Gene point mutation mouse model construction method
By designing sgRNA and ssODN to target T274M mutations on Kcnq2 Exon6, using CRISPR/Cas9 technology to microinject Cas9 protein and ssODN, a stable and repeatable Kcnq2T274M/+ point mutant mouse model was constructed, solving the problem of poor model stability and repeatability in the prior art, and achieving efficient preparation of positive mice.
Patent Information
- Application Number
- PCT/CN2023/141592
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-25
- Publication Date
- 2025-07-03
AI Technical Summary
In the prior art, the stability and repeatability of the Kcnq2-T274M mouse model using ES cell targeting technology are poor, and it is difficult to obtain a sufficient number of positive mice.
The Cas9 protein containing azide non-natural amino acids, DBCO modified ssODN and screened sgRNA were used to design sgRNA and ssODN to target T274M mutations on Kcnq2 Exon6 through microinjection technology, and the Kcnq2T274M/+ point mutation mouse model was constructed using CRISPR/Cas9 technology.
Improve editing efficiency and enable the preparation of a larger number of Kcnq2T274M/+ point mutant mice, ensuring the stability and repeatability of the model.
Smart Images

Figure CN2023141592_03072025_PF_FP_ABST
Abstract
Description
A method for constructing a gene point mutation mouse model Technical Field
[0001] The present application belongs to the field of transgenic technology, and particularly relates to a method for constructing a gene point mutation mouse model. Background Art
[0002] CRISPR / Cas9 is a technology that uses the Cas9 nuclease to edit targeted genes, guided by a small guide RNA (sgRNA). The CRISPR / Cas9 mechanism works by base-pairing crRNA (CRISPR-derived RNA) with tracrRNA (trans-activating crRNA) to form a tracrRNA / crRNA complex. This complex guides the Cas9 protein to cleave double-stranded DNA at the target sequence paired with the crRNA. By artificially designing the crRNA and tracrRNA, the sgRNA acts as a guide, directing the Cas9 protein to cleave DNA at the targeted site, creating a blunt-ended double-stranded DNA nick. This in turn triggers DNA repair, primarily by connecting upstream and downstream sequences via NHEJ (nonhomologous end joining) or HR (homologous recombination). The widespread adoption of CRISPR / Cas9 technology has made the generation of mouse models for gene point mutations simple and accessible. For example, the Kcnq2-T274M knock-in mouse constructed by Milh et al. in 2019 exhibits spontaneous epilepsy in heterozygous individuals. However, because this model uses ES cell (embryonic stem cell) targeting technology, the number of positive mice obtained is not stable and the reproducibility is poor.
[0003] Summary of the Invention
[0004] The present application provides a method for constructing a gene point mutation mouse model, which aims to solve at least one of the above-mentioned technical problems in the prior art to a certain extent.
[0005] In order to solve the above problems, this application provides the following technical solutions:
[0006] A method for constructing a gene point mutation mouse model, comprising:
[0007] sgRNA and ssODN were designed targeting the T274M mutation on Kcnq2 Exon6;
[0008] Female mice of a set age were selected as egg donors. After a certain dose of PMSG and hCG was injected into the peritoneal cavity of the female mice, they were mated with male mice, and fertilized eggs were collected from the mated female mice.
[0009] Injecting Cas9 protein, ssODN and sgRNA into the pronucleus of the fertilized egg by microinjection technology, transplanting the injected fertilized egg into the ampulla of the oviduct of a surrogate mouse, and obtaining offspring after the surrogate mouse gives birth;
[0010] According to the site of the Kcnq2 gene point mutation, a pair of identification primers F1 and R1 were designed at both ends of the mutation site, and the pups were identified to screen out Kcnq2 with the T274M mutation successfully knocked in. T274M / + Point mutation mice.
[0011] The technical solution adopted in the embodiment of the present application also includes: the sgRNA and ssODN are designed with the T274M mutation on Kcnq2 Exon6 as the target, specifically:
[0012] Design sgRNA: CCCGTAGCCAATG GTCGTCA, and use SpCas9 to detect sgRNA;
[0013] ssODN was designed: GCCCAAGTAACCAGAGCCCCTTACCCCTCAGATCATGCTGA CGACC ATTGGCTACGG GGACAAGTACCCTCA, and c.821C>T,822 C>G leading to p.AThr274Met mutation was introduced after homologous recombination.
[0014] The technical solution adopted in the embodiment of the present application also includes: selecting female mice of a set age as egg donors, specifically:
[0015] SPF female mice aged 4-6 weeks were selected as egg donors.
[0016] The technical solution adopted in the embodiment of the present application also includes: after injecting a certain dose of PMSG and hCG into the abdominal cavity of the female mouse, mating with a male mouse, and collecting fertilized eggs from the mated female mouse, specifically:
[0017] 10 IU of PMSG was injected into the peritoneal cavity of the female mouse, and 0.8 IU of hCG was injected into the peritoneal cavity of the female mouse after a set interval. The female mouse was then mated with a male mouse with normal reproductive capacity, and the fertilized eggs of the female mouse were collected. The fertilized eggs were digested and washed and then stored in an incubator at a set temperature.
[0018] The technical solution adopted in the embodiment of the present application also includes: injecting the Cas9 protein, ssODN and sgRNA into the pronucleus of the fertilized egg by microinjection technology, and transplanting the injected fertilized egg into the ampulla of the oviduct of a surrogate mother mouse, and further includes:
[0019] The surrogate mother mouse is weighed at set intervals to determine whether the fertilized egg is successfully pregnant.
[0020] The technical solution adopted in the embodiment of the present application further includes: after obtaining the offspring after the surrogate mother gives birth, it also includes:
[0021] After the set time of delivery, the offspring were tail-clipped, numbered, and subjected to PCR testing to obtain F0 mice.
[0022] The technical solution adopted in the embodiment of the present application also includes: according to the site of the Kcnq2 gene point mutation, a pair of identification primers F1 and R1 are designed at both ends of the mutation site, specifically:
[0023] F1:GCCTTGTTTGGCACTAGTATGG, R1:CCTACATCCTTGGAATTATCTAGC.
[0024] The technical solution adopted in the embodiment of the present application also includes: identifying the mice, screening the Kcnq2 with successful knock-in of the T274M mutation T274M / + Point mutation mice: specifically:
[0025] The F0 mice were amplified by PCR primers and sent for sequencing. The product amplified by the primers in the gene knockout mice was 788 bp. The F0 mice were identified by Sanger sequencing, and the F0 mice with sequencing results of c.821C>T, 822 C>G were identified as the Kcnq2 mice with successful knock-in of the T274M mutation. T274M / + Positive F0 mice;
[0026] Kcnq2 T274M / + Positive F0 mice were used as the father / mother and mated with wild-type mice to obtain F1 mice. PCR primer amplification and Sanger sequencing were used to identify the F1 mice after the birth of the F1 mice. The F1 mice with sequencing results of c.821C>T, 822 C>G were identified as Kcnq2 T274M / + Positive F1 mice.
[0027] Compared with the prior art, the beneficial effects of the embodiments of the present application are as follows: the gene point mutation mouse model construction method of the embodiment of the present application uses the T274M mutation on Kcnq2 Exon6 as the target to design sgRNA and ssODN, and injects Cas9 protein containing azide non-natural amino acid, DBCO-modified ssODN and the screened gRNA through microinjection technology to construct Kcnq2 based on CRISPR / Cas9. T274M / + Point mutation knock-in mouse models are simple to prepare and have high reproducibility, which can improve editing efficiency and obtain more Kcnq2 T274M / + Point mutation mice. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG1 is a flow chart of a method for constructing a gene point mutation mouse model according to an embodiment of the present application;
[0029] FIG2 is a diagram of Kcnq2 in an embodiment of the present application. T274M / + Schematic diagram of mouse preparation strategy;
[0030] FIG3 is a diagram of Kcnq2 in an embodiment of the present application. T274M / + Mouse identification peak diagram. DETAILED DESCRIPTION
[0031] The following will be combined with the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.
[0032] The terms "first," "second," and "third" in this application are used only for descriptive purposes and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, a feature defined as "first," "second," or "third" may explicitly or implicitly include at least one of such features. In the description of this application, "multiple" means at least two, for example, two, three, etc., unless otherwise specifically defined. All directional indications in the embodiments of this application (such as up, down, left, right, front, back...) are only used to explain the relative positional relationship, movement, etc. between the components under a specific posture (as shown in the accompanying drawings). If the specific posture changes, the directional indications also change accordingly. In addition, the terms "including" and "having," as well as any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, system, product, or device that includes a series of steps or units is not limited to the listed steps or units, but may optionally include steps or units that are not listed, or may optionally include other steps or units that are inherent to these processes, methods, products, or devices.
[0033] References herein to "embodiments" mean that a particular feature, structure, or characteristic described in connection with the embodiments may be included in at least one embodiment of the present application. The appearance of this phrase in various places in the specification does not necessarily refer to the same embodiment, nor does it constitute an independent or alternative embodiment that is mutually exclusive of other embodiments. It is understood, both explicitly and implicitly, by those skilled in the art that the embodiments described herein may be combined with other embodiments.
[0034] To address the shortcomings of the existing technology, the present invention uses azide-containing non-natural amino acid Cas9 protein, DBCO-modified ssODN and the screened sgRNA for injection through microinjection technology. The preparation is simple, the HDR efficiency is high, and a larger number of Kcnq2-T274M knock-in positive F0 mice can be obtained.
[0035] Specifically, please refer to Figure 1, which is a flow chart of the method for constructing a gene point mutation mouse model according to an embodiment of the present application. The method for constructing a gene point mutation mouse model according to an embodiment of the present application comprises the following steps:
[0036] S100: Design of sgRNA and ssODN targeting the T274M mutation on Exon6 of Kcnq2 (gene related to epilepsy);
[0037] In this step, since the incidence of T274M mutation (c.821C>T, 822 C>G leads to p.AThr274Met) is higher in the population, the embodiment of the present application selects T274M mutation as the target. T274M occurs on Exon6. First, sgRNA:CCCGTAGCCAATG GTCGTCA is designed, and the sgRNA is detected by SpCas9 in vitro (a DNA endonuclease guided by crRNA and tracrRNA (or sgRNA formed after the fusion of the two)). At the same time, ssODN:GCCCAAGTAACCAGAGCCCCTTACCCCTCAGATCATGCTGA CGACC ATTGGCTACGG GGACAAGTACCCTCA is set, and c.821C>T,822 C>G leads to p.AThr274Met mutation is introduced after homologous recombination. As shown in Figure 2, Kcnq2 of the embodiment of the present application is shown in Figure 2. T274M / + Schematic diagram of the mouse preparation strategy, where "Wild type allele" represents the wild type arm; "ssODN" represents single-stranded oligonucleotide; "Targeted allele" represents the targeting arm; "Exon" represents the exon; "Coding region" represents the coding region; and "Untranslated region" represents the non-coding region.
[0038] S110: Female mice of a set age are selected as egg donors. After intraperitoneal injection of a certain dose of pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG), the mice are mated with male mice, and fertilized eggs are collected from the mated female mice.
[0039] In this step, 4-6 week-old SPF (Specific Pathogen Free) female mice are selected as egg donors. 10 IU (International Unit, medical potency unit) of PMSG is injected intraperitoneally into the female mice. After a set interval (48 hours), 0.8 IU of hCG is injected intraperitoneally into the mice. The mice are then mated with male mice of normal reproductive capacity. Fertilized eggs are collected, digested, washed, and stored in a 37°C incubator until use. It is understood that the above parameters such as age, injection parameters, interval time, and storage temperature can be set according to the actual application scenario.
[0040] S120: Cas9 protein, ssODN, and sgRNA are injected into the pronucleus of fertilized eggs through microinjection technology. The injected fertilized eggs are transplanted into the ampulla of the oviduct of surrogate mice for surrogacy, and pups are obtained after the surrogate mice give birth.
[0041] In this step, the Cas9 protein containing the azide non-natural amino acid, DBCO-modified ssODN and sgRNA are injected into the pronucleus of the fertilized egg by microinjection technology, and then the fertilized egg is transplanted into the ampulla of the oviduct of the surrogate mouse. The surrogate mouse is weighed every set time (one week) to determine whether the fertilized egg is pregnant. If the pregnancy is successful, the surrogate mouse gives birth to pups 19-21 days after the injection, and the pups are tail-cut and numbered and PCR (polymerase chain reaction) tested after the set time of delivery (5 days) to obtain F0 mice (F0 mice refer to positive mice identified by tail-cutting, i.e., first-generation mice).
[0042] S130: Based on the site of the Kcnq2 gene point mutation, a pair of identification primers F1 and R1 were designed at both ends of the mutation site, and F0 mice were identified to screen out Kcnq2 with successful knock-in of the T274M mutation. T274M / + point mutation mice;
[0043] In this step, the mouse identification method is specifically as follows: according to the site of the Kcnq2 gene point mutation, a pair of identification primers F1 and R1 are designed at both ends of the mutation site, F1: GCCTTGTTTGGCACTAGTATGG, R1: CCTACATCCTTGGAATTATCTAGC; then, the F0 mice are amplified by PCR primers and sent for sequencing. The product amplified by the primers in the gene knockout mice is 788 bp; and the F0 mice are identified by Sanger sequencing. The F0 mice with sequencing results of c.821C>T, 822 C>G are identified as the Kcnq2 mice with successful knock-in of the T274M mutation. T274M / + Positive F0 mice. Kcnq2 T274M / + The positive F0 mice were used as the father / mother to breed, and the selected Kcnq2 T274M / + Positive F0 mice were mated with wild-type mice to obtain F1 mice (F1 mice refer to the first generation of mice obtained by planned mating between two inbred strains). After the F1 mice were born (14 days), PCR primer amplification was performed to identify the pure heterozygous mice. The identification primers were the same as those for F0 mice. F1 mice were identified by Sanger sequencing. F1 mice with sequencing results of c.821C>T, 822 C>G were identified as Kcnq2 T274M / + Positive F1 mice. Specifically shown in Figure 3, the Kcnq2 of the present embodimentT274M / + Mouse identification peak diagram, where WT represents wild type and KI represents knock-in. T274M / + Point mutation mice can be used to study the mechanism and treatment of epilepsy, and can also be applied to the study of other diseases caused by Kcnq2 gene mutations.
[0044] In other embodiments of the present application, Kcnq2 can also be prepared by mouse embryonic single cell (ES cell) targeting technology. T274M / + Point mutation mice are generated by using homologous recombination between chromosomal DNA in cells and exogenous DNA introduced into cells within the same sequence region to destroy endogenous genes in mouse ES cells. The totipotency of ES cells is then used to obtain knock-in Kcnq2 derived from ES cells. T274M / + Mice heterozygous for the point mutation.
[0045] To verify the feasibility and effectiveness of the present invention, Cas9 protein containing azide unnatural amino acid, DBCO-modified ssODN and gRNA were injected into the pronuclei of about 40 fertilized eggs by microinjection. 25 offspring were born, and 7 of them were positive mice. The experimental results show that the HDR (homology-directed repair) of the present invention is highly efficient and can obtain more Kcnq2 T274M / + Point mutation mice.
[0046] Based on the above, the gene point mutation mouse model construction method of the present application embodiment uses the T274M mutation on Kcnq2 Exon6 as the target to design sgRNA and ssODN, and injects the Cas9 protein containing azide non-natural amino acid, DBCO-modified ssODN and the screened gRNA by microinjection technology to construct Kcnq2 based on CRISPR / Cas9. T274M / + Point mutation knock-in mouse models are easy to prepare and can produce more Kcnq2 while improving editing efficiency. T274M / + Point mutation mice. T274M / + Point mutation mice can be used to study the mechanism and treatment of epilepsy, and can also be applied to the study of other diseases caused by Kcnq2 gene mutations.
[0047] In the several embodiments provided in this application, it should be understood that the disclosed systems, devices and methods can be implemented in other ways. For example, the system embodiments described above are merely illustrative. For example, the division of units is only a logical function division. In actual implementation, there may be other division methods, such as multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. Another point is that the mutual coupling or direct coupling or communication connection shown or discussed can be an indirect coupling or communication connection through some interfaces, devices or units, which can be electrical, mechanical or other forms.
[0048] In addition, each functional unit in each embodiment of the present application can be integrated into one processing unit, or each unit can exist physically separately, or two or more units can be integrated into one unit. The above-mentioned integrated unit can be implemented in the form of hardware or in the form of a software functional unit. The above is only an implementation method of the present application and does not limit the patent scope of the present application. Any equivalent structure or equivalent process transformation made using the content of the description and drawings of this application, or directly or indirectly used in other related technical fields, are also included in the patent protection scope of the present application.
Claims
1. A method for constructing a gene point mutation mouse model, characterized in that, Including: Design sgRNA and ssODN targeting the T274M mutation on Kcnq2 Exon6; Select female mice of a set age as egg donors. After intraperitoneally injecting a certain dose of PMSG and hCG into the female mice, mate them with male breeding mice, and collect fertilized eggs from the mated female mice; Inject Cas9 protein, ssODN, and sgRNA into the pronucleus of the fertilized eggs through microinjection technology. Transplant the injected fertilized eggs into the ampulla of the oviduct of surrogate mother mice, and obtain offspring mice after the surrogate mother mice give birth; According to the site of the point mutation of the Kcnq2 gene, a pair of identification primers F1 and R1 were designed at both ends of the mutation site, and the pups were identified to screen out the Kcnq2 mice with the T274M mutation successfully knocked in. T274M / + Point mutation mice.
2. The method for constructing a gene point mutation mouse model according to claim 1, wherein The design of sgRNA and ssODN targeting the T274M mutation on Kcnq2 Exon6 is specifically as follows: Design sgRNA: CCCGTAGCCAATG GTCGTCA, and detect the sgRNA using SpCas9; Design ssODN: GCCCAAGTAACCAGAGCCCCTTACCCCTCAGATCATGCTGA CGACCATTGGCTACGG GGACAAGTACCCTCA, and introduce the c.821C>T, 822C>G leading to p.AThr274Met mutation after homologous recombination.
3. The method for constructing a gene point mutation mouse model according to claim 2, characterized in that, The selection of female mice of a set age as egg donors is specifically as follows: Select SPF-grade female mice at 4 - 6 weeks of age as egg donors.
4. The method for constructing a gene point mutation mouse model according to claim 3, characterized in that After intraperitoneally injecting a certain dose of PMSG and hCG into the female mice, mating them with male breeding mice, and collecting fertilized eggs from the mated female mice is specifically as follows: Intraperitoneally inject 10 IU of PMSG into the female mice, and then intraperitoneally inject 0.8 IU of hCG into the female mice at a set interval. Then, mate the female mice with male breeding mice with normal reproductive ability, collect the fertilized eggs of the female mice, and store the fertilized eggs in an incubator at a set temperature after digestion and washing.
5. The method for constructing a gene point mutation mouse model according to any one of claims 1 to 4, characterized in that After injecting Cas9 protein, ssODN, and sgRNA into the pronucleus of the fertilized eggs through microinjection technology and transplanting the injected fertilized eggs into the ampulla of the oviduct of surrogate mother mice, it further includes: Weigh the surrogate mother mice at set intervals to determine whether the fertilized eggs are successfully pregnant.
6. The method for constructing a gene point mutation mouse model according to claim 5, wherein After obtaining offspring mice after the surrogate mother mice give birth, it further includes: Tail snip and number the offspring mice and perform PCR detection at a set time after birth to obtain F0 mice.
7. The method for constructing a gene point mutation mouse model according to claim 6, characterized in that, According to the site of the Kcnq2 gene point mutation, design a pair of identification primers F1 and R1 at both ends of the mutation site specifically as follows: F1: GCCTTGTTTGGCACTAGTATGG, R1: CCTACATCCTTGGAATTATCTAGC.
8. The method for constructing a gene point mutation mouse model according to claim 7, wherein Identifying the neonatal mice and screening out the Kcnq2 mice with the T274M mutation successfully knocked in T274M / + Point mutation mice: specifically The F0 mice were subjected to PCR primer amplification and sent for sequencing. The product amplified by the primer in the gene knockout mice was 788 bp. The F0 mice were identified by Sanger sequencing. The F0 mice with sequencing results of c.821C>T, 822C>G were identified as Kcnq2 successfully knocked in with the T274M mutation. T274M / + Positive F0 mice; Use the Kcnq2 T274M / + positive F0 mice as the male / female parent and mate them with wild-type mice to obtain F1 mice. After setting a specific time for the birth of the F1 mice, perform PCR primer amplification for identification, and use Sanger sequencing to identify the F1 mice. Identify the F1 mice with sequencing results of c.821C>T, 822C>G as Kcnq2 T274M / + positive F1 mice.
Citation Information
Patent Citations
Method for constructing KARS-gene-mutated mouse models and application of KARS-gene-mutated mouse models
CN106929533A
Method for performing electrotransfection gene editing on animal fertilized eggs and application of method
CN113881708A
Microglia-like cell line containing TREM2 mutant gene, mouse model and construction method thereof
CN114262709A
Mouse model with Lama3 gene point mutation and construction method thereof
CN115843747A
Mouse model
WO2006096648A2
Cited By
Construction method and application of Clock gene site-directed mutagenesis mouse model
CN121227804A