Combination regimen of decitabine and belotecan for preventing or treating ovarian cancer

The combination of decitabine and belotecan addresses the limitations of current ovarian cancer treatments by enhancing apoptosis and inhibiting metastasis, offering a more effective therapy for ovarian cancer.

WO2025143279A1PCT designated stage expired Publication Date: 2025-07-03SEOUL NAT UNIV HOSPITAL +7
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2023/021623
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-26
Filing Date
2023-12-26
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Ovarian cancer has high mortality rates due to late diagnosis and drug resistance, with existing treatments like paclitaxel and cisplatin combination chemotherapy showing limited effectiveness and high recurrence.

Method used

A combination therapy using decitabine and belotecan, administered together, to inhibit ovarian cancer cell proliferation and metastasis, enhancing apoptosis and immune response.

Benefits of technology

The combination therapy demonstrates synergistic effects in reducing ovarian cancer cell viability, inducing apoptosis, and inhibiting metastasis, with improved treatment outcomes compared to single-drug therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2023021623_03072025_PF_FP_ABST
    Figure KR2023021623_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a combination regimen of Decitabine and Belotecan for preventing or treating ovarian cancer, and provides a pharmaceutical composition for preventing or treating ovarian cancer, the pharmaceutical composition being characterized by comprising Decitabine or a pharmaceutically acceptable salt or solvate thereof as an active ingredient, wherein the pharmaceutical composition is administered in combination with Belotecan or a pharmaceutically acceptable salt or solvate thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Combination therapy of decitabine and belotecan for the prevention or treatment of ovarian cancer

[0001] The present invention relates to a combination therapy of decitabine and belotecan for the prevention or treatment of ovarian cancer.

[0002]

[0003] Ovarian cancer is one of the most lethal gynecological cancers worldwide. In the United States, ovarian cancer caused an estimated 13,980 deaths in 2019 (4.9% of all cancer deaths in women), and its incidence is steadily increasing in Korea. However, due to the lack of effective diagnostic methods, most cases are diagnosed at an advanced stage, making treatment difficult, leading to high rates of recurrence and mortality.

[0004] The prognosis for ovarian cancer is poor because early-stage symptoms are rare, making early diagnosis difficult. Furthermore, advanced ovarian cancer often develops resistance to chemotherapy. While the five-year survival rate exceeds 90% when diagnosed early, if diagnosed late and metastatic, the five-year survival rate plummets to less than 30%.

[0005]

[0006] However, more than 75% of patients diagnosed with ovarian cancer are diagnosed only after the cancer has spread to the ovaries or the abdominal cavity, and approximately 70% of patients develop recurrence and chemotherapy resistance after treatment. The combination of paclitaxel and cisplatin chemotherapy, introduced as the standard treatment for ovarian cancer in 1996, has remained in continuous use. Despite improvements in surgical, adjuvant, and chemotherapy combinations, ovarian cancer continues to recur.

[0007]

[0008] To date, Belotecan has been used as a compound with some degree of effectiveness against ovarian cancer, but the need to develop a more effective drug has arisen.

[0009]

[0010] The purpose of the present invention is to provide a therapy for preventing, improving or treating ovarian cancer, comprising a combination of Decitabine, or a pharmaceutically acceptable salt or solvate thereof; and Belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0011] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating ovarian cancer, comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof, characterized in that the pharmaceutical composition is administered in combination with belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0012] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating ovarian cancer, comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, characterized in that the pharmaceutical composition is administered in combination with decitabine, or a pharmaceutically acceptable salt or solvate thereof.

[0013] Another object of the present invention is to provide a combination comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0014] Another object of the present invention is to provide a pharmaceutical composition for preventing, improving or treating ovarian cancer comprising the above combination.

[0015] Another object of the present invention is to provide a pharmaceutical kit for preventing, improving or treating ovarian cancer comprising the above combination.

[0016] Another object of the present invention is to provide a method for preventing, improving or treating ovarian cancer, comprising administering and / or using the combination, pharmaceutical composition or pharmaceutical kit to a subject in need thereof.

[0017] Another object of the present invention is to provide a health functional food composition for preventing or improving ovarian cancer, comprising decitabine or a food-based acceptable salt thereof and belotecan or a food-based acceptable salt thereof as active ingredients.

[0018] Another object of the present invention is to provide a feed composition for preventing or improving ovarian cancer, comprising decitabine or a feed-based acceptable salt thereof and belotecan or a feed-based acceptable salt thereof as active ingredients.

[0019] Another object of the present invention is to provide a composition for inhibiting the proliferation of ovarian cancer cell lines, comprising decitabine or a pharmaceutically acceptable salt thereof and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

[0020] Another object of the present invention is to provide a composition for inhibiting ovarian cancer metastasis, comprising decitabine or a pharmaceutically acceptable salt thereof and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

[0021] Another object of the present invention is to provide a method for preventing, improving or treating ovarian cancer, comprising the step of co-administering and / or co-using a composition comprising a pharmaceutically effective amount of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and a composition comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, to a subject in need thereof.

[0022] Another object of the present invention is to provide a use of the combination, pharmaceutical composition, or pharmaceutical kit for preventing, improving, or treating ovarian cancer, and / or for the manufacture of a medicament for preventing, improving, or treating ovarian cancer.

[0023]

[0024] The combination therapy of the present invention has an improved effect compared to a single-dose therapy, and can be usefully used for the prevention or treatment of ovarian cancer.

[0025]

[0026] Figure 1 provides information on five ovarian cancer cell lines. Specifically, the histological type, origin, and mutation type of TP53 and ARID1A in each cell line are shown.

[0027] Figure 2 shows the cell viability of human and mouse ovarian carcinoma cell lines. The results are shown after cells were treated with the indicated doses of belotecan or topotecan, with open circles representing belotecan and closed circles representing topotecan treatment (n=3). Belotecan and topotecan were administered at nanomolar doses to ES-2 [A] and TOV-112D [D] cells and at micromolar doses to SKOV3 [B], TOV-21G [C], and ID8 [E] cells. Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05).

[0028] Figure 3 shows the cell viability of human and mouse ovarian carcinoma cell lines after treatment with various doses of decitabine. The line graphs represent the results of the MTT assay performed in ES-2 [A], TOV-21G [C], SKOV3 [B], TOV-112D [D], and ID8 [E] cells. Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05).

[0029] Figure 4 demonstrates the cell viability of human ovarian cancer cell lines after combination treatment with belotecan and various doses of decitabine. The bar graphs show the additive effect of belotecan and decitabine on the viability of ES-2 [A], SKOV3 [B], TOV-21G [C], and TOV-112D [D] cells. The graphs are expressed as the mean ± standard deviation of three independent biological replicates. Statistical significance compared to the control group is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05). Lowercase a indicates statistical difference compared to belotecan monotherapy.

[0030] Figure 5 shows apoptosis in human ovarian cancer cell lines ES-2 [A], SKOV3 [B], TOV-21G [C], and TOV-112D [D] after treatment with belotecan and / or decitabine for 48 hours. Dot plots show flow cytometric analysis results for cells stained with Annexin V and PI. Bar graphs represent the relative values ​​of Annexin V- and PI-double-positive cells. Graphs are expressed as the mean ± standard deviation of three independent biological replicates. Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05). Lowercase a indicates statistical difference compared to belotecan monotherapy.

[0031] Figure 6 shows the transcriptional expression of TNF and TGFB1 after treatment with decitabine for 24 hours. The bar graphs represent the relative expression levels of TNF and TGFB1 mRNA after decitabine treatment in ES-2 [A and F], SKOV3 [B and F], TOV-21G [C and G], and TOV-112D [D and H]. The graphs are expressed as the mean ± standard deviation of three independent biological replicates. Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05).

[0032] Figure 7 shows flow cytometric analysis of lymphocytes in the spleen of mice after decitabine treatment. Decitabine (0.25 mg / kg) was administered intraperitoneally five times on day 1, six times on day 2, and ten times on day 2. SSC-A / FSC-A contour plots indicate gating based on lymphocyte size. Cells were gated on FSC-A / FSC-H to remove doublets. The third row of plots shows the percentage of CD3+CD8+ T cells in control [A], five [B], six [C], and ten [D] treated mice (n=1). Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05).

[0033] Figure 8 shows the timeline of the experimental procedures including [A] surgery, grouping, treatment, and sacrifice. Specifically, ID8 cells (1.0 x 10 in 100 μl) were injected subcutaneously into mice. 7 ) were transplanted. Mice were injected with belotecan (0.17 mg / kg) PBS or a combination of belotecan (0.17 mg / kg) and decitabine (0.25 mg / kg). Decitabine was injected six times at 2-day intervals, and data were measured 2 weeks after the final treatment. [B] The table shows the results of measuring the subcutaneous tumor size and mass of mice in each treatment group (n=5). [C] The graph shows the subcutaneous tumor volume (n=5). [D] The bar graph shows the relative value of the CD3+ T cell percentage in the mouse spleen (n=3). [E and F] The bar graphs show the relative values ​​of the CD8+PD-1+ T cell and CD8+CTLA4+ T cell percentages in the mouse spleen in each treatment group (n=3). The data in the bar graphs are expressed as mean ± SD. Statistical significance is indicated by asterisks (***P < 0.001, **P < 0.01, *P < 0.05).

[0034]

[0035] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions described below.

[0036] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0037] Additionally, numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety to provide a clearer understanding of the state of the art and the scope of the present invention.

[0038]

[0039] One aspect of the present invention is a therapy for preventing, improving or treating ovarian cancer, comprising a combination of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0040] Another aspect of the present invention is a pharmaceutical composition for preventing or treating ovarian cancer, comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof, characterized in that the pharmaceutical composition is administered in combination with belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0041] Another aspect of the present invention is a pharmaceutical composition for preventing or treating ovarian cancer, comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, characterized in that the pharmaceutical composition is administered in combination with decitabine, or a pharmaceutically acceptable salt or solvate thereof.

[0042]

[0043] The 'Decitabine' of the present invention acts as a nucleic acid synthesis inhibitor and is used as a drug for the treatment of myelodysplastic syndrome and acute myeloid leukemia (AML), a condition in which certain blood cells do not function. The IUPAC name of the decitabine is 4-Amino-1-(2-deoxy-β-D-erythro-pentofuranosyl)-1,3,5-triazin-2(1H)-one, and in the present invention, either a commercially available decitabine or one manufactured by a known chemical synthesis method may be used, and is also referred to as 5-aza-2'-deoxycytidine and has a trade name of Dacogen, and has a chemical formula represented by the following chemical formula 1.

[0044] [Chemical Formula 1]

[0045]

[0046]

[0047] The 'Belotecan' of the present invention is a semi-synthetic camptothecin analogue used as a drug for chemotherapy and small cell lung cancer and ovarian cancer. The IUPAC name of the above belotecan is (4S)-4-Ethyl-4-hydroxy-11-[2-(isopropylamino)ethyl]-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14(4H,12H)-dione, and in the present invention, either a commercially available belotecan or one manufactured by a known chemical synthesis method may be used. The above belotecan has a trade name of Camtobell and has a structure represented by the following chemical formula 2.

[0048] [Chemical Formula 2]

[0049]

[0050]

[0051] Meanwhile, the compounds of the present invention are meant to include not only compounds having a specific structural formula, but also clathrates, hydrates, solvates, or polymorphs thereof. In addition, the compounds of the present invention are meant to include pharmaceutically acceptable salts of the compounds of the present invention, unless such pharmaceutically acceptable salts are mentioned. In one embodiment, the compounds of the present invention may exist as stereomerically pure compounds (e.g., substantially free of other stereoisomers (e.g., 85% ee or more, 90% ee or more, 95% ee or more, 97% ee or more, or 99% ee or more)), but are not limited thereto.

[0052] The term "hydrate" means a compound of the present invention or a pharmaceutically acceptable salt thereof comprising a stoichiometric or non-stoichiometric amount of water bound by non-covalent intermolecular forces.

[0053] The term "clathrate" means a compound of the present invention or a salt thereof in the form of a crystal lattice containing spaces (e.g., channels) that confine guest molecules (e.g., solvent or water).

[0054] The phrases “pharmaceutically acceptable” or “pharmaceutically acceptable” mean suitable for use as a pharmaceutical preparation and may be used to refer to compounds, materials, compositions and / or dosage forms which, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response or other problems or complications, and which have a reasonable benefit / risk ratio.

[0055] The term "pharmaceutically acceptable salt" or "pharmaceutically acceptable salt" of the present invention refers to a derivative of the disclosed compound in which the parent compound is modified by preparing an acid or base salt thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic moieties such as amines; alkali or organic salts of acidic moieties such as carboxylic acids; and the like. Examples of pharmaceutically acceptable salts of the present invention include, but are not limited to, salts commonly used in the pharmaceutical field such as hydrochloride, hydrobromide, hydroiodide, hydrogen fluoride, sulfate, sulfonate, citrate, camphorate, maleate, acetate, lactate, nikitate, nitrate, succinate, phosphate, malonate, malate, salicylate, phenylacetate, stearate, formate, fumarate, urea, sodium, potassium, calcium, magnesium, zinc, lithium, cinnamate, methylamino, methanesulfonate, picrate, p-toluenesulfonate, naphthalenesulfonate, tartrate, triethylamino, dimethylamino, and tri(hydroxymethyl)aminomethane.

[0056] Pharmaceutically acceptable salts of the present invention can be synthesized from parent compounds containing basic or acidic moieties by conventional chemical methods. Typically, such salts can be prepared by reacting the free acid or base form of the compound with a sufficient amount of a suitable base or acid in water or in an organic diluent such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile, or mixtures thereof.

[0057] The term "solvate" or "pharmaceutically acceptable solvate" refers to a solvate formed by the association of a compound with one or more solvent molecules. The term solvate includes hydrates (e.g., hemihydrate, monohydrate, dihydrate, trihydrate, tetrahydrate, etc.).

[0058]

[0059] The pharmaceutical composition according to the present invention can be prepared according to conventional methods in the pharmaceutical field. The pharmaceutical composition can be combined with an appropriate pharmaceutically acceptable carrier depending on the formulation, and, if necessary, can be prepared by further including excipients, diluents, dispersants, emulsifiers, buffers, stabilizers, binders, disintegrants, solvents, etc. The appropriate carriers, etc., which do not inhibit the activity and properties of the compound according to the present invention, can be selected differently depending on the dosage form and formulation.

[0060] The pharmaceutical composition of the present invention may additionally include suitable carriers, excipients, or diluents commonly used in the manufacture of pharmaceutical compositions. A composition including a pharmaceutically acceptable carrier may be in various parenteral dosage forms. When formulated, the composition may be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants commonly used. Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin.

[0061] The preferred dosage of the pharmaceutical composition and concomitant ingredients according to the present invention varies depending on the patient's condition, body weight, severity of the disease, drug form, route of administration, and duration of administration, but can be appropriately selected by those skilled in the art. However, for desirable effects, the dosage may be 0.0001 to 100 mg / kg per day, specifically 0.001 to 100 mg / kg. The dosage may be administered once a day or divided into several doses. However, the scope of the present invention is not limited by the above dosage.

[0062] The pharmaceutical composition according to the present invention may be administered by intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but is not limited thereto.

[0063]

[0064] In addition, the pharmaceutical composition of the present invention may have any one dosage form selected from the group consisting of, but not limited to, tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.

[0065] Each component of the pharmaceutical composition according to the present invention may be included in the pharmaceutical composition in a pharmaceutically effective amount.

[0066] "Pharmaceutically effective amount" means an amount sufficient to inhibit or alleviate increased vascular permeability at a reasonable benefit / risk ratio applicable to the medical use, and the effective dose level may be determined based on factors including the type and severity of the disease, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0067] The effective dosage level of the pharmaceutical composition may vary depending on the intended use, the patient's age, sex, weight, and health condition, the type and severity of the disease, the activity and sensitivity of the drug, the method of administration, the time of administration, the route of administration, and the excretion rate, the duration of treatment, the drugs used in combination or concurrently, and other factors well known in the medical field. For example, although not fixed, it may generally be administered at a dosage of 0.001 to 100 mg / kg, for example, 0.01 to 10 mg / kg once or several times daily. The above dosage does not limit the scope of the present invention in any way.

[0068] The pharmaceutical composition may be appropriately administered to a subject according to a conventional method, administration route, and dosage used in the art, depending on the purpose or need. Examples of administration routes include oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal administration, and parenteral injection includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In addition, an appropriate dosage and frequency of administration may be selected according to a method known in the art, and the actual amount of the pharmaceutical composition of the present invention to be administered and the frequency of administration may be appropriately determined by various factors, such as the type of symptom to be treated, administration route, sex, health condition, diet, age and weight of the subject, and severity of the disease.

[0069] The term "administration" refers to introducing the pharmaceutical composition of the present invention into a subject by any suitable method, and the route of administration may be through various parenteral routes as long as it can reach the target tissue.

[0070] The pharmaceutical composition may be administered to any animal capable of developing ovarian cancer, including, for example, humans and primates, as well as livestock such as cows, pigs, horses, and dogs. In some embodiments, the animal may be an animal other than a human.

[0071]

[0072] In the present invention, "combined administration," "combined use," and "combined use" not only mean simultaneous administration, but may also refer to a dosage form in which decitabine, or a pharmaceutically acceptable salt or solvate thereof, and belotecan, or a pharmaceutically acceptable salt or solvate thereof, act together on a subject so that each substance can perform a level equivalent to or higher than its original function. Therefore, when the term "combined use" is used herein, it should be understood that it refers to simultaneous, separate, sequential, or reverse administration, and the order is unlimited. When the administration is sequential, reverse, or separate, the order of administration is not particularly limited, but the interval between administrations of the secondary components should be such that the beneficial effect of the combination is not lost.

[0073] In the present invention, (i) a composition comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof, and (ii) a composition comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, may be administered in the following forms, but are not limited thereto:

[0074] a) administered as a mixture of (i) decitabine, or a pharmaceutically acceptable salt or solvate thereof; and (ii) belotecan, or a pharmaceutically acceptable salt or solvate thereof; or

[0075] b) (i) decitabine, or a pharmaceutically acceptable salt or solvate thereof; and (ii) belotecan, or a pharmaceutically acceptable salt or solvate thereof, may be administered in separate forms, but are not limited thereto.

[0076] When (i) decitabine, or a pharmaceutically acceptable salt or solvate thereof; and (ii) belotecan, or a pharmaceutically acceptable salt or solvate thereof, are in separate forms, (i) and (ii) may be formulated as separate formulations and administered simultaneously, separately, sequentially, or in reverse order.

[0077] The therapeutically effective dosage of each active ingredient used in combination may vary depending on the specific compound or pharmaceutical composition used, the mode of administration, the condition being treated, the severity of the condition being treated, the species of warm-blooded animal, body weight, sex, diet, and age. Therefore, the dosage regimen using the compounds of the present invention is selected based on various factors, including the route of administration and the patient's renal and hepatic function. A surgeon, clinician, or veterinarian skilled in the art can readily determine and prescribe the effective dose of the drug required to prevent, counteract, or arrest the progression of the condition. Optimal precision in achieving drug concentrations within a range that achieves efficacy without toxicity requires a regimen based on the kinetics of drug availability at the site of targeting. This includes considering drug distribution, equilibrium, and elimination. Therefore, the dosage regimen, i.e., the dosage level and frequency of administration of any individual component of the present invention, can be adjusted to provide the optimal therapeutic response.

[0078] The composition of the present invention may suppress the proliferation ability of ovarian cancer cell lines compared to administration of decitabine or belotecan alone, and may enhance the killing effect of ovarian cancer cell lines compared to administration of decitabine or belotecan alone.

[0079] In one embodiment of the present invention, it was confirmed that apoptosis increased when decitabine and belotecan were administered together compared to when decitabine or belotecan was administered alone, and in a mouse allograft model, it was confirmed that tumor growth was significantly reduced when decitabine and belotecan were administered together compared to when decitabine or belotecan was administered alone. This confirmed a remarkable synergistic effect in the treatment of ovarian cancer when decitabine and belotecan were administered together.

[0080] Another aspect of the present invention is a combination comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0081] The term "combination" in the present invention refers to a combined administration use of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, and can be understood to have the same meaning as combined use. This also includes, but is not limited to, pharmaceutical compositions and pharmaceutical kit forms characterized by the combined use of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0082]

[0083] Another aspect of the present invention is a kit for preventing or treating ovarian cancer, comprising (i) decitabine, or a pharmaceutically acceptable salt or solvate thereof; and (ii) belotecan, or a pharmaceutically acceptable salt or solvate thereof, as active ingredients. The "kit" in the present invention may include a combination or composition according to the present invention for co-administration of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof. Specifically, the kit of the present invention may include individual formulations of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, or decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, each formulated as a single formulation. The kit may additionally include a material necessary for co-administration of the two substances, but is not necessarily limited thereto.

[0084] In the present invention, the term "kit" refers to a collection of parts that can be assembled to create something, and in the present invention, refers to a collection of experimental supplies provided to prevent or treat the above ovarian cancer disease.

[0085]

[0086] The term "ovarian cancer" in this invention is one of the most lethal gynecological cancers worldwide. The majority of ovarian cancers are malignant tumors that develop from genetic mutations in ovarian epithelial cells, and are therefore called epithelial ovarian cancers. Epithelial ovarian cancers are classified into serous carcinoma, mucinous carcinoma, endometrioid carcinoma, and clear cell carcinoma based on histopathological analysis (Kaku T et al., Med Electron Microsc, 36:9-17, 2003). The incidence of ovarian cancer is gradually increasing in Korea. However, due to the lack of effective diagnostic methods for ovarian cancer, most cases are diagnosed at a difficult-to-treat stage, resulting in high recurrence and mortality rates.

[0087] The term "treatment" in the present invention refers to clinical intervention to alter the natural process of a subject or cell to be treated, and this can be performed during the progression of a clinical pathological condition or to prevent it. The desired therapeutic effect includes preventing the occurrence or recurrence of a disease, alleviating symptoms, reducing all direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, alleviating or temporarily alleviating the disease condition, and causing remission or improving the prognosis. Specifically, it means any act that improves or beneficially changes the symptoms of ovarian cancer by administering the pharmaceutical composition, and "prevention" means any act that inhibits or delays the onset of ovarian cancer by administering the pharmaceutical composition.

[0088] The term "improvement" of the present invention means any action that at least reduces a parameter related to ovarian cancer, for example, the severity of symptoms, by administering the composition of the present invention.

[0089]

[0090] Another aspect of the present invention is a method for preventing, improving or treating ovarian cancer, comprising administering and / or using a combination, pharmaceutical composition or pharmaceutical kit comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, to a subject in need thereof.

[0091] Another aspect of the present invention is a method for preventing, improving or treating ovarian cancer, comprising administering and / or using in combination a composition comprising a pharmaceutically effective amount of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and a composition comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, to a subject in need thereof.

[0092] Another aspect of the present invention is a composition comprising a pharmaceutically effective amount of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and a pharmaceutical composition comprising belotecan, or a pharmaceutically acceptable salt or solvate thereof, or a pharmaceutical kit for use in the prevention, amelioration or treatment of ovarian cancer, and / or for the manufacture of a medicament for the prevention, amelioration or treatment of ovarian cancer.

[0093] Another aspect of the present invention provides a pharmaceutical composition for inhibiting metastasis of ovarian cancer, comprising a pharmaceutically effective amount of decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof.

[0094]

[0095] A composition comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, for the prevention and treatment of ovarian cancer, as described above in other embodiments.

[0096]

[0097] Another aspect of the present invention is a health functional food composition for preventing or improving ovarian cancer, comprising decitabine or a food-based acceptable salt thereof and belotecan or a food-based acceptable salt thereof as active ingredients.

[0098] The food composition of the present invention includes forms such as pills, powders, granules, infusions, tablets, capsules, or liquids, and foods to which the composition of the present invention can be added include, for example, various foods, such as beverages, gum, tea, vitamin complexes, and health supplements.

[0099] In addition, as mentioned above, food auxiliary additives may be additionally added, and the food auxiliary additives include food auxiliary additives conventional in the art, such as flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, etc.

[0100] Examples of the above natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., common sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. In addition to those described above, natural flavoring agents (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used as flavoring agents.

[0101] In addition to the above, the food composition of the present invention may include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may include fruit pulp for the production of natural fruit juices, fruit juice drinks, and vegetable drinks. These ingredients may be used independently or in combination.

[0102] The above health supplements include health functional foods and health foods.

[0103] The above functional food is the same term as food for special health use (FoSHU), and refers to a food with high medical and healthcare effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition. Here, "functionality" means regulating nutrients for the structure and function of the human body or obtaining a useful effect for health purposes such as physiological action. The food of the present invention can be manufactured by a method commonly used in the art, and during the manufacturing process, raw materials and ingredients commonly added in the art can be added. In addition, the formulation of the food can be manufactured without limitation as long as it is a formulation recognized as a food. The food composition of the present invention can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur when taking drugs for a long time by using food as a raw material, and is highly portable, so the food composition of the present invention can be taken as a supplement to enhance the effect of preventing or improving ovarian cancer.

[0104]

[0105] Another aspect of the present invention is a feed composition for preventing or improving ovarian cancer, comprising decitabine or a feed-based acceptable salt thereof and belotecan or a feed-based acceptable salt thereof as active ingredients.

[0106] The above feed composition may contain, in addition to decitabine and belotecan, known carriers, stabilizers, or additives acceptable for pharmaceutical, food, or feed use. For example, binders, emulsifiers, and preservatives may be added to prevent quality deterioration, and amino acids, vitamins, enzymes, flavoring agents, non-protein nitrogen compounds, silicates, buffers, extractants, oligosaccharides, and the like may be added to the feed to increase utility. In addition, feed mixers may be additionally included, but are not limited thereto. The feed composition may also contain various nutrients such as vitamins, amino acids, and minerals, antioxidants, and other additives, as needed, and may be in an appropriate form such as powder, granules, pellets, or suspension. The feed composition of the present invention may be supplied to single animals alone or mixed with feed. The feed of the present invention is not particularly limited, and there is no limitation as long as it is for animals such as dogs, cats, horses, and cows, and any feed such as powdered feed, solid feed, dry feed, wet feed, moist pellet feed, dry pellet feed, EP (Extruder Pellet) feed, and raw feed may be used.

[0107]

[0108] Another aspect of the present invention is a composition for inhibiting the proliferation of ovarian cancer cell lines, comprising decitabine or a pharmaceutically acceptable salt thereof and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

[0109] Another aspect of the present invention is a composition for inhibiting ovarian cancer metastasis, comprising decitabine or a pharmaceutically acceptable salt thereof and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

[0110] A composition comprising decitabine, or a pharmaceutically acceptable salt or solvate thereof; and belotecan, or a pharmaceutically acceptable salt or solvate thereof, and for ovarian cancer, as described above in the other embodiments.

[0111]

[0112] Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify the present invention, and the scope of the present invention is not limited to these examples and experimental examples.

[0113]

[0114] Manufacturing Example 1: Reagent

[0115] Belotecan (Camtobel®) was supplied by Chong Kun Dang Pharmaceutical Co., Ltd. (Seoul, Korea), and decitabine (Decilid®) was supplied by Samyang Biopharm (Seongnam, Korea). Topotecan hydrochloride hydrate (Cat. T2705) was purchased from Sigma-Aldrich (St. Louis, USA). For in vitro experiments, stock solutions of belotecan (2 mM), topotecan (5 mM), and decitabine (20 mM) were prepared by dissolving them in UPW.

[0116]

[0117] Manufacturing Example 2: Cell Culture

[0118] ES-2 human ovarian clear cell carcinoma cell line (Cat. CRL-1978, ATCC), TOV-21G human ovarian adenocarcinoma cell line (Cat. CRL-11730, ATCC), and TOV-112D human ovarian endometrial carcinoma cell line (Cat. CRL-11731, ATCC) were purchased from the American Type Culture Collection (ATCC) (Manassas, VA, USA), and SKOV3 human ovarian adenocarcinoma cell line (Cat. 30077, KCLB) was purchased from the Korean Cell Line Bank (Seoul, Korea). In addition, ID8 mouse ovarian surface epithelial cell line (Cat. SCC145, Merck Millipore) was purchased from Merck Millipore (Temecula, CA, USA).

[0119] ES-2 cells were maintained in McCoy's 5A medium (Cat. 16600082, Gibco) supplemented with 10% fetal bovine serum (FBS). TOV-21G and TOV-112D cells were maintained in DMEM / high glucose supplemented with 10% FBS and 1% penicillin / streptomycin. SKOV3 cells were maintained in RPMI 1640 (with HEPES) medium (Cat. SH30255.01, Hyclone) supplemented with 10% FBS and 1% penicillin / streptomycin. ID8 cells were maintained in DMEM / high glucose supplemented with 4% FBS, 5 μg / ml insulin, 5 μg / ml transferrin, 5 ng / ml sodium selenite, and 1% penicillin / streptomycin. All cells were grown at 37°C in a 5% CO2 incubator, and monolayer cells were cultured to 70–80% confluence for use in experiments.

[0120]

[0121] Manufacturing Example 3: Cell Viability Evaluation

[0122] Cell viability was determined using an MTT detection kit (Cat. 11465007001, Roche). To assess viability, cells were seeded in 96-well culture plates and treated with various concentrations of topotecan, belotecan, and decitabine for 48 hours. MTT labeling reagent was added to the cells and incubated for 4 hours. Afterwards, the solubilizing solution was added to the cells without removing the medium. After overnight incubation at 37°C, the reaction wells were detected by colorimetric analysis using a spectrophotometer.

[0123]

[0124] Manufacturing Example 4: Cell Death Assay

[0125] An Annexin V detection kit (Cat. 556547, BD Biosciences) was used to analyze apoptosis in ovarian cancer cell lines. Based on the viability analysis results, the concentration of belotecan for each cell line was determined. Cells were treated with belotecan and / or decitabine for 48 hours. Cells were then harvested and stained with Annexin V and propidium iodide (PI) for 15 minutes at room temperature. For flow cytometry detection, the stained cell suspension was diluted with 1X binding buffer. Fluorescence signals were analyzed using an Accuri C6 Plus (BD Biosciences).

[0126]

[0127] Manufacturing Example 5: RNA isolation and RT-PCR

[0128] For total RNA isolation, cells were treated with 5 and 10 μM decitabine for 24 hours. After 24 hours of treatment, cells were washed with PBS and lysed using Transzol-Up (Cat. ET111-01, TransGen Biotech). Total RNA concentration and purity were determined using a nanodrop spectrophotometer. The expression levels of target genes were measured and analyzed using the StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The 2-ΔΔCT method was used to quantify relative gene expression levels. Gene expression levels of all samples were normalized to the expression levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Each primer was designed with reference to the mRNA sequences in the NCBI GenBank database and synthesized by Bioneer (Daejeon, Korea). The primer sequences of the target genes are shown in Table 1 below.

[0129]

[0130] Primer sequence for RT-PCR Gene symbol GenBank no. Forward primer (5′→3′) Reverse primer (5′→3′) TNFNM_000594.4 CCCGACTATCTCGACTTTGCGGGGGTAATAAAGGGATTGGTGFB1NM_000660.7 CCCTGGACACCAACTATTGCTGCGGAAGTCAATGTACAGCGAPDHNM_001289745.3 GGCTCTCCAGAACATCATCCTTTCTAGACGGCAGGTCAGG

[0131] Manufacturing Example 6: Animal

[0132] The experimental procedures were approved by the Institutional Animal Care and Use Committee of Korea University (KUIAUCC-2019-0055) and complied with the principles of laboratory animal care. Four-week-old female C57BL / 6(J) mice were purchased from DBL (Incheon, Korea) and housed for 1 week for adaptation. All mice were housed in a controlled environment (12 / 12 h light / dark cycle, 23°C, 50% humidity) and had free access to food and water. The ID8 allogeneic transplantation mouse model was performed by injecting ID8 cells (5.0 x 10 in 100 μl) into the animal model. 7 ) were injected subcutaneously into mice. To ensure stable cell growth, ID8 cells were resuspended in a 1:1 mixture of PBS and Matrigel before injection. The subcutaneous tumor size was 50 mm. 3 When reached, mice were randomly divided into three groups (n=5). Tumor length and width were measured with a caliper.

[0133]

[0134] Manufacturing Example 7: Drug Administration

[0135] Decitabine (0.25 mg / kg) was diluted in PBS and injected intraperitoneally six times every other day for 12 days. The decitabine dose was determined based on the standard human decitabine dose (20 mg / m2). Belotecan (0.17 mg / kg) was administered intraperitoneally for 5 consecutive days starting the day after decitabine injection. Belotecan was diluted in PBS, and the dose for mice was determined based on the standard human treatment (0.5 mg / m2). Control mice received only PBS. The dose of the anticancer drug for mouse administration was calculated based on the following formula: B = A / (37 × 0.081) (A: human dose, B: mouse dose).

[0136]

[0137] Manufacturing Example 8: Flow cytometric analysis of lymphocytes in mouse spleen

[0138] Spleens were isolated from mice treated with vehicle, belotecan, and both belotecan and decitabine. Fresh spleen tissue was filtered through a 70 μm cell strainer to obtain spleen cells. Cells were sedimented by centrifugation and resuspended in RBC Lysis Buffer (Cat. 42031, BioLegend) to remove red blood cells. Cells were resuspended in fresh RPMI-1640 medium containing 5% FBS and seeded at a density of 1.0 x 10 6 Cells were counted and transferred to new Eppendorf tubes for staining. For flow cytometry, cells were incubated with FITC anti-mouse CD3ε antibody (Cat. 100305, BioLegend), APC Rat Anti-Mouse CD8a (Cat. 553035, BD Biosciences), PE-Cy™7 Rat Anti-Mouse CD45 (Cat. 552848, BD Biosciences), PE Hamster Anti-Mouse CD152 (CTLA4) (Cat. 553720, BD Biosciences), and PE Hamster Anti-Mouse CD279 (PD-1) (Cat. 561788, BD Biosciences). Anti-CD152 and anti-CD279 staining were performed in separate tubes. After 20 minutes, the staining solution was removed, and cells were resuspended in 5% FBS-PBS. Stained cells were detected and analyzed using FACSVerse (BD Biosciences).

[0139]

[0140] Manufacturing Example 9: Statistical Analysis

[0141] Statistical analysis was performed using the General Linear Model Procedure in SAS software (Cary, NC, USA). Statistical significance was analyzed using a one-way ANOVA followed by Tukey's post hoc test. Data are expressed as mean ± standard deviation (SD). A P value less than 0.05 was considered significant.

[0142]

[0143] Example 1: Confirmation of the cell viability effects of belotecan and topotecan in five types of ovarian cancer cell lines.

[0144] To investigate the therapeutic response to the anticancer drugs belotecan and topotecan in ovarian cancer cells, various human ovarian cancer cell lines, including ES-2, SKOV3, TOV21G, and TOV112D, as well as the mouse ovarian cancer cell line ID8, were used. All cell lines harbored different mutation types in TP53 and ARID1A, as shown in Figure 1.

[0145] To more clearly demonstrate the differences between the two reagents (belotecan and topotecan), a range of experimental concentrations for belotecan and topotecan was determined for each ovarian cancer cell line through preliminary experiments. To compare the cytotoxic effects of belotecan and topotecan, cell viability was assessed using the MTT assay.

[0146] As a result, belotecan was found to be more effective in impairing cell viability than topotecan at all experimental doses in ES-2 (Fig. 2A), TOV-21G (Fig. 2C), and ID8 (Fig. 2E) cell lines. In TOV-112D cells, both belotecan and topotecan only slightly affected cell viability at concentrations below 5 μM. However, at doses higher than 8 μM, belotecan reduced TOV-112D cell viability to a greater extent than topotecan (Fig. 2D). In contrast, in the SKOV3 cell line, the decrease in cell viability was almost identical between belotecan and topotecan treatments (Fig. 2B).

[0147] The above results suggest that belotecan is more effective than topotecan in inhibiting cell viability in ovarian cancer cells, except for SKOV3.

[0148]

[0149] Example 2: Effect of decitabine on the survival rate of five types of ovarian cancer cell lines.

[0150] Next, the anticancer effects of decitabine were confirmed in four types of human ovarian cancer cell lines and one type of mouse ovarian cancer cell line.

[0151] As a result, 100 μM decitabine treatment in ES-2 cells reduced cell viability by approximately 0.86-fold (P < 0.01) (Fig. 3A). TOV-21G cells showed a similar decrease in viability by approximately 0.73-fold (P < 0.001 and P < 0.05) at 100 μM decitabine (Fig. 3C). SKOV3 and TOV-112D cells showed a 0.97-fold and 0.92-fold decrease (P < 0.05) at 100 μM decitabine, respectively, showing little effect on viability (Figs. 3B and 3D). In contrast, decitabine significantly inhibited the viability of ID8 cells. Specifically, a 0.4-fold decrease was observed at 1 μM (P < 0.001) and a 0.33-fold decrease was observed at 50 μM (P < 0.001) (Fig. 3E).

[0152]

[0153] Example 3: Effect of combination therapy with belotecan and decitabine in human ovarian cancer cell lines.

[0154] We aimed to determine the concentration of decitabine that does not directly affect cell viability when co-administered with belotecan in ovarian cancer cell lines. Therefore, we examined cell viability when co-administered with belotecan and various concentrations of decitabine in ES-2, SKOV3, TOV-21G, and TOV-112D cells. The concentration of belotecan for each cell line was determined based on previous viability assay results. The dose that induced a 40-50% reduction in viability was selected for combination therapy.

[0155] As a result, in ES-2 (Fig. 4A), SKOV3 (Fig. 4B), and TOV-112D (Fig. 4D) cells, decitabine showed an additive effect of reducing cell viability only at a high concentration of 10 μM. In TOV-21G cells, viability was statistically reduced at decitabine concentrations of 0.1–10 μM compared to belotecan treatment alone (Fig. 4C).

[0156]

[0157] Example 4: Effect of combined treatment with belotecan and decitabine on apoptosis induction in human ovarian cancer cell lines.

[0158] Based on the results of Example 3, we attempted to confirm the induction of apoptosis in human ovarian cancer cell lines after treatment with belotecan and 10 μM decitabine.

[0159] As a result, decitabine did not induce apoptosis in any cell lines when treated alone. However, belotecan treatment statistically increased the proportion of apoptotic cells in all cell lines. In ES-2 cells, combination treatment with decitabine showed a similar increase in apoptosis as belotecan treatment alone (Fig. 5A). In contrast, in SKOV3 (Fig. 5B), TOV-21G (Fig. 5C), and TOV-112D (Fig. 5D), combination treatment with belotecan and decitabine increased apoptosis compared to belotecan treatment alone.

[0160]

[0161] Example 5: Confirmation of regulation of transcription levels of inflammation-related genes in human ovarian cancer cell lines by decitabine.

[0162] We aimed to investigate the expression levels of TNF and TGFB1 after decitabine treatment.

[0163] As a result, the expression of TNF did not show statistical changes in ES-2 (Fig. 6A), but was significantly increased by up to 1.71-fold (P < 0.01) and 1.18-fold (P < 0.05) in SKOV3 and TOV-21G cells by decitabine treatment (Figs. 6B and 6C). However, decitabine reduced the transcription level of TNF by approximately 0.49-fold (P < 0.01) in TOV-112D (Fig. 6D).

[0164] Additionally, TGFB1 expression was increased in ES-2 (Fig. 6E), SKOV3 (Fig. 6F), and TOV-112D (Fig. 6H) by treatment with 5 and 10 μM decitabine. However, in TOV-21G, TGFB1 levels were slightly increased at 5 μM decitabine and statistically decreased at 10 μM (Fig. 6G).

[0165]

[0166] Example 6: Confirmation of tumor growth effect in a mouse allograft model by combination treatment with belotecan and decitabine.

[0167] To determine the optimal injection frequency and administration time for verifying the immunomodulatory effects of decitabine, a preliminary experiment was conducted in mice. Specifically, decitabine (0.25 mg / kg) was administered via intraperitoneal injection five times daily or six or ten times every other day.

[0168] As a result, the CD3+CD8+ T cell population was 10.7% in control mice (Fig. 7A) and 13.0% in mice treated with decitabine five times a day (Fig. 7B). In mice administered decitabine six and ten times every other day, the CD3+CD8+ T cell population was 16.8% and 15.6%, respectively (Figs. 7C and 7D).

[0169] Based on the above results, we designed a pretreatment regimen of decitabine six times over 12 days. To evaluate the anticancer and immunomodulatory effects of the combination treatment of decitabine and belotecan in vitro, vehicle, belotecan, or belotecan and decitabine were administered to the ID8 allograft mouse model (Fig. 8A). Tumor growth of the ID8 allograft tumors was evaluated (Fig. 8B). As a result, the tumor volume was reduced by approximately 0.72-fold in the belotecan treatment group, but the difference was not statistically significant, whereas the belotecan and decitabine combination treatment group showed a statistically significant (P < 0.05) decrease of 0.63-fold (Fig. 8C).

[0170] Additionally, changes in T cell subpopulations in the mouse spleen were evaluated. As a result, it was confirmed that combination treatment with belotecan and decitabine increased T cell numbers by approximately 1.98-fold (P < 0.05), whereas belotecan monotherapy did not cause any changes in T cell numbers (Fig. 8D).

[0171] Additionally, we examined the expression of PD-1 and CTLA4 in cytotoxic T cells. As a result, we confirmed that the population of cytotoxic T cells expressing PD-1 and CTLA4 did not significantly change in either the belotecan or combination treatment groups compared to the control group (Figures 8E and 8F).

[0172]

[0173] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A pharmaceutical composition for the prevention or treatment of ovarian cancer, comprising decitabine or a pharmaceutically acceptable salt or solvate thereof as an active ingredient, A pharmaceutical composition, characterized in that the composition is administered in combination with Belotecan, or a pharmaceutically acceptable salt or solvate thereof.

2. A pharmaceutical composition according to claim 1, wherein the composition inhibits the proliferation ability of ovarian cancer cell lines compared to administration of decitabine or belotecan alone.

3. A pharmaceutical composition according to claim 1, wherein the composition enhances the killing effect of ovarian cancer cell lines compared to administration of decitabine or belotecan alone.

4. A pharmaceutical composition in accordance with claim 1, wherein the composition further comprises a pharmaceutically acceptable carrier, excipient or diluent.

5. A pharmaceutical composition according to claim 1, characterized in that decitabine, or a pharmaceutically acceptable salt or solvate thereof, is administered concurrently, sequentially, or in reverse order with belotecan, or a pharmaceutically acceptable salt or solvate thereof.

6. In paragraph 1, A pharmaceutical composition for preventing or treating ovarian cancer, wherein the pharmaceutical composition is administered by at least one administration method selected from the group consisting of intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, topical administration, intranasal administration, intrapulmonary administration, and rectal administration. 7.(i) Decitabine, or a pharmaceutically acceptable salt or solvate thereof; and (ⅱ) A kit for preventing or treating ovarian cancer, comprising belotecan or a pharmaceutically acceptable salt or solvate thereof as an active ingredient.

8. A health functional food composition for preventing or improving ovarian cancer, comprising decitabine or a food-related acceptable salt thereof and belotecan or a food-related acceptable salt thereof as active ingredients.

9. A feed composition for preventing or improving ovarian cancer, comprising decitabine or a feed-based acceptable salt thereof; and belotecan or a feed-based acceptable salt thereof as active ingredients.

10. A composition for inhibiting the proliferation of ovarian cancer cell lines, comprising decitabine or a pharmaceutically acceptable salt thereof; and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

11. A composition for inhibiting ovarian cancer metastasis, comprising decitabine or a pharmaceutically acceptable salt thereof; and belotecan or a pharmaceutically acceptable salt thereof as active ingredients.

Citation Information

Patent Citations

  • Composition for inhibiting myeloid-derived suppressor cells comprising decitabine or its pharmaceutically acceptable salt as an active ingredient

    KR1020170054997A

  • Stave and method for manufacturing the stave

    KR1020200101189A

  • Method for processing substrate

    KR1020240131517A

  • Combination decitabine and cedazuridine solid oral dosage forms

    US20230263818A1