Recombinant adeno-associated virus vector for retinal gene delivery and use thereof
By designing recombinant adeno-associated viral vectors carrying the AIPL1 gene expression box, specifically infecting retinal pigment epithelial cells and photoreceptor cells, the treatment problem of retinal degenerative diseases was solved, and the efficient expression of AIPL1 protein and visual recovery were achieved.
Patent Information
- Application Number
- PCT/CN2024/142748
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-29
- Filing Date
- 2024-12-26
- Publication Date
- 2025-07-03
AI Technical Summary
The prior art lacks effective methods to specifically infect retinal pigment epithelial cells and photoreceptor cells, increase the expression of exogenous genes such as AIPL1, to treat retinal degenerative diseases such as Leber's congenital myxa.
A recombinant adeno-associated viral vector was designed to carry the AIPL1 gene expression box, including specific regulatory sequences such as IRBP enhancer, rhodopsin kinase promoter and CAG intron, and specific expression of exogenous genes is achieved through intravitreal or subretinal injection.
It significantly improved the expression of AIPL1 protein in retinal pigment epithelial cells and photoreceptor cells, effectively alleviated or treated Leber's congenital myomegaly, and restored the function of photoreceptors.
Smart Images

Figure PCTCN2024142748-FTAPPB-I100001 
Figure PCTCN2024142748-FTAPPB-I100002 
Figure PCTCN2024142748-FTAPPB-I100003
Abstract
Description
Recombinant adeno-associated virus vector for retinal gene delivery and its application Technical Field
[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a recombinant adeno-associated viral vector for delivering an exogenous target gene to the retina, particularly AIPL1, to retinal pigment epithelial cells and photoreceptor cells. Intravitreal or subretinal administration of the recombinant adeno-associated viral vector can achieve increased and specific expression of the exogenous target gene in the retina, thereby alleviating or treating Leber congenital amaurosis. Background Art
[0002] Over 95% of human cognitive activity originates from vision. As the first stage of visual processing, the retina plays a crucial role in photoelectric signal transduction and the progressive presentation of visual information. Leber congenital amaurosis (LCA) is a severe congenital blinding retinal disease with an early onset, accounting for over 5% of inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired or blind vision, and abnormal or absent electroretinograms (ERGs). To date, mutations in 20 different genes have been identified that cause the LCA phenotype, accounting for approximately 70% of all cases. These genes include GUCY2D, RPE65, SPATA7, AIPL1, LCA5, RPGRIP1, CRX, CRB1, NMNAT1, CEP290, IMPDH1, RD3, RDH12, LRAT, TULP1, IQCB1, CLUAP1, PRPH2, KCNJ13, and IFT140.
[0003] Seventeen LCAs are classified based on the chromosomal location of the mutated gene. Leber congenital amaurosis type 4 (LCA4) is primarily caused by mutations in the aryl-hydrocarbon-interacting protein-like 1 (AIPL1). The AIPL1 gene is located on chromosome 17, and 79 LCA-causing mutations have been identified to date. AIPL1 consists of 384 amino acids and is expressed exclusively in photoreceptors and the pineal gland. AIPL1 has an N-terminal FK506-binding protein (FKBP)-like domain, a tetratricopeptide repeat (TPR) domain, and a C-terminal proline-rich domain unique to primates. AIPL1 mutations are the cause of LCA4, which accounts for approximately 5.3% of LCAs.
[0004] In the retina, AIPL1 acts as a molecular chaperone for the HSP90 and cyclic nucleotide phosphodiesterase PDE6 complex and is an essential enzyme effector in the phototransduction pathway. PDE6 is activated by light and hydrolyzes cyclic GMP (cGMP), triggering cGMP-dependent Ca 2+ The closure of ion channels propagates the "light" electrical signal through the hyperpolarization of the plasma membrane.
[0005] AIPL1 gene mutations disrupt the interaction of AIPL1 with HSP90 or prenylated PDE6A (a subunit of the PDE6 complex), affecting the assembly of the PDE6 holoenzyme and leading to rapid proteasome degradation of PDE6 subunits. Reduced PDE6 function leads to elevated intracellular cGMP, prolonged opening of cyclic nucleotide-gated channels, and Ca 2+ Excessive influx leads to photoreceptor degeneration and poor vision.
[0006] Currently, there are no approved treatments for LCA4. Most treatments are limited to adjunctive therapies for poor vision, which do not address the underlying pathology and have not been reported to alter the clinical course. Therefore, there is a need in the art for a recombinant adeno-associated virus vector for ocular gene delivery that can specifically infect retinal pigment epithelial cells and photoreceptor cells and increase the expression of an exogenous target gene, such as AIPL1. Summary of the Invention
[0007] The present invention provides a recombinant AAV viral vector carrying a target gene expression cassette. The recombinant AAV viral vector can specifically infect retinal pigment epithelial cells and photoreceptor cells, and increase the expression level of exogenous target genes such as the AIPL1 gene, thereby alleviating or treating retinal diseases (such as Leber congenital amaurosis).
[0008] Therefore, in a first aspect, the present invention provides an expression cassette carrying an exogenous target gene, wherein the expression cassette comprises the exogenous target gene to be specifically expressed in retinal pigment epithelial cells and photoreceptor cells and a regulatory sequence directing its expression.
[0009] In some embodiments, the regulatory sequences of the present invention are provided as isolated nucleic acid molecules comprising operably linked:
[0010] a. the IRBP enhancer sequence set forth in SEQ ID NO: 18, or an enhancer sequence at least about 90% identical thereto, e.g., an enhancer sequence about 95%, 96%, 97%, 98%, 99% or more identical thereto, or
[0011] the CMV enhancer sequence set forth in SEQ ID NO:43, or an enhancer sequence at least about 90% identical thereto, e.g., an enhancer sequence about 95%, 96%, 97%, 98%, 99% or more identical thereto,
[0012] b. a photoreceptor cell-specific promoter sequence, for example, the photoreceptor cell-specific promoter sequence is selected from:
[0013] The rhodopsin kinase (RK) promoter sequence set forth in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0014] the hIRBP promoter sequence set forth in SEQ ID NO:44, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0015] The CRX promoter sequence set forth in SEQ ID NO: 45, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0016] the RHO promoter sequence set forth in SEQ ID NO:46, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0017] or,
[0018] A constitutive promoter sequence, for example, the constitutive promoter sequence is selected from:
[0019] the CBA promoter sequence set forth in SEQ ID NO: 47, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0020] the EF1α promoter sequence set forth in SEQ ID NO: 48, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0021] the UBC promoter sequence set forth in SEQ ID NO: 49, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0022] the CMV promoter sequence set forth in SEQ ID NO: 50, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0023] The SFFV promoter sequence set forth in SEQ ID NO: 51, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0024] the SV40 promoter sequence set forth in SEQ ID NO:52, or a promoter sequence at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto,
[0025] as well as
[0026] c. the CAG intron sequence set forth in SEQ ID NO:20, the UBC intron sequence set forth in SEQ ID NO:53, the human globin intron sequence set forth in SEQ ID NO:54, the CMV intron sequence set forth in SEQ ID NO:55, the EF1α intron sequence set forth in SEQ ID NO:56; the CMV globin intron sequence set forth in SEQ ID NO:57, or intron sequences at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto;
[0027] In some embodiments, the regulatory sequences of the invention comprise, as isolated nucleic acid molecules, operably linked to:
[0028] a. the IRBP enhancer sequence set forth in SEQ ID NO: 18, or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0029] b. a photoreceptor cell-specific promoter sequence, for example, the photoreceptor cell-specific promoter sequence is the rhodopsin kinase (RK) promoter sequence set forth in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0030] c. The CAG intron sequence set forth in SEQ ID NO: 20, or an intron sequence at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto.
[0031] In some embodiments, the exogenous target gene expression cassette of the present invention comprises an operably linked regulatory sequence of the present invention and an exogenous target gene.
[0032] In some specific embodiments, the exogenous target gene expression cassette of the present invention is an AIPL1 gene expression cassette. The AIPL1 gene expression cassette comprises an operably linked regulatory sequence of the present invention and a nucleotide sequence encoding AIPL1. For example, the nucleotide sequence encoding AIPL1 is a nucleotide sequence encoding AIPL1 as set forth in SEQ ID NO:5, or having at least about 90% identity (e.g., about 95%, 96%, 97%, 98%, 99% or greater identity) with SEQ ID NO:4, or SEQ ID NO:3, for example, the nucleotide sequences set forth in SEQ ID NOs:2-5.
[0033] In a second aspect, the present invention provides a nucleic acid expression vector comprising the exogenous target gene expression cassette (eg, AIPL1 gene expression cassette) described in the first aspect of the present invention.
[0034] In some embodiments, the nucleic acid expression vector of the present invention is flanked by one or more inverted terminal repeat (ITR) sequences on the side of the exogenous target gene expression cassette described in the first aspect of the present invention (e.g., the AIPL1 gene expression cassette), for example, two ITR sequences, namely, a 5' ITR sequence and a 3' ITR sequence. In some embodiments, the nucleic acid expression vector of the present invention further comprises a polyadenylation signal sequence, for example, a human growth hormone polyadenylation signal.
[0035] In a third aspect, the present invention provides a recombinant adeno-associated virus (rAAV) vector comprising a capsid and a viral vector genome, wherein the viral vector genome comprises, from the 5' end to the 3' end, a 5'ITR sequence or a variant thereof, the exogenous target gene expression cassette described in the first aspect of the present invention, and a 3'ITR sequence or a variant thereof, optionally, one of the two flanking ITRs is a modified AAV ITR sequence allowing generation of a self-complementary viral vector genome, for example, the ITR has the nucleotide sequence shown in SEQ ID NO: 42.
[0036] In some embodiments, the capsid of the rAAV vector of the present invention comprises any one of the following capsid proteins: AAV2 capsid protein or a variant thereof, AAV5 capsid protein or a variant thereof, AAV7 capsid protein or a variant thereof, AAV8 capsid protein or a variant thereof, AAV9 capsid protein or a variant thereof,
[0037] In some embodiments, the capsid of the rAAV vector of the present invention comprises an AAV2 capsid protein variant, wherein the AAV2 capsid protein variant has a 587-LALGDVTRPA-588 insertion fragment (SEQ ID NO: 28), as well as I240T and V708I relative to the AAV2 capsid protein; or has a 587-ALALGDVTRPA-588 insertion fragment (SEQ ID NO: 32), as well as I240T and V708I; wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO: 38.
[0038] In some embodiments, the capsid of the rAAV vector of the present invention comprises an AAV9 capsid protein variant, wherein the AAV9 capsid protein variant is a mutation replacing 15 functional amino acids (HQSAQAQAQTGWVQN, SEQ ID NO: 40) of the variable region VIII (584-598aa) of the AAV9 capsid VP1 with 25 specific amino acids (LQRGNLALGDVTRPARQAATADVNT, SEQ ID NO: 41), wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO: 39.
[0039] In a fourth aspect, the present invention provides a drug comprising the gene expression cassette of the first aspect of the present invention, the nucleic acid expression vector of the second aspect of the present invention, or the rAAV vector of the third aspect of the present invention. The drug optionally further comprises a pharmaceutically acceptable carrier, for example, a buffer, a diluent, or an excipient.
[0040] In a fifth aspect, the present invention provides a use of the gene expression cassette of the first aspect of the present invention, the nucleic acid expression vector of the second aspect of the present invention, or the rAAV vector of the third aspect of the present invention for preparing a pharmaceutical composition for alleviating or treating retinal degenerative eye diseases, for example, Leber congenital amaurosis. Preferably, the pharmaceutical composition is administered by intravitreal injection or subretinal injection. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] The preferred embodiments of the present invention described in detail below will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the present invention, the drawings show presently preferred embodiments. However, it should be understood that the present invention is not limited to the precise arrangements and means of the embodiments shown in the drawings.
[0042] Figure 1 shows a comparison of the hAIPL1 protein levels produced by target gene expression after cells were infected with the four recombinant AAV viruses (RC-C07V5&G05, RC-C07V5&G12, RC-C07V5&G29, and RC-C07V5&G30) of Example 1. In Figure 1, panel A shows that the RC plasmid RC-C07V5 contains a nucleic acid sequence encoding REP2 protein and a nucleic acid sequence encoding a CAP9 variant (i.e., C07V5) protein; the GOI-G05 plasmid contains a CAG promoter, a hAIPL1 (i.e., wtAIPL1) nucleic acid sequence and a PolyA sequence; the GOI-G12 plasmid contains a CAG promoter, a hAIPL1opt1 nucleic acid sequence and a PolyA sequence; the GOI-G29 plasmid contains a CAG promoter, a hAIPL1opt2 nucleic acid sequence and a PolyA sequence; the GOI-G30 plasmid contains a CAG promoter, a hAIPL1opt3 nucleic acid sequence and a PolyA sequence; panels B and D show that four recombinant AAV viruses (RC-C07V5&G05, RC-C07V5&G12, RC-C07V5&G29, RC-C07V5&G30) were injected at MOI 1E3 and MOI 1E3, respectively. Western blotting (WB) results and relative expression level of AIPL1 protein after ARPE19 cells were infected with 5E3; Panels C and E show the Western blotting (WB) results and relative expression level of AIPL1 protein (AIPL1 / GAPDH) after 661W cells were infected with four recombinant AAV viruses (RC-C07V5&G05, RC-C07V5&G12, RC-C07V5&G29, RC-C07V5&G30) at MOI 1E3 and MOI 5E3, respectively. In the figure, the negative control "NC" represents the relative expression level of AIPL1 protein (AIPL1 / GAPDH) corresponding to the uninfected cell control.
[0043] Figure 2 shows a comparison of the hAIPL1 protein levels produced by target gene expression after cells were infected with the four recombinant AAV viruses (RC-C07V5&G17, RC-C07V5&G27, RC-C07V5&G31, and RC-C07V5&G33) of Example 2. In Figure 2, panel A shows that the RC plasmid RC-C07V5 contains a nucleic acid sequence encoding REP2 protein and a nucleic acid sequence encoding a CAP9 variant (i.e., C07V5) protein; the GOI-G17 plasmid contains a hIRBP enhancer-hRK promoter-CAG intron, a hAIPL1 (i.e., wtAIPL1) nucleic acid sequence, and a PolyA sequence; the GOI-G27 plasmid contains a hIRBP enhancer-hRK promoter-CAG intron, a hAIPL1opt1 nucleic acid sequence, and a PolyA sequence; the GOI-G31 plasmid contains a hIRBP enhancer-hRK promoter-CAG intron, a hAIPL1opt2 nucleic acid sequence, and a PolyA sequence. sequence; GOI-G33 plasmid contains hIRBP enhancer-hRK promoter-CAG intron, hAIPL1opt3 nucleic acid sequence and PolyA sequence; Panel B shows the expression results of hAIPL1 in the retina detected by Western blotting (WB) after four recombinant AAV viruses (RC-C07V5&G17, RC-C07V5&G27, RC-C07V5&G31, RC-C07V5&G33) were administered to C57BL / 6J wild mice by subretinal injection (SR); Panel C shows the relative expression level of AIPL1 protein; Panel D shows the results of immunofluorescence staining using AIPL1 antibody and / or RHO antibody.
[0044] Figure 3 shows the results of infection of the wild-type optic cup with the recombinant AAV virus RC-C07V5&G33, and infection of the Aipl1-KO optic cup at MOIs of 0, 1E9 vg, 3.3E9 vg, and 1E10 vg, as described in Example 3. In Figure 3, Panel A shows Western blot analysis of hAIPL1 protein; Panel B shows the relative expression level of hAIPL1 protein; and Panel C shows immunofluorescence analysis of hAIPL1 protein expression.
[0045] Figure 4 shows the results of cGMP level detection after infection of the Aipl1-KO optic cup with the recombinant AAV virus RC-C07V5&G33 at an MOI of 1E9 vg in Example 4. In Figure 4, Panel A shows that the cGMP expression level in the Aipl1-KO optic cup was significantly decreased in the RC-C07V5&G33-infected group compared to the group not infected with the recombinant AAV virus by immunofluorescence detection; Panel B shows that the cGMP expression level in the RC-C07V5&G33-infected group was significantly decreased in the ELISA method compared to the group not infected with the recombinant AAV virus.
[0046] Figure 5 shows the phenotype of the AIPL1 knockout (Aipl1-KO) mouse model of Example 5. In Figure 5, Panel A shows that no AIPL1 protein was detected in the photoreceptors of Aipl1-KO mice at two and three weeks after birth, indicating that the AIPL1 gene was successfully knocked out in this model; Panel B shows the results of HE staining of retinal photoreceptor cells; Panel C shows the results of retinal outer nuclear layer thickness analysis using a ruler; Panel D shows the results of retinal photoreceptor layer thickness analysis using a ruler.
[0047] Figure 6 shows the results of detecting AIPL1 protein expression and retinal outer nuclear layer thickness in Aipl1-KO mice infected with the recombinant AAV virus RC-C07V5&G33 at MOIs of 2E7 vg, 5E7 vg, and 7.5E7 vg, respectively, as described in Example 6. In Figure 6, Panel A shows that hAIPL1 is specifically expressed in photoreceptors in the RC-C07V5&G33-infected group by immunofluorescence, and RHO-positive photoreceptor cells are significantly preserved, with their locations corresponding to the locations of high hAIPL1 protein expression in the retina of the treated group. Panel B shows that in the RC-C07V5&G33-infected group, the outer nuclear layer thickness of photoreceptor cells increases accordingly with increasing AAV virus infection doses.
[0048] FIG7 shows the results of detecting the expression of AIPL1 protein in Aipl1-KO mice after infection with recombinant AAV viruses AAV8&G33 at MOIs of 1E7 vg and 5E7 vg, respectively, in Example 7.
[0049] FIG8 shows the results of optimization and screening of serotype RC-C14 in Example 8. In Figure 8, Panel A shows three CAP variant sequences based on the RC-C14 sequence; Panel B shows that the GOI-E04 plasmid contains a CAG promoter, an EGFP nucleic acid sequence, and a PolyA sequence; the GOI-E10 plasmid contains a CAG promoter, an mScarlet nucleic acid sequence, and a PolyA sequence; Panel C shows the transduction frequency (the proportion of fluorescent cells to total cells, Freq. of Parent) of HEK293T cells infected with the recombinant AAV viruses RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04 at an MOI of 500 and 5000, respectively; Panel D shows the transduction frequency (the proportion of fluorescent cells to total cells, Freq. of Parent) of HEK293T cells infected with the recombinant AAV viruses RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04 at an MOI of 500 and 5000, respectively. Figure 5. Mean fluorescence intensity (MFI) of HEK293T cells after infection with recombinant AAV viruses RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04 in mice via IVT. Panel E shows that the fluorescent viruses corresponding to the three RC-C14 variants were unable to effectively cross the inner limiting membrane after IVT administration of recombinant AAV viruses RC-C14&E04, RC-C14V7&E04, and RC-C14V8&E04, and RC-C14V9&E04 to mice. After SR administration, compared with RC-C14&E04, RC-C14V7&E04 had obvious green fluorescence expression in the inner and outer segments and outer nuclear layer inclusions of photoreceptor cells, and photoreceptor cells in all areas of the retina showed strong green fluorescence.
[0050] Figure 9 shows further results after SR administration of the recombinant AAV viruses to mice in Example 8. In Figure 9, Panels A and B show the results of Western blot analysis and bar graphs of EGFP expression in the retina and choroid of mice administered with recombinant AAV viruses RC-C14&E04 and RC-C14V7&E04 at a low dose of 1E7 vg / eye and a high dose of 5E7 vg / eye; Panel C shows the results of immunofluorescence staining to detect the expression level of mScarlet red fluorescence after administration of recombinant AAV viruses RC-C14&E10 and RC-C14V7&E10 at a low dose of 1E7 vg / eye.
[0051] FIG10 shows the results of SR administration of the recombinant AAV viruses RC-C14&G33 to Aipl1-KO mice in Example 9.
[0052] FIG11 shows the results of SR administration of the recombinant AAV virus RC-C14V7&G33 to Aipl1-KO mice in Example 10. DETAILED DESCRIPTION
[0053] Unless otherwise defined hereinafter, all technical and scientific terms used in this specification have the same meaning as those of ordinary skill in the art to which the present invention pertains. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In addition, the materials, methods and examples described herein are merely illustrative and are not intended to be restrictive. Other features, objects and advantages of the present invention will become apparent from this specification and the accompanying drawings and from the appended claims.
[0054] I. Definition
[0055] As used herein, the term "about" when used in conjunction with a numerical value is intended to encompass numerical values within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value. The term is also intended to encompass values within ±1%, ±0.5%, or ±0.1% of the specified number.
[0056] As used herein, the term "comprising" or "including" means including the recited elements, integers, steps, or groups of elements, integers, or steps, but does not exclude any other elements, integers, or steps, or other groups of elements, integers, or steps. As used herein, unless otherwise indicated, the term "comprising" or "including" also encompasses the situation consisting of the recited elements, integers, or steps. For example, when referring to a polynucleotide "comprising" a particular sequence, it is intended to encompass a polynucleotide consisting of that particular sequence.
[0057] Herein, the expression "and / or," when used in conjunction with two or more items, is intended to mean any one of the associated listed items, or any multiple or all possible combinations of the associated listed items.
[0058] As used herein, an "isolated" nucleic acid refers to a nucleic acid molecule that has been artificially synthesized or separated from at least some components of its natural environment. For example, an isolated nucleic acid can be part of a larger nucleic acid, or part of a vector or composition of matter, or can be contained within a cell and still be "isolated" provided that the larger nucleic acid, vector, composition of matter, or specific cell is not the natural environment of the nucleic acid.
[0059] As used herein, the term "operably linked," also referred to as "effectively linked" or "functionally linked," means that two or more polynucleotide (e.g., DNA) segments are in a relationship that allows them to function in the intended manner. For example, a promoter sequence is operably linked to a coding sequence if it stimulates or regulates the transcription of the coding sequence in a suitable host cell or other expression system. Generally, promoters that are operably linked to a transcribable sequence are contiguous with the transcribable sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences (e.g., enhancers) do not need to be physically adjacent to or in close proximity to the coding sequence whose transcription they enhance.
[0060] "Promoter" refers to a polynucleotide sufficient to direct transcription of a downstream polynucleotide. In some embodiments, the nucleic acid vectors described herein may comprise one or more regulatory elements. One of ordinary skill in the art can select regulatory elements suitable for use in mammalian cells or human host cells. Non-limiting examples of regulatory elements include promoters, transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements. The nucleic acid vectors described herein may comprise a promoter sequence operably linked to a nucleotide sequence encoding a polypeptide of interest (e.g., AIPL1 protein).
[0061] As used herein, the term "adeno-associated virus (AAV)" is named after its discovery in adenovirus products. AAV is a member of the Parvovirus family, which includes multiple serotypes and has a single-stranded DNA genome.
[0062] AAV is a dependent virus that requires other viruses such as adenovirus, herpes simplex virus, human papillomavirus, or auxiliary factors to provide auxiliary functional proteins for replication.
[0063] The first AAV virus isolated was serotype 2 (AAV2). The AAV2 genome is approximately 4.7 kb long, flanked by 145-bp inverted terminal repeats (ITRs) at either end, forming a palindromic hairpin structure. The genome also contains two large open reading frames (ORFs), encoding the rep and cap genes, respectively.
[0064] ITRs are cis-acting elements of the AAV vector genome, playing a crucial role in AAV virus integration, rescue, replication, and genome packaging. The ITR sequence contains the Rep protein binding site (RBS) and the terminal resolution site (TRs), which are recognized by the Rep protein and produce a nick at the TRs. The ITR sequence also forms a unique "T"-shaped secondary structure, playing a crucial role in the AAV virus life cycle.
[0065] The rest of the AAV2 genome can be divided into two functional regions, the rep gene region and the cap gene region.
[0066] The rep gene region encodes four Rep proteins: Rep78, Rep68, Rep52, and Rep40. Rep proteins play an important role in the replication, integration, rescue, and packaging of AAV viruses. Rep78 and Rep68 specifically bind to the terminal melting sites trs and GAGY repeat motifs in the ITR, initiating the replication of the AAV genome from single-stranded to double-stranded. The trs and GAGC repeat motifs and / or GAGY repeat motifs in the ITR are the center of AAV genome replication. Therefore, although the ITR sequences are different in various serotypes of AAV viruses, they can all form a hairpin structure and contain Rep binding sites. There is a p19 promoter at position 19 on the AAV2 genome map, which initiates the expression of Rep52 and Rep40, respectively. Rep52 and Rep40 have ATP-dependent DNA helicase activity but do not have the function of binding to DNA.
[0067] The cap gene encodes the AAV capsid proteins VP1, VP2, and VP3. VP3 has the smallest molecular weight but is the most abundant. In mature AAV particles, the ratio of VP1, VP2, and VP3 is approximately 1:1:10. VP1 is essential for the formation of infectious AAV; VP2 facilitates VP3 entry into the cell nucleus; and VP3 is the primary protein in AAV particles.
[0068] As used herein, the terms "AAV capsid protein variant," "AAV variant capsid protein," and "AAV capsid variant" refer to an AAV capsid protein having at least one modification (including deletion, insertion, and / or substitution) in the amino acid sequence relative to the parent AAV capsid protein. The variant AAV capsid protein may have at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of the parent capsid protein.
[0069] As used herein, "parent AAV capsid protein" or "parent capsid protein" refers to an AAV capsid protein that serves as a template for introducing capsid protein mutations. The parent of the variant AAV capsid protein may be a naturally occurring or "wild-type" AAV capsid protein; or it may not be a wild-type capsid protein, for example, a capsid protein in which one or more (e.g., no more than 30 or 20, 15, 10, 5, 3, 1) amino acid modifications are introduced into the natural AAV capsid protein; or a chimeric capsid protein formed by splicing capsid proteins of different AAV serotypes. It should be understood that when the parent capsid protein is a non-natural capsid protein, the parent capsid protein does not contain a capsid protein mutation at a specific site according to the present invention. In some embodiments, the parent capsid protein is a natural AAV9 serotype capsid protein, for example, a VP1 protein having the amino acid sequence of SEQ ID NO: 39.
[0070] Reference herein to amino acid positions in an AAV2 capsid protein or a segment thereof refers to the amino acid positions numbered according to the reference sequence SEQ ID NO: 38. The amino acid positions in the sequence of the capsid protein corresponding to the amino acid positions of SEQ ID NO: 38 can be determined by aligning the amino acid sequence of the AAV capsid protein with SEQ ID NO: 38.
[0071] Reference herein to amino acid positions in an AAV9 capsid protein or a segment thereof refers to the amino acid positions numbered according to the reference sequence SEQ ID NO: 39. The amino acid positions in the sequence of the capsid protein corresponding to the amino acid positions of SEQ ID NO: 39 can be determined by aligning the amino acid sequences of the AAV capsid protein with SEQ ID NO: 39.
[0072] It should be understood that in the present disclosure, when an AAV capsid protein variant involves amino acid substitutions at certain specific amino acid positions, the alignment of the AAV capsid protein variant with the reference sequence in that segment can be visually inspected, and as needed, a gap can be introduced into one or both of the two aligned sequences to ensure that, after the gap is introduced, the segment of the AAV capsid protein and the corresponding segment of the reference sequence are in the corresponding position region in the alignment and have corresponding amino acid residue numbers. Sequence alignment for determining amino acid positions can be performed using the Basic Local Alignment Search Tool available from https: / / blast.ncbi.nlm.nih.gov / Blast.cgi using default parameters.
[0073] As used herein, "AAV virion" and "AAV virus particle" are used interchangeably to refer to a complete virus particle comprising an AAV capsid and an AAV nucleic acid genome (including wild-type AAV genomes and recombinant AAV genomes) packaged within the capsid. In this regard, the AAV nucleic acid molecule strand packaged into any one AAV virion can be either the sense (e.g., "positive") strand or the "antisense" strand, and both strands have equal infectivity.
[0074] Herein, the terms "recombinant AAV vector" and "recombinant AAV virions" and "recombinant AAV virus particles" are used interchangeably to refer to non-wild-type recombinant AAV virus particles that can serve as a carrier for exogenous target nucleic acids. Typically, the viral vector comprises a capsid and a vector genome packaged therein, and preferably the vector genome comprises a target nucleic acid to be delivered to a target cell or tissue inserted therein. Herein, "recombinant" can be abbreviated as "r", for example, recombinant AAV can be referred to as rAAV. Therefore, herein, the terms "recombinant AAV virions" and "recombinant AAV vectors" can also be used interchangeably with "rAAV virus particles", "rAAV virus particles" or "rAAV" or "rAAV vectors". Typically, recombinant AAV vectors are infectious but replication-defective.
[0075] Herein, for the purposes of the present disclosure, rAAV capsids can be from or derived from various adeno-associated virus serotypes, including but not limited to AAV2 capsid protein or variants thereof, AAV5 capsid protein or variants thereof, AAV7 capsid protein or variants thereof, AAV8 capsid protein or variants thereof, AAV9 capsid protein or variants thereof.
[0076] The term "vector genome (vg)" refers to the nucleic acid sequence packaged within the rAAV capsid to form the rAAV vector. The vector genome may contain regulatory sequences that direct the expression of a functional protein of interest.
[0077] In this article, for the purposes of this disclosure, the vector genome packaged in the rAAV vector is recombinant, that is, it has a genetically modified AAV genomic DNA relative to the wild-type AAV genomic DNA. In order to produce recombinant AAV virions that can deliver the nucleic acid of interest to tissues or cells, it is generally only necessary to retain the inverted terminal repeat (ITR) cis elements in the genome, while the remaining sequences required for viral packaging can be provided in trans. Therefore, typically, rAAV can have one or more AAV wild-type genes that are completely or partially deleted, for example, rep and / or cap genes that are completely or partially deleted, and are thus replication-defective; but retain the functional flanking ITR sequences necessary for the rescue, replication and packaging of AAV virions. More typically, the recombinant AAV vector genome packaged in the rAAV virion can retain only functional ITR sequences, and preferably comprises or consists of one or more exogenous nucleotide sequences located between two AAV ITR sequences. It should be understood that, with respect to rAAV, the functional ITR sequence can be, but is not necessarily, a wild-type nucleotide sequence, which can be changed, for example, by insertion, deletion or substitution of nucleotides, as long as it still provides the functions required for rescue, replication and packaging. Therefore, in this article, the rAAV vector is a viral vector that at least comprises the functional ITR required for viral replication and packaging in cis. It should also be understood that the recombinant AAV vector genome can comprise two or more (e.g., three) ITR sequences, and these ITR sequences can be the same or different.
[0078] Herein, the terms AAV "inverted terminal repeat" or "ITR" are used interchangeably to refer to the functional inverted terminal repeat cis-acting elements from the AAV viral genome and encompass wild-type ITR sequences and variant ITR sequences.
[0079] The wild-type ITR of the natural AAV virus contains a Rep protein binding site (RBS) and a terminal resolution site trs (terminal resolution site) in its sequence. It can be bound and recognized by the Rep protein and produce a cut at the trs, and can form a unique "T"-shaped secondary structure, which plays an important role in the life cycle of the AAV virus. The earliest isolated AAV virus, AAV2, has a "reverse terminal repeat sequence" (ITR) with a length of 145bp and a palindromic-hairpin structure located at both ends of the genome. Subsequently, different ITR sequences were found in various serotypes of AAV viruses, but they can all form a hairpin structure and have Rep binding sites. Recombinant AAV viral vectors based on these wild-type ITR sequences are generally single-stranded AAV vectors (ssAAV).
[0080] Compared to the wild-type ITR sequence, the variant ITR can be, for example, a deletion, substitution, and / or addition, and / or truncation of one or more nucleotides, but still be functional, i.e., a non-natural ITR sequence that can be used to generate rAAV viral vectors. It has been found that, unlike the above-mentioned ssAAV, by modifying the ITR, deleting the trs sequence and, optionally, the D sequence in the ITR sequence on one side of the AAV virus, the recombinant AAV viral vector obtained by packaging can carry self-complementary genomic DNA, thereby generating a virus called scAAV (self-complementary AAV). The packaging capacity of the scAAV viral vector is half that of the ssAAV viral vector, approximately 2.2 kb-2.5 kb, but the transduction efficiency after infecting cells is higher. See, for example, Self-complementary AAV Vectors; Advances and Applications, https: / / doi.org / 10.1038 / mt.2008.171. Such variant ITR sequences that can be used to generate scAAV viruses are also referred to herein as ΔITR. The present disclosure contemplates not only ssAAV vectors generated by combining two wild-type ITRs, but also scAAV vectors generated by combining a ΔITR sequence with a wild-type ITR.
[0081] As those skilled in the art will appreciate, the viral capsid protein of the recombinant adeno-associated virus and the viral vector genome ITR sequence may be from the same or different AAV virus serotypes.
[0082] As used herein, the term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including the progeny of such cells. Examples of host cells include, but are not limited to, microorganisms, yeast cells, insect cells, and mammalian cells. In some embodiments, the host cell is a mammalian cell. Depending on the context in which the term is used, the host cell may be an in vitro, ex vivo, or in vivo cell. In other embodiments, the host cell is a producer cell for producing an rAAV vector according to the present invention, for example, a "HEK293T cell" or a "293T cell," or a cell line derived from said cell.
[0083] The term "transduction efficiency" refers to the percentage of cells that are transduced with at least one AAV genome. For example, if 1 × 10 6 cells were exposed to AAV virus, and 0.5×10 6 If 100% of cells contain at least one copy of the AAV genome, the transduction efficiency is 50%. Methods for determining transduction efficiency include, for example, flow cytometry. For example, when the AAV genome contains a polynucleotide encoding green fluorescent protein (GFP), GFP+ The percentage of cells is a measure of transduction efficiency.
[0084] As used herein, the terms "exogenous" or "heterologous" are used interchangeably to describe a nucleic acid or protein and refer to a nucleic acid or protein that is foreign or heterologous relative to the virus, host cell, subject, or other organism in which it is derived, or to a flanking nucleic acid or polypeptide to which it is linked, i.e., that is, that is present in a non-natural state in the virus, host cell, subject, or organism, or is non-naturally associated with such flanking nucleic acid or polypeptide. For example, a nucleic acid that is introduced into a particular viral genome, host cell, or subject by recombinant techniques so as to be associated with a sequence that is not naturally associated with it, or is in a non-natural chromosomal or cellular location or state, is heterologous relative to the viral genome, host cell, or subject. Thus, a nucleic acid that is inserted into the same host cell as the cell from which it was derived, or into the same organism as the organism from which it was derived, but is present in a non-natural state, e.g., in a different copy number or under the control of different regulatory elements, is exogenous or heterologous.
[0085] In this article, the term sequence "identity" is used to describe the sequence structure similarity between two amino acid sequences or polynucleotide sequences. For determining the percent identity of two amino acid sequences or two nucleotide sequences, the sequences can be compared for optimal comparison purposes (for example, room can be introduced in one or both of the first and second amino acid sequences or nucleotide sequences for optimal comparison or non-homologous sequences can be abandoned for comparison purposes). In a preferred embodiment, for comparison purposes, the length of the compared reference sequence is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, or 100% of the length of the reference sequence. Subsequently, the amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are compared. When the position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at this position.
[0086] The comparison of sequences and calculation of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needlema and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm, which has been integrated into the GAP program in the GCG software package (available at http: / / www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http: / / www.gcg.com), using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred parameter set (and the one that should be used unless otherwise stated) is the Blossum62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.
[0087] The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller ((1989) CABIOS, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weighted remainder table, a gap length penalty of 12, and a gap penalty of 4.
[0088] As used herein, the term "conservative" amino acid or nucleotide changes refers to neutral or nearly neutral amino acid or nucleotide changes that result in the protein or nucleic acid molecule containing the amino acid or nucleotide change substantially retaining its original function. For example, a conservative amino acid substitution is a substitution or replacement of an amino acid with a different amino acid whose side chain has similar biochemical properties (e.g., charge, hydrophobicity, and size). Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles. The following eight groups contain amino acids that are conservative substitutions for each other: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine (C), methionine (M) (see, e.g., Creighton, Proteins (1984)). One skilled in the art can readily determine the conservative nature of amino acid or nucleotide changes in a particular polypeptide sequence or nucleotide sequence by conventional techniques, such as functional assays.
[0089] As used herein, "individual" and "subject" are used interchangeably to refer to mammals. Examples of mammals include, but are not limited to, humans, non-human primates (e.g., cynomolgus monkeys, rhesus monkeys), rodents, and other mammals, such as cattle, pigs, horses, and dogs. As used herein, mammals include individuals at all stages of development, including embryonic and fetal stages.
[0090] As used herein, the term "treatment" refers to clinical intervention intended to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or palliating the disease state, and alleviating or improving prognosis. The term "treatment" also encompasses modification or improvement of at least one physical parameter, including physical parameters that may not be discernible by the patient.
[0091] As used herein, the term "alleviate" refers to delaying the onset or development or progression of a disease or condition.
[0092] Various aspects of the present invention are described below.
[0093] II. Exogenous target gene expression cassette
[0094] In one aspect, the present invention provides an expression cassette for specifically expressing an exogenous target gene in retinal pigment epithelial cells and photoreceptor cells, wherein the expression cassette comprises an exogenous target gene to be specifically expressed in retinal pigment epithelial cells and photoreceptor cells and a regulatory sequence directing its expression.
[0095] In some embodiments, the exogenous target genes to be expressed include but are not limited to GUCY2D, RPE65, SPATA7, AIPL1, LCA5, RPGRIP1, CRX, CRB1, NMNAT1, CEP290, IMPDH1, RD3, RDH12, LRAT, TULP1, IQCB1, CLUAP1, PRPH2, KCNJ13, and IFT140 genes.
[0096] In some embodiments, the regulatory sequence comprises an operably linked enhancer sequence, a promoter sequence, and an intron sequence.
[0097] In some embodiments, the regulatory sequences of the present invention comprise operably linked:
[0098] a. the IRBP enhancer sequence set forth in SEQ ID NO: 18, or an enhancer sequence at least about 90% identical thereto, e.g., an enhancer sequence about 95%, 96%, 97%, 98%, 99% or more identical thereto, or
[0099] the CMV enhancer sequence set forth in SEQ ID NO:43, or an enhancer sequence at least about 90% identical thereto, e.g., an enhancer sequence about 95%, 96%, 97%, 98%, 99% or more identical thereto,
[0100] b. a photoreceptor cell-specific promoter sequence, for example, the photoreceptor cell-specific promoter sequence is selected from:
[0101] The rhodopsin kinase (RK) promoter sequence set forth in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0102] the hIRBP promoter sequence set forth in SEQ ID NO:44, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0103] The CRX promoter sequence set forth in SEQ ID NO: 45, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0104] the RHO promoter sequence set forth in SEQ ID NO:46, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0105] or,
[0106] A constitutive promoter sequence, for example, the constitutive promoter sequence is selected from:
[0107] the CBA promoter sequence set forth in SEQ ID NO: 47, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0108] the EF1α promoter sequence set forth in SEQ ID NO: 48, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0109] the UBC promoter sequence set forth in SEQ ID NO: 49, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0110] the CMV promoter sequence set forth in SEQ ID NO: 50, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0111] The SFFV promoter sequence set forth in SEQ ID NO: 51, or a promoter sequence having at least about 90% identity thereto, for example, a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0112] the SV40 promoter sequence set forth in SEQ ID NO:52, or a promoter sequence at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto,
[0113] as well as
[0114] c. the CAG intron sequence set forth in SEQ ID NO:20, the UBC intron sequence set forth in SEQ ID NO:53, the human globin intron sequence set forth in SEQ ID NO:54, the CMV intron sequence set forth in SEQ ID NO:55, the EF1α intron sequence set forth in SEQ ID NO:56; the CMV globin intron sequence set forth in SEQ ID NO:57, or intron sequences at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto;
[0115] In some embodiments, the regulatory sequences of the present invention comprise operably linked:
[0116] a. the IRBP enhancer sequence set forth in SEQ ID NO: 18, or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0117] b. the rhodopsin kinase (RK) promoter sequence set forth in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0118] c. The CAG intron sequence set forth in SEQ ID NO: 20, or a promoter sequence at least about 90% identical thereto, for example, about 95%, 96%, 97%, 98%, 99% or more identical thereto.
[0119] In some embodiments, the present invention provides an AIPL1 gene expression cassette comprising a nucleotide sequence encoding AIPL1 and a regulatory sequence directing its specific expression in retinal pigment epithelial cells and photoreceptor cells. In some embodiments, the nucleotide sequence encoding AIPL1 is a nucleotide sequence encoding AIPL1 set forth in SEQ ID NO: 5, or a nucleotide sequence encoding AIPL1 having at least about 90% identity (e.g., about 95%, 96%, 97%, 98%, 99% or greater identity) with SEQ ID NO: 3 or SEQ ID NO: 4.
[0120] In some embodiments, the nucleotide sequence encoding AIPL1 is selected from
[0121] (i) the nucleotide sequence encoding AIPL1 as shown in SEQ ID NO: 2;
[0122] (ii) a nucleotide sequence encoding the same AIPL1 as the nucleotide sequence in (i) but differing from the nucleotide sequence in (i) due to the degeneracy of the genetic code; or
[0123] (iii) a sequence that is at least 70%, 80%, or 90% identical (e.g., at least 95%, 96%, 97%, 98%, 99% or more identical) to the nucleotide sequence of (i) or (ii).
[0124] In some embodiments, the regulatory sequence directing the expression of AIPL1 comprises an operably linked:
[0125] a. the IRBP enhancer sequence set forth in SEQ ID NO: 18, or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto,
[0126] b. the rhodopsin kinase (RK) promoter sequence set forth in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or more identity thereto, and
[0127] c. The CAG intron sequence set forth in SEQ ID NO: 20, or a promoter sequence at least about 90% identical thereto, for example, an intron sequence about 95%, 96%, 97%, 98%, 99% or more identical thereto.
[0128] III. Adeno-associated virus (AAV) vectors
[0129] In another aspect, the present invention provides an adeno-associated virus vector, which is an artificial recombinant virus particle, wherein a replication-defective viral genome sequence comprising an expression cassette encoding an exogenous target gene specifically expressed in retinal pigment epithelial cells and photoreceptor cells (e.g., an expression cassette of AIPL1) is packaged in a viral capsid, such that the recombinant virus particle cannot produce progeny virions but retains the ability to infect target cells.
[0130] III.1. Capsid Protein of Adeno-Associated Virus Vectors
[0131] The AAV viral capsid is composed of approximately 60 VP monomers from three VP capsid proteins arranged in an icosahedral structure. The optimal molar ratio of the three capsid proteins, VP1:VP2:VP3, is approximately 1:1:10. VP1, VP2, and VP3 are all encoded by the AAV cap gene and produced from the same transcript, regulated by the p40 promoter. The three VP proteins share a common C-terminal sequence but distinct N-terminal initiation sites; VP2 and VP3, produced through alternative splicing, are truncated forms of VP1.
[0132] VP1 and VP2 are primarily localized in the nucleus, while monomeric VP3 is distributed both in the nucleus and in the cytoplasm. The outer surface of the assembled AAV capsid is composed of the VP3 sequence (including VP3 and the C-termini of VP1 and VP2), while the N-termini of VP1 and VP2 are located inside the capsid.
[0133] The VP has nine protruding loops called variable regions (VRs). VRs vary among AAV serotypes and are responsible for serotype-specific differences in receptor binding. Due to their exposed position and their function in receptor binding, the VRs forming the protruding loops are ideal locations for capsid modifications aimed at redirecting or expanding AAV tropism (i.e., cell surface targeting).
[0134] In some embodiments, the capsid protein of the adeno-associated virus vector of the present invention is selected from any one of the following: AAV2 capsid protein or a variant thereof, AAV5 capsid protein or a variant thereof, AAV7 capsid protein or a variant thereof, AAV8 capsid protein or a variant thereof, AAV9 capsid protein or a variant thereof.
[0135] In some embodiments, the capsid protein of the adeno-associated viral vector of the present invention comprises an AAV2 capsid protein variant, wherein the AAV2 capsid protein variant has a 587-LALGDVTRPA-588 insertion fragment (SEQ ID NO: 28), as well as I240T and V708I relative to the AAV2 capsid protein.
[0136] Furthermore, in order to develop new cell / tissue-targeted AAV capsid protein variants, the inventors screened AAV capsid protein variants. By inserting the designed sequence into the cap ORF at the amino acid position (587-588 position) in the VIII loop of the AAV2 capsid protein variable region (VR), and constructing an AAV transfer plasmid containing a reporter gene (e.g., EGFP, mScarlet) and the cap ORF to couple the genotype and phenotype of the AAV capsid variant with reporter gene expression, a variety of plasmids were generated. Subsequently, through capsid variant screening and tissue distribution detection in animals, AAV capsid protein variants that can more efficiently and / or more specifically transduce the retina when administered under subretinal injection were identified. Thus, the inventors generated new capsid protein variants of the present invention.
[0137] Therefore, the present invention provides AAV capsid protein variants. In one embodiment, the AAV capsid protein variant according to the present invention is derived from a parent AAV2 capsid protein, which has amino acid insertions at amino acid positions 587 and 588 of the parent capsid protein, for example, inserting the amino acid sequence ALALGDVTRPA shown in SEQ ID NO: 37, and performing I240T and V708I substitutions (numbering according to AAV2 VP1 of SEQ ID NO: 38). The capsid protein modification according to the present invention does not interfere with capsid assembly and genome packaging, and allows rAAV to obtain retinal tissue targeting.
[0138] In some embodiments, the capsid protein of the adeno-associated virus vector of the present invention comprises an AAV9 capsid protein variant, wherein the AAV9 capsid protein variant is obtained by mutating 15 functional amino acids (HQSAQAQAQTGWVQN, SEQ ID NO: 40) of the variable region VIII (584-598aa) of the AAV9 capsid VP1 to 25 specific amino acids (LQRGNLALGDVTRPARQAATADVNT, SEQ ID NO: 41), wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO: 39.
[0139] In some embodiments, the capsid protein variants of the present invention may further include or exclude amino acid substitutions (preferably, conservative substitutions) at one or more other amino acid positions, for example, 2 to 5, 5 to 10, or 10 to 15 amino acid substitutions.
[0140] In some embodiments, the AAV capsid protein variants according to the present invention can be further modified, for example, to enhance or extend the delivery of the recombinant vector. Methods for constructing and screening recombinant AAV capsid protein libraries are well known in the art. See, for example, US 2005 / 0053922 and US 2009 / 0202490, the disclosures of which are incorporated herein by reference in their entirety.
[0141] In some embodiments, the variant capsid proteins disclosed herein confer increased retinal pigment epithelial and photoreceptor transduction to rAAV virions comprising the corresponding parental AAV capsid protein or wild-type AAV, compared to transduction of cells in the retina (e.g., retinal pigment epithelial cells and photoreceptor cells). For example, relative to AAV virions comprising parental AAV capsid protein or wild-type AAV, variant capsid proteins of the present invention result in more AAV virions being taken up by retinal pigment epithelial and photoreceptor cells. In some implementation embodiments, AAV virions comprising variant capsid proteins of the present invention preferentially transduce retinal pigment epithelial and photoreceptor cells, for example, compared to other cells, the transduction efficiency of retinal pigment epithelial and photoreceptor cells is increased by 1.5 times, 2 times, 2.5 times, 3 times or more.
[0142] The transduction efficiency of the AAV viral particles to be tested in retinal pigment epithelial cells and photoreceptor cells can be assessed in vitro or in vivo using a variety of methods known in the art for measuring gene expression, such as an increase in transduction efficiency, transduction preference, etc. For example, rAAV genomes containing a reporter gene (e.g., a fluorescent protein under the control of a promoter) can be packaged using AAV capsid proteins, and the transduction efficiency and / or transduced cell type selectivity / preferentiality can be assessed by detecting the expression of the reporter gene (e.g., fluorescence microscopy) in an in vitro cell-based assay (e.g., after transfection of a target cell or a group of target cells) or in an animal model-based assay.
[0143] III.2. Genome of Adeno-associated Virus Vector
[0144] The genomic sequence of the adeno-associated viral vector of the present invention does not contain genes encoding enzymes required for viral replication. Therefore, it is considered safe to use viral vectors in gene therapy because replication and infection of progeny virions will not occur in the absence of enzymes required for viral replication.
[0145] In some embodiments, the adeno-associated viral vector genome of the present invention comprises, from the 5' end to the 3' end, a 5' ITR sequence or a variant thereof, an exogenous target gene expression cassette, and a 3' ITR sequence or a variant thereof.
[0146] In some embodiments, the adeno-associated viral vector genome of the present invention comprises, from the 5' end to the 3' end, a 5' ITR sequence or a variant thereof, an AIPL1 gene expression cassette of the present invention, and a 3' ITR sequence or a variant thereof.
[0147] ITRs are genetic elements responsible for genome replication and packaging during adeno-associated viral vector production and are the only viral cis-elements required for the production of rAAV. ITRs can be selected from AAVs of different origins.
[0148] In one embodiment, the ITR is derived from an AAV different from the AAV from which the capsid of the viral particle is derived. In one embodiment, the ITR sequence variant is a ΔITR, which is an ITR with the D sequence and the terminal melting site trs deleted, which enables the genome carried by the packaged recombinant adeno-associated virus vector to be self-complementary and form a double strand, significantly improving the in vivo and in vitro transduction efficiency of the AAV vector. The packaged virus is called scAAV (self-complementary AAV) virus, the so-called double-stranded AAV virus. It is different from ssAAV (single-stranded AAV) in which both ITRs are not mutated.
[0149] IV. Preparation of recombinant adeno-associated virus vector
[0150] The recombinant adeno-associated virus (AAV) vectors of the present invention can be produced using known techniques. Such methods involve culturing packaging cells comprising a nucleic acid sequence encoding an AAV capsid; a functional rep gene; an exogenous gene of interest expression cassette as described herein, flanked by AAV inverted terminal repeats (ITRs) or variants thereof such as ΔITRs; and sufficient helper functions to allow packaging of the expression cassette into the AAV capsid protein.
[0151] Also provided herein are packaging cells comprising a nucleic acid sequence encoding an AAV capsid; a functional rep gene; an expression cassette as described herein, flanked by AAV inverted terminal repeats (ITRs) or variants thereof such as ΔITRs; and sufficient helper functions to allow packaging of the expression cassette into AAV capsid proteins.
[0152] Other methods known in the art for producing rAAV can be utilized. Suitable methods may include, but are not limited to, baculovirus expression systems or production by yeast.
[0153] Currently, commonly used packaging systems for preparing AAV vectors include three-plasmid co-transfection systems, systems using adenovirus as a helper virus, systems using herpes simplex virus type 1 (HSV1) as a helper virus, and baculovirus-based packaging systems. Each packaging system has its own unique characteristics, and those skilled in the art can make the appropriate selection based on their needs.
[0154] The three-plasmid transfection packaging system is the most widely used recombinant AAV vector packaging system because it does not require a helper virus and has high safety. It is also the mainstream production system in the world. In one embodiment, the recombinant AAV vector of the present invention is produced by a three-plasmid co-transfection method. The specific preparation process is to first construct and purify three plasmids: 1) cis vector plasmid: encoding AAV inverted terminal repeats and exogenous target nucleic acid; 2) trans plasmid: encoding AAV rep and cap genes; 3) helper plasmid: usually encoding adenovirus helper genes; then these three plasmids are co-transfected into a suitable cell line, optionally HEK293 cells, thereby harvesting the rAAV vector carrying the exogenous target nucleic acid in the cell lysate.
[0155] In another embodiment, the recombinant AAV vector of the present invention is produced using a baculovirus packaging system.
[0156] V. Pharmaceutical Compositions
[0157] In one aspect, the present invention provides a pharmaceutical composition comprising a rAAV vector of the present invention. The rAAV vector according to the present disclosure can be formulated according to known methods after purification to prepare a pharmaceutically useful composition. The compositions of the present disclosure can be formulated using techniques known in the art for administration to a mammalian subject, such as a human.
[0158] When the delivery system is formulated as a solution or suspension, the delivery system is in an acceptable carrier, such as an aqueous carrier. A variety of aqueous carriers can be used, for example, water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid, etc. These compositions can be sterilized by conventional well-known sterilization techniques, or can be aseptically filtered. The resulting aqueous solution can be packaged for use as is, or lyophilized, and the lyophilized preparation can be combined with a sterile solution before administration.
[0159] The pharmaceutical composition according to the present invention may contain pharmaceutically acceptable auxiliary substances to approximate physiological conditions, such as pH regulators and buffers, tonicity regulators, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc. The pharmaceutical composition according to the present invention may or may not contain a preservative.
[0160] The genomic titer of a viral vector, such as that in the compositions and formulations disclosed herein, can be determined using a variety of standard methods, including, for example, using PCR to determine the genomic titer of a viral vector. The genomic titer of a viral vector can be determined using qPCR and ddPCR.
[0161] In a preferred embodiment, the pharmaceutical composition of the present invention is in the form of a pharmaceutical preparation for intravitreal injection or subretinal injection.
[0162] VI. Uses of Recombinant AAV Vectors
[0163] As a gene drug, the recombinant AAV vector of the present invention can be physically introduced into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including but not limited to intravitreal injection or subretinal injection.
[0164] The recombinant AAV vectors of the present invention provide an effective means for gene delivery-based treatment of retinal degenerative eye diseases (eg, Leber congenital amaurosis).
[0165] In some embodiments, the recombinant AAV vector of the present invention is injected into mice via intravitreal injection or subretinal injection, and the results show that the protein level of the exogenous target gene expressed in retinal pigment epithelial cells and photoreceptor cells is significantly increased, indicating that the recombinant AAV vector of the present invention can be used to alleviate or treat retinal degenerative eye diseases (e.g., Leber congenital amaurosis).
[0166] In some embodiments, the recombinant AAV vector of the present invention, for example, the recombinant adenovirus vector RC-C07V5&G33, AAV8&G33, RC-C14&G33, RC-C14V7&G33, is subretinally injected into Aipl1-KO mice. The results show that the expression level of hAIPL1 in the retinal tissue is significantly increased, indicating that the recombinant AAV vector of the present invention can be used to treat Leber congenital amaurosis.
[0167] Example
[0168] The technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the various reaction reagents involved in the embodiments can be purchased through commercial channels.
[0169] Example 1: Comparison of in vitro translation efficiency of humanized codon-optimized AIPL1 sequences
[0170] In this example, the hAIPL1 gene coding sequence (CDS) and three humanized codon-optimized sequences were constructed into GOI vectors for constitutive expression driven by the CAG promoter through gene cloning. Each of the four constructed GOI vectors was used as an AAV genome vector and co-transfected into HEK293T cells with an adenovirus gene helper plasmid and the RC plasmid RC-C07V5 (patent application number 202311491510.9) to obtain viruses with identical capsids.
[0171] The four recombinant AAV viruses were used to infect retinal-derived cell lines ARPE-19 (human retinal epithelial cells, purchased from ATCC) and 661W (mouse retinal photoreceptor cells, purchased from Lonza). The levels of hAIPL1 protein produced by the expression of the target gene after the four recombinant AAV viruses infected the cells were analyzed and compared to reflect the translation levels of the hAIPL1 gene coding sequence (CDS) and its three humanized codon-optimized sequences in in vitro cells.
[0172] 1.1. Construction of GOI vector
[0173] GOI plasmid cloning process: GOI-E04 (sequence: SEQ ID NO: 1) was first synthesized using gene synthesis technology as the base vector. The GOI-E04 base vector was linearized using the EcoRI (nucleotide position 2021) restriction enzyme site at the N-terminus and the BamHI (nucleotide position 2764) restriction enzyme site at the C-terminus. The hAIPL1 gene coding sequence (CDS) and its three humanized codon-optimized sequences (i.e., wtAIPL1: SEQ ID NO: 2, AIPL1opt1: SEQ ID NO: 3, AIPL1opt2: SEQ ID NO: 4, AIPL1opt3: SEQ ID NO: 5) were enriched by PCR using templates from gene synthesis. The GOI-E04 sequence from nt 143 to 3243 was then replaced by homologous recombination. The resulting clones were designated GOI-G05, GOI-G12, GOI-G29, and GOI-G30, respectively (see Figure 1, Panel A). The primer sequences used in the PCR enrichment are shown in Table 1.
[0174] Table 1 Primer sequences used in PCR enrichment
[0175] 1.2. Preparation of recombinant AAV virus
[0176] Adherent HEK293T cells were revived and passaged at a ratio of 1:3 when the confluence of HEK293T cells reached 90%. After culturing for 24 h, the cell confluence reached 80%, and recombinant AAV virus was prepared by the three-plasmid transfection method.
[0177] Specifically, prepare a suitable transfection system before transfection. For the packaging system of each 10cm culture dish, the transfection mixture is preferably prepared according to the following system: serum-free culture medium Opti-MEM (Gibco) 500μl, pHLP (AAV packaging auxiliary plasmid synthesized by Nanjing Genescript) 7.5μg, RC-C07V5 plasmid 3.75μg, GOI plasmid 3.75μg prepared in Example 1.1, PEIpro (Polyplus) 22.5μL; add the transfection mixture dropwise to different areas of the 10cm culture dish and shake gently; transfer the transfected cells to a carbon dioxide incubator and culture at 37□ for 72h; 72h after transfection, blow the cells with cell supernatant and collect the cell pellet by centrifugation at 1500rpm; add lysis solution and lyse on a shaker at 37□ for 1h, collect the supernatant by centrifugation at 4000rpm in a horizontal rotor for 10min, and filter with a 0.45μm needle filter; add a quarter volume of 2.5M 40% PEG8000 in NaCl was mixed and precipitated at 4 degrees for 2 hours, and centrifuged at 10,000g for 30 minutes; after resuspending the precipitate with 15 ml PBS, it was separated by ultracentrifugation at 65,000 rpm (Beckman ultracentrifuge) through an iodixanol (Sigma) density gradient, and the 40% layer of virus was collected. The solvent was replaced with PBS, concentrated to about 100 μl, and centrifuged through a 0.22 μm filter to obtain four recombinant AAV viruses (RC-C07V5&G05, RC-C07V5&G12, RC-C07V5&G29, RC-C07V5&G30), which were packaged in 20 μl volumes and stored at -80 degrees.
[0178] 1.3. qPCR detection of recombinant viral vector genome titer
[0179] The genome titer of the recombinant AAV virus prepared in Example 1.2 was detected by qPCR using hGHpA primer sequences (hGHpA F: CACAATCTTGGCTCACTG, SEQ ID NO: 14; hGHpA R: CTGGAATCCCAACAACTC, SEQ ID NO: 15) and hGHpA probe sequence (FAM-TTCAAGCGATTCTCCTGCCTC-BHQ1, SEQ ID NO: 16).
[0180] The GOI plasmids used in the preparation of each recombinant AAV virus were linearized with EcoRI enzyme, and the plasmid concentration was calculated according to the formula (concentration (copies / ul) = (6.02x10 23 The concentration of the linearized plasmid vector was calculated by quantifying the concentration of the vector by quantifying the concentration of the vector using the equation (g / mol) x (concentration in g / ul) / 660 (g / mol). The vector was diluted with ddH2O to 1E9 copies / ul, aliquoted at 10ul / tube, and stored in a -80°C refrigerator for use as a standard.
[0181] A standard sample with a concentration of 1E9 copies / ul was diluted with ddH2O in a 10-fold gradient (90ul ddH2O + 10ul sample to be diluted) to 1E8 copies / ul - 1E2 copies / ul. The recombinant AAV virus sample prepared in Example 1.2 was diluted 100-fold and 1000-fold with ddH2O. A qPCR reaction system was set up in duplicate wells (20ul system containing 6.4ul ddH2O, 10ul Probe PreMix (Takara, RR390A), 0.4ul hGHpA F primer, 0.4ul hGHpA R primer, 0.8ul hGHpA probe, and 2ul sample). qPCR reaction conditions were: one cycle at 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds, with fluorescence signal collected at the 60°C for 30 seconds step. After the reaction is completed, the concentrations of 100-fold and 1000-fold dilutions of the sample are calculated using the standard curve. The average genome titer (vg / ml) and CV value are calculated after conversion. A CV value less than 0.15 is considered a reliable test result.
[0182] Comparison of relative expression levels of AIPL1 in ARPE-19 and 661W cells after infection with recombinant AAV virus
[0183] ARPE-19 cells and 661W cells were passaged at a ratio of 1:3 and 1:5, respectively, plated on 24-well cell culture plates, and cultured in a carbon dioxide incubator for about 24 hours after cross-shaking. When the cell confluence reached 30%, four recombinant AAV viruses (RC-C07V5&G05, RC-C07V5&G12, RC-C07V5&G29, RC-C07V5&G30) were used to infect the two cells at two MOIs (low MOI / high MOI).
[0184] 48 h after infection, cells were harvested and lysed by denaturation before Western blotting (WB) analysis (using an AIPL1 antibody, Thermo Fisher Scientific 109372). Western blot results were scanned in grayscale, and GAPDH was used as an internal control. The relative quantitative value of AIPL1 / GAPDH was used as the relative expression level of AIPL1 protein.
[0185] The results showed that the expression of AIPL1 protein in ARPE-19 cells and 661W cells was better than that of other recombinant AAV viruses after infection of ARPE-19 cells and 661W cells with GOI-G30 recombinant AAV virus (i.e., RC-C07V5&G30) (panels BE in Figure 1). After infection of ARPE19 cells and 661W cells at a higher MOI with GOI-G12, GOI-G29, and GOI-G30 recombinant AAV viruses corresponding to the three nucleotide sequences after human codon optimization, the expression of AIPL1 protein was higher than that of GOI-G05 recombinant AAV virus using the wild-type coding sequence (WT CDS) (panels BE in Figure 1). This indicates that the three sequences obtained after codon optimization of the AIPL1 gene sequence have better translation levels in retinal cell lines than the wild-type sequence.
[0186] Example 2: Comparison of in vivo translation efficiency of humanized codon-optimized AIPL1 sequences
[0187] Through gene cloning, the CAG promoter in the four GOI vectors of Example 1 was replaced with the hRK photoreceptor cell-specific promoter. Each of the four GOI vectors was used as an AAV genome vector and co-transfected into HEK293T cells with an adenoviral gene helper plasmid and the RC plasmid RC-C07V5 to obtain viruses with identical capsids.
[0188] The in vivo expression levels of the wild-type hAIPL1 gene sequence and three sequences optimized with human codons driven by a photoreceptor-specific promoter (hRK promoter) were evaluated by subretinal administration in wild-type mice.
[0189] 2.1. Construction of GOI vector
[0190] GOI plasmid cloning process: GOI-G05, GOI-G12, GOI-G29, and GOI-G30 constructed in Example 1.1 were used as base vectors. The vectors were linearized using the HindIII (nucleotide position 393) restriction enzyme site at the N-terminus and the EcoRI (nucleotide position 2009) restriction enzyme site at the C-terminus. The CAG promoter was replaced with the hIRBP enhancer-hRK promoter-CAG intron (SEQ ID NO: 17). After PCR enrichment, the sequences nt 393 to 2009 of the base vectors GOI-G05, GOI-G12, GOI-G29, and GOI-G30 constructed in Example 1.1 were replaced by homologous recombination. The resulting clones were named GOI-G17, GOI-G27, GOI-G31, and GOI-G33, respectively. The element sequences of the four vectors are shown in Figure 2, Panel A. The primer sequences used in the PCR enrichment are shown in Table 2.
[0191] Table 2 Primer sequences used in PCR enrichment
[0192] Preparation, purification, and titer determination of recombinant AAV virus
[0193] Four recombinant AAV viruses RC-C07V5&GOI-G17, RC-C07V5&GOI-G27, RC-C07V5&GOI-G31, and RC-C07V5&GOI-G33 were prepared using a method similar to that described in Example 1.2.
[0194] 2.3. Analysis of AIPL1 protein translation in vivo
[0195] The expression specificity and expression level of hAIPL1 in the retinal photoreceptor cells of C57BL / 6J wild mice using the four viruses prepared in Example 2.2 were evaluated by subretinal injection (SR). The experimental groups are shown in Table 3.
[0196] Table 3. Animal experimental groups
[0197] Subretinal administration (recombinant AAV virus) procedure: On the day of the experiment, 60 mg / kg of Zotai 50 and 7.98 mg / kg of xylazine hydrochloride were intraperitoneally injected, diluted to the desired concentration with 0.9% sodium chloride injection. 0.5% compound tropicamide eye drops (Medo-Li) were used to dilate the pupil, and ofloxacin eye ointment (Diclo) was applied to the ocular surface. Under a surgical microscope, a disposable injection needle was used to puncture the sclera at the inner side of the corneal scleral limbus. A microinjector with a 36G flat needle was used to enter the puncture and bypass the lens to reach the vitreous or subretinal space, completing the drug (recombinant AAV virus prepared in Example 2.2) delivery.
[0198] Four weeks after administration, retinal tissues were separated from half of the eyes in the control group and experimental groups, and AIPL1 protein levels were detected by Western blotting. Frozen sections and immunofluorescence analysis were performed on the other half of the eyes in the control group and experimental groups.
[0199] Retinal Isolation and Western Blot Sample Preparation: Mice were sacrificed by cervical dislocation, and the eyeballs were removed with ophthalmic forceps and placed in corresponding sample tubes for retinas to be isolated. The specific steps for Western Blot sample preparation are as follows: Place the pre-cooled module of a grinder (Ningbo Xinzhi Biotechnology, SCIENTZ-48) in a -80°C freezer for at least 10 minutes. Under a dissecting microscope, remove the retinal pigment layer, choroid, and other tissues, retaining only the retina. Transfer the isolated retina to a flat-bottom tube designed for grinding, add 100 μL of lysis buffer, and add two steel balls to each flat-bottom tube. Place the pre-cooled sample in a high-throughput tissue grinder and grind. The parameters were 50 Hz, 180 s, and three cycles were performed. Samples were placed at 4°C, 13,000 rpm, and 30 minutes, and the supernatant was collected. Before protein electrophoresis, add one-quarter volume of 5x denaturing protein loading buffer (Yisheng, 20315ES) and denature at 100°C for 10 minutes.
[0200] The cryosectioning method is as follows: After anesthetizing mice, dislocate the cervical vertebrae, remove the eyeballs, and fix them overnight in FAS Eye Fixative (Sevier, G1109). Dehydrate in sucrose solution. Carefully remove the eyeball with forceps and place it (with the cornea facing left) in a mold containing OCT embedding medium (OCT Cryosection Embedding Medium, Sakura, 4583). Carefully adjust the position of the eyeball with a pipette. Place the mold on dry ice or in a -80°C freezer for approximately 30 minutes to allow the OCT to completely solidify before removing the mold and sectioning. Set the cryostat to section mode and adjust the thickness to 12 μm. Use a rolling slide method to mount the slides, with the first section mounted on the first slide, the second on the second, and so on, until the 21st section is mounted on the first slide. The number of sections that can fit on a slide is determined based on the sample size. Five sections with good morphology are selected for immunofluorescence staining.
[0201] Immunofluorescence staining: The cells were stained with AIPL1 antibody (Sino Biological, 207288-T10, 1:1000), RHO antibody (Abcam, ab98887, 1:500) and DAPI (1:2000). The specific procedure was as follows: wash with PBS; circle the tissue with an immunohistochemistry pen and drop 200 μl of 0.2% Triton X-100 onto each tissue, incubate in a humidified chamber; wash with PBS; block with 5% BSA for 30 min in a humidified chamber; add the primary antibody (AIPL1 antibody at a dilution of 1:1000, RHO antibody at a dilution of 1:500) and incubate overnight in a humidified chamber; wash with PBS; add the secondary antibody (Alexa Fluor 594-conjugated goat anti-rabbit IgG (H+L), Yisheng, 33112ES60) and incubate in a humidified chamber for 1 h; wash with PBS; stain with DAPI for 5 min; wash with PBS; mount the slides with anti-fluorescence quencher (Fluoromount-G, SouthernBiotech, 0100-01). Images were taken using an EVOS instrument (Invitrogen, M7000).
[0202] WB results showed that after the four viruses prepared in Example 2.2 were administered to C57BL / 6J wild mice, the recombinant AAV virus RC-C07V5&GOI-G33 group had the highest expression level of hAIPL1 protein, and the recombinant AAV virus RC-C07V5&GOI-G17 group had the lowest expression level. The expression levels of the recombinant AAV virus RC-C07V5&GOI-G27 group and the recombinant AAV virus RC-C07V5&GOI-G31 group were relatively close (Figure 2, panels B and C).
[0203] Immunofluorescence results showed that after the four viruses prepared in Example 2.2 were administered to C57BL / 6J wild mice, the recombinant AAV virus RC-C07V5&GOI-G17 group had the lowest hAIPL1 protein expression, and the hAIPL1 protein expression levels of the other three groups were similar (Figure 2, Panel D).
[0204] Therefore, the in vivo results of hAIPL1 protein expression driven by a specific promoter were consistent with the in vitro results. The three human codon-optimized nucleotide sequences encoding hAIPL1 showed higher translation levels in the retina than the wild-type sequence. The recombinant AAV virus RC-C07V5 & GOI-G33 group showed the highest relative expression levels both in vivo and in vitro. The following example illustrates the case where GOI-G33 serves as the vector genome GOI, with the full sequence being SEQ ID NO: 24.
[0205] Example 3: Expression analysis in the optic cup model
[0206] Retinal organoids (optic cups) are differentiated from iPS cells and can be cultured to form three-dimensional structures containing all retinal cell types. As such, optic cups closely resemble the human retina and serve as an excellent in vitro model for retinal research.
[0207] When the optic cup differentiates to the photoreceptor cell maturation stage (about 200 days), the photoreceptor cell-specific promoter hRK can normally initiate the expression of downstream target genes. Therefore, the in vitro expression and activity of the GOI-G33 viral vector can be analyzed by infecting the optic cup at this stage.
[0208] 3.1. Construction of the AIPL1 gene knockout model in the optic cup
[0209] To simulate the in vivo efficacy of viral vectors in humans, an AIPL1 knockout optic cup clone was established using CRISPR gene editing technology. The sgRNA sequences used for the gene editing targets are as follows.
[0210] AIPL1 sgRNA-01: gagctcccaaacttcatcac (SEQ ID NO: 25)
[0211] The steps for constructing the AIPL1 gene knockout (Aipl1-KO) H9 cell line using the RNP system are as follows: Cas9 protein and sgRNA (targeting sequence: SEQ ID NO: 25) are electroporated into H9 cells. After culturing for 3-5 days, the electroporated cells are dissociated into a single cell suspension and sorted into a 96-well plate by flow cytometry, with 1 cell per well. After the cells in each well of the 96-well plate grow into a monoclonal clone, the monoclonal clone is passaged and a portion of the cells are lysed, and the region near the target sequence is amplified and Sanger sequenced. Monoclonal cells with homozygous genotypes and the number of bases inserted or deleted at the target site is not a multiple of 3 in the sequencing results are expanded and cultured, and ultimately used for the differentiation of retinal organoids.
[0212] 3.2. Optic cup differentiation
[0213] Wild-type H9 cells (Yuanjing Biotechnology, YC-C097) and AIPL1 gene homozygous knockout H9 cells were used for retinal organoid differentiation. The specific differentiation steps were as follows: (Day 0, D0) H9 cells, a human embryonic stem cell line, were gently digested at 37°C and embryoid bodies (EBs) were established in ultra-low attachment 6-well plates; (Days 1-5) The medium was changed every 2 days with 5 ml of NIM medium (DMEM / F-12 + 1 x N-2 + MEM-NEAA + Heparin) per well (DMEM / F-12, Gibco, 11320033; N-2, Gibco 17502048; MEM-NEAA, Gibco, 10370088); (Day 7 onwards) EBs were transferred to Matrigel using a Pasteur pipette Coat 6-well plates, half-medium NIM was replaced on D9, D12, and D15; (Day 16-25) 3:1 medium (DMEM / F-12 + 1 x B-27 + MEM-NEAA) (B-27, Gibco, 12587010) was replaced every 2 days; and the optic cups were separated. Cells were scraped off using a cross-cutting pipette technique and transferred to a low-attachment 6-well plate with a Pasteur pipette. After isolating the optic cups, the culture medium was changed to 3D-RDM (DMEM / F-12 + 10% FBS + MEM-NEAA + 1 x B-27 + 100 μM Taurine (Taurine, Sigma, T0625). (Days 30-40) Optic cups with distinct structures were selected under a stereomicroscope for long-term culture. The first stage of optic cup differentiation lasts as late as six weeks after isolation and is characterized by the appearance of a dark core in the center. By 17-24 weeks after isolation, most iPSC-derived optic cups have reached the second stage, characterized by the appearance of distinct surface hair-like appendages and the reappearance of a thin outer rim. By the onset of stage 3 differentiation (latest day 148-196), the optic cups have reached an advanced stage of photoreceptor cell development, including the formation of inner and outer segments, outer nuclear layer, and outer plexiform layer. This stage is optimal for studying photoreceptor-related disease models.
[0214] 3.3. Western blot analysis of hAIPL1 expression in the optic cup after recombinant AAV infection
[0215] After approximately 200 days of optic cup differentiation, Aipl1-KO optic cups were infected with RC-C07V5 and G33 viruses at concentrations of 1E9, 3.3E9, and 1E10 vg, respectively. Three weeks after infection, optic cups were harvested, resuspended in PBS, and ground to obtain cell lysates, which were then analyzed by denaturing western blot (AIPL1 antibody, Thermo 109372).
[0216] Compared with the wild-type optic cup, no AIPL1 protein expression was detected in the Aipl1-KO optic cup cells (Panel A in Figure 3 ), indicating that AIPL1 was successfully knocked out. After RC-C07V5&G33 infected the Aipl1-KO optic cup, obvious hAIPL1 protein expression was detected in the optic cup cells.
[0217] Western blot results were scanned in grayscale, using GAPDH as an internal control. The relative quantitative value of hAIPL1 / GAPDH was used as the relative expression level of hAIPL1 protein. As shown in Figure 3, Panel B, after RC-C07V5&G33 infection of the Aipl1-KO optic cup at 1E9 vg, the resulting hAIPL1 expression level far exceeded that of the wild-type optic cup. The relative expression level of hAIPL1 increased with increasing recombinant AAV infection dose, indicating that RC-C07V5&G33 infection of the Aipl1-KO optic cup expresses hAIPL1 protein in a dose-dependent manner.
[0218] 3.4. Immunofluorescence detection of hAIPL1 expression levels after recombinant AAV virus infection of the optic cup
[0219] After the optic cup differentiated for about 200 days, the RC-C07V5&G33 virus was used to infect the AIPL1 knockout optic cup at 1E9 vg. Three weeks after infection, the optic cup was collected, fixed with a fixative, and dehydrated with a sucrose solution. The fixed and dehydrated eyeball tissue was free of excess tissue, placed in an embedding frame, and then OCT embedding medium was added and frozen in a freezing microtome. The embedded sample was fixed in the sample placement area of the freezing microtome (cornea facing left), the sample position was adjusted so that the blade was parallel to the embedding block, the slice thickness was set to 12 μm, the slices were sliced and mounted, and immunofluorescence staining was performed. The specific experimental process was the same as in Example 2.
[0220] RHO staining results were consistent between wild-type and Aipl1-KO optic cups, indicating that mature photoreceptor cells had been differentiated normally in the optic cups at this stage. Consistent with the WB results, AIPL1 expression levels were significantly decreased in Aipl1-KO optic cup tissue. However, infection of the Aipl1-KO optic cups with RC-C07V5&G33 cells significantly increased AIPL1 expression, reaching levels greater than those in wild-type optic cups (Figure 3, Panel C).
[0221] Example 4: PDE6 enzyme molecule activity detection experiment
[0222] Knockout of AIPL1 will affect the function of its downstream molecule PDE6 enzyme, reduce PDE6 enzyme activity, and lead to accumulation of intracellular cGMP.
[0223] After recombinant AAV viral vector infects the AIPL1 knockout optic cup, AIPL1 expression can be detected by measuring the PDE6 enzyme activity in the cells. PDE6 enzyme activity can be qualitatively detected by immunofluorescence to measure the expression level of the PDE6 substrate cGMP, or quantitatively measured by ELISA kits to measure cGMP concentration.
[0224] 4.1. Immunofluorescence analysis of cGMP expression after recombinant AAV infection of the optic cup
[0225] After the optic cups had differentiated for approximately 200 days, the Aipl1-KO optic cups were infected with 1E9 vg of RC-C07V5&G33 virus (the recombinant AAV virus used in Example 2). Three weeks after infection, the optic cups were harvested and fixed, dehydrated, embedded, and immunofluorescence stained using the same methods as in Example 2. The cells were stained with cGMP (Abcam, ab169753), RHO (Abcam, ab98887, 1:500), and DAPI (1:2000, blue), and photographed using an EVOS (Invitrogen, M7000).
[0226] RHO staining results were consistent between wild-type and Aipl1-KO optic cups, indicating that the optic cups had differentiated into mature photoreceptor cells at this stage. cGMP expression (red) was significantly increased in the AIPL1-knockout optic cup tissue, while cGMP expression was significantly decreased in the RC-C07V5&G33-infected group compared to the uninfected group (Figure 4, Panel A). This suggests that RC-C07V5&G33 infection increases PDE6 enzyme activity in the Aipl1-KO optic cup, thereby reducing the level of its substrate, cGMP.
[0227] 4.2. ELISA to detect changes in cGMP concentration after recombinant AAV virus infection of the optic cup
[0228] After the optic cup differentiated for approximately 200 days, the Aipl1-KO optic cup was infected with 1E9 vg of RC-C07V5&G33 virus (recombinant AAV virus as in Example 2). Three weeks after infection, the optic cup was collected and ground to obtain optic cup cell lysate. The cell lysate was used as a sample for optic cup cell cGMP detection according to the instructions of the cGMP ELISA detection kit (GenScript, L00461). The OD450 absorbance was read using a microplate reader within 15 minutes after the reaction was completed.
[0229] Consistent with the immunofluorescence results (Figure 4, Panel A), cGMP concentrations in the Aipl1-KO optic cup were significantly higher than those in the wild-type optic cup. Compared with the group not infected with the recombinant AAV virus, cGMP levels in the RC-C07V5&G33-infected group were significantly decreased (Figure 4, Panel B), indicating that RC-C07V5&G33 infection increased PDE6 enzyme activity in the Aipl1-KO optic cup. AIPL1 positively promoted the activity of downstream PDE6 enzymes, reducing the concentration of its substrate, cGMP.
[0230] Example 5: Preparation of AIPL1 knockout mouse model
[0231] The in vivo animal experimental model used in the present invention is an AIPL1 knockout (Aipl1-KO) mouse model. This model was constructed in a C57BL / 6J background and uses CRISPR / Cas9 gene editing technology to delete the sequence of exon 1 to exon 6 of the AIPL1 site in the mouse genome. This mouse model shows a phenotype similar to the clinical observation of patients with loss of AIPL1 function, including early loss of photoreceptor cells and no ERG waveform detected (data not shown). Therefore, it can serve as a good animal model for the disease and is used to explore the efficacy of gene therapy products.
[0232] The natural history of this model primarily analyzed the expression and thickness of AIPL1 in the inner and outer segments of the retinal photoreceptor cell layer and the outer nuclear layer using immunofluorescence and immunohistochemistry. Tissue samples were processed, fixed, dehydrated, sectioned, and mounted using the same immunofluorescence and hematoxylin / eosin (HE) staining methods as in Example 2.
[0233] The HE staining process is as follows: wash with PBS for 5 minutes, repeat three times; stain with hematoxylin for 10 minutes; wash with ddH2O for 5 minutes, repeat three times; hydrochloric acid ethanol rapid differentiation solution for 2 seconds; wash with ddH2O for 5 minutes, repeat three times; stain with eosin for 10 minutes; wash with ddH2O for 5 minutes, repeat three times; 100% ethanol for 5 minutes; xylene for 5 minutes, repeat three times; seal with neutral gum for storage.
[0234] Immunofluorescence results showed that the photoreceptors of two-week-old wild-type mice expressed low levels of AIPL1 protein, and the AIPL1 protein level increased three weeks after birth. AIPL1 was not detected in the photoreceptors of Aipl1-KO mice at two and three weeks after birth, indicating that the AIPL1 gene was successfully knocked out in this model (Panel A in Figure 5). The HE staining results (Panel B in Figure 5) analyzed and quantified the thickness of the retinal inner and outer segments and outer nuclear layer using a ruler, and plotted using GraphPad (Panels C and D in Figure 5). The thickness of the retinal outer nuclear layer and inner and outer segments of two-week-old Aipl1-KO mice was less than half that of wild-type mice. By three weeks of age, the retina was severely atrophied, the inner and outer segments disappeared, and only one nuclear layer remained in the outer nuclear layer. Therefore, when conducting in vivo efficacy test analysis using this model, it is necessary to administer the drug before the mice are two weeks old to ensure that the target photoreceptor cell layer structure is relatively well preserved when administering the drug.
[0235] Example 6: Animal Efficacy of Recombinant AAV Virus RC-C07V5&G33
[0236] AAV2, AAV5, AAV7, AAV8, and AAV9 can effectively transduce mouse photoreceptor cells via SR administration. RC-C07V5 (patent application number CN202311491510.9) is a variant of the AAV9 serotype that adds receptor recognition sites and amino acid substitutions at specific sites, improving its ability to cross the inner limiting membrane after IVT administration and the transduction of photoreceptor cells after subretinal administration. Therefore, the efficacy of the recombinant AAV virus RC-C07V5&G33, encapsidated with the RC-C07V5 capsid, in specifically expressing AIPL1 in photoreceptor cells can be analyzed.
[0237] At 12 days after birth (DOB12) of Aipl1-KO mice, the mouse retina is relatively mature and the eyes are open. The results of Example 5 show that the thickness of the inner and outer segments and outer nuclear layer of the photoreceptor cells at this time is about half of that of wild-type mice, and it has not yet entered the stage of rapid degeneration. Taking all factors into consideration, administration at this period is a better choice.
[0238] In Aipl1-KO mice at DOB12, 2E7 vg, 5E7 vg, and 7.5E7 vg of anesthetic were administered via SR to both eyes. The recombinant AAV virus, RC-C07V5&G33 (same virus as in Example 2), was used. The subretinal administration procedure was the same as in Example 2. The anesthetic dosage was adjusted based on mouse weight, and the administration volume was controlled at 0.8 μl to minimize damage caused by administration.
[0239] Two weeks after administration, retinal tissue samples were collected from the experimental mice and immunofluorescence stained using the same method as in Example 2. Rhodopsin (RHO), a representative marker of rods, indicates photoreceptor survival. Immunofluorescence staining was visualized using a green fluorescent secondary antibody. hAIPL1, driven by the hRK photoreceptor-specific promoter, was immunofluorescently stained using a red fluorescent secondary antibody. In theory, red hAIPL1 and green RHO should colocalize.
[0240] No AIPL1 protein expression was detected in the untreated control group, and the number of residual RHO-positive cells was extremely small. In the drug-treated group, hAIPL1 was specifically expressed in photoreceptor cells, and RHO-positive photoreceptor cells were significantly preserved, corresponding to the location of high hAIPL1 protein expression in the retina of the treated group. The expression of hAIPL1 increased with increasing dose, and the area occupied by RHO-positive cells also increased accordingly (Panel A in Figure 6). The thickness of the outer nuclear layer of green fluorescence expression in each dose-treated group was quantified after ruler analysis and plotted using GraphPad. As the dosage increased, the thickness of the outer nuclear layer of photoreceptor cells increased accordingly (Panel B in Figure 6). The results showed that the expression of hAIPL1 and the efficacy of RC-C07V5&G33 in promoting the preservation of photoreceptor cells after subretinal administration were dose-dependent.
[0241] Example 7: Animal Efficacy of Recombinant AAV Virus AAV8&G33
[0242] AAV8 has been reported to be the best serotype for transducing photoreceptor cells after SR administration. Following SR administration, target gene expression was detected both inside and outside the injection site in rats and dogs, suggesting that AAV8 infection and transduction may be diffuse, making AAV8 a promising option for subretinal transduction of photoreceptor cells. AAV8 may transduce all retinal cell types after SR administration, but since the selected molecule G33 is specifically expressed in photoreceptors, the efficacy of the recombinant AAV virus (AAV8&G33) encapsidated with AAV8 was evaluated for its ability to specifically express AIPL1 in photoreceptors.
[0243] 7.1. Preparation, Purification, and Genome Titer Detection of Recombinant AAV Viruses
[0244] The recombinant AAV virus AAV8 & GOI-G33 was prepared in a similar manner to Example 1. The AAV8 plasmid was obtained by replacing the cap sequence (SEQ ID NO: 28) of RC-C14 (SEQ ID NO: 27) with a fully synthesized AAV8 cap sequence (SEQ ID NO: 26).
[0245] In vivo experiments
[0246] When Aipl1-KO mice were at DOB12, the drug was administered to both eyes via SR at doses of 1E7 vg and 5E7 vg. The administration virus was the recombinant AAV virus AAV8&G33. The administration process was the same as in Example 2, and the administration precautions were the same as in Example 6.
[0247] Two weeks after administration, retinal tissue samples were collected from the experimental mice and immunofluorescence staining was performed using the same method as in Example 2. Rhodopsin (RHO), a representative marker of rod cells, can indicate photoreceptor cell survival. Immunofluorescence staining was visualized using a green fluorescent-labeled secondary antibody. hAIPL1, driven by the hRK photoreceptor-specific promoter, was immunofluorescently stained and visualized using a red fluorescent-labeled secondary antibody.
[0248] No AIPL1 protein expression was detected in the untreated control group, and almost all photoreceptor cells died, with only one RHO-positive cell remaining in the displayed figure. Compared with the untreated control, a small amount of RHO-positive photoreceptor cells were preserved in the 1E7vg dose group of the recombinant AAV virus AAV8&G33. In the 5E7vg dose group of the recombinant AAV virus AAV8&G33, hAIPL1 was specifically expressed in photoreceptor cells, and the expression level was high. In the retina of the treated group, the high hAIPL1 protein expression position corresponded to obvious photoreceptor cell preservation, and the area of RHO-positive photoreceptor cell preservation occupied half of the retinal area (Figure 7). As the dose of recombinant AAV virus AAV8&G33 increased, the number and area of preserved photoreceptor cells also increased accordingly, indicating that the efficacy of recombinant AAV virus AAV8&G33 after treatment of Aipl1-KO mice is dose-dependent.
[0249] Example 8: Optimization and variant screening of serotype RC-C14
[0250] Serotype RC-C14 (patent application number 202310084749.8) has a stronger ability to penetrate the internal limiting membrane (ILM) than AAV2.7m8 via intravitreal (IVT) administration. RC-C14's ability to transduce photoreceptors after SR administration is slightly higher than that of AAV2 and AAV2.7m8. We aimed to identify serotypes based on the RC-C14 sequence that would have a stronger ability to cross the ILM after IVT administration, or that would exhibit better expression in photoreceptors and / or RPE after subretinal (SR) administration, and / or that could diffuse from the injection site to the surrounding area. We designed three CAP sequences, as shown in Figure 8, Panel A. Using RC-C14 as a control, we compared spontaneous red (mScarlet) or green fluorescence (EGFP) expression in the target cell layer (immunofluorescence, flow cytometry, and western blot) after IVT and SR administration in wild-type mice to identify new effective serotypes.
[0251] 8.1. Construction of GOI vector
[0252] GOI plasmid cloning process: GOI-E04 (sequence: SEQ ID NO: 1) was first synthesized using gene synthesis technology as a base vector. The vector was linearized using EcoRI (nucleotide position 2021) restriction enzyme at the N-terminus and BamHI (nucleotide position 2764) restriction enzyme at the C-terminus. mScarlet: SEQ ID NO: 29 (template from gene synthesis) was enriched by PCR and replaced with GOI-E04 nt 143-3243 sequence by homologous recombination. The resulting clones were GOI-E10 (see Figure 8, panel B). Primer sequences are shown in Table 4.
[0253] Table 4 Primer sequences used in PCR enrichment
[0254] RC-C14V7, RC-C14V8 and RC-C14V9 cloning process: First, use RC-C14: SEQ ID NO: 27 as the basic vector. Use SwaI (nucleotide position 2008) restriction enzyme at the N-terminus and PmeI (nucleotide position 4352) restriction enzyme at the C-terminus to linearize the vector. Replace the RC-C14 CAP with RC-C14V7 CAP: SEQ ID NO: 32, RC-C14V8 CAP: SEQ ID NO: 33, and RC-C14V9 CAP: SEQ ID NO: 34. After PCR enrichment, homologous recombination replaces the RC-C14 nt 2008-4352 sequence to obtain clones RC-C14V7, RC-C14V8, and RC-C14V9. The primer sequences used for construction are shown in Table 5.
[0255] Table 5 Primer sequences used in PCR enrichment
[0256] 8.2. Preparation, Purification, and Genome Titer Detection of Recombinant AAV Viruses
[0257] Six viruses, RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, RC-C14V9&E04, RC-C14&E10, and RC-C14V7&E10, were prepared using the same method as in Example 1.
[0258] 8.3. In vitro cell flow cytometry analysis
[0259] HEK293T (293T) cells were passaged at a ratio of 1:5, plated on 24-well cell culture plates, and cultured in a carbon dioxide incubator for about 24 hours after cross-shaking. When the cell confluence reached 30%, HEK293T cells were infected with four viruses (RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04) at two MOIs (low / high).
[0260] 48 hours after infection, cells were collected and flow cytometry was used to analyze the percentage of green fluorescent cells and mean fluorescence intensity in each infection group. The flow cytometric analysis process was as follows: cells were trypsinized, the reaction was terminated with high-glucose DMEM medium containing 10% FBS, the supernatant was removed by centrifugation, and the cells were resuspended in PBS to form single cells.
[0261] Load the sample onto a flow cytometer, using FSC as the horizontal axis and SSC as the vertical axis. Adjust the voltage to separate live cells, and set the sample loading to 1E4 live cells. Analyze the percentage of fluorescent cells using FITC-A as the horizontal axis and SSC-A as the vertical axis, and analyze the mean fluorescence intensity of the fluorescent cells. Output the values and plot them in GraphPad. A high percentage of fluorescent cells indicates a high number of cells infected with the test AAV and expressing the fluorescent protein, while a high mean fluorescence intensity indicates a high number of AAVs (MOI) per infected cell expressing the fluorescent protein.
[0262] As can be seen from Figure 8, panels C and D, the order of transduction activity (TU&MFI) of RC-C14 and its three variant serotypes in 293T is: RC-C14>RC-C14V7>RC-C14V9>RC-C14V8.
[0263] In vivo experiments
[0264] The in vivo experimental analysis was divided into two stages. In the first stage, the ability of serotype RC-C14 and three variant serotypes to cross the inner limiting membrane after IVT administration, and their ability to infect and transduce photoreceptor cells and / or RPE cells after SR administration were analyzed. In the first stage, the serotype RC-C14V7, which can efficiently infect and transduce photoreceptor cells by subretinal administration, was screened. In the second stage, the protein WB expression level of green fluorescent virus packaged by RC-C14 and RC-C14V7, and the fluorescence expression range and expression intensity after red fluorescent virus infected photoreceptor cells and RPE cells were analyzed by subretinal administration. Finally, the serotype RC-C14V7 was successfully screened out, which was better than RC-C14 in transducing photoreceptor cells.
[0265] Phase 1:
[0266] Wild mice were administered IVT at a dose of 4E8 vg / eye with the following viruses: RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04. The specific administration method was as follows: 6-8 week old C57BL / 6J mice (purchased from Nanmo) were intraperitoneally injected with 60 mg / kg of Shutai 50 and 7.98 mg / kg of xylazine hydrochloride on the day of the experiment, adjusted to the desired concentration with 0.9% sodium chloride injection. Mydriasis was dilated with 0.5% compound tropicamide eye drops (Medo-Li), and ofloxacin eye ointment (Dicloro) was applied to the ocular surface. Under a surgical microscope, the sclera was punctured at the inner side of the corneoscleral limbus with a disposable injection needle, and a microinjector with a 36G flat needle was inserted through the puncture. After bypassing the lens and reaching the vitreous body, the drug is delivered through the vitreous cavity injection. After the injection, the mice are placed in a warm environment for recovery and returned to the cage after waking up. In each experimental group, the injection is completed in sequence, and the start time of anesthesia and drug administration (injection completion time) are recorded. Unless otherwise specified, the left eye (OS) is the non-injected eye and the right eye (OD) is the injected eye. During the vitreous cavity injection process, any abnormalities caused by human operation, such as injection failure, intraocular damage, etc., will be recorded truthfully, and those with severe injuries will be excluded.
[0267] Wild-type mice were administered SR at a dose of 4E7 vg / eye using RC-C14&E04, RC-C14V7&E04, RC-C14V8&E04, and RC-C14V9&E04 viruses. Specific administration methods were as described in Example 2.
[0268] 8 weeks after administration, the mouse retinas were subjected to autofluorescence analysis, and the specific sampling, sectioning and sealing processes were as described in Example 2. After sealing, the green fluorescence was recorded directly by taking pictures using the EVOS instrument (Invitrogen, M7000). The results in panel E of Figure 8 show that after IVT administration, the fluorescent viruses corresponding to the three variants of RC-C14 were unable to effectively cross the inner limiting membrane. After SR administration, compared with RC-C14&E04, RC-C14V7&E04 had obvious green fluorescence expression in the inner and outer segments and outer nuclear layer inclusions of photoreceptor cells, and photoreceptor cells in all areas of the retina showed strong green fluorescence, which indicates that RC-C14V7 can efficiently infect photoreceptor cells after subretinal administration, and there may be a phenomenon of effective penetration from the administration site. After subretinal administration, the fluorescence expression of the photoreceptor layer of RC-C14V8&E04 and RC-C14V8&E04 was lower than that of RC-C14&E04, indicating that these two mutations lead to a weakening of the ability of RC-C14 to infect and transduce photoreceptor cells.
[0269] Phase 2:
[0270] Wild-type mice were administered SR at doses of 1E7 vg / eye and 5E7 vg / eye, respectively, using RC-C14&E04 and RC-C14V7&E04 viruses. The specific administration method is as described in Example 2. Eight weeks after administration, the mouse retinas and choroids were isolated, and sample preparation and denaturing western blot analysis for fluorescent protein expression were performed according to the same procedures as in Example 2. As shown in Figures A and B of Figure 9, after eight weeks of administration at the same dose, the levels of green fluorescent protein expressed by RC-C14V7&E04 were significantly higher than those of RC-C14&E04 in both the low- and high-dose groups.
[0271] Wild-type mice were administered SR at a dose of 1E7 vg / eye with RC-C14&E10 and RC-C14V7&E10 as the virus. The specific administration method is as described in Example 2. Eight weeks after administration, tissue processing and immunofluorescence staining were performed as in Example 2. The immunofluorescence staining antibody was RHO antibody (Abcam, ab98887, 1:500) and DAPI dye (1:2000) was used for staining. As can be seen from the results in Panel C of Figure 9, after 4 and 8 weeks of subretinal administration at an extremely low dose of 1E7 vg, only very low red fluorescence expression was detected with RC-C14&E10. However, the red fluorescence expressed by RC-C14V7&E10 in the RPE and photoreceptor cells occupied half of the retinal area, and the red fluorescence expression levels were much higher than those of RC-C14&E10.
[0272] In vivo experiments have confirmed that the RC-C14 variant serotype RC-C14V7 can more efficiently infect and transduce RPE and photoreceptor cells via subretinal administration. RC-C14V7 CAP amino acid sequence: SEQ ID NO: 37.
[0273] Example 9: Animal Efficacy of Recombinant AAV Viruses RC-C14 & G33
[0274] Serotype RC-C14 (patent application number 202310084749.8) has been shown to efficiently transduce photoreceptor cells via SR administration, with transduction levels exceeding those of AAV2 and AAV2.7m8. Therefore, we investigated the efficacy of the recombinant AAV virus RC-C14&G33, encapsidated with RC-C14, in its ability to specifically express AIPL1 in photoreceptor cells.
[0275] 9.1. Preparation, Purification, and Genome Titer Detection of Recombinant AAV Viruses
[0276] The recombinant AAV virus RC-C14&G33 was prepared in a manner similar to that described in Example 1.
[0277] In vivo experiments
[0278] In Aipl1-KO mice at DOB12, the drug was administered to both eyes via SR at doses of 2E7 vg and 6E7 vg. The administered virus was the recombinant AAV virus RC-C14&G33. The administration process was the same as in Example 2, and the administration precautions were the same as in Example 6.
[0279] Two weeks after administration, retinal tissue samples were collected from the experimental mice and immunofluorescence staining was performed using the same method as in Example 2. Rhodopsin (RHO), a representative marker of rod cells, can indicate photoreceptor cell survival. Immunofluorescence staining was visualized using a green fluorescent-labeled secondary antibody. hAIPL1, driven by the hRK photoreceptor-specific promoter, was immunofluorescently stained and visualized using a red fluorescent-labeled secondary antibody.
[0280] As shown in Figure 10, no AIPL1 protein expression was detected in the untreated control group, and the number of residual RHO-positive cells was minimal. In the 2E7 vg and 6E7 vg dose groups, hAIPL1 was specifically expressed in photoreceptors, with RHO-positive photoreceptors significantly preserved. Their locations corresponded to areas of high hAIPL1 protein expression in the treated retina. hAIPL1 expression increased with increasing dose, as did the area occupied by RHO-positive cells. The 6E7 vg dose-treated group had a pharmacologically effective area covering approximately half of the retina. These results demonstrate that hAIPL1 expression and the efficacy of RC-C14&G33 in promoting photoreceptor preservation following subretinal administration are dose-dependent.
[0281] Example 10: Animal Efficacy of Recombinant AAV Virus RC-C14V7&G33
[0282] Serotype RC-C14V7 has been demonstrated in Example 8 to be highly effective in transducing photoreceptor cells via SR administration, with transduction levels significantly higher than those of RC-C14. Therefore, the efficacy of the recombinant AAV virus RC-C14V7&G33, encapsidated with RC-C14V7, was evaluated to determine its ability to specifically express AIPL1 in photoreceptor cells.
[0283] 10.1. Preparation, Purification, and Genome Titer Detection of Recombinant AAV Viruses
[0284] The recombinant AAV virus RC-C14V7&G33 (RC-C14V7 plasmid was obtained by replacing the "RC-C14 cap sequence" of the RC-C14 plasmid with the "RC-C14V7 cap sequence") was prepared using a method similar to that of Example 1.
[0285] In vivo experiments
[0286] In Aipl1-KO mice at DOB12, the drug was administered to both eyes via SR at doses of 2E7 vg and 6E7 vg. The administered virus was RC-C14V7&G33. The administration process was the same as in Example 2, and the administration precautions were the same as in Example 6.
[0287] Two weeks after administration, retinal tissue samples were collected from the experimental mice and immunofluorescence staining was performed using the same method as in Example 2. Rhodopsin (RHO), a representative marker of rod cells, can indicate photoreceptor cell survival. Immunofluorescence staining was visualized using a green fluorescent-labeled secondary antibody. hAIPL1, driven by the hRK photoreceptor-specific promoter, was immunofluorescently stained and visualized using a red fluorescent-labeled secondary antibody.
[0288] As shown in Figure 11, no AIPL1 protein expression was detected in the untreated control group, and the number of residual RHO-positive cells was minimal. hAIPL1 was specifically expressed in photoreceptor cells in the 2E7 vg and 6E7 vg dose groups, with RHO-positive photoreceptor cells significantly preserved, corresponding to the sites of high hAIPL1 protein expression in the treated retina. At the low dose (2E7 vg) of RC-C14V7&G33, hAIPL1 expression levels were high and a significant pharmacological effect was observed. The area occupied by RHO-positive cells increased with increasing dose, indicating that the efficacy of RC-C14V7&G33 in promoting photoreceptor preservation after subretinal administration is dose-dependent.
[0289] While the exemplary embodiments of the present invention have been described above, it should be understood by those skilled in the art that these disclosures are merely exemplary and that various other substitutions, adaptations, and modifications may be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.
[0290] Exemplary sequences
Claims
1. An isolated nucleic acid molecule comprising operably linked: a. An IRBP enhancer sequence as shown in SEQ ID NO: 18 or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, or A CMV enhancer sequence as shown in SEQ ID NO: 43 or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, b. A photoreceptor cell-specific promoter sequence, e.g., the photoreceptor cell-specific promoter sequence is selected from: The rhodopsin kinase (RK) promoter sequence as shown in SEQ ID NO: 19 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The hIRBP promoter sequence as shown in SEQ ID NO: 44 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The CRX promoter sequence as shown in SEQ ID NO: 45 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, and The RHO promoter sequence as shown in SEQ ID NO: 46 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, Or, A constitutive promoter sequence, e.g., the constitutive promoter sequence is selected from: The CBA promoter sequence as shown in SEQ ID NO: 47 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The EF1α promoter sequence as shown in SEQ ID NO: 48 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The UBC promoter sequence as shown in SEQ ID NO: 49 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The CMV promoter sequence as shown in SEQ ID NO: 50 or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, The SFFV promoter sequence shown in SEQ ID NO: 51, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, and The SV40 promoter sequence shown in SEQ ID NO: 52, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, and c. The CAG intron sequence shown in SEQ ID NO: 20, the UBC intron sequence shown in SEQ ID NO: 53, the human globin intron sequence shown in SEQ ID NO: 54, the CMV intron sequence shown in SEQ ID NO: 55, the EF1α intron sequence shown in SEQ ID NO: 56; the CMV globin intron sequence shown in SEQ ID NO: 57, or an intron sequence having at least about 90% identity thereto, e.g., an intron sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto; For example, the isolated nucleic acid molecule comprises operably linked: a. The IRBP enhancer sequence shown in SEQ ID NO: 18 or an enhancer sequence having at least about 90% identity thereto, e.g., an enhancer sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, b. A photoreceptor cell-specific promoter sequence, e.g., the photoreceptor cell-specific promoter sequence is the rhodopsin kinase (RK) promoter sequence shown in SEQ ID NO: 19, or a promoter sequence having at least about 90% identity thereto, e.g., a promoter sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto, and c. The CAG intron sequence shown in SEQ ID NO: 20 or an intron sequence having at least about 90% identity thereto, e.g., an intron sequence having about 95%, 96%, 97%, 98%, 99% or higher identity thereto.
2. An exogenous target gene expression cassette, which comprises the isolated nucleic acid molecule according to claim 1 and an exogenous target gene operably linked, e.g., an AIPL1 gene expression cassette, which comprises the isolated nucleic acid molecule according to claim 1 and a nucleotide sequence encoding AIPL1, the nucleotide sequence encoding AIPL1 being a nucleotide sequence encoding AIPL1 shown in SEQ ID NO: 5 or having at least about 90% identity (e.g., about 95%, 96%, 97%, 98%, 99% or higher identity) to SEQ ID NO: 4 or to SEQ ID NO: 3, e.g., the nucleotide sequences shown in SEQ ID NOs: 2-5.
3. A nucleic acid expression vector, the nucleic acid expression vector comprising the isolated nucleic acid molecule of claim 1 or the exogenous target gene expression cassette of claim 2 (e.g., the AIPL1 gene expression cassette), optionally, flanking the isolated nucleic acid molecule of claim 1 or the exogenous target gene expression cassette of claim 2 (e.g., the AIPL1 gene expression cassette) are one or more inverted terminal repeat (ITR) sequences, e.g., two ITR sequences, namely a 5' ITR sequence and a 3' ITR sequence, respectively.
4. The nucleic acid expression vector according to claim 3, further comprising a polyadenylation signal sequence, e.g., the human growth hormone polyadenylation signal.
5. A recombinant adeno-associated virus (rAAV) vector, comprising a capsid and a viral vector genome, the viral vector genome comprising, from the 5' end to the 3' end, a 5' ITR sequence or a variant thereof, an exogenous target gene expression cassette (which comprises the isolated nucleic acid molecule of claim 1 and an exogenous target gene effectively linked thereto, e.g., the AIPL1 gene expression cassette of claim 2), and a 3' ITR sequence or a variant thereof, optionally, one of the two flanking ITRs is a modified AAV ITR sequence allowing the production of a self-complementary viral vector genome, e.g., the ITR has the nucleotide sequence shown in SEQ ID NO:
42.
6. The rAAV vector according to claim 5, wherein the capsid comprises any one of the following capsid proteins: AAV2 capsid protein or a variant thereof, AAV5 capsid protein or a variant thereof, AAV7 capsid protein or a variant thereof, AAV8 capsid protein or a variant thereof, AAV9 capsid protein or a variant thereof, e.g., the capsid comprises an AAV2 capsid protein variant, wherein the AAV2 capsid protein variant has an insertion fragment of 587-LALGDVTRPA-588 (SEQ ID NO: 28), and I240T and V708I relative to the AAV2 capsid protein; or has an insertion fragment of 587-ALALGDVTRPA-588 (SEQ ID NO: 32), and I240T and V708I; wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO: 38; ( e.g., the capsid comprises an AAV9 capsid protein variant, wherein the AAV9 capsid protein variant has 15 functional amino acids (HQSAQAQAQTGWVQN, SEQ ID NO: 40) in variable region VIII (584-598aa) of AAV9 capsid VP1 mutated and replaced with 25 specific amino acids (LQRGNLALGDVTRPARQAATADVNT, SEQ ID NO: 41), wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO:
39.
7. A drug, which comprises the isolated nucleic acid molecule according to claim 1, the AIPL1 gene expression cassette according to claim 2, the nucleic acid expression vector according to claim 3 or 4, or the rAAV vector according to claim 5 or 6, and optionally, a pharmaceutically acceptable carrier, for example, a buffer, a diluent or an excipient.
8. Use of the isolated nucleic acid molecule according to claim 1, the AIPL1 gene expression cassette according to claim 2, the nucleic acid expression vector according to claim 3 or 4, or the rAAV vector according to claim 5 or 6, or the drug according to claim 7, for preparing a pharmaceutical composition for alleviating or treating retinal degenerative eye diseases, for example, Leber congenital amaurosis, and preferably, administering the pharmaceutical composition by intravitreal injection or subretinal injection.
9. An AAV2 capsid protein variant, which has an insertion fragment of 587-ALALGDVTRPA-588, and I240T and V708I; wherein the amino acid positions are determined with reference to the amino acid sequence positions of SEQ ID NO: 38; for example, the AAV2 capsid protein variant has the amino acid sequence shown in SEQ ID NO:
32.
10. An isolated nucleic acid, which comprises a nucleotide sequence encoding the AAV2 capsid protein variant according to claim 9.
Citation Information
Patent Citations
Adeno-associated virus variant capsids and methods of use thereof
CN109476707A
Compositions and methods for enhanced gene expression
CN110546257A
Compositions and methods for enhancing visual function
CN111417339A
Adeno-associated virus variant capsids and use for inhibiting angiogenesis
CN111770999A
Expression vector for high-level expression of exogenous gene
CN114250226A