Composition for enhancing bioenergy metabolism containing kestose

The Kestos composition addresses the inefficacy of existing supplements by promoting mitochondrial biosynthesis and ATP production, enhancing energy metabolism, and treating diseases through targeted metabolic pathways, thereby increasing muscle energy levels and preventing or treating diseases like diabetes and obesity.

WO2025143788A1PCT designated stage expired Publication Date: 2025-07-03SAMYANG CORP
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/021115
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-27
Filing Date
2024-12-26
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing nutritional supplements fail to effectively increase ATP production, especially in muscles, and do not adequately address energy metabolism-related diseases such as diabetes, obesity, and mitochondrial diseases.

Method used

A composition containing Kestos as an active ingredient, which promotes mitochondrial biosynthesis, ATP production, and sugar absorption, and is used to enhance energy metabolism, treat, or prevent related diseases by stimulating pathways like AMPK, SIRT1, PGC1α, TFAM, NRF1, IRS-1, AKT, Myod, Myog, and insulin secretion factors.

Benefits of technology

The Kestos composition significantly increases ATP production and energy levels in muscle cells, enhances exercise endurance, and treats or prevents energy metabolism-related diseases by improving mitochondrial function and sugar absorption.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024021115_03072025_PF_FP_ABST
    Figure KR2024021115_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to: a composition for enhancing cellular energy metabolism, comprising kestose as an active ingredient; and use thereof for the prevention, treatment or amelioration of diseases related to cellular energy metabolism.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for promoting bioenergy metabolism containing kestose

[0001] The present invention relates to a use for promoting energy metabolism or a use for improving energy metabolism reduction, which comprises kestos as an active ingredient.

[0002] It is well known that adenosine triphosphate (ATP) is the energy source for cells. During anabolism, energy derived from nutrient metabolism is transferred to high-energy phosphate bonds in ATP. The energy from these bonds is consumed during the energy expenditure phase.

[0003] To increase ATP levels, various nutritional supplements relying on creatine compounds are known in the art. Creatine has been reported to be effective in stimulating ATP production because it plays a role in anaerobic ATP production during short-duration / intensive exercise via the creatine kinase system. These supplements often fail to achieve the desired increase in ATP production, particularly intramuscular ATP production.

[0004] While numerous compositions and methods for increasing energy metabolism and ATP production are known in the art, all or nearly all of them suffer from one or more drawbacks. Therefore, there remains a need for improved compositions and methods for increasing energy metabolism and ATP production.

[0005]

[0006] One example of the present invention is to provide a composition for promoting energy metabolism in an individual, comprising kestos as an active ingredient.

[0007] Another example of the present invention relates to a composition for promoting adenosine triphosphate (ATP) production in tissues having mitochondria, comprising kestose as an active ingredient, and more particularly, to provide a composition for promoting mitochondrial biogenesis.

[0008] Another example of the present invention is to provide a composition for promoting protein biosynthesis in mitochondria in tissues having mitochondria, comprising kestose as an active ingredient.

[0009] Another example of the present invention is to provide a composition for promoting sugar absorption, comprising kestos as an active ingredient.

[0010] Another aspect of the present invention provides a composition for preventing, improving and / or treating energy metabolism-related diseases, comprising kestos as an active ingredient.

[0011] Another example of the present invention is to provide a method for enhancing energy metabolism in a subject, comprising administering kestos to the subject in need of enhancing energy metabolism.

[0012] Another example of the present invention is to provide a method for preventing, improving and / or treating an energy metabolism-related disease, comprising administering kestos to a subject in need of prevention, improvement and / or treatment of an energy metabolism-related disease.

[0013] Another example of the present invention provides a use of Kestos for promoting energy metabolism or for preventing, improving and / or treating diseases related to energy metabolism.

[0014] Another example of the present invention provides a use of kestos for preparing a composition for promoting energy metabolism in an individual or a composition for preventing, improving and / or treating a disease related to energy metabolism.

[0015] In this specification, "enhancing energy metabolism" means a process of improving energy production, utilization, and storage at the cellular and biological levels, and specifically, may be at least one selected from the group consisting of promoting adenosine triphosphate (ATP) production in tissues containing mitochondria (specifically, promoting mitochondrial biogenesis), promoting protein biosynthesis within mitochondria in tissues containing mitochondria, promoting insulin secretion, and promoting sugar absorption, but is not limited thereto.

[0016] Specifically, the composition of the present invention, which includes kestose as an active ingredient, has uses such as promoting bioenergy metabolism, promoting adenosine triphosphate (ATP) production in tissues having mitochondria, promoting protein biosynthesis within mitochondria in tissues having mitochondria, promoting insulin secretion, and promoting sugar absorption.

[0017] A composition containing the ketose according to the present invention as an active ingredient may be, for example, a pharmaceutical composition or a food composition.

[0018] A composition containing ketose as an active ingredient according to the present invention can be used to promote energy metabolism in an individual or subject, and the individual or subject can be a mammal, including a human.

[0019] In addition, the present invention can be used to promote adenosine triphosphate (ATP) production in a tissue having mitochondria, promote protein biosynthesis in mitochondria in a tissue having mitochondria, or promote sugar absorption in a tissue, and the individual or subject may be a mammal including a human.

[0020] One embodiment of the present invention relates to a composition and method for promoting energy metabolism, and more particularly, to a composition for increasing ATP production. The present invention provides a food composition for promoting or improving the energy level of a subject. The composition according to the present invention can substantially increase ATP and energy levels, and has been confirmed to significantly increase ATP production in muscle tissue, and has been confirmed to have the effect of promoting ATP and energy levels in muscle cells.

[0021] These individuals may be mammals, including humans, including those suffering from diseases that reduce intracellular adenosine triphosphate (ATP), those engaging in excessive physical activity, such as athletes or workers, and those seeking to increase their energy levels. Other mammals, such as dogs and cats, are also included in the present method.

[0022] Administration of a composition according to the present invention increases the level of ATP within muscle cells, prolongs the time and intensity with which a mammal can exercise, and mammals that do not exercise and mammals that expend higher than normal levels of energy while recovering from physical damage such as trauma, burns, and sepsis also benefit from administration of the composition of the present invention.

[0023] The composition for promoting bioenergy metabolism, the method for promoting energy metabolism in a subject, and / or the method for preventing, improving, and / or treating diseases related to energy metabolism according to the present invention stimulate and promote ATP synthesis in a mammal, and specifically, kestose is orally administered in an amount effective to enhance the energy of the mammal before, during, and after a period of high ATP demand. Subjects administered kestose can exercise for longer periods of time, achieve higher intensities, and subjectively have more energy than mammals not administered kestose. The present invention provides a method for stimulating ATP synthesis by administering kestose, and provides a kestose-containing composition that is particularly beneficial for mammals experiencing high energy demand or mammals with chronically low energy levels.

[0024] The above enhancement of energy metabolism can occur in muscle cells or muscle tissue.

[0025] Typically, mitochondrial biogenesis pathway activators activate or increase genes in that pathway. Increased activation or increase in the mitochondrial biogenesis pathway can be observed by increased activity of genes in that pathway. AMPK maintains energy balance by sensing energy (ATP) levels and plays a role in activating the energy and mitochondrial biogenesis metabolic pathways.

[0026] In particular, as activators of the mitochondrial biogenesis pathway, AMPK, SIRT1 (sirtuin1), PGC1α (peroxisome proliferator-activated receptor gamma coactivator), TFAM (Mitochondrial transcription factor A), NRF1 (Nuclear respiratory factor 1), IRS-1 (Insulin receptor substrate 1), Akt, MyoD (Myogenic differentiation 1), MyoG (Myogenin), etc. are linked to the mitochondrial biogenesis metabolic pathway. Therefore, AMPK, SIRT1, PGC1α, TFAM, NRF1, IRS-1 (Insulin receptor substrate 1), Akt, MyoD (Myogenic differentiation 1), MyoG (Myogenin) are energy metabolism regulatory enzymes and genes that follow the mitochondrial biogenesis signal transduction pathway. Promotion or enhancement of mitochondrial biogenesis can be determined by the expression level and / or expression of related genes. Therefore, activation of the AMPK and SIRT1 pathways includes stimulation of PGC1α, TFAM, NRF1, IRS-1, Akt, MyoD, MyoG and / or stimulation of mitochondrial biogenesis. In addition, it is known that when AMPK is activated, it increases the movement of GLUT4 to the cell membrane within the cell, and the GLUT4 in the cell membrane moved by AMPK promotes glucose uptake. The composition according to the present invention, the method for promoting energy metabolism in an individual and / or the method for preventing, improving and / or treating energy metabolism-related diseases can promote the expression of one or more factors selected from the group consisting of AMPK, SIRT1, PGC1α, TFAM, NRF1, IRS-1, Akt, MyoD and MyoG.

[0027] The composition according to the present invention relates to a composition for promoting insulin secretion or sugar absorption in a tissue, wherein the insulin secretion or sugar absorption may be muscle tissue or intestinal tissue. Sugar absorption in an individual, tissue, or cell can be promoted by various hormones or physiological factors, together with insulin. For example, exercise induces sugar absorption in skeletal muscle through an insulin-independent pathway, and α1-adrenergic or endothelin A receptors also increase the sugar absorption rate through an insulin-independent pathway. Insulin is secreted from pancreatic cells and binds to insulin receptors on the cell membrane to transmit a signal so that blood sugar can be absorbed into the cells, thereby causing sugar metabolism and energy metabolism in each tissue to occur and maintain a constant blood sugar level through body metabolism. If insulin secretion decreases due to a decline in pancreatic beta cell function, or if insulin resistance increases in peripheral tissues such as muscles, liver, and blood vessels, blood sugar cannot be used as an energy source and is excreted from the body, which can lead to various complications. Therefore, it also contributes to the promotion of energy metabolism by promoting glucose absorption to supply glucose used as an energy source in muscle cells or intestinal cells.

[0028] In particular, as factors promoting sugar absorption, there are GLUT2 (glucose transporter 2), SGLT1 (sodium-glucose cotransporter 1), GCK (glucokinase), etc., and as factors related to inducing insulin secretion, there are GLP-1 (Glucagon-Like Peptide-1), CREB (cAMP Response Element-Binding Protein), etc. Specifically, when insulin is secreted, the expression of GLP-1 increases, the expression of CREB decreases, and the decrease in CREB expression may occur due to the induction of insulin secretion by the phosphorylation of CREB. The composition according to the present invention, the method for promoting energy metabolism in an individual, and / or the method for preventing, improving, and / or treating a disease related to energy metabolism can promote the expression of one or more factors selected from the group consisting of GLUT2, SGLT1, GCK, and GLP-1, and can suppress the expression of the CREB factor.

[0029] Another example of the present invention provides a composition for treating energy metabolism-related diseases, comprising kestose as an active ingredient. In the present specification, energy metabolism-related diseases may be at least one selected from the group consisting of diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, diseases that may arise due to mitochondrial disease, and precocious puberty, but are not limited thereto. Diseases that may arise due to mitochondrial disease include degenerative brain diseases (e.g., dementia, Parkinson's disease, etc.), diabetes, cardiovascular disease, cancer, etc.

[0030] Another example of the present invention is to provide a method for enhancing energy metabolism in a subject, comprising administering kestos to the subject in need of enhancing energy metabolism.

[0031] Another example of the present invention is to provide a method for preventing, improving and / or treating an energy metabolism-related disease, comprising administering kestos to a subject in need of prevention, improvement and / or treatment of an energy metabolism-related disease.

[0032] The above object may be at least one selected from the group consisting of, but is not limited to, primates such as humans and monkeys, rodents such as mice, rats and rabbits, mammals including dogs, cats, cows, pigs, sheep, horses and goats, birds including chickens, ducks and geese, reptiles including snakes, lizards, turtles and crocodiles, amphibians and vertebrates such as fish.

[0033] In this specification, "treatment" may be used to mean alleviating or improving symptoms (e.g., diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, precocious puberty, etc.), delaying or alleviating the progression of a disease (e.g., diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, precocious puberty, etc.), improving, alleviating or stabilizing a disease state or symptom, partial or complete recovery or elimination, and other beneficial treatment results. "Improvement" may be used to mean alleviating or ameliorating symptoms (e.g., diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, precocious puberty, etc.), delaying or alleviating the progression of a disease (e.g., diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, precocious puberty, etc.), improving, alleviating or stabilizing a disease state or symptom, and the like. “Prevention” is used to mean all mechanisms and / or effects that act on a subject who does not have a specific disease to prevent the development of said specific disease or to delay the development of said disease.

[0034] The pharmaceutical composition provided herein may be administered in any commonly used manner, for example, by oral administration, or by parenteral administration such as intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, local administration to the lesion site, or intraperitoneal injection.

[0035] The pharmaceutical composition may be administered in a pharmaceutically effective amount. The dosage of the pharmaceutical composition may vary depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration interval, administration route, excretion rate, and response sensitivity. The dosage may vary depending on the patient's age, weight, sex, administration form, health condition, and disease severity, and may be administered once or several times a day at regular intervals at the discretion of a physician or pharmacist.

[0036] The dosage forms of pharmaceuticals, quasi-drugs, and supplements containing Kestos are not particularly limited, and a dosage form appropriate for the administration method can be appropriately selected. For example, in the case of oral administration, solid or liquid dosage forms such as powders, tablets, sugar syrups, capsules, granules, dry syrups, liquids, syrups, drops, and drinks can be used.

[0037] The composition according to the present invention comprises kestose or 1-kestose as an active ingredient, and kestose can be used alone or in a sugar composition containing it. Kestose can be used in liquid or powder form, and the powder can be amorphous or crystalline. The kestose can be purchased and used as a commercial product, or can be manufactured using a predetermined raw material.

[0038] An example of the above sugar composition may be a kestose-containing fructooligosaccharide (FOS). FOS consists of a linear chain with 1 to 9 fructose residues linked to a sucrose molecule by β2→1 linkages. The above kestose-containing fructooligosaccharide preferably has 1-kestose as its main component, and specifically, the sugar composition may include kestose and a mixture of at least one sugar selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4), i.e., the kestose may be provided as a mixture of at least one sugar selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4). For example, it may contain a high content of 1-kesotse (GF2), and may contain at least one selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4).

[0039] When the above kestose is provided as a mixture with one or more sugars selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4), the kestose content may be 50 wt% or more, 60 wt% or more, 65 wt% or more, 70 wt% or more, 75 wt% or more, 80 wt% or more, 85 wt% or more, and may be 99.9 wt% or less, 99.5 wt% or less, or 99 wt% or less, but is not limited thereto.

[0040] There is no particular limitation on the kestose or sugar composition containing kestose that can be used in the present invention, and it can be produced using sugar as a substrate, usually by using an enzyme having kestose conversion activity or a microorganism that produces the enzyme.

[0041] The enzyme having the above kestose conversion activity is an enzyme having an activity of converting a fructooligosaccharide containing kestose from a sugar-containing substrate, and may be an enzyme derived from at least one selected from the group consisting of, for example, an Aspergillus niger strain, a Pichia farinose strain, a Yarrowia lipolytica strain, a Millerozyma farinose strain, and an Aspergillus oryzae strain.

[0042] In the present invention, the intake (administration) of kestose is, specifically, in the method for promoting energy metabolism of the subject and / or the method for preventing, improving and / or treating energy metabolism-related diseases, the intake (administration) of kestose is, for example, 0.01 to 0.34 g / kg body weight, preferably 0.01 to 0.30 g / kg body weight, more preferably 0.01 to 0.24 g / kg body weight, 0.03 to 0.34 g / kg body weight, 0.05 to 0.34 g / kg body weight, 0.06 to 0.34 g / kg body weight, 0.03 to 0.24 g / kg body weight, 0.05 to 0.24 g / kg body weight, 0.06 to 0.24 g / kg body weight, 0.03 to 0.30 g / kg body weight, 0.05 to 0.30 Examples include 0.06 to 0.30 g / kg body weight, 0.03 to 0.26 g / kg body weight, 0.05 to 0.26 g / kg body weight, or 0.06 to 0.26 g / kg body weight. These intake amounts are not limited to once a day, but may be divided into multiple doses and consumed.

[0043] One method is to administer Kestos orally to humans or animals as is or in the form of food or medicine.

[0044] In the above Kestos composition, Kestos as an active ingredient may be included in a total daily dosage of 1 g to 30 g, 1 g to 20 g, 1 g to 15 g, 2 g to 15 g, 1 g to 10 g, 2 g to 10 g, 1 g to 7 g, or 2 g to 7 g based on a 60 kg adult, but is not limited thereto.

[0045] In addition, the above-mentioned kestose composition may be a composition containing a combined content of kestose, nystose, and fructofuranosylnystose of 400 mg / g or more, 500 mg / g or more, 800 mg / g or more, or 900 mg / g or more.

[0046] The kestose usable in the present invention may be in either liquid (e.g., sugar syrup) or powder form, and may be included in the composition according to the present invention in various amounts. The kestose may be used as a single component or in a mixed composition containing other sugars, such as fructooligosaccharide (FOS).

[0047] The above-mentioned liquid or powdered kestos may be a composition having a content of 50 (w / w) % or more, 60 (w / w) % or more, 70 (w / w) % or more, 80 (w / w) % or more, preferably 85 (w / w) % or more based on the total solids. In addition, the crystalline kestos may be a composition having a content of 98% or more based on the total solids.

[0048] Kestose can be added to and used in the normal manufacturing processes of various foods, food additives, and animal feed. 1-Kestose has a sweetness index of 30, and its taste, physical properties, and processability are close to sucrose. Therefore, it can be used in various foods, beverages, food additives, medicines, or feeds by treating it in the same way as sugar, such as by replacing some or all of the sugar with 1-Kestose in the manufacturing process of various foods.

[0049] In the food composition provided herein, the term "food" means an edible natural product or processed product containing one or more nutrients, and may be used in its conventional sense to mean one or more selected from the group consisting of various general foods, health functional foods, beverages, food additives, and beverage additives. The term "food composition" may mean a combination of materials for producing the above food.

[0050] Specific embodiments of the composition according to the present invention include, for example, beverages, dairy products, granules for food use, pastes, seasonings, retort foods, baby foods, fermented foods, preserved foods, processed foods such as processed fishery products, processed meat products, and processed grain products, food additives, health foods, animal feed, etc.

[0051] The present invention relates to a use for promoting energy metabolism, or a use for preventing, treating or improving diseases related to decreased energy metabolism, including kestos as an active ingredient.

[0052] Figure 1 is a graph comparing the expression levels of sugar absorption promoting factors for inducing energy metabolism in muscle cells (C2C12). This was confirmed by treating muscle cells (C2C12) with kestose, glucose, and maltose, extracting RNA from the cells, synthesizing cDNA, and performing real-time PCR.

[0053] Figure 2 is a graph showing the sugar content absorbed into muscle cells (C2C12). It is the result of confirming the sugar content within the cells by ELISA after treating muscle cells (C2C12) with kestose, glucose, and maltose.

[0054] Figure 3 is a graph comparing the expression levels of mitochondrial biosynthesis promoting factors that produce energy sources (ATP) using sugar absorbed in muscle cells (C2C12). This is the result of treating muscle cells (C2C12) with kestose, glucose, and maltose, extracting RNA from the cells, synthesizing cDNA, and confirming it through real-time PCR.

[0055] Figure 4 is a graph showing the quantitative analysis of mitochondrial proteins that produce energy sources (ATP) used for energy metabolism in muscle cells (C2C12). This graph shows the results of extracting mitochondria from muscle cells (C2C12) after treating them with kestose, glucose, and maltose, and then checking the protein concentration of the mitochondria using BSA.

[0056] Figure 5 is a graph showing the amount of energy source (ATP) produced and used for energy metabolism in muscle cells (C2C12).

[0057] Figure 6 is a graph showing changes in body weight according to the type of administered substance and administration time for normal mice and obese mice.

[0058] Figure 7 is a graph comparing the expression levels of mitochondrial biogenesis promoting factors in the muscles of normal and obese mice.

[0059] Figure 8 is a graph comparing the expression levels of glucose absorption promoting factors in the intestines of normal and obese mice.

[0060] Figure 9 is a graph comparing the expression levels of insulin secretion inducing factors and glucose absorption factors in the pancreas of normal and obese mice.

[0061]

[0062] The present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not intended to be limited to the following examples.

[0063]

[0064] Example 1: Cell culture and differentiation induction

[0065] C2C12 muscle cells were cultured in an incubator using DMEM medium (Lonza, USA) containing 1% penicillin / streptomycin and 10% FBS. Cells were passaged when 70–80% confluent. After washing twice with PBS, cells were detached using 0.25% trypsin-EDTA and centrifuged at 1,000 rpm for 5 min to obtain cells. The cells were passaged using fresh cell medium. In this experiment, additional experiments were performed using cells that had been passaged more than twice.

[0066] Muscle cells (C2C12) were differentiated using horse serum (Gibco, USA). Muscle cells seeded in well plates were cultured in DMEM media containing 1% penicillin / streptomycin and 10% FBS until 90% confluent in an incubator and differentiation was induced. The differentiation medium used was DMEM media containing 1% penicillin / streptomycin and 2% horse serum, and the medium was replaced with fresh medium every two days. The differentiation medium was replaced three times over a total of 6 days. On the 6th day after the initiation of differentiation, muscle cells were treated with 1-kestose, glucose, or maltose dissolved in the differentiation medium at a concentration of 14 mM each and reacted for 24 hours.

[0067]

[0068] Example 2: Measurement of the expression level of genes related to sugar absorption for energy metabolism and the content of absorbed sugar.

[0069] Example 2-1: Measurement of the expression level of factors that induce sugar uptake and utilize the absorbed sugar to induce energy metabolism in muscle cells (C2C12).

[0070] To measure the mRNA expression levels of factors involved in promoting glucose uptake and utilizing absorbed glucose in differentiated muscle cells, RNA was extracted from muscle cells treated with 1-kestose, glucose, or maltose as described in Example 1 using Trizol (Invitrogen, USA). The isolated RNA was used to synthesize cDNA using a cDNA synthesis kit (Takara, Japan). Real-time PCR quantitative analysis was performed using the synthesized cDNA to measure the expression levels of factors involved in promoting glucose uptake (GLUT4, GCK) in differentiated muscle cells.

[0071] The primer sequence information used in performing the above PCR is shown in Table 1 below, and the results of measuring the expression levels of GLUT4 and GCK are shown in Figures 1 and 2, respectively.

[0072] Target gene설명서열SEQ ID NOGLUT4Forward (5′-3′)CTTGGCTCCCTTCAGTTTG1GLUT4Reverse (5′-3′)TGCCTTGTGGGATGGAAT2GCKForward (5′-3′)CTGTGAAAGCGTGTCCACTC3GCKReverse (5′-3′)GTGATTTCGCAGTTGGGTGT4AMPKForward (5′-3′)TCACCGGACATAAAGTGGCT5AMPKReverse (5′-3′)TGATGATGTGAGGGTGCCTG6SIRT1Forward (5′-3′)AGTTCCAGCCGTCTCTGTGT7SIRT1Reverse (5′-3′)CTCCACGAACAGCTTCACAA8PGC1αForward (5′-3′)CGGAAATCATATCCAACCAG9PGC1αReverse (5′-3′)TGAGGACCGCTAGCAAGTTTG10TFAMForward (5′-3′)GGGTATGGAGAAGGAGGCCC11TFAMReverse (5′-3′)TCCCTGAGCCGAATCATCCT12NRF1Forward (5′-3′)AGGGCGGTGAAATGACCATC13NRF1Reverse (5′-3′)CGGCAGCTTCACTGTTGAGG14IRS-1Forward (5′-3′)TGAACCTCAGTCCCAACCATAA15IRS-1Reverse (5′-3′)TCCGGCACCCTTGAGTGT16AktForward (5′-3′)ACTCATTCCAGACCCACGAC17AktReverse (5′-3′)CCGGTACACCACGTTCTTCT18MyoDForward (5′-3′)TGGGATATGGAGCTTCTATCGC19MyoDReverse (5′-3′)GGTGAGTCGAAACACGGATCAT20MyoGForward (5′-3′)AGCATCACGGTGGAGGATATG21MyoGReverse (5′-3′)CAGTTGGGCATGGTTTCGT22GLUT2Forward (5′-3′)TTACTCTCCATTTCAGTCCTTTGT23GLUT2Reverse(5′-3′)TAGAGCAGCTCTTTATTCCAGATTT24SGLT1Forward (5′-3′)ACTGCCACCGATGCACCCAT25SGLT1Reverse (5′-3′)AAACATGGCCCACAGCCCGA26GCKForward (5′-3′)CTGTGAAAGCGTGTCCACTC27GCKReverse (5′-3′)GTGATTTCGCAGTTGGGTGT28GLP-1Forward (5′-3′)CGGAGTGTGAAGAGTCTAAGCG29GLP-1Reverse (5′-3′)ATGGCTGAAGCGATGACCAAGG30CREBForward (5′-3′)CAGGTATCCATGCCAGCAGCTC31CREBReverse (5′-3′)AGGCTCCTTGAAAGGATTTCCC32

[0073] As a result of measuring the expression level of sugar uptake promoting factors in the differentiated muscle cells, the expression level of sugar uptake promoting factors (GLUT4, GCK) was high in muscle cells treated with 1-kestose.

[0074]

[0075] Example 2-2: Measurement of glucose uptake in muscle cells (C2C12)

[0076] Muscle cells (C2C12) passaged more than twice in Example 1 were seeded at 1x10 in a 96-well plate. 4 After seeding at a concentration of 200 mL per cell / well, muscle cells were differentiated using DMEM containing 2% horse serum for 6 days.

[0077] The absorbed sugar content was measured using a glucose uptake cell-based assay kit (Cayman Chemical Co., USA). Differentiated C2C12 cells were simultaneously treated with glucose-free medium containing 150 mg / mL 2-NBDG, a fluorescent glucose analogue, and 1-kesotse, glucose, or maltose as sugars at a concentration of 14 mM in glucose-free medium in a 96-well plate for 4 h. After the 4-h reaction, the fluorescence absorbance was measured at a wavelength of excitation 485 nm / emission 650 nm, and the results were calculated as a percentage of the control group not treated with sugars, and the results are shown in Fig. 3.

[0078] As a result of measuring the sugar content absorbed by the differentiated muscle cells, the sugar content absorbed by the muscle cells treated with 1-ketose significantly increased.

[0079]

[0080] Example 3: Measurement of expression levels of genes related to mitochondrial biogenesis and concentration of mitochondrial proteins.

[0081] Example 3-1: Measurement of the expression level of a mitochondrial biosynthesis promoting factor that produces energy source (ATP) by utilizing sugar absorbed by muscle cells (C2C12).

[0082] To measure the mRNA expression level of mitochondrial biogenesis promoting factors in differentiated muscle cells (C2C12), RNA was extracted from muscle cells treated with 1-kestose, glucose, or maltose in Example 1 using Trizol (Invitrogen, USA). The isolated RNA was used to synthesize cDNA using a cDNA synthesis kit (Takara, Japan).

[0083] The expression levels of mitochondrial biogenesis promoting factors (AMPK, SIRT1, PGC1α, TFAM, NRF1) were measured using real-time PCR analysis for the synthesized cDNA.

[0084] The primer sequence information used in performing PCR is shown in Table 1 above, and the results of measuring the expression level of mitochondrial biogenesis promoting factors are shown in Figure 3.

[0085] As a result of measuring the expression levels of mitochondrial biogenesis promoting factors, it was measured that the expression levels of AMPK, SIRT1, PGC1α, TFAM, and NRF1 were higher in the group treated with 1-kestose than in the other groups.

[0086]

[0087] Example 3-2: Measurement of protein concentration in mitochondria that produce energy source (ATP) used for energy metabolism in muscle cells (C2C12).

[0088] Muscle cells (C2C12) passaged more than twice in Example 1 were seeded at 5x10 in a 12-well plate. 4 After seeding at a concentration of cell / well / mL, muscle cells were differentiated for 6 days using DMEM containing 2% horse serum in substantially the same manner as in Example 1, and 1-kestose, glucose, or maltose were treated to the muscle cells to react.

[0089] To isolate mitochondria within the muscle cells, a Mitochondrial isolation kit (Thermo Fisher Scientific; Rockford, IL, USA) was used. Differentiated muscle cells (C2C12) were harvested using a scraper and washed twice with cold PBS. Reagent A included in the Mitochondrial isolation kit was added to the cells and mixed. Isolation reagent B was then added and mixed. The mixture was then mixed at maximum speed every minute for 5 minutes at 4°C. Isolation reagent C was added, the tube was inverted, and centrifuged (700 g for 10 minutes) at 4°C. After removing the supernatant, the sediment was suspended in isolation reagent C and centrifuged (12,000 g for 5 minutes) at 4°C to obtain mitochondria. The protein concentration of mitochondria was measured using BSA (Bovine Serum Albumin) as a standard protein using a BCA protein assay kit (Thermo Fisher Scientific, USA), and the results are shown in Figure 4.

[0090] As a result of measuring the protein concentration of the above mitochondria, the group treated with 1-kestose showed an increase in the protein concentration of the mitochondria.

[0091]

[0092] Example 4: Measurement of the amount of energy source (ATP) produced for energy metabolism in muscle cells (C2C12).

[0093] Muscle cells passaged more than twice in Example 1 above were seeded at 5x10 in a 12-well plate. 4After seeding at a concentration of 10 cells / well / mL, differentiation was performed for 6 days using DMEM containing 2% horse serum in substantially the same manner as in Example 1, and on the 6th day, 1-kestose, glucose, or maltose were treated as sugars at a concentration of 14 mM each and reacted for 24 hours. After the reaction, the cells were washed twice with PBS, and the amount of ATP produced was measured using an ATP colorimetric assay kit (Abcam, UK), and the concentration of energy sources within the cells was analyzed using an ELISA method, and the results are shown in Fig. 5.

[0094] Measurement of ATP production showed that the group treated with 1-kestose had higher concentrations of intracellular energy source (ATP) due to increased production.

[0095]

[0096] Example 5: Study on the energy metabolism regulation effect of kestos through animal testing.

[0097] Example 5-1: Animal model induction and administration

[0098] Diabetes is a disease in which sugar is not absorbed into cells, preventing them from using it as a sufficient energy source. This sugar absorption disorder is caused by either decreased insulin secretion or insulin resistance. Insulin is secreted by pancreatic cells and binds to insulin receptors on the cell membrane to send a signal so that blood sugar can be absorbed into the cells. This signals sugar metabolism and energy metabolism in each tissue, ensuring that blood sugar levels remain constant through metabolism. If insulin secretion is reduced due to a decline in pancreatic beta cell function, or insulin resistance increases in peripheral tissues such as muscles, liver, and blood vessels, blood sugar cannot be used as an energy source and is excreted from the body, leading to various complications. Therefore, diabetic animal models can be used to monitor insulin secretion and sugar absorption, and these animal models can be used to analyze the mechanisms by which absorbed sugar is converted into energy sources and then metabolized. Therefore, they were selected as the subject of this experiment.

[0099] To conduct a study on the regulation of kestose energy metabolism, 6-week-old male C57BL / 6 mice were divided into groups of 6 each and acclimated for 1 week. Specifically, as distinguished in Table 2 below, the normal diet group (ND) group, which consumed a normal diet (Zeigler Bros., USA), and the high-fat diet group (HFD) group, which induced consumption of a high-fat diet (Research Diets, USA), were prepared.

[0100] To monitor insulin secretion and sugar absorption, and to analyze the mechanism that leads to energy metabolism by generating energy sources from the absorbed sugar, T2D (Type 2 diabetes) was induced in a group of mice for 10 weeks. During the T2D induction period, the test substances for each group were orally administered daily as an amount converted to 30 g of mouse weight based on the daily intake amount of 8 g / 70 kg for adults, as shown in Table 2 below. In addition to the diet, the sugars administered were kestose, sucrose, or fructooligosaccharide (FOP).

[0101] The general diet administered to the above experimental animals was Rodent NIH-41 Open Formula Diet sold by Zeigler Bros., Inc., and its specific composition is shown in Table 3. The high-fat diet was D12492 (Rodent Diet With 60 kcal% Fat) sold by Research Diets, Inc., and its specific composition is shown in Table 4.

[0102] The experimental animals used in this experiment were divided into negative control group, positive control group, comparison group, and test group (see Table 2).

[0103] Item Intake Diet Test substance Dose Negative control group Regular diet intake group* Positive control group High-fat diet intake group* Comparison group 1 High-fat diet + FOP (Fructooligosaccharides) FOP 3.56 mg / d Comparison group 2 High-fat diet + Sucrose intake group Sucrose 3.43 mg / d Test group 1 Regular diet + Kestose intake group 1 - Kestose 3.45 mg / d Test group 2 High-fat diet + Kestose intake group 1 - Kestose 3.45 mg / d

[0104] Ingredient content (% by weight) Ground Whole Wheat34.9Ground No. 2 Yellow Corn21Ground Whole Oats10Wheat Middlings10Fish Meal (60% Protein)9Soybean Meal (47.5% Protein)5Soy Oil2Alfalfa Meal (17% Protein)2Corn Gluten Meal (60% Protein)2Dicalcium Phosphate1.5Brewers Dried Yeast1Premixes0.6Limestone0.5Salt0.5Total100

[0105] Ingredient Content (Wt%): Casein, Lactic, 30 Mesh 25.845%, Cystine, L 0.388%, Lodex 1016.153%, Sucrose, Fine Granulated 9.408%, Solka Floc, FCC 2006.461%, Lard 31.660%, Soybean Oil, USP 3.231%, S10026B 6.461%, Choline Bitartrate 0.258%, V10001C 0.129%, Dye, Blue FD&C #1, Alum. Lake 35-42%, 0.006%, Total 100%

[0106]

[0107] Example 5-2: Measurement of mouse weight gain and food intake and collection of feces

[0108] During the T2D induction and test group administration periods of Example 5-1 above, the weight changes of mice according to each experimental group were recorded to measure the weight changes due to T2D induction. Weight measurements for measuring weight changes were performed at the same time every week before oral administration.

[0109] Additionally, food intake was measured at the same time every week to determine whether obesity was caused by T2D, and the results of analyzing the change in body weight of the mice during the test period are shown in Figure 6.

[0110] Analysis of the weight change in mice during the test period showed that 1-kestose alleviated the weight gain caused by the high-fat diet in high-fat diet mice, and compared to sucrose and FOP, the group that consumed 1-kestose had the greatest weight gain alleviation effect.

[0111] Example 5-3: Analysis of the regulatory effects of sugar uptake and utilization factors and mitochondrial biogenesis promoting factors in mouse muscle tissue.

[0112] To measure mRNA expression levels in mouse muscles, mice whose weight changes were analyzed in Example 5-2 above were sacrificed, muscle tissue was obtained from the sacrificed mice, and RNA was extracted using an RNeasy mini kit (Qiagen, Germany). cDNA was synthesized from the RNA extracted from the muscle tissue using a cDNA synthesis kit (Takara, Japan).

[0113] Real-time PCR quantitative analysis was performed using the synthesized cDNA. The expression levels of mitochondrial biogenesis promoting factors (AMPK, SIRT1, PGC1α, NRF1, IRS-1, Akt, MyoD, MyoG) were measured to analyze the muscle metabolic effect due to activated energy metabolism. The PCR primers used to measure the expression levels of the above factors are shown in Table 1, and the analysis results are shown in Figure 7. Figure 7 is a graph comparing the expression levels of mitochondrial biogenesis promoting factors that produce energy sources (ATP) using absorbed sugar.

[0114] According to the above analysis results, AMPK, SIRT1, PGC1α, NRF1, IRS-1, Akt, MyoD, and MyoG, which are mitochondrial biogenesis promoting factors, showed higher expression levels in the groups treated with a normal diet, a high-fat diet, and 1-kestose compared to the other groups.

[0115]

[0116] Example 5-4: Measurement of the effect of regulating sugar metabolism on energy metabolism in mouse intestinal tissue.

[0117] In order to measure the mRNA expression level of glucose absorption regulators in the intestine of experimental mice, the mice whose weight change was analyzed in Example 5-2 were sacrificed, and intestinal tissues were obtained from the sacrificed mice, and RNA extraction, cDNA synthesis, and PCR thereof were performed in substantially the same manner as in Example 5-3 to measure the expression level of glucose absorption promoting factors (GLUT2, SGLT1) and analyze the effect of regulating sugar metabolism for energy metabolism. The primer information used is shown in Table 1 above, and the analysis results are shown in Fig. 8. Fig. 8 is a graph comparing the expression levels of glucose absorption promoting factors in the intestine of mice.

[0118] According to the above results, the expression level of glucose absorption promoting factors did not show any difference in expression due to 1-kestose in the general diet administration of test group 1, but in the high-fat diet administration of test group 2, the expression of glucose absorption promoting factors (GLUT2, SGLT1) that increase postprandial blood sugar was suppressed by 1-kestose.

[0119]

[0120] Example 5-5: Evaluation of the ability to regulate glucose metabolism for energy metabolism in mouse pancreatic tissue

[0121] In order to measure the mRNA expression levels of insulin secretion-inducing factors and glucose absorption-promoting factors in the pancreas of experimental mice, the mice whose weight changes were analyzed in Example 5-2 were sacrificed, and pancreatic tissues were obtained from the sacrificed mice. RNA was extracted, cDNA was synthesized, and PCR was performed thereon using substantially the same method as in Example 5-3, thereby measuring the expression levels of pancreatic insulin secretion-inducing factors (GLP-1, CREB) and glucose absorption-promoting factors (GLUT2). The primer information used is shown in Table 1 above.

[0122] The results of the above analysis are shown in Figure 9, which is a graph comparing the expression levels of insulin secretion inducing factors and sugar absorption factors in the mouse pancreas.

[0123] As shown in Fig. 9, the expression levels of factors related to insulin secretion induction and sugar absorption were measured, and no difference in the expression of factors related to insulin signaling was observed in the general diet-administered group 1, but in the high-fat diet-administered group 2, the expression of GLP-1, an insulin secretion-inducing factor, increased and the expression of CREB decreased due to 1-kestose, confirming that insulin secretion was induced by phosphorylation of CREB, and the expression of GLUT2, a sugar absorption-promoting factor, increased compared to other intake groups.

Claims

1. A composition for promoting energy metabolism in an individual, containing kestos as an active ingredient.

2. A composition in claim 1, wherein the promotion of energy metabolism is at least one selected from the group consisting of promotion of adenosine triphosphate (ATP) production in tissues having mitochondria, promotion of protein biosynthesis in mitochondria in tissues having mitochondria, and promotion of sugar absorption.

3. A composition according to claim 2, wherein the enhancement of energy metabolism occurs in muscle cells or muscle tissue.

4. A composition according to any one of claims 1 to 3, wherein the composition has the following properties (1) or (2): (1) Promotion of expression of one or more factors selected from the group consisting of AMPK, SIRT1, PGC1α, TFAM, NRF1, IRS-1, Akt, MyoD, MyoG, GLUT2, SGLT1, GCK, and GLP-1; (2) Inhibits CREB factor expression.

5. A composition according to any one of claims 1 to 3, wherein the kestose is provided as a mixture with at least one sugar selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4).

6. In the fifth paragraph, a composition in which the kestose is provided as a mixture with at least one sugar selected from the group consisting of nystose (GF3) and 1-F-fructosyl nystose (GF4), the kestose content being 50 wt% or more based on 100 wt% of the total mixture.

7. A composition according to any one of claims 1 to 3, wherein the ketose is included in the composition in a total daily dosage of 1 g to 30 g based on a 60 kg adult.

8. A composition according to any one of claims 1 to 3, wherein the kestose is provided in the form of a syrup or powder containing kestose.

9. A composition for preventing or treating energy metabolism-related diseases, containing kestose as an active ingredient.

10. A composition according to claim 9, wherein the energy metabolism-related disease is at least one selected from the group consisting of diabetes, obesity, metabolic syndrome, thyroid disease, mitochondrial disease, diseases that may be caused by mitochondrial disease, and precocious puberty.

Citation Information

Patent Citations

  • Allergy-suppressive composition, allergy-suppressive food and allergy-suppressive agent

    EP1878738A1

  • Hinge assembly and electronic device comprising the same

    KR1020230170530A

  • Axis Bearing Press Fitting Apparatus for Electric Motor

    KR102246314B1

  • Composition for Improving Intestinal Flora

    US20090142304A1