was processed to plasma, and AGT circulating protein levels in all plasma samples were analyzed using an AGT ELISA assay (IBL America, #27412). Results for each individual at Day 28 were calculated as a percentage of circulating AGT protein remaining relative to the pre-dose average (Day -7, Day 0), and group mean values are listed in Table 4. In addition, liver hAGT mRNA was measured by qPCR (normalized to mouse ACTB) on day 35 using specific primers. As shown in FIG.2, expression relative to the saline control group is presented as mean ± standard deviation. These results demonstrate the seed region modifications evaluated for the SRS-002093 parent sequence are well tolerated. For example, SRS-002094 and SRS-002095 reduced plasma AGT on Day 28 by -83% and -80%, respectively. In addition, SRS-002094 and SRS-002095 reduced liver AGT mRNA on Day 35 by -69% and -74%, respectively. These reductions were similar to improved when compared to the parent sequence of SRS-002093. Results show that these seed region modified siRNAs can reduce AGT mRNA expression in liver and AGT protein in plasma. Example 3 – Testing AGT siRNAs in Transgenic Mice
[0255] Sequences of siRNAs evaluated are specified in Table 5 with the 3’ end of each passenger strand (or sense strand) conjugated with a GalNAc via X2 (see Formula (V')). Transgenic AGT mice (HuAoGen Mice, B6.Cg-Tg(hAGT)2041Sig / J, Jackson Laboratory) were assigned to treatment groups (n=4, 2-3 males, 1-2 females). Each treatment group was administered a single 2 mg / kg subcutaneous injection of AGT siRNA on day 0. Blood samples were collected pre-dose (days -7, 0), and on days 7, 14, 21, 28, 35, and 42. Blood was processed to plasma, and AGT circulating protein levels in all plasma samples were analyzed using an AGT ELISA assay (IBL America, #27412). Results for each individual at were calculated as a percentage of circulating AGT protein remaining relative to the pre-dose average (Day -7, Day 0), and group mean valuesWSGR Docket No.61382-729.601 are listed in Table 6. In addition, liver hAGT mRNA was measured by qPCR (normalized to mouse ACTB) on day 42 using specific primers. As shown in FIG.3, expression relative to the saline control group is presented as mean ± standard deviation. Taken together, these results demonstrate that these siRNAs effectively reduce human AGT mRNA in the liver and reduce AGT protein in plasma. Example 4 – Testing AGT siRNAs in Non-Human Primates
[0256] Sequences of siRNAs were used for the non-human primate study are specified in Table 7 with the 3’ end of each passenger strand (or sense strand) conjugated with a GalNAc via X2 (see Formula (V’)). Four male cynomolgus monkeys were assigned to each treatment group. Each treatment group was administered a single 2 mg / kg subcutaneous injection of AGT siRNA (as shown in Table 7) on day 1. Blood samples were collected pre-dose (days -14, -7, and day 1), and on days 8, 15, 22, 29, and 36. Blood was processed to serum, and AGT circulating protein levels in all serum samples were analyzed using an AGT ELISA assay (IBL America, #27412). As shown in FIG.4 and Table 8, after receiving AGT siRNAs, levels of serum AGT were decreased. Results for each individual were calculated as the % change in circulating AGT protein relative to the day 1 pre-dose timepoint, and group values are presented as mean ± standard deviation. Example 5 – Testing ANGPTL3 siRNAs in Transgenic Mice
[0257] Selected siRNAs shown in Table 9 or PBS were administered in a single subcutaneous dose into transgenic ANGPTL3 mice (n=5 per group) available commercially from Shanghai Model Organisms Center, Inc (C57BL / 6-Angptl3em2(hANGPTL3)Smoc, cat# NM-HU-210036). The 3’ end of the passenger / sense strand of each siRNA is conjugated with a triantennary GalNAc moiety (X2- GalNAc as in Formula (V’)). Selected siRNAs were administered at a single subcutaneous dose level of 1 mg / kg on day 0. Serum hANGPTL3 protein levels were measured by ELISA (R&D Systems, cat# DANL30) on Days -4 (predose) and days 7, 14, 21, 28,and 35. For each individual, the % change in serum ANGPTL3 relative to the PBS group mean per timepoint was calculated. The average % change in serum hANGPTL3 protein levels relative to the PBS group and standard error are reported in Table 10. Results are plotted and shown in FIG.5. Example 6 -Testing selected Lp(a) siRNAs in cynomolgus monkeys
[0258] Eight Lp(a) siRNAs, SRS-000018, SRS-001955, SRS-001958, SRS-000016, SRS-002041, SRS-002042, SRS-002064, and SRS-002065 were tested in cynomolgus monkeys, the sequences for which are specified in Table 11. The 3' end of the passenger strand (or sense strand) of eachWSGR Docket No.61382-729.601 siRNA was conjugated with a GalNAc via X2 (see Formula (V')). The Lp(a) siRNAs had sequences which were cross reactive with the cynomolgus monkey LPA gene. Male cynomolgus monkeys (n=4 per treatment group / siRNA) were administered a single 1 mg / kg subcutaneous injection of each Lp(a) siRNA or saline. Animals were fasted overnight prior to collection of blood samples on day -15, -8, and 1 (pre-dose) and on days 4, 8, 11, 15, 22, 29, 36, 43, and 50. Additional blood samples were collected on day 57, 64, 71, 78, 85, 99, 113, 127, 141, and 155 for the SRS-000018, SRS-00016, SRS-002064, and SRS-002065 treated groups. Lp(a) circulating protein levels in all serum samples were analyzed using an Lp(a) ELISA assay (Abcam, catalog # ab212165). Results for each individual animal were expressed as the % change of circulating Lp(a) protein relative to the pre-dose (day 1) timepoint. The mean % change for each treatment group along with standard deviation is plotted in FIG.6 and listed in Table 12. Results show that levels of serum Lp(a) protein were decreased after administration of Lp(a) siRNA. Example 7 Testing selected Lp(a) siRNAs in cynomolgus monkeys
[0259] Eight Lp(a) siRNAs, SRS-000018, SRS-001955, SRS-001958, SRS-000016, SRS-002041, SRS-002042, SRS-002064, and SRS-002065 were tested in cynomolgus monkeys, the sequences for which are specified in Table 13. The 3’ end of the passenger strand (or sense strand) of each siRNA was conjugated with a GalNAc via X2 (see Formula (V’)). The Lp(a) siRNAs had sequences which were cross reactive with the cynomolgus monkey LPA gene. Male cynomolgus monkeys (n=4 per treatment group / siRNA) were administered a single 0.5 mg / kg subcutaneous injection of each Lp(a) siRNA. Animals were fasted overnight prior to collection of blood samples on day -15, -8, and 1 (pre-dose) and on days 8, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, 99, and 113. Lp(a) circulating protein levels in all serum samples were analyzed using an Lp(a) ELISA assay (Abcam, catalog # ab212165). Results for each individual animal were expressed as the % change of circulating Lp(a) protein relative to the pre-dose (day 1) timepoint. The mean % change for each treatment group along with standard deviation is plotted in FIG.7 and listed in Table 14. Results show that levels of serum Lp(a) protein were decreased after administration of Lp(a) siRNA. Example 8 Testing selected Lp(a) siRNAs in cynomolgus monkeys
[0260] Three Lp(a) siRNAs, SRS-002064, SRS-002378, and SRS-002379 were tested in cynomolgus monkeys, the sequences for which are specified in Table 15. The 3' end of the passenger strand (or sense strand) of each siRNA was conjugated with a GalNAc via X2 (see Formula (V')). The Lp(a) siRNAs had sequences which were cross reactive with the cynomolgusWSGR Docket No.61382-729.601 monkey LPA gene. Male cynomolgus monkeys (n=4 per treatment group / siRNA) were administered a single 0.5 mg / kg subcutaneous injection of each Lp(a) siRNA. Animals were fasted overnight prior to collection of blood samples on day -15, -8, and 1 (pre-dose) and on days 8, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78. Lp(a) circulating protein levels in all serum samples were analyzed using an Lp(a) ELISA assay (Abcam, catalog # ab212165). Results for each individual animal were expressed as the % change of circulating Lp(a) protein relative to the pre-dose (day 1) timepoint. The mean % change for each treatment group along with standard deviation is plotted in FIG.8 and listed in Table 16. Results show that levels of serum Lp(a) were decreased after administration of modified Lp(a) siRNA. Example 9 Testing selected ApoC3 siRNAs in APOC3 transgenic mice
[0261] The siRNAs listed in Table 17 were administered to APOC3 transgenic mice (The Jackson Laboratory, B6;CBA-Tg(APOC3)3707 / Bres / J, strain #006907) by subcutaneous injection at adose level of 0.5 mg / kg. The 3' end of the passenger strand was conjugated with a GalNAc via X2 linker (see formula (V')). Plasma from all groups was collected on days -7, 0 (pre-dose), and on days 7, 14, 21, 28, and 35. Plasma hAPOC3 protein levels were measured using an ELISA assay (Abcam, catalog #: ab154131). For normalization, the APOC3 level for each animal at each timepoint was divided by the pre-dose (day 0) level of that animal. Then, for each individual at a specific timepoint, the pre-dose normalized value was normalized to the vehicle control group's mean pre- dose normalized value. The mean results along with standard deviation are listed in Table 18 and plotted in FIG.9. The majority of seed region modified siRNAs still resulted in reduced hAPOC3 protein expression at a dose of 0.5 mg / kg.
[0262] While preferred aspects of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the aspects of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.WSGR Docket No.61382-729.601 -'5(A A A A A A A A A A”C C C C C C C C C Ca;oetre“c G G G G G G G G G G;etotahoto n A A A A A A A A A Atasresrpssr - ce G G G G G G G G G G hfuereferohefdeiA rcaN q U U U U U U U U U Ups ”e U U U U U U U U U U o”p-’ ” claS A A hCg3TieGes)'AA UAAA UAAA A A A A A A p UAA UAA UAA UAA UAA A A UAUAU-’“; “; -ed“ lc,.g a3 A AA AA A A A A A A A 3-eta etanid;eu n.eB A A A AA AA AA AA AA AA AA AehhireA A A A A A A A A A np ps rtuahci(s ytg C C C C C C C C C Cis soolypneG G G G G G G G G G ohhhs aobaeio ssU U U U U U U U U Unep a C C C C C C C C C C d'- p 3-’tehl3mmp-’og P C C C C C C C C C Cao-e- - 3niniA A A A A A A A A AtsrnienO- -enoteesfois ’o2 niee nenotdrg irht-ratQ:EDIO 5rdau 1 51 5 5 5 5 5 5 5 5”alg srulLlao S N 1 1 1 1 1 1 1 1 A“yoefy . ht t erhteyttecdelwesr ”um-a- p -' a a a a a a a a a aorm-ef“ 5-Nu 5(u u u u u u u u u ua eOer;ec oce a a a a a a a a aa'-”taoroilc sdaocaCgcaagcagcagcagcagca acm2gc cgas -oGi“hulfycecega a a a a agaga1a enr u gu gu g g g g g g ght i;eptsoh-’aoneutufufufu ufu ufu ufu ufu ufu ufu uf fm Aa-hp2- ottu sqecu)'AarfAafAafAafAafAaAaAaAaAon2 ps ’o3- s rrefsrt 3 A SafAf f f fafmoth afAafAafAafAafAafAafAafAafulsrpee-’nifdeer er"g ) n rA A A A A A A A A ocef3- ir”f cesyegcgcgcgcgcgcgcgcgcgAc tg hedneu gr euTAsascuscuscuscuscuscuscuscuscuc ir"n1io aditt “ Ns-pr;eT(dut sacsc c c c c c cscasas s s s s s s scsti "; yceftah" e;ifiS Pa a a a a a asaneeo tayxerps etdocdhoiQ:etps e ”oadUhh ppsmh EDIO 61 61 61 61 61 61 61 61 6 7acoh-’“2 ;e-t’3ohcaMS N 1 1 ol p-c3oisitah-epE. -en'-;nsrpes i3rodir-e ene)'3 C - G C A C C A C C C A Ois fG C G G C G G CNoerhp- ulnim ymosg's5(U U U G U U U G G U U G U U U U U D neI ne ” ’dC3hyi- d-eteht- S)ac U U U U U U U U U U Qarne U U y“n C CU U U C U U U U U Ex;eism-5dic A u U U UUUUCU UC UUUUUCUC C C UUUUUUUCS oetao n-l aN c GT qe A AUAUUU AUAUAUUU AUAUAUAUUUndh AUia-’pay uhie(rSCGAG AGAG AGAGAGofesGCGAG GCGAG GCGC AGtr2sogytelcdic a U AU AC GU C AU AC GU C AT TG C A AC Gecaothpxo m- unal csCe BG G C G G C G C C U G U U G U G G Gfsceor-e’ eO df3- d-’-’oineilcniU U U U U U U U U Ue er eeu U A U A A U A U U U22nu Ac ”niootonlG A U U A U U U A U U A A U U UneuAdiuqdttsycsrreerofht- cylqeeQ:s “;eoref eDO 1 2 3 4 2 3 4 5 5 3 gtaoerr Lu””tcig- l eS E.SINnidh npslfG“;co-’d“etay nicdi1oph2 ;ehaomyelcscscscsuscscsusc c cssep rr-’ot3straphs tosh rtbacsusuususu uugsu us sugusus suoc-e enfepshpe-feotsTusu g u g g g ggag g)agaug ug g gehtisro ” h’r rp3") ef .)’’'ggacfga acfcfcfcfgaga acf ;onfeC-’- 3e eniT-r ’’3-acfG 'cfG G GufG Gcu uf fcfG1.9da“;e-edirT(")’n’V 5(GufeUufufU UfG GuU Uufuf f7 U 44orotanisul";eg T( ro rufUuutUuufUufuf fU Uufufu U U U uuU fufuf8 U 3uh 1loy fp-sonahta" ,’uteoi;e’’cfu Uu a uaaU Uua0’hghtta’’urU t uaauaa aa) acfac a)cuaua ac0_2otp-’orm- 5orh pV,SaacecfUc)B U) )cAaca)c))cM Nsr 3- o euldf )B AcAfotohso’h’’’iUB A d(AN-N- TT- ng A Nt epfeni-’srpesop'- Vucg A dfd(cU N- T(fT(cT(-cTirrd c”fit2fh yoterp3-,’G uu(sfg gcu u gT((cUg g(c ssu u uu g gcu u g u u g nAcl su usu uar“yhr”-’eeT“ 3sVoobalu A usfsfsu u ufsfut ;et fe; t irAfsAsAssfsfAsfAsAssfAnata ehm-r”eftasrymexro u u uAs su uAsu usu u muphfhsoOGp e oeFoth-’“p2 ;s reoh”dsi,.g “ D'.e: e-’ottap- (Q EDIO 6 7 8 9 01 11 21 31 41 11 vit3-e srh-p’;s3e2t,'rea1k S Nalerniesfeo- henihotniltseno 9 9 9 9 9 9 9 9 9iornne”cp-“’dp3is sroruheapfeaigriti62 62 62 62 62 62 62 6 9 2 62 62 oitdal;e-enor-’r v"d asTo 1 1 1 1 1 1 1 1 1 1iytaio3- )nPsoh ptetehsu epolf- e nmiB A’D 1 4 5 6 7 8 9 0 1 4gr - sona ’Ohu2 did(3pglotm I 1 y" st; 7 5 5 5 5 5 5 6 6 8aeitax 1 02 02 0 0 0 0 0 0 0tee-’-2’y 3h l 0tsrehtta )p00 0 0 2 0 0 2 0 0 2 2 2 2 2 0 0 0 0 0 0 0htot -enefeyxh psesotu -S -S -S -S -S -S0-S0-S0-S0-S:etsr idm-r oO”f eohcaD R S R S R S R S R S R S R S R S R S R S oefitNeryc-’d 2U“-’2'p l3agWSGR Docket No.61382-729.601 Table 2. Percent Remaining Plasma AGT Relative to Pre-Dose Average Study Day Duplex ID Dose Statistic -7 0 7 14 21 28 35 Mean 104.9 95.1 89.0 93.9 92.1 91.6 99.1 PBS - SD 11.7 11.7 7.8 20.9 12.6 12.0 9.3 N 5 5 5 5 5 5 5 Mean 101.7 98.3 9.2 9.5 7.8 11.2 14.5 SRS-001711 3 mg / kg SD 12.6 12.6 2.3 3.3 2.2 1.5 2.9 N 5 5 5 5 5 5 5 Mean 98.7 101.3 31.7 46.7 61.0 100.8 137.6 SRS-002054 3 mg / kg SD 6.5 6.5 12.0 15.7 20.2 35.0 42.6 N 5 5 5 5 5 5 5 Mean 101.4 98.2 12.6 11.3 11.1 20.7 30.7 SRS-002055 3 mg / kg SD 7.8 8.8 3.4 3.2 4.0 8.2 9.5 N 5 4 5 5 5 5 5 Mean 93.8 106.6 43.3 44.2 50.0 74.2 85.7 SRS-002056 3 mg / kg SD 9.3 9.5 14.7 12.0 16.5 28.1 22.3 N 5 5 5 5 5 5 5 Mean 100.8 99.2 20.3 30.9 48.6 86.2 108.6 SRS-002057 3 mg / kg SD 8.4 8.4 4.4 4.4 10.2 23.3 27.4 N 5 5 5 5 5 5 5 Mean 100.0 100.0 18.0 16.1 19.6 35.8 50.9 SRS-002058 3 mg / kg SD 7.8 7.8 5.7 5.7 5.7 11.2 17.1 N 5 5 5 5 5 5 5 Mean 99.5 100.4 19.7 18.6 24.0 37.3 45.3 SRS-002084 3 mg / kg SD 4.9 4.8 7.2 7.7 8.9 16.5 20.7 N 5 5 5 5 5 5 5 Mean 104.1 95.9 68.0 65.4 73.5 87.1 85.6 SRS-002059 3 mg / kg SD 4.7 4.7 11.6 18.5 24.9 18.9 15.9 N 5 5 5 5 5 5 5 Mean 105.8 94.2 15.4 14.1 11.7 15.7 25.2 SRS-002060 3 mg / kg SD 10.7 10.7 7.9 7.0 4.5 3.8 6.7 N 5 5 5 5 5 5 5 Mean 106.2 93.8 12.0 11.4 10.4 12.2 16.7 SRS-002061 3 mg / kg SD 7.7 7.7 5.0 3.2 4.1 4.6 2.9 N 4 4 4 4 4 4 4WSGR Docket No.61382-729.601 A A A A A A A A A A A A A A -;C Oet’)'A A A U U U U U C C C C C A A A -’ ah33-'C C C C C U U U U U G G G”a2 ”fpssti5(U U U e A A A G G G G G C C C“o G G G G G C C C;eto srtU otsar“c G G G U A A U U A G Atae ; -’h)n U A A e U U U A A A A G hferef e2'p esetao3-otu A A A C C C C C C C Cpq U U U C C C C C C C Cso” rhte C”gpssrdice ca alaS G G G U U U U U U U U h e U U U C C C C C U U U p-’“;s G G G U U U U U A A A3- e“o t;ehft pecg a -r’ ”ielrco a U U U U U U U U A A A ea3T nhh-educB C C C U U U U U G G G reG G G G G G G G A A Aisposopso g U U U C C C C C A A A hni“ nA d;eciNlaneU U U C C C C C A A Aneh dp'- p-s’irtuasalhbaGs U U U G G G G G A A Aa3,a G G G A A A A A A A A o P U U U C C C C C C C Ct -e3-eyhpsrnini tseol .hog.pni e(esfosnm- -’noyteonO3ereiQ 2 3 3 4 5 5 6 6 7 8 9erdau-’-ehto E SDIo N 3 3 3 3 3 3 3 3 3 3 3”Aalg 2 ni“yood-m. htet t irLlg ytniaaaaaa a a a awsrserfefulyecteg eacadcacucuucucuucuc aucacacaorm-eOererhtea-ratouauauag g u g g g g g ug g g gugcggc cc c '-” ”c m2- Gum-Nciao C g eug 1 raaaaau ua1uau ua1aaacgaaagseoni“ “;e;e5- orlctd utufufuf ccf ccf ccf ccf ccc cfcfcfcfhtmtatahoyucaelp c G u G fufG uf aUcUcUcaUcUcaU u U u Ufuo A- hpspslf-’otu urtG SuG u Gf f f f f f f fn2o u U U U U U AaA A moo t hh pp2 sorocef sirfeCfCfCufufuU UfufuU Uf fafafU G G Gul- g go sr-’ ’3tu gu g g g g g g- serecydne)'u u uuccccgccccccaaaaaaa ctef3 aaaaaher-eer"nineif"e)rcneu s3usususgsg g gs s s giddiAqeusta-'gP5( sugsugssausascsascsascsacsacsa acscscr 1st ai" it r;ycu ”fN-soTTreS neeo tayxt “;ho sr e (t"g ;eneciQ 0 1 2 3 4 5 6 7 8 9 0 dpeef ahta sE o SDIN 4 4 4 4 4 4 4 4 4 4 5etasd co-’erpshsaMohpl p-2”ohpsc3oitU G“pod heiAsi- sr; -’pfinG G G U U U U UeA G G C G C C C C G A A. eneet3'- d G G G Ois feah-e3-sC A A U G G G G U G GNorpsni eo nmgA C C C U U U U U U U Dne ”Codir ihcA A A G C C C C U U UI dadh m pulyanar)'A A A G G G G G U U U Qy“ -3’yht E;-'C A A C G G G G U U U E G C C A C C C C C U USx;e3ht-rnoeta-e edi eTr5(eA G G A A A A A U C Cioc C A A A A A A A U U Uadhn t-’psism-c5am cosfn A C C G A A A A A U Ure C A A A G G G G A A Aec2ooo-suthlipnayeil-cS q A C C G A A A A A AasU A Ar-’uhtu)G G G G G G G Gfoef3gyenlAece S A U UnC C C A G G G G G G GeesA A A A A U U Uecer-exm- oN ”nioeOniG(a U U U C C C C C U G GneduBA A A C C C C C G G G uAditd-’-’2noe dicqe G G G A A A A A G C Cqe“ yc2 ot rhaediU U U G G G G G C U Us ;eorotst- ciS u U U U A A A A U U U A U U U U G G G gt.G U U U U Uni ao dhulnps fsrreeffeLeclc3opo-’errilcun h2””t lelQ E o 8 9sepotG“ y;caocb SDIN 1 1 91 02 12 12 12 12 22 32 32rr-’3sred“etaotylg-aoc- Te enfe;rethsapsreenigsg usu a ashtiso”fhohfer digsgssgsasususcacuscsgcscsscs sg g gasgsgs ;ng g1. eCpsp u 97da“;o eh-’")my p3T- h gcasu u ucucgsu u 4orta-’-ecaaa T taaaf aafgc cu g g g gfg g g u f u u u 4 uuf8ouh p3-ni (od"tsafC gfCcgfgfu gfggfCafC C C uf3 afafafufU Ulcfcf1f senir;er0- 0’o 2hisoultya efeCgfAcfAcfCafAaA AafAafUcfU U uf_otp-’nahotiehtr").)A A A AfafUufMsr 3-eugorng’’)'cfcacaafGaGaGaGgagufAaAaN gt e3- A pfeniorm- 5ohT(’’’’'cu)cu)cGag g g 5a agag)cg)cAagg g)cirrditouot pso";eV ( u eafA A gg)c)cA A g u g)cAcs”nfylfAcl-’srehpta rhor u CN-tTN-afA A TN N-N-ufAaUN- rt “;y eht 2ofer-’,3 ps ’’’cua(f(fAcc -NT - T T T(f(fgN- T gT((fnata e tsr”otoh’’u g rtu C Ca(s uauagc(cccAcAc cu g Ug mhmups -OefT e“ srp'- V,’SfseUsgf a au g s u g gcac ss AssfsfgagfgGcsugscho f uoth-’r ;ep2 ”ftaefher3- e’s’’diuf fusfsfusf e-’otG uUsp”oV,G uUsAsAsu u uAsuAsGusuGsv uit3 al-e sre“;ss“b eohir ’yVernisfetap;-’ etax oalQsiorne”h cps3-eheu psdimrE o 42 52 52 6 7 7 8 8 9 0 1 n itd“o oDo SDIN 2 2 2 2 2 2 3 3 o isal;yehnih'- Fhtap-’dirp-’2,',.g egrito 2p tehp3 s -euor3- 1o .e(ais2 2 4 2 2 4 2 2 4 5 2 6 5 2 6 5 25 25 00 00 00tem- onisouenti sreTtoPn o 1 1 1 1 1 61 61 61 81 81 81grh tlaO e -’p-2’o 3nfa-’direfkniu2mer lxel- 5 S8- 6- 7- 8- 9- 0- 1 2 3 4 5htot -egloy tht")a0S80S80S80S80S90S9- 0S9- 0S9- 0S9-S9:srniysryBaip R2R2R2R2R2R2R 0 0etdh xAvu 0 0 2R2R2R2R2oefitteefodd DDIS 0 S 0 S00 S00 S00 S00 S00 S00 S00 S00 S00 Nerycmer ed("neWSGR Docket No.61382-729.601 Table 4. Percent Remaining Plasma AGT Relative to Pre-Dose Average Study Day Duplex ID Dose Statistic -7 0 28 Mean 108.0 92.0 170.0 PBS - SD 9.5 9.5 32.1 N 5 5 5 Mean 110.1 89.9 40.3 SRS-002085 3 mg / kg SD 12.3 12.3 9.4 N 4 4 4 Mean 97.8 102.2 99.4 SRS-002086 3 mg / kg SD 12.6 12.6 5.4 N 4 4 4 Mean 112.3 87.7 114.3 SRS-002087 3 mg / kg SD 8.8 8.8 18.9 N 4 4 4 Mean 91.8 108.2 21.4 SRS-002088 3 mg / kg SD 10.4 10.4 2.3 N 4 4 4 Mean 96.4 103.6 130.7 SRS-002089 3 mg / kg SD 26.8 26.8 15.3 N 5 5 5 Mean 97.0 103.0 113.8 SRS-002090 3 mg / kg SD 15.1 15.1 7.3 N 4 4 4 Mean 109.3 90.7 114.8 SRS-002091 3 mg / kg SD 16.4 16.4 3.1 N 4 4 4 Mean 87.0 113.0 93.8 SRS-002092 3 mg / kg SD 12.2 12.2 22.7 N 4 4 4 Mean 93.6 106.4 32.4 SRS-002093 3 mg / kg SD 17.1 17.1 15.9 N 4 4 4 Mean 96.0 104.0 17.2 SRS-002094 3 mg / kg SD 14.6 14.6 12.8 N 4 4 4 Mean 104.9 95.1 19.7 SRS-002095 3 mg / kg SD 14.0 14.0 9.0 N 4 4 4WSGR Docket No.61382-729.601 )'A A A A A A A A A A A A U C U U U U U C A -,3-'A A U U G C A A A A A C A A U O- -'- ’’’5A G U A A A A A U G C A”’2”f5-l- d3- ’(eC C G C C C C C G C G Aac G C G G G G G G G C A C“o ; o etUyic esV,s t “htaob’ne A A U A A A A A U A G G u G A U G G G G G U A U Ata rsr;hefef ete cq U C C U U U U U C C U Gp erer ahm-ieirVyalOlcxu e S U C C U U U U U C C A Us ” ”ps-’unoemresA U U A A A A A U U A U oh a A U C A A A A A C U A A pCg -’“; “o ; h2lpotodio nDFBA A U A A A A A U A A Ae ereA A U A A A A A U A A A3-tata-’3s irn'- ,.o2,'g.eg A G U A A A A A U G C A enhh-nC A G C C C C C G A Gispsps e eenifeerh1ot(res G A C A G G G G G C A U C ooohdrs U A C U U U U U C A C Gnehppir”tt- Lsrk a C A G C C C C C G A C d'- -’ul“; ci ef nilP C A A C C C C C A A A Ua3- 3yet lc er aA C C A A A A A C C C G C ote-eh srnisniste ah pyc")aivefoom- soaoB Ad Q:5 7 4 5 5 5 5 5 4 7ernenaOhtsd(neEDIO 1 3 3 1 1 1 1 1 3 3 36 46 du-’pr "’S N”Aal“ygo2 -’ eo3-efe;e3t st-' a a .htetsrtsrnir") ahip ta5( aeua a a a a a aac ucuauauauauaucc aa ag w orm-efefd eirT- so)esdaacgcugacacacacacuaaggc cugaaac eO'- er” r”ulyT(h "'p oto Cgaegcagugaggaggaggaggag g ucaggm aas2-oGuh ““ te;et 3-calr uauccucc uuuuuuuuuuucaccu c uagueni;e;etadi aam-oicag ut f f f f f f f f f f f fhtcu)'A U U A A A A A U U A UfmtAa-hh ps5ohtoc rieocrt3afufcA AfaUfaAfaAfaAfaAfc ufafa o p trAfU A Afn2soosrolcA SarfafufafafafafafufafafAafmo eAcG UA ulthh sp- p-’efhuN epsn lagcAcAcA AU G C Ar ’3rocigaagc cgaagayncocef3deuss casaccg -- ”hsaG,.csagug g g g scucucucucccaaucguther ee ascscscscscgsasacsn niTp “-’bag.asscgir"1iaditdir;et 3ol eo(uta PsascscsasasasasascscgscstSi "n;eycuat ytyoethnp sr ineiciQ:o tax h E 6 8 3 6 6 6 6 6 3 8 5 6 doe ps esr soefoo hererdefp”ht-mg SDIO N 1 4 4 1 1 1 1 1 4 1 6 6taMco- er '- s noh’lp-2”3“LitoU-e;lyegci3 G U U G Gsi- ts “; ni edta tecrane)'G U C G G G U U G G C U G. enreet irha-ta3-'A U G G G G U A A G G A Ois fC C C A A A U G CNoer ahupspoio o hN tgs5n(U G e G U C C C C G G G U A G G G G C U C U DI ne ” sac U C A U U U U U A C G U QdaCoht- pcidh yr“p2- -’l3cdel-ycpu n U U A U U U U U A U U U e U U A U U Ex;e-’3or ea ocT u U U U A U U q U U CA G UCUCUCU U G A U USnoeta-eoulre UUAA GAU CUUUUUUUC UUC UAU CAA A U GUCAUiad-’h pfnidiotssnis '- imsreofSA e UG G GA A A A A G G U CAtro2yef csA G GG A UA UA UA U UG GG G C Ge 2oernesa C A A U A C C C C C A U Tcothpnaothty U A U T T T T A Casr-’usrx")u qecBe C U U A C C C C C CT GfdniG G C C G G C G G G G G C G C Uo ef3- g eyexfeoe c edAsreu U C A U U U U U A C G Uecernioer -’N- eg G U U G U U U U U G U U Ane ”dd"f2 T(nu A G A A A A A A A G U C uAdit-’3o" esqU U U U U U U U U U U Uqe“ yc2U" tes s ;esag;et oro ot ;e reftapS.Q:ni ausrtaeE dhlfefhrh pd sei5SDIO 1 2 0 1 1 5 5 5 0 1 2 3pN 2 2 2 5 5 5 nospo-’erps ”Tohfid h2”ohdpoelsepobcscscsusas au rtGp“'- r -’3sd'- ;e3- mh -re“3- ta ecaacsasuscscsususuuscsgssc soTusg s us ce enfe;reteh anipsnineEusgcsusuusu ug g u g gcg g gucuu u ghtis;o”fhd pirohda;re)'g g u g uucg g g agagacacfgac g g u g u gaac1.neC“soup- hoi-’dim 3-au 'c5fufg ( G UgfcfcGf fG G Gfu GfCf fgU Cf9dU 7ao;etp- ht- 3-ecaosi-erufcfCa ufuf fufUufafcfgUfUuf44r8oa ’2cS uh3- -lnidie )U UfU A U UufufU A 3ufafufufU uf31lfp-’ se ony i ht irlcuA utufufafufufU UG AU U 0 hs eulnN curU 3 U u Uuua aua0_2p-’o t uA n myhlG(S aaGa gaU u g g u ga aaaacaa aa g f g g a gua aot a -ta c)Ms3- uOeonidiecfufaf acf )T-c)C) )uA)TfCT- Ntrefe nig or '-2 m- nocadicuUfcUAcU UcTT(- TT- - - )T p T T TT-(fir erditouot 5-eor crhieG g gcgfuugccag u C(f(c(f(CfG T(Cgcs”nfycllf-’srteo-luLcu sfusg u fsfu 3 s u g C s u g g u ucaggc cg u uu arA t“;yh2ferlf-’cinlAf fu s uGsAusuAsuAssfusu fsfsfusfsf asfna etateots"l32cy uAsAsAsG UsCsmhm-reuot cocyluAsu u usu u u uphsoOfe";e saotg-eoth-’rp2 ”ftarehfe srQ: enidiE 9 6 4 5 6 7 8ev-’3otsGpsr”ffem SDIO 6 N 2 2 5 5 5 5 5 95 06 16 26ital-ere“;eohTry erni fetap- “ ")htts sen go 9 0 2 9 9 9 9 9 2 0 8 0iorh’;eAnne”-cp“s3 o-etaohTt(rit"sreais62 08 56 62 62 62 62 62 56 08 62 72 oitdal;ehnTo 1 1 1 1 1 1 1 1 1 1 1 1i tpip-dso;efePsy oha ’irhtarp tteh ep3up s -eor-’hp ”)sn.)D 1 I 1 5 7 1 94 56 66 76 86 96 07 17 27 37grm- on aOhpiso ou3l-feog’’nihpT(’’“’’x 1 71 81 32 3 3 3 3 3 3 3 3tee-’-2’3na-’u2di'r-3;eVrl0 p0- 0 0- 0 0- 0 2 0- 0 2 0- 0 2 0- 0 2 0- 0 2 0- 0 2 0- 0 2 0- 0 2 0- 0 0-hto :t -esniglo yt usl-etynaihop ,’u S S S S S S S S S S S Set rdihtrhms’’D R S R S R S R S R S R S R S R S R S R S R S R S oef t eefteyo Nerycmermhth’p’VWSGR Docket No.61382-729.601 Table 6. Percent Remaining Plasma AGT Relative to Pre-Dose Average Study Day Duplex ID Dose Statistic -7 0 7 14 21 28 35 42 Mean 112.1 87.9 104.9 105.6 129.9 135.7 126.4 138.6 PBS - SD 10.7 10.7 15.8 24.9 14.3 15.4 28.2 28.0 N 4 4 4 4 4 4 4 4 Mean 93.2 106.8 13.6 16.8 13.2 12.5 17.4 32.1 SRS-001711 2 mg / kg SD 2.1 2.1 5.1 4.1 5.1 2.0 4.3 8.6 N 4 4 4 4 4 4 4 4 Mean 106.0 94.0 17.8 20.0 20.2 22.8 31.5 41.0 SRS-002365 2 mg / kg SD 11.5 11.5 4.9 8.4 9.0 7.7 11.9 12.5 N 4 4 4 4 4 4 4 4 Mean 93.6 106.4 15.0 14.0 11.0 12.4 19.1 29.2 SRS-002366 2 mg / kg SD 3.1 3.1 5.2 3.1 6.0 6.5 7.3 8.1 N 4 4 4 4 4 4 4 4 Mean 105.4 94.6 25.2 23.0 28.3 57.3 44.6 55.8 SRS-002367 2 mg / kg SD 10.0 10.0 7.9 4.9 8.8 33.3 10.1 16.1 N 4 4 4 4 4 4 4 4 Mean 96.7 103.3 30.2 36.4 34.3 43.4 55.3 78.8 SRS-002368 2 mg / kg SD 7.5 7.5 9.0 18.4 18.2 23.1 15.0 30.9 N 4 4 4 4 4 4 4 4 Mean 97.9 102.1 30.8 28.1 30.9 33.6 51.5 69.9 SRS-002369 2 mg / kg SD 13.5 13.5 12.5 5.7 10.2 8.9 15.4 25.0 N 4 4 4 4 4 4 4 4 Mean 104.7 95.3 14.8 12.0 13.2 16.0 19.0 22.5 SRS-001849 2 mg / kg SD 4.6 4.6 5.5 3.0 6.3 7.5 7.1 7.3 N 4 4 4 4 4 4 4 4 Mean 99.3 100.7 15.8 15.4 20.4 27.1 28.5 44.5 SRS-002370 2 mg / kg SD 5.6 5.6 10.0 5.9 4.1 2.5 6.9 11.1 N 4 4 4 4 4 4 4 4 Mean 106.4 93.6 31.0 20.8 21.1 30.1 30.7 40.5 SRS-001715 2 mg / kg SD 5.9 5.9 6.5 3.2 7.6 8.2 7.3 6.9 N 4 4 4 4 4 4 4 4 Mean 94.0 106.0 16.8 18.0 20.7 25.0 24.8 31.7 SRS-002371 2 mg / kg SD 10.8 10.8 3.2 9.7 9.4 12.7 11.3 14.3 N 4 4 4 4 4 4 4 4 Mean 96.2 103.8 29.5 40.3 45.2 67.4 69.8 89.2 SRS-002372 2 mg / kg SD 3.5 3.5 3.6 5.2 4.2 11.5 8.3 7.5 N 4 4 4 4 4 4 4 4 Mean 99.8 100.2 27.6 22.5 24.7 23.3 25.8 30.3 SRS-002373 2 mg / kg SD 7.8 7.8 10.0 12.4 8.3 10.3 9.2 8.8 N 4 4 4 4 4 4 4 4WSGR Docket No.61382-729.601 A A A A A A A )'U C U C C C C -e s3 A A C A A A Aotni-'A G U G G G Gsrs-ere- 5eoni;e(C C G C C C Cfenadirtafere e G C G C C C Cr -’” ni3uuh ps )dic A A n U A A A G”a -egloroA- my e G A U A G A A“ niyhouhpT(h u U C C C C C C C C;edtelf-’“ tqe U C C C Ctaitym-’3-;eotS A U esA U U U U U U C U U U U hc-2eta srA A A A ApsoO a A U- otniheA A A A A ohts’2sdi psfeB A U r A G U G G G G preC A G A A A A -’efore rohr")g G A C A A A A3-ert fsr er ulyp h-’ng.)neU A C A A A A en”ef”fte3- T(’’ssC A G A A A AisCerUme" ’’a C A A A A A A o“;”“-5ni;e’’P A C C C C C Cne edtag;“et -lmtaV ah;e ahyy hhth pro 5 7 4 7 9 7 opstapste -dso,’Q:1 3 3 3 3 3 83tohhom- ich’’E Osrep- psh opOacp-’’’SDINfer ’3h-’3-’ie3- V,”-ep a n-’-e2otlcues’’’’eua a a a a aAis3-niac ucc c c c “oendir srno elbirV,’daaocgcua a a aggcgcgcg.ncwedisoulyfeo rniy nxVCgaegcagc cauaaaca cgorealynahte”tooeerdialu r u utucfcfucccgcUf f caccaUfcf cc U Ufmhtu eg m-“;ehtDmrUasotOta --’2o c A ua uUc u u u uem-s -’hL ,’Frf f f f f f ftA A U A A A AhtSafO-r’ef2 posciolc1 ,.og.erfafue Gfafafafafo erthytU G G G G n2-o”srpc sgAcr (rgaaga a a amnynea cc aaa a aul iG“ ef-’3ae e-otfek ndss)'3uc asgaasaasaasas ocm A;eer” eni srer”ilua-'sctP5(saascsasacsa a acscscsc t -thgSi2ahudi fe )Baarot ps“;e rulrAivsetsrohtay”)ht6Td(“d n Q:1 84 34 84 05 84 94inefeph r -’pste -T(;e eta ’a E SDIO Nod”3-eohm-“;h3stmi et1anip-’5oetapsira tPC Ac“U A;U G C G A A A oled tit3-taycesroeio hhatp’ )esn U G G G G G Gsihyni fG G G.pa G U U Usxdireror3-”odiotcG U C U U U U OooeuThm A U G U U UNhp cpd-a ala’ot “socgu)'C U U G U U U U D- U U UI3-e2osr;eetahpi-elrco 3H- -'G U C 5(U C A U C U U U Q C C C Enistsfrerh p’s3uconAnoeU U A U U c U U A U U USoen U A G A U U U ni ne f ”o erUht ciN psrsalaN e U A A A A A AaA A Atrdaru y”“C;e-’3 q A G G G -efebaGl,.oe A G G G G G Gecxdtaerog.fSC G Gaoe“hni ”s ni e(seU A U s U U A T U T G U Ufod;-ea C G C G G G Ge’ eptsaod“n hir;eoytecBG G C G G G Gce U C A C C C Cn 2hpu eops-’oithaer io hht-nuto3-t-pLmediU U G U U U U u A G A G G G Gqesreh f pe u- 2- solg G U U U U U U Usger ’n 3ishyoorptnieteqeni ” -enaou- 1 2 0 1 3 7 3 dnAdniul’f3ca- -e -gratS.Q:2 2 5 2 6 2 op“ditgy’2niNc aE Os7SDINe;eyrcxotdi ilcotrtaelohoroe smycdelcpsod u-’rey fehtap oubaasasags eohlfsasgshtp-’2oryxt o2 t ”focesr sTcsaussg usgsg gugsg g;-’su1.3-ot re3 f Ud-’eferiecusg gcsu u u u 97esegu g u u u u 4ni re r“”;e2o”)cneu a u cfuucuufuuf4 u gufUufU 8s3ofnetaterGdhsrAqesGfufUgfUcfUcf1”fcfCcaffU UcuffU U 0du0_aoC““ ;epsetofNhe-r”T(reg uuf r;e ap“n U Uf fo h-’T; e)'ufufAafAaAaAgAa aMu g Nttlf ahps3deo-e“ ta ssa3-'UuAaGagg g)5cg (aaggg ) u)p-i’r2 pshpni;eh tapspd ecrfg g u gua)fAT- cAcsoto s hp-’d 3irho pheifiutUfT-N- T c UAcT T(fN- narre-’3-eusp noioh-’d 3o c g g(fu ugrccaG(fU U Tt fg(fna er -eit unsh ot- p-’-emS sfusg fsfgcg ggcG g m”f iditna2-l3nih y-en caeAdsGsAsusf cu u i u u us sf cu us hA“;yu clg ohertenida E;uGs fuGGsGs fot ey u uGs etah u vithto d um-ir -rueldim alps elf-’O- ycaos6 9erohm- ’hcO22 teiei-S Q:2 62 06 13 86 96sip-’-’otot m-lc )E O n32sr sr5- unA SDIN oit-ieot ef efor loN snis sreer er”o G uni(egrito ais96 00 25 00 0 0 0pofTtot ne e”frG3ulf- n ’ odeircaPn 2 o 1 81 61 8 0 1 8 0 1 8 0 1 8ed 1gratal”c“;ye“;e2ht- cixeh“; tataotsLelcel- 1h te etah ph spsref cilun S1 - 5 S1 - 9 S4- 1 S7- 1 S1 - 2 S1 - 31t:m- hooercylp 7 7 8 3 5 5S5 u R1 R1 R1 R2R2R2R2etoOp-sh ophp”f caocDDIS00 S00 S00 S00 S00 S00 S00 N’2h p-’3-’3T“otylgWSGR Docket No.61382-729.601 62.8.1.3.336 2 9.2.3.8.-3 4806.-94328.-7 46.7 - 3 452.6 31.5.1 - 8 4 17- 7 42 7 - 5 4 1 95.2328.9.5.9.5.6.6.7.3.0.0.3.6.-3 47 6 - 044 44 18- 47- 442 16- 3 44 43 27- 77- 0 4 1esoD-erP1ya 20.271.7.4496.4.8 405.6.7 439.42 4.02.68 4.33.07 4.07.5 4yD 7-5-8-7- 16- 16- 17-aDydotuteSvital56.e1627.8.6.9.3.9.9.7.6.0.8.4.3.-1 46 5 - 046 41 17- 56- 949 14- 444 40 26- 660 4 2R-TGAmu6r.e8855.5.7 4074.3.7 409.1.6 425.83 4.49.42 4.67.5.7.8 41 1 4S- -6-5- 14- 14-4- 1niegnah 10.00.040.00.40.0.40.0.40.0.40.0.40.0.4C 0 0 0 0 0 0 0 0 0 0 0tnecrecitPsn.itan n n n n n DaDaDaDaDa aaetM S NeS NeS NeS NeS NeD S NeD S N8S M M M M M Melba T e g sko / g gk / g gk / g gk / g gk / g gk / g gk / g Dm2m2m2m2m2m2m2 11 51 94 17 11 21 3 I 7 7 8 3 1 D 1 5 5 5 0 10 10 20 2 2 2 S0 0 0 00 0 0 0 0 R - S- - - - -0- S S S S S S S R S R S R S R S R S R S R SWSGR Docket No.61382-729.601 )'A A A A A A A A A A A A 3 U U U U U U U U U U U Uot-s'C C C C C C C C C C C Cr5(U U U U U U U U U U U Ue-f’- e3-”f5-l- di- e C C C C C C C C C C C CreenUyhca so c A A A G G A A A A A A A n”a id“e U A A U U U U U U U U U“ ;; it-ette cbiramiey u A A A A A G A G A A A A y U U Uet cOh-lcx qe U U U U U U U U U Ou Uao-’ps-’noeS U U U U U U U U U U U h esG G G G G G G G G G G Gp t 2o2ldiG G G G GsosrothotoD a G G G G G G G A A A A A hefsp-’ snin'-BA A A A A A A r A A A A A A A A A A A A p e G G G G G G G G G G G G -’er r”ef3-erefo2,'geer1nG G G G G G G G G G G G3-eCernirhotesU U U U U U U U U U U U n“;”gd”tt- ssA A A A A A A A A A A Ais ea A A A A A A A A A A A A ota“ i;reul“; L reecifeP A A A A A A A A A G A Aneh A A A A A A A A G G A A dpastayhtalcrohtehyc")othppspsaB '- ohm- ohotA Q:sr3pO 0 1ef-e-’-’p-’ sred("E SDIO N 9 9 19 29 29 39 09 39 49 59 09 09ern23 ”is3- ofe;eoet -er taAnnissrni")h ea a a a a a a a a a a a“. edaoefd duc ln erirTu-ps.To)h’’o uucu ucucucuucuccucuucucucc uucucucc uucuwa l (c ucc uc oryhu”y tguh"'p ’’t;e3-’’Ce acacag ga a a a a a a e eo“;etadiV ruaautuauaauuauauguauuu gauuauuauuama m-tsr etam-oica ro cufufufu ufu ufu ufufu ufufufufu uf seO'- efh u)'p 5oht cirt3- Ge,’’gG g G g G g G g G g G g G g G g G g GhgG gtf2-er st or ’o”osrolc’’S'r5f f f f f f f f f f f f(A A A A A A A A A A A Aoeafafafa a a anniGh “ p-’efhuV epsn,g G G Gf f f fa afafa amroci’’GfG Gf fmA;et 3- ”hs ’’ynegu gu g G u g G u g G u gu g G u gu g g Gdssauaaaaaaaaaaaaaaauaug G u guul -o2ae hniTp “-’ abaVtaaaPsassasaaaa ctot psd oir;et 3ol,’oVSsasasaas saassasasas sasasasaasaasggs asgsah asagisrrehpuaohtsrnialesfter-’3ts psnu oefo i"-ce ri :n1aefhperermr”ht- o Q EDIO 69 7 7 8 8 9 6 9 00 10 6 6o " nider '-3s“LF,.MS N 9 9 9 9 9 9 9 1 1 9 9 det;ciaeit ”-ectay ;lg hcU y“; ni eyt.edtaec(ne-'C 5(C A A A A A C A C C C C o C C C C C C C C C C Cl psi sxeooetairh upsa-rekgs eU C C C C C U C U U U U.hdhoioNnicn U U U U U U U U U U Op- -’psht- hpcilan e C C C C U Uau CAU U U U U C CAU A ACACAN3-e2o orqe)AGCAC CAC CAC CAC CA C AGCAC C C C AGAGthp2- -’l3cycaiAG GDInissr-’or-ea vdTS'AUAG G G G G UAUAUAUAUAUAG UACACAUA AUQoef3- ouniot nee 3 UU UAUAUAUAUAUUU UAUUU C U UUUUUTU UEneer eni lf'- disr ’r sa A U UUUUU UUU AUU AUA UUA A UU UAUAUA A TUUUSnda ” so2myef3fso BG AG UG UG UG UG UG AU G UU G AU G AG AG AiayCsetdrxdnaotshtyer t"iteiA A A A A A A A A A A A G G G G G G G G G G G Gecoe“d;eucutgyrex)afoe c )G A A A A A A A A A A A Aa-’ axenU U U U U U U U U U U Uf2hoerdAeseo " -’N-oteouct psdf2so-’3oT(c"alaqQ:eE 0ne reh f p-’2U o" t; sr;etgrS SDIO N 7 17 17 27 27 37 07 37 47 57 67 77 u qeer”3-tsr etaef ahoc.se gAdniedfherpes9 nrps ”A ToN aisasd“;eity”ohdh “ p'- laelasbasgsasgsasggsasasgaasasnopta cGp hord“'-3;et3-eG,.agsuugsusu u u ugT u u u u u uus su usasgsgsu ggu usepsou;e-e ahnig.e)'u u u u u uau u uu usuc su urrolftuccu uoh-’ anhidpsone(dyt3-'ufu a5fCa(cfafCafafC uafafuu u u ucp uafaf e-’2 psiruhpa-eifCc cfCcfcfC CcfafafCcCc ht;3-eotsohpoih-’3dio cme C rcfUfU UcufU uufU ufuf fC Cf fU U ufcfcfU U4.nrU Uufuf5i9s eofe-’t- 3- 2--e alni cig eniutUCfCcC CcufCu u4n reydi lctecuf cCcaca C cf fCcC 4e”fnhrug urtCcaa aaa c aC C a ca1dS aaisteulnraaua)acu uf auf)caaa) c c aBaaaaufa)0 C _or“o ;n m- yhlotaeudfA)A B)cA)Aui AN- A A BN)-TA- Adu(fufA AA)T- T T Mo ( ue afNtlftau hgO o't-eni2m- no otd u ud(A(fT( fu u - p-’ps ro5-erelGgaT(uN- gsu fgagaT(d(g A ugAugaggagT(Auirc2otoo hulfts orht- pu Asg gsfga auagg ggagsagsfsfgaggagsnasrp-’-’ refoulfL ocusfsfsfgsffA sfAsuAssufsf rtefe3-e2oter"-’cilsciAsAsAs suAsAsAsnar ni s32 y ecu uAsu uAsu u u u mu”fdreu" ot canehAiot“t; yfecelr ;e sy”ftareotu hfe sqreesQ:EDIO 8etahG 7 9 0 1 2 3 4 5 6 7 8 9 vhte“ psr”ffeesS N 7 8 8 8 8 8 8 8 8 8 8italps;eohTrero" nehm-tap“)stspOh-’;eA- deeni -’-’go 32 ps3 o-eta ihT(fid rit7 7 7 7 7 7 7 7 7 7 7 7 n ais53 5 5 5 5 5 5 5 5 5 5 5 oit-eotshpnidps"o o;eTo 1 31 31 31 31 31 31 31 31 31 31 31ini -’irht mPsosore3upahh pfte-eor-’enedrnp ca8 4 8 2 4 5 7 9 0 1 2 3gral”ciso3- soEoulfeh DI56 20 20 30 30 40 40 40 50 50 50 50atyh“;x 0ena-’nip 2di'er- ;3etal0 2 p00 2 2 2 2 2 2 2 2 2 2etet00 0 0 0 0 0 0 0 0 0ht au hglot ul-eh nipsu -S -S0-S0-S0-S0-S0-S0-S0-S0-S0-S0-S:etm-psyhsryhmo R R R R R R R R R R R R oO-’oteefteyh D S S S S S S S S S S S S N 2h p mermht 'p3WSGR Docket No.61382-729.601 7 M3.4 E 07.3 80 S 1 1.3.28.41.5 20 0- S R g M3.5 6 1 8 7S v2.6.62.00.05.9.15 E 2.1.2.2.1.3 A0-52 -4-5-2-9- 02 S 1 0 0- S R g2.9.4.2.22. . .5.1.0.v1.1 - 5 6 3.M9 4 6S51 7 3 5 6 5 E A 02 S 7 5 5 8 7 7- - - -3- 0 0- S R g M4.9.3.3 3 8S8 0.1.1.0.0 0. . .v.9 1 7 21.5 E 1 2 4 2 1 5 A0-3-2-2-1- 8 02 S 0 0- SelR g0.6.7.1.7.cieM3.1.S v0.3 1 6 8 6 l 54 E7.76.9.9.1 2elA 07-8-7-5-5-heci02 S 7 2 6 1 1ciheV he0otV 0-VotSo9 3t9 M7.08.1.6.5.5.e eR g S v2. . .5053.00. .3ev 40 E S 1 2 4 5 9 7vitviA -2- 12- 6 3it20atalaleele0- R SR Rn R g1.2.0.9.3 n8o M8 6 8o S v0- 6 7 2.28.5 i 4. . .t2 E 9 4 55.85.85.7itA5a -2-3-L T a 0 Prt2 S)r0 nde tn Ge ec0- S uncn M5.3 2.N no R g S v7.9.83.1.57.8.3ito 82 E 0.58.85.42.9 1 nC0 S 1 1A CA0-1-9-1- 1 2 3 20m3oc(L0-u L TrTeP 0 P S R gv0.2.0.8.6.1.SG M0.3.8.4.9.9 1eG S 3 7 N A 03- 32- 42 94niN 23 E 8. lS 4 5 4 5 8 b AeA 0 h 20 ahgn m0a u - T muhrS e R g6 1 9 7 re4 M 3 E3.88.14.42.37.5.4 2CSS v. . . .0A0.-55 S0 S 3tni57 2 -2-3-5- .2ni2 e 0neg0-ecg n S n a R g4.2.5.0.8reah 8 M7.7.5.3.9.00.h S v8.8 5 2 2.A0-50 C -2-5-1- 53P.Ct5 E 6 S 8 0 3 3 1 1tn 0 n 01 e ec 0celre0-reS P 3 M5.2.6.0.8.P4 4 5 2 45 E 9 6 8 5 10.1 0b R gv3. .4.9. . .0 S 1a S T A0-71 2 1 -6-7-4-2- 20 0- S R g2.4.5.S v2.50- 363. .1 8 6 3 M8 5 9.7.4.A -3-1- 1 E. .9.9 3 0 S 8 9 3 1 1 1 S B P g y v 0 0 0 0 0 0 a ADy4- 7 41 12 8 5 d 2 3 utS ya D y47 4 1 8 5 d - 1 2 2 3 utSWSGR Docket No.61382-729.601 es)'U U U U U U U U A -’ot-e;ea3 B-'AACACACACAC AAAA2st oGG G G G GAAGAotreni ahtsre5(U UAUAUAUAUAU UG GAACACACACAC A Asr fed rirpsregec GG AAG G G G GGGGG CACACACACGeAGAfe- ”fulo yhfernen se C C su AC AAAC AAC AAC AGC C C AAACACr’3- U“htp e'-3")n aq C CGCACACGCG A A”ae; -g Pe S CGAA A A A GCGCG“ ni eA GG CA G CA G CA G CA G CC C A GA G;et m- eTU U U U U U U Utd-a5ni (aitOh-lm"hy psc -’2psy ohy;the.)tta’’ootothpe -h’’:4 5 6 6 hpsrsr-’m-dic ps’’Q O 1 1 1 1 71 81 41 4- efe3OaoV E SDIN 1 1 1 1 1 1 1 11’3-ef-e-’ chrern”eri”ni2 iel'p3-o,’sC o“gd “irot csunes’’’’)'n3e;et ;eutlyreflo obirV -' a5(gaaaa aac aaaaa ag daaahaphh pte er n”iny,x’’’’egcacdaggoccgc cgacac gacggag os satohohm- tooO“ er edVgaa a1 gcgagca c1sraefp'- p-’-’;etaht- iD,’V C g e gacarufuc afufacaucgcgg gger3-e3-2h eot psL'-ci2', alu utA C CfufufufC C C Auf ”nn ol 1A Aisissrhcca otmrufgfgrtU g UfgUgf fgUfaUfaf“.o neoenfpyco aer-’asfafafUr FafafafU gfU gfw ordalu g”u3-eot e,.sfegsSreGcAcAeigancaca AcAcAacGacGc eyhtot “;enidrer .ef")(ccacsasacacacasas ccacmas esretair erhulrBekdesssaasgusugs sugsgsusugsuascsuas emh- ftO'- er”psy oh"t)A eT-d(n"ilutsP ufo2n- h oGp- m-T(;eat aio mni“;e ’3-5 "o;e ahvpdviulmtae hnvDI:ocA-pit tsr aosione’n QO 1 2 2 22 32 42 91 52sd h 9 0 1th2oirefeht 'p 3siE N 1 1 1 1 1 1 1 1tSgio nr thuror3-ii stsrp-’ot”o Thdictadei ef3se -e re“; psoac )esA U U U U nrec A"ni fer etahieotsne UCC A A A A A Aodu u UGGG GCGCGCGCGU UCUC GUGet1ad "ity”hp Ups-’l3cucnalasqe A A GGGGGGGGA Aac;e c“oocgecS)'CA A UGCAAAAAAAACA A UCUol tayx;ehttpsr ises3- C U GCGCGCGCC C ha ro UGCU U U UCUTGTGsip oe ah'-3efba cna'eB5(GG GU U U G G. sd UUUUGUGCGUGG G Oo-’ps-eer lA oNu e UGG diC CGGUGUGUGUUUUU h C C CGCGNp-2onohid”s“nilaUC UCGCG G G CG G UG UG UG UUC C CU CD3- tp s-’iru;noGqeu C U UsG U U U U C CIe r3 U U U U U U U U Qn Ei ef-eoi ehtaer,.hg.Ssoer”nist- ht2 ps - eL(A D niNI:2 3 4 4 5 6 7 7anetdCo- norohlyyteiR QO 0 0 0 0 0 0 0 0r ad eyx“a; uoptgulif-’eco msE N 1 1 1 1 1 1 1 1cSa) foe eodtayx'- 3- a- - hoe2eniNgnita(e’c2 psod-pn’otsdicilc eg geothpr- 2oem feyycratLsgsgsgsusr ’3t r htyaoag g gsgscscsqeef -sr"fxtotdcseggs s sis g acacacag gs ere ucusasag”nief3oesredelfa su uid)'uagcg g g uu ufgufug ugnid dAditer”U"d ;-’ ferpu 3 g gfuGfg g n G G Gufufo“ y;cGeo -'ueordta2o"ot )c c5fuf(G GufufufuUfU G p c Gc setaou“;h epssrAsiMe.rcfufUafUafafaf fCfCrrhlo ps f-’taoehhferN-eTcn1utC cafUafC1u UgC C Cag gaga faUf co Ueh2 psp'-3” ("e; u q u Ca ag g g g u uhtp u guuef)ca a;-’otsohp-eTdlrt“eta esS ac ag)c)cCc c4b ec )Ac)c) .73-erefe-’n3id;eh psesadfiuUfA A C u gN NcAN- TT-T- 75nisr-irt”eanenuhohsT Guu cug-cT-(T(N-(fT(gT(5ofg 00neCisoihpspd o'- eis u u f gsfg g T(Cuucuuc_ uda“o ;enat-2h3-p-efid Cc cgs uUcgcsg usfgsg gsfsfM Ntorotaul-’hgnoyh3-io nmUfsfsfsuUsCuUsCspu s uUsu uirlfprtucs-s’ooue eneidh acan2hplfm- dir -daiErott-’-’O 32'- ulyca ;rensare-eonts2othtceiem DfI:meridi resrm-lcousi- QO 80 9 E N 1 0 0 1 1 0 1 1 1 2 3 3 u 1 11 11 11 11h ”f tyfer efer5- nlS)SotAcle“y” oro hf "oniA vit;etateG“3 ; u"ulfnN - oG tenalgo rit2 0 0 0 0 0 2 2eh rpsm- eOta;eht’a2 erh(t-dic ais71 6 6 6 6 6 7 7so-’To 1 72 72 72 72 72 11 11ih2 psh pots sLacP nop it-’otohoreis3- sf cil ierp-’hp-ercylccu oenef3’”fan pis e-e3- TolD 6 8 5 8 1 2 4 5teor”niI10 1 5 5 4 4 6 6gse n“tsocx 0 00 91 9 0 0 0 0rnae cd“oindir;eteareylg l 0 p0- 0 0- 0 1 0- 0 2 0- 0 2 2 2t0- 0 0- 0 0- 0 0- eal;htyehtaauufhglorh opesr -eo")niu S S S S S S S S R R R:tepsyuhAdiD S S S R S R S R S R S R Setom- ohtelf-’p- - Tmy N Oh p m 2’3("htWSGR Docket No.61382-729.601 96.494. .479. .994. .47.8.864.11- 92 46- 12 46- 21 45- 7 44- 02 4 55.486.4.983.4.373. .232. .991.12- 816- 527- 21 46- 31 44- 81 4 147.4.540.8.049.6.442.5.1 8.4.511- 016- 727- 316- 11 45- 61 4 72.190.4.417.4.794.4.34.44.492.13- 428- 617- 617- 85- 12 4 31.41 85.3 - 21 4.026.8 - 41 4.92 8.-69 4.24 7.-29 4.437.6 - 41 4 9.19 53.1 - 81 4.277.8 - 01 4.438.8 - 11 4.171.7 - 11 4.317.6 - 02 4 5.58 34. .8.0.0.03- 31 4 1 9.-86 4 9 8.-05 4 2 8.-1 69 4 9.6 - 51 4eso 8.57 4.8.2.5.8.9 8.3 4 4 3 9.75 4 0 9.05 4 4.09 4 1 5 4D- - - -8-7- 1erP1.17 67. .4.7.8.9 6.1 - 41 4 3 9.-94 4 0 9.14 4 3 8.18 4 1 7 51 41- - -ya 46.7 00. .5- 6. .9.9.8 4.3 4 3195 4 1 9.82 4 5 8.38 4 1 8 4D- - -7- 1otev y 7.0.5 5.ita 5 16 9.4 9.6 8. .01 84 4 59.-3 4 29.-2 4 58.-9 4 5771 4aD-lyed utR S 05. .6 0.3.2. .2 5.7.1.7.9. .0 4. .6 2. .1 4. .5)5 9 94 4 69- 3 4 43- 43 4 42- 8 4 39- 2 4 02- 53 4 33- 02 4 68- 01 4 27- 12 4a(PL34.4 33.-23 4.36 9.-52 4.288.4 - 22 4.622.3 - 11 4.73 9.-81 4.649.3 - 92 4.119.3 - 51 4.460. .88- 0 49.1 47- 51 4mure6.8.3.2.8.4.5.93 90.2 7 4 6.12 4 66.7 4 0.26 4 2.5 53 4 5.6 4 58.0 4.841.1 4.914.7 4S- 39-5- 14-9-3- 23- 28- 17- 1nie9g 27. .8 9.2. .8 1. .8 5.5. .5 4. .3 9. .3.1 61 4 48n9.-1 4 74- 02 4 43- 31 4 8 -18.5 4 02- 14 4 43- 22 4 018- 21 4 9.56- 41 4ah C 20. .3 6.t26- 2 15.9.0.3 6.4.3 6.20.5.0.6 0. .9 5. .2 9. .62 49- 2 45- 71 44- 01 48- 7 43- 93 4 33- 12 4 37- 51 4 06- 81 4necr.e571 33.2 42 4.63 8.23 4.584.4 11 4.11 4.79 4.880.6 11 4.719.3 52 4.995.2 71 4.986.5 91 4.715.4 91 4P- - - - - - - - -.211.4.8.9.4.5.1.2.1 22.1 9 2.170.8.101.9.1.4 3. .8 1.2 466 4 4 4 2 4 0 4 9 6 4 8 3 4 9 5 4 3 2 4el - -2- 12-5- 11- 31- 13- 23- 1baT 88.5.0 1.5. .8 2.2. .5 1. .4 9. .4 1.7.1 - 02 4 904.-8 4 12- 21 4 2 -11.9 4 72- 01 4 71- 72 4 21- 12 4 2 -02.7 4 0 -22.9 4 49.8.-821 45.962.-4 46.142.4.-4 4 251.1.-2 4 142.8.-6 4 1.1 4.2 - 9 52.7.28.0.05.1 41- 7 41- 6 42- 8 4 10.00.0 40.00.0 40.00.0 40.00.0 40.00.0 40.00.0 40.00.0 40.00.0 40.00.0 4 citsna na na na na na na na n ite D e D D D D D D D a D atS N S N e S N e S N e S N e S N e S N e S N e S N S M M M M M M M M M e g skg k g k g k g k g k g k g k g o / g / g / g / g / g / g / g / gk / g Dm1m1m1m1m1m1m1m1m1 ye- 8 - 5 - 8 6 1 2 4 5 dy n S10 S59 S5 - 9 S1 -S4 -S4 -S6 -S6 utaila R0 R1 R1 R00 R02 R02 R02 R02 S D S S00 S00 S00 S00 S00 S00 S00 S00WSGR Docket No.61382-729.601 )'3 A A A A A A A A -’;et -’- -'G G G G G G G Ga3O 5(A A A A A A A A2h -e-’ reC C C C C C C Cotpsni2 cio c A A A A A A A Asro-’dotsa cne G G G G G G G Geu G G G G G G G Gfh ep3irul sbaA N q U U U U U U U Ur -’-”eyrea3- nisht fe-’ lolnae S A esAAA AAA AAA AAA AAA AAA AAA e AA“er 3iG; nio”tono,.g a U GU GU GU GU GU GU GU Gednam-“ t .BG G G G G G G GtaityuO;esrer e(reG G G G G G G G hc gl-’taefht- C C C C C C C Cpsoy2herLytg n A A A A A A A A othtesC C C C C C C C hpsr eot pss ” leiros“yto s C C C C C C C C -’efm-ma A A A A A A A A 3erOefh P U U U U U U U U -eepe-’;e ca- g nin”-’ risC2”3tau-ehNtceg o“ot “ nips iraQ:E SDIO 41 41 41 41 41 41 41 41ne;eN 1 1 1 1 1 1 1 1 dtaasr;heeftd airohlctpyhul '-caop aottseor”psy3 oht)e-eotd 'srhel3'epg -a a a a a a a a fe'- “hp 3;e-’m-nisdre5i fp e5ruo(gagegaggaggag g g gr-gagaga a ” etnah3- m eoty h" c)sidaoca a a a agagaAisacacacacacac c “opsonidsr toi cAecC g e g gg gg gg gg gag gag gg.wnehirefh dp- rufu’u ert-Nn2- Teu AfuAfuAfuAfuAfuAfu o ao” - (AfAre ly3-tTyx" qesutecaiufafafafafafafafmhesr“ ;a teniessef;eoetaesdrtU gutSfU gfU gfU gfU gfU gfU gfU gf sem- oertad h-'h psnerseGcGcGcGcGcGcGcGchtfO'n-a ”gaca 2ugUp“s2ootoshdeioneccaccaccaccaccaccacccon-oo h p t;epsr '-3fid ssas s s s s s ssasasasasasasasmnisrta 'h-3efe-eovi sa u u u u u u u uulmefvPocp -e r"nimtA-er sohnid3 h Tnecan h2i:gio”t Gp'- irudd "a-En Q 9 9 9 9 9 9 9r sr“;3- oi;edi ;riE SDIO 1 1 1 1 1 1 1 91sN 1 1 1 1 1 1 1 1ti ef eteneanhti t- ahca emdoresd"hpsso2- copsieosi)'G G G G G G G Get1aon a";hil rolpyoh hulfpc --’uS n)u 3 U U U U U U U Gcoe-’te '- 3loAs-e'G G G G G G G Ul ta3c- m 2 -eniN 5(C C C C C C C Gsih pe -otninG(neec C C C C C C C C. sniO n A A A A A A A C Oohdu e U U U T U U U ANp-it '-y 2sredio femerdiyht-cau UC CUCUCUCUC CTC 3cotr ht cqq GUG G G G GUGee As SCAAAAAAAAAAAAAUGDI -eyxsre"fyxL icelesCUC C C C C C AA GCUCUCUCUCUCUC UQn Eisoefe3iUoelc cuA a U T GU GU GU GU GT GC od- r "dyNBG G G G G G G TSnne ’"i;e-’ cn alo U U U Giad 2o"; ta2 oce U C U C U U C Utr aytethottsylRdiC C C Cisu U U U U U U U CeG C C C C C C C Ucxsr apsU U U Cafoeedfh e osrreg-rpshfe pef er ni)U U U U Uo -’ ”oherdia(ec2Cp'-3”")notd- Q“’- T 3edA- myhp:2 7 2 6 2 2 7 7eusLr;-eni“ T(tE SDIO 0 0 0 2 0 0 0 2 N 1 1 1 1 1 1 1 1qeef etand i dssir;ueta";eotsegerinfi ”h pso noih ptarhefidAoah ndhugt- s e2ohpsrdocscscscsc cscsop“;p e - g gs t’y 3x-loyp h- o")’hn 3p'- gM.sa acsg gsgss gsg gss sa err ah-eneidte-e3-eT(" .)u ugsa a au ua ag ug u u u g gocpsod-i’t2 m-nidni;e3)'g gt ’’’13-'gu ufgg g u g g u g g g uuf ehthpycotO'- irulmyah’’’el5f(uG Gf fGfGuf fG G Gc;-4’3-orosr2eoyhht-psoVrbercfcfG CcfcfcfauCcfcf f .C 77enulffertsrtedih t Cc'p o,cafafUCaCaCC3afaf a au T 55iso-’ ”eGfme- 5a ’c3-’’T urU t u u 3 a u T 3 3 u d u d U Uacu 0 a 0ne2otdr -“"orieels’o’V Sac cc ec)acuau cacua c) cc -)Mda sre;e3uoc" uubir ,’’dfcfUT- Ucfcf ccfT-T- Nortoufetah;elf- n ’ly ox’’iu g Gu T(cg g Ug UgUiT(gT(p girlfr p- ”f stoah2o nioneVd ,’usfucucu uuscuf ucussfucsfuuscfuusccs ’Chpf u n2ot“;p-s t’oshroieerD h'- ValCsfuCsCssfarts et3- pfet-2,'u u uCsuCsCusuCsuCsruna e af hen-’ri 3-”fL 1 mot ro meps se uroo h”fhnaniTcid“ l;cysr Fe,.g Ap- uir e cfe.eQ:otE O 80 31 82 92 03 13 2 3e“’3gutav;e-eororhaotr")(reSDIN 1 1 1 1 1 1 31 31italtaoops sBk ehnirpdu itlfu -lfo - hrepfeAndiltens si oy’ ’h -’r(ago pcl22yotot3- ")";eairit2 2 2 2 2 2 2 2 n i 7 7 7 7 7 7 7 7 oit-’hte s eTrsr ni -tavhd as1 To 1 11 11 11 11 11 11 11iPs3- e edT(noe pnm-fefeir" ps e’eioOr r ul;eo ts- ”f”fytah36 4g n’e2GUhteoi 'p3-stiDI10 6 1 0 8 2 0 8 6 0 9 8 0 2 3 3 3 5 3 3r3atd x 0 2 2 2 2 2 2 2aot “;e“;em-htdita)el0 0 0 0 0 0 0 0e lhtyhsre p0ftat5orcahah-lohcesu -S0-S0-S0-S0-S0-S0-S0-S:e teerpspsyhpsieoltc D R S R S R S R S R S R S R S RtS omN- ”ooteoc alOc“h ph p mh pu nagWSGR Docket No.61382-729.601 319.1.0 2.0.0 6.9.5.6.1 216.-848.4 - 2 13.-2.-08.68.29.73.1 4754393 45- 31 46- 544- 21 44- 124 95.9 81 3.2 7.8 7.6.7.5.3.0 2.1.3.8.6.-842 4.-742 7.-649 3 - 7241 5 - 41 42 7.-649 3 - 11 43 5 - 41 4 50.8 147.8.-9470.0.4 - 6 51.8.94.7.97.6.52.7.04.4.99.1 47- 344- 0245- 51 47- 544- 845- 74 82.6 0 3 1 6 8 77 527.-74.46.5 - 41 4.907.-44.13.6 - 41 4.39.6 - 21 4.667.-44.47.4 - 01 4.695.-74 16.7 92 0.6.8.3.1.7.8.9.4.7.-74236.-94168.-344 6 - 1 15.-02.-68.-6 1 478 485 44945- 81 4eso 45.6 158.7.3.7.9.6.4.3.5.0.0.8.4.8.9.-544 6 - 944 8 - 242 6 - 21 49 6 - 11 42 8 - 543 4 - 11 47 5 - 51 4D-erP74.15 108.5.6458.2.61 4478.7.3460.1.60 4207.6.7 432.3.3 470.246.96.54y- -1- -1 -8-4- 15- 1aDyaotD03.5 01.44.42.47.29.45.49.42.94.46.25.47.67.0.00.eyd8- 86- 318- 47- 57- 38- 65- 747- 74vtuitS ale32.4 018.-945.49.6 - 01 40.298.1 45.387.349.647.547.138.642.825.846.78.611 4R- - - - - -)a(P 66.9.4.6.1.2 6 43 857.8419.631 4008.24976.44877. .2 4907. .2. .6 47 501 4826.74L- - - - - - - -mure93.2 53.9.2.9.9.5.4.9.8.5.3701 40 581 4527.44776.1 4297.54547.840 51 44.24S- - - - - - -16- 1nieg 28.2 876.2.1.0.-74904.3.-40 7.2 8.9 5.7.9.9.1 427- 3406.-6476.-7407.747401 48511 4n- - -ah Ct57.1 654.4.7481.5.30 413.2.2440.247.34.1.3 489.7.3.8.6.5 421 483 4ne- -15-4- 14-4-2- 23- 1creP.89.28.40.39.42.22.45.85.47.48.45.27.6.1.5.02.42- 31- 92- 011- 311- 72- 94011 42- 01 41elba 10.00.040.00.040.00.040.00.040.00.040.00.40.0.40.0.4T 0 0 0 0 0 citsna na na na na n n n ite D N e D N e D e D e D ae D ae D ae D atM S M S M S N M S N M S N N N N M S S S S M M g esk / g gk / g gk / g gk / g gk / g gk / g k / g k / o g g g Dm5.m m m m m m05.05.05.05.05.05.m05.0 y 6 4 1 2 6 8 3 5 a 10 6 8 8 9 2 3 3 D 0 0 0 2 0 0 2 0 0 2 0 3 3 3 0 20 20 20 2 yd0u-tS0-S0-S0-S0-S0-S0- 0 S0-S S R S R S R S R S R S R S R S R SWSGR Docket No.61382-729.601 )'G G G 3 --’;e'A A A 5(G G G2oottahyteA A Atssr-’pso-eic C C C n A A Areef3- hLo eu G G Gfe-’erep'-lytmg q G G Gre U U U”a3- ”uni3- ecniS A“e“dir ena-tesAA AA; ni-;eul iNg e A A A Aea U U Utd aitOtaydirahy-’hhtmcil tBG G G reG G Gpscoo2 ptos ey t ohm-hcty ao oi ctg C C C h neA A A psrsrp5haodelssC C C -’e3feref-’o a C C C- er3-t ts- 2-tsrpu P A A AeU U U n”isC”ergnieyefocdfex o“ o er s;“; ir r” ed"ieQ:ne eta etauoT'- )c cn EDIO 41 4 1 1 4 dhht “1 11a pspssr;e2A oetN- u S N otsoo )rheftahsrT(qephs'e'perpsefe"; es3f-3-’ ”o -' a a aer-5e3- Uhre (gag “p" et3anhesegaga ”nn dag gAisis;e '-t3- Tdpsd oeiocaacaaca“.o neo naahe"p ni;ehpfi'- do C gg gg gg wdusodirta3 eufufuforalghuh-emsr ueyetA hoicaAaAamtetp s'- oipshohnih ncauf f fas rdrU U Uem-ef3-et- pen2- -’dEa- ;utgtSfgs reGfgfhtOeriso3recGcGc f '-”oro-edim gacacaco 2n-oGn “ilunylf icon di acosvecsc cissasasamnui;metaht'- e2miei- l S)vasususulocA- hm-oty ht cuA Ptps srynNn h2i giooO h'-efxlnr tseorp-eoG ’2 rdnin(diQ:steE O 91 91 91if3ote-e s"f-’oir 32 ercad SDIN 1 1 1 n orni eUohciesd"dfe"et1a; tsrt- elusaU U Uc" itro;eyc"i et e"ahfLce u rcilcnlec)'G G Gl t3sayx;eps ”yn -ihoetaohTco' G G GacU U U.psdhpde5(Oo-’ps '- “; otylsg-eueG G G h c C C CNp-2oh3-et r3otpe ahef nidqen C C C D e A A AI -ensr-’nie3pe- dir sori" mysuq UCUCUCQ e UGU U Eis f eoerniu oih)pA- htASA AGAGS nNesC AC AC Anie ” sCoh-’a Cn t- 3- T(otsR T CT CaTtrdada2e"eyx“;ug-lni;erefisBe G G GcU U Uaoe e)didtayy xhtd eirta eru C C Cf-’h poemulh yps")n G U U Uoe 2sod- - hohga(C C Ccp U U Uneoth’O p us - 2o'- tep 2m- '- T(3" .)Lr:qee’f3-to esrt 5s- -e;eonita’’h’’d Q 7 7 7s ereiEDIO 0 0 0 g”niedfer rrefomyps’’VfS N 1 1 1niidAiterulfhorndyc ”G"-’t- h'p od o“ocscsgcsp;gseetaord3 ou“u2 di;e";eotcsa3-,’ces’’’’M g.sasasarrhlftat reieobV u uog ugcpso-’2hapshfel ircur ,y’’51 )'gg g 3uel-fgeufhthp-’otsopsho”fnlx’o’eV'ufG G;c Gc 4.3-erephpTo f-’-’“ nidi,’b5(aecf fr C Cf7 C 75nie3 sr -e3-;etnD ao'- ValTutafafaf50o”c U Unfneher2, Cisnipht'u 1mu u u U 0eaua_da“od ;enair suo- hL ot ro rtaSccce)c)cfM Norotaugorpco-’ ilsFcre,.diT-T-C)Tt-puh lfpsoroulf3-eycfeg r.euT(Tir- g(fT(cs ’ou-2hlf ’niadot")(reGucG uug scucnarotp-’-’232 otirfuul sBk r AnilCssfusCftnsare-eosC fent si sreyehfed(drefeter "" ;eaaiu usu mur itfer m- )tavh ”ofy t Aclr ”f5T- h pd snee“y”fU“ -lyT("o’Q:3 4 5 v;ehtG;eht ;h3E SDIO 1 3 3 N 1 1 1italta e“ te e 'p steh rpsm-;etataha3p m-oi -diitasoO-’h psoO-’htca )tenoihp2sohp2 or cesgi2 2 2 n-’oth-’oieotrtais71 7 7 oitp3othlccaTo 1 11 11iPs3- s- oe’-spsulpnre3ereonag teisfe- oreni”nidfehpci rsirr” -’saocD 46 8 9grne c0 73 73atd“ou; nl tay“ 3;ot balA Ix 2 el0 20 20eal eh p0tyhtauh glte etasroNle ni au -S0-S0-S:etteh psyhm- h pfsernoG,.D R S R S R S omN- oteO Oh p m-’o”erg.2h ps“hte(WSGR Docket No.61382-729.601 88.1.7 94 5 1.6.-8 4 5.5 - 31 4 68.6 - 42 4 13.7 34.1.2 5.56- 11 4 7.6 - 51 4 5.5 - 23 4 46.6 39 0.2.4.5.7.-5 4 2 6 - 01 4 8 6 - 22 4 73.5 787.9.-5 4 23.1.6.6 - 21 4 7 6 - 52 4es04.5 967.4 44.60.8 43.07.9 4o -6-7- 1D-erPya 37.4 018.4.0.8.1.-5 4 0 7 - 8 4 0 7 32 41 D-y y a d uDtSot68.8.4.3 93.4 86.4 02.5 4e7- 56- 57- 1vitale4 7R 9.2 457.7 4.46.2.6 4 40.1 4) -6-6- 2a(PL26.2 95.1.8 4 30.0 46.49.6 4m5-5- 15- 2ureSni51.1 084.1.8.4.4.7 4 9 2 01 4 1 3 02 4e - - -gnah Ct88.48.9 3.5.1 - 31 4.3 - 51 46.1 41 4necre10.0.40.0.40.0.4P 0 0 0 0 0 0.61elcibtsn n naita D a D a D a e t N e N e N M S M S M ST S g esk / g k / g k / o g g g Dm5.m05.m05.0 y 4 8 9 a 6 D 0 7 7 2 3 3 0 2 2 y00 0 0 d u -tS -S0-S S R S R S R SWSGR Docket No.61382-729.601 -'5 U C C C C U U U U U U;e(A U U U U A -’taec U C A A A A A C C C U U U U A G2otothytn G U U U U G G G G G G e A U U U U A A G A A Assr-’pso-Leio uq C A A A A C C C C C Creef3- hle A U U U U A A A A A Afe-’erep'- ytmg Ses)'GAGAGAGAGAGAGAGrAGAGAGA”a3- ”ni3 e ue“di -e canita 3 G GCA A A A G UCGCGCGCGGCG GCG GCG GCG GCG GC“; ni-;e rulni - eg B A A AA AA AA AA UA UA UA UA UA Ued G G G GtaittyO-’ ahyhdiNrmci atreA A A A A A A A G G G G A hc 2 psteylcag A A A A A neA G G G G A A A A A ApsooomU A A A A U U U U U ohts th-htyoi co atd ssU U A A A A U U U U prsrp-’5ohtot ela U U C A A A A C C C C C C -’efefG3 t-srp P3-eerer -sr2- u G A C C C G G G G G ee on”Q:i”sCgniedfy erxfoeer csi1 2 3 3 3 1 1 4 1 5 6 o“; “;EDO5 5 5 5 5 5 5 5 5 5 5ne eteirt”d"auT'- )cecSIN 1 1 1 1 1 1 1 1 1 1 1 daah pho spst “sr;e2AnoetN- u os)'tsohoheftearhsrefT(qe"s3ea a a a rp'pps; esi-'a5cad(u g euaag g gcacaucaucuacuacauceufer-3--’3”-Uoher" etaneucacacucucucucuauauauaua ua ” enen“;p3h e'- Tpssdtd u o gsCauoe cuu u u u u u u gagag uag gag g Aiagsia “osota3-ed"oheifiraf auauuauuaucaf caf cacacfaf ca.fwnenahpsnid;etp'- doviutGf f f fcgfGaG G G G g Gfd g G G g GogG grealuoir ah3 ygohpups-emhvurGfaCfaCfaCfCfGfgGf f f fG G G G mhtetsr '- o3ihntohincantaiSfaerAfaGfaGfaGfaGfafafafafa as - -peEAf em-efen2- -’d;eaagg gg gg g A gaA A A aaaaaaaaA aaahtO'- er”isoor3- a-edirecg ui eaaaaaaaau u u u u uf2- noun cm nussususususususooGillf i aosmscassasgsasasaascscsccsgcsgcsgcsgcsgcsn“y g mnui;eh'- di cil mtate2mie -S otylc )ciPoctA- hm2 ps -OshrtuA eynlNneQ:h DO75 85 95 95 95 75 75 06 75 16 26gio rtoh'- fsp2ex roeo dniG(gsE SIN 1 1 1 1 1 1 1 1 1 1 1snt r-’oi ef3t"f-’nodianer-e sre32 coer acrC U G G G C A A C A Ao"nidfeU" tht-ietG U U U U C C G C C d1aitr ;esrL lcn)'Gi3 A U U U U A G G A G Get" y-'A U U U U A A A A A Aac;e c"itaefciu y"herlcnld5(U C C C C U A A U A A ol tax;eps ”yeU C C C C U U UsihoetaohTcoacys eU U U c U C C C C U U U U U U.psdhpdu n“e U U U U U U Ooh-’ps '- ;eot lsg-esu C G G G G U U U U U q C U U U U C U U C U U C C C C C CNp-2oh3- t3otpenahref nidece S CACACACACA A CA DI - s -’ ipe iA A A A AC AC AC A AC AC AeneeU A A A A nr3dir srm s U C C U C C Q G U U U U a G U U G U U Eisef-eU A A A A T G G U G GSoerniuo oih")y pA- htuBC A A A A C C C C U U niane ” sdCoh-’nt- 3- T(o"tsqeediA G G G G A A A A C C U A A A A U U U U U Utr ad eyx“a; u2 g-l eyni;ertefsueG A G G G G A A A A A AcA U U U U A A A A A AaA G C C C C G G G G G Gfoe edtayhdihxte r aulhrp")U U U U U U U U U U Uo -Ne’psoec2odm- yshong h-’OtehpT(RisQ:neotp2'-'- 6 7 8 8 8 9 0 0 6 1 1 usr- Ee’o2 m3 to- 3"5- -e;e.t)’’3 SDIO3 3 3 3 3 3 4 4 3 4 4qN 1 1 1 1 1 1 1 1 1 1 1esfge-resrte srorni ah’’’C”ni fefomps ’noidi ereulyhoVpa ...
Claims
WSGR Docket No.61382-729.601 CLAIMS WHAT IS CLAIMED IS:
1. An inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a nucleotide analogue selected from a group consisting of acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T- T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L- threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i). 2 An inhibitory polynucleic acid molecule comprising a passenger strand (sense strand) and a guide strand (antisense strand), wherein the guide strand comprises a formula: 5’- (A)n1-(B)n2-(C)n3-(D)n4-(E)n5-3’ wherein A comprises one or more nucleotides selected from 2′-O-alkyl modified nucleotide, 2′- alkoxy modified nucleotide, 2′- alkyl modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, and n1 is 1-7; B comprises one or more nucleotide analogue selected from a group consisting of acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine- 3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i), and n2 is 1-5; C is selected from DNA, RNA, 2′-O-alkyl modified nucleotide and 2′-halo modified nucleotide and consists of nucleotides with unmodified or same modification, and n3 is 0-6; D is selected from 2′-O-alkyl modified nucleotide and 2′-halo modified nucleotide and comprises nucleotides that are differently modified from their adjacent nucleotides, and n4 is 4- 8; and E is selected from 2′-O-alkyl modified nucleotide, 2′-alkoxy modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, UNA, and n5 is 3-10.WSGR Docket No.61382-729.6013. The inhibitory polynucleic acid molecule of claim 1 or claim 2, wherein the inhibitory polynucleic acid molecule is an siRNA.
4. The inhibitory polynucleic acid molecule of any one of claims 1-3, wherein the nucleotide analogue is located at the seed region of the guide strand (positions 2-8) from the 5’ end.
5. The inhibitory polynucleic acid molecule of any one of claims 1-4, wherein the nucleotide analogue is located at any one of positions 4-8 from the 5’ end of the guide strand. 6 The inhibitory polynucleic acid molecule of any one of claims 1-5, wherein the nucleotide analogue is located at any one of positions 5-8 from the 5’ end of the guide strand. 7 The inhibitory polynucleic acid molecule of any one of claims 1-6, wherein the nucleotide analogue is located at any one of positions 6-8 from the 5’ end of the guide strand. 8 The inhibitory polynucleic acid molecule of any one of claims 1-7, wherein the nucleotide analogue is located at position 6 from the 5’ end of the guide strand. 9 The inhibitory polynucleic acid molecule of any one of claims 1-8, wherein the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 7, 12, 14, 16 from the 5’ end. 10 The inhibitory polynucleic acid molecule of any one of claims 1-9, wherein the nucleotide analogue is located at position 6 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end. 11 The inhibitory polynucleic acid molecule of any one of claims 1-7, wherein the nucleotide analogue is located at position 7 from the 5’ end of the guide strand from the 5’ end. 12 The inhibitory polynucleic acid molecule of any one of claims 1-7 and 11, wherein the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 12, 14, and 16 from the 5’ end. 13 The inhibitory polynucleic acid molecule of any one of claims 1-7 and 11-12, wherein the nucleotide analogue is located at position 7 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 12, 14, and 16 from the 5’ end.WSGR Docket No.61382-729.60114. The inhibitory polynucleic acid molecule of any one of claims 1-7, wherein the nucleotide analogue is located at position 8 from the 5’ end of the guide strand.
15. The inhibitory polynucleic acid molecule of any one of claims 1-7 and 14, wherein the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at at least three of positions 2, 7, 12, 14, and 16 from the 5’ end.
16. The inhibitory polynucleic acid molecule of any one of claims 1-7 and 14-15, wherein the nucleotide analogue is located at position 8 from the 5’ end of the guide strand, and the guide strand comprises 2’-F modified nucleotides at positions 2, 7, 12, 14, and 16 from the 5’ end.
17. The inhibitory polynucleic acid molecule of any one of claims 1-16, wherein the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide are selected from DNA , RNA, and 2′-O-alkyl modified nucleotide.
18. The inhibitory polynucleic acid molecule of any one of claims 1-17, wherein the nucleotides of the guide strand that are not the nucleotide analogue or 2’-F modified nucleotide are 2’-O- methyl modified nucleotides.
19. The inhibitory polynucleic acid molecule of any one of claims 1-18, wherein the guide strand comprises at least two, at least three, or at least four phosphorothioate modified internucleotide linkages.
20. The inhibitory polynucleic acid molecule of any one of claims 1-19, wherein the guide strand comprises two phosphorothioate modified internucleotide linkages at the 5’end and two phosphorothioate modified internucleotide linkages at the 3’ end.
21. The inhibitory polynucleic acid molecule of any one of claims 1-20, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmXFmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S- isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).WSGR Docket No.61382-729.60122. The inhibitory polynucleic acid molecule of any one of claims 1-21, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T- A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
23. The inhibitory polynucleic acid molecule of any one of claims 1-20, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmmXmmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S- isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).
24. The inhibitory polynucleic acid molecule of any one of claims 1-20 or 23, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmXmmmmFmFmFmmmmmsmsm- 3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T- T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
25. The inhibitory polynucleic acid molecule of any one of claims 1-20, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmmFXmmmFmFmFmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-WSGR Docket No.61382-729.601 isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).
26. The inhibitory polynucleic acid molecule of any one of claims 1-20 or 25, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmFXmmmFmFmFmmmmmsmsm- 3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic L-threoninol nucleic acid-thymine-3'-phosphate (T- T), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'- Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’- O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
27. The inhibitory polynucleic acid molecule of any one of claims 1-26, wherein the passenger strand comprises at least two, at least three, or at least four 2’-F modified nucleotides.
28. The inhibitory polynucleic acid molecule of any one of claims 1-27, wherein the passenger strand comprises three 2’-F modified nucleotides.
29. The inhibitory polynucleic acid molecule of any one of claims 1-28, wherein the passenger strand comprises 2’-F modified nucleotides at at least one of positions 7, 9, and 11 from the 5’ end.
30. The inhibitory polynucleic acid molecule of any one of claims 1-29, wherein the passenger strand comprises 2’-F modified nucleotides at positions 7, 9, and 11 from the 5’ end.
31. The inhibitory polynucleic acid molecule of any one of claims 1-30, wherein the nucleotides in the passenger strand that are not 2’-F modified nucleotide are any one of 2′-O-alkyl modified nucleotide, 2′-alkoxy modified nucleotide, 2′-halo modified nucleotide, DNA, RNA, ENA, BNA, LNA, and UNA.
32. The inhibitory polynucleic acid molecule of any one of claims 1-31, wherein the nucleotides in the passenger strand that are not 2’-F modified nucleotide are 2’-O-methyl modified nucleotides.
33. The inhibitory polynucleic acid molecule of any one of claims 1-32, wherein the passenger strand comprises at least one phosphorothioate modified internucleotide linkage.WSGR Docket No.61382-729.60134. The inhibitory polynucleic acid molecule of any one of claims 1-33, wherein the passenger strand comprises at least one phosphorothioate modified internucleotide linkage at the 5’ end.
35. The inhibitory polynucleic acid molecule of any one of claims 1-34, wherein the passenger strand comprises two phosphorothioate modified internucleotide linkage at the 5’ end.
36. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmXFmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’-mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O- methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine- 3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
37. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmXFmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L-threoninol nucleic acid-thymine-3’-phosphate (T-T), acyclic L-threoninol nucleic acid- adenine-3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3’phosphate (T- NAc), 1’,2’-Dideoxyribose-3’-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S- isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’- phosphate (U3f), 2'-deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'- phosphate (i).
38. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmmXmmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’-mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O- methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine- 3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).WSGR Docket No.61382-729.60139. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmXmmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N- acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'- phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
40. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-mFmmmmFXmmmFmFmFmmmmmmm-3’, and the passenger strand comprises 5’-mmmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O- methyl modified nucleotide, F is 2’-F modified nucleotide, and X is selected from acyclic L- threoninol nucleic acid-thymine-3'-phosphate (T-T), acyclic L-threoninol nucleic acid-adenine- 3’-phosphate (T-A), acyclic N-acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’-phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'- deoxy-2-thiothymidine-3'-phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
41. The inhibitory polynucleic acid molecule of any one of claims 1-35, wherein the guide strand comprises a nucleic acid sequence of 5’-msFsmmmmFXmmmFmFmFmmmmmsmsm-3’, and the passenger strand comprises 5’-msmsmmmmFmFmFmmmmmmmmmm-3’, wherein m is 2’-O-methyl modified nucleotide, F is 2’-F modified nucleotide, s is phosphorothioate internucleotide linkage, and X is selected from acyclic L-threoninol nucleic acid-thymine-3'- phosphate (T-T), acyclic L-threoninol nucleic acid-adenine-3’-phosphate (T-A), acyclic N- acetyl L-threoninol abasic nucleic acid-3'phosphate (T-NAc), 1',2'-Dideoxyribose-3'-phosphate (dAB), thymidine-glycol nucleic acid (GNA) S-isomer (Tgn), 2’-O-methyl-2-thiouridine-3’- phosphate (u3), 2’-fluoro-2-thiouridine-3’-phosphate (U3f), 2'-deoxy-2-thiothymidine-3'- phosphate (dT3), and 2'-O-methylinosine-3'-phosphate (i).
42. The inhibitory polynucleic acid molecule of any one of claims 1-41, wherein the passenger strand is conjugated with a targeting moiety.WSGR Docket No.61382-729.60143. The inhibitory polynucleic acid molecule of claim 42, wherein the targeting moiety is an asialoglycoprotein receptor targeting moiety.
44. The polynucleic acid molecule conjugate of claim 43, wherein the asialoglycoprotein receptor targeting moiety comprises N-Acetylgalactosamine (GalNAc) or galactose.
45. The inhibitory polynucleic acid molecule of claim 43 or 44, wherein the targeting moiety is conjugated via a linker.
46. The inhibitory polynucleic acid molecule of claim 45, wherein the linker comprises formula (IV) below,, wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule.
47. The polynucleic acid molecule conjugate of claim 46, wherein the linker and the asialoglycoprotein receptor targeting moiety with the last nucleotide on the 3’ end of the passenger strand of the polynucleic acid molecule are shown in:WSGR Docket No.61382-729.601Z in formula (V’), (V’’’’), (V’’’’’), or (V’’’’’’) is -H, -OH, -O-Methyl, -F, or -O-methoxyethyl, and R in formula (V’), (V’’’’), (V’’’’’), or (V’’’’’’) is adenine, uracil, guanine, cytosine, thymine, abasic, or others.
48. A method of modulating mRNA expression or protein expression level of a target gene in a cell or a subject in need thereof, comprising: contacting the cell or administering to the subject theWSGR Docket No.61382-729.601 inhibitory polynucleic acid molecule of any one of claims 1-47, thereby modulating the mRNA expression or protein expression level of a target gene in the subject.
49. A method for suppressing off-target effects caused by a guide strand of an inhibitory polynucleic acid molecule in a cell, comprising introducing the inhibitory polynucleic acid molecule of any one of claims 1-47 to the cell.
Citation Information
Patent Citations
SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US20190316127A1
Microtubule associated protein TAU (MAPT) irna agent compositions and methods of use thereof
WO2023049871A2