Novel pet degrading enzyme and use thereof

Abstract

The present application relates to a novel PET degrading enzyme and use thereof.

Description

Novel PET-degrading enzyme and its use

[0001] The present application relates to a polypeptide having PET decomposition activity and its use.

[0002] Over 400 million tons of plastics are newly produced each year. As environmental concerns surrounding waste plastics grow, efforts are being made to reduce production through regulations on single-use products and the use of alternative plastics. However, production continues to increase annually. PET, which accounts for less than 10% of all plastics, produces approximately 360 million tons annually. Due to its primary use in single-use products, PET is considered the plastic with the shortest life cycle. Recycling of waste plastics includes mechanical recycling, pyrolysis, and chemical recycling, each of which is either commercialized or in the final stages of research toward commercialization. While each technology offers potential solutions to the waste plastic issue, none of the existing methods are perfect due to the impacts of downcycling on quality, carbon neutrality, resource depletion, and eutrophication of seawater and freshwater.

[0003] To address environmental issues caused by waste plastics, such as microplastics, greenhouse gas emissions, and resource depletion, a series of research results are being published on the use of enzyme-based biological technology to decompose PET, a representative type of plastic.

[0004] [Prior Art Literature]

[0005] (Patent Document 1) EP 3909947 A2

[0006]

[0007] The present application relates to a polypeptide having PET decomposition activity and its use.

[0008]

[0009] One object of the present application is to provide a mutant polypeptide having PET decomposition activity.

[0010] Another object of the present application is to provide a composition comprising the polypeptide.

[0011] Another object of the present application is to provide a polynucleotide encoding the polypeptide.

[0012] Another object of the present application is to provide a host cell comprising the polypeptide; a polynucleotide encoding the polypeptide; a nucleic acid structure comprising the polynucleotide; and / or a vector comprising the nucleotide or the nucleic acid structure.

[0013] Another object of the present application is to provide a method for producing a mutant polypeptide having PET decomposition activity.

[0014] Another object of the present application is to provide a method for degrading polyester, comprising treating a polypeptide having PET degrading activity; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide to the polyester.

[0015] Another object of the present application is to provide a method for producing bis-2-hydroxyethyl terephthalate (BHET), (mono(2-hydroxymethyl) terephthalate (MHET), terephthalic acid (TPA), and / or ethylene glycol (EG), comprising contacting a polyester with a polypeptide having PET degrading activity; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide.

[0016] Another object of the present application is to provide a method for producing polyester, comprising a step of synthesizing polyester using BHET, MHET, TPA, and / or EG manufactured by the above method.

[0017] Another object of the present application is to provide a use of a polypeptide having PET degrading activity, a host cell expressing the polypeptide, and / or a composition comprising the polypeptide for PET degrading.

[0018] Another object of the present application is to provide a use of a polypeptide having PET decomposition activity, a host cell expressing the polypeptide, or a composition comprising the polypeptide, for reaction with polyester in the production of bis-2-hydroxyethyl terephthalate (BHET), (mono(2-hydroxymethyl) terephthalate (MHET), terephthalic acid (TPA), and / or ethylene glycol (EG).

[0019]

[0020] The mutant polypeptide having PET decomposition activity of the present application can be usefully used in various industrial fields.

[0021]

[0022] Figure 1 shows the PET degradation activities of KbPETase, LCC, and IsPETase at 40°C and 50°C.

[0023]

[0024] One aspect of the present application is a mutant polypeptide having PET decomposition activity.

[0025] As a specific example, the mutant polypeptide is i) a polypeptide having a sequence identity of at least 70% and less than 100% with SEQ ID NO: 1; and / or

[0026] ii) the mutant polypeptide is a polypeptide encoded by a polynucleotide having a sequence identity of 70% or more and less than 100% with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and / or

[0027] iii) the mutant polypeptide is a polypeptide encoded by a polynucleotide that hybridizes with (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) a cDNA thereof, or (c) the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions; and / or

[0028] iv) the above mutant polypeptide is a functional fragment of polypeptides i) to iii) having PET decomposition activity; and

[0029] The above mutant polypeptide comprises any one modification selected from the following:

[0030] Deletion, insertion, substitution with another amino acid, disulfide bond formation, and combinations thereof at one or more of the amino acids at positions 95, 119, 184, 239, 279, 173, 197, 236, 281, 127, 131, and 190;

[0031] Here, the position number corresponds to the position of the polypeptide of sequence number 1.

[0032] As a specific example of any one of the above specific examples, before the modification, amino acid position 95 may be threonine (T); amino acid position 119 may be threonine (T); amino acid position 184 may be valine (V); amino acid position 239 may be aspartic acid (D); amino acid position 279 may be alanine (A); amino acid position 173 may be alanine (A); amino acid position 197 may be lysine (K); amino acid position 236 may be alanine (A); amino acid position 281 may be serine (S); amino acid position 127 may be glutamine (Q); amino acid position 131 may be glutamic acid (E); and / or amino acid position 190 may be aspartic acid (D).

[0033] As an example of any one of the above embodiments, the mutant polypeptide may comprise one or more of the following substitutions:

[0034] Substitution of the amino acid corresponding to position 95 with arginine, histidine, or lysine;

[0035] The amino acid corresponding to position 119 is replaced with asparagine, glutamine, arginine, histidine, lysine, aspartic acid, or glutamic acid;

[0036] The amino acid corresponding to position 184 is substituted with isoleucine;

[0037] Substitution of the amino acid corresponding to position 239 with serine or threonine;

[0038] The amino acid corresponding to position 279 is replaced with serine;

[0039] The amino acid corresponding to position 173 is substituted with cysteine, isoleucine, leucine, or valine;

[0040] The amino acid corresponding to position 197 is replaced with cysteine, alanine, isoleucine, leucine, or valine;

[0041] The amino acid corresponding to position 236 is substituted with cysteine, leucine, or serine;

[0042] The amino acid corresponding to position 281 is substituted with cysteine, alanine, or leucine;

[0043] The amino acid corresponding to position 127 is substituted with serine;

[0044] The amino acid corresponding to position 131 is replaced with glutamine, asparagine, or cysteine; and

[0045] The amino acid corresponding to position 190 is replaced with histidine, arginine, lysine, or glutamic acid;

[0046] Here, the position number corresponds to the position of the polypeptide of sequence number 1.

[0047]

[0048] As one of the above specific examples, the mutant polypeptide is

[0049] One or more substitutions selected from T95R, D239S, A279S, T119N, V184I;

[0050] A173C / K197C;

[0051] A236C / S281C; and

[0052] One or more substitutions selected from Q127S, E131Q, D190H;

[0053] wherein the position number may be a position corresponding to a position of the polypeptide of SEQ ID NO: 1.

[0054]

[0055] As one of the above specific examples, the mutant polypeptide is

[0056] T95R / D239S / A279S / T119N / V184I;

[0057] A173C / K197C;

[0058] A236C / S281C; and

[0059] Q127S / E131Q / D190H; wherein the position number may be a position corresponding to the position of the polypeptide of SEQ ID NO: 1.

[0060]

[0061] As one of the above specific examples, the mutant polypeptide is

[0062] Amino acid 95 is replaced with arginine; amino acid 239 is replaced with serine; amino acid 279 is replaced with serine; amino acid 119 is replaced with asparagine; amino acid 184 is replaced with isoleucine; amino acid 173 is replaced with cysteine; amino acid 197 is replaced with cysteine; amino acid 236 is replaced with cysteine; and amino acid 281 is replaced with cysteine.

[0063] The above position number may be a position corresponding to the position of the polypeptide of sequence number 1.

[0064]

[0065] As one of the above specific examples, the mutant polypeptide is

[0066] Amino acid 173 is substituted with cysteine; amino acid 197 is substituted with cysteine; amino acid 236 is substituted with cysteine; amino acid 281 is substituted with cysteine; amino acid 127 is substituted with serine; amino acid 131 is substituted with glutamine; and amino acid 190 is substituted with histidine.

[0067] The above position number may be a position corresponding to the position of the polypeptide of sequence number 1.

[0068]

[0069] As one of the above specific examples, the mutant polypeptide is

[0070] Amino acid position 95 is replaced with arginine; amino acid position 239 is replaced with serine; amino acid position 279 is replaced with serine; amino acid position 119 is replaced with asparagine; amino acid position 184 is replaced with isoleucine; amino acid position 173 is replaced with cysteine; amino acid position 197 is replaced with cysteine; amino acid position 236 is replaced with cysteine; amino acid position 281 is replaced with cysteine; amino acid position 127 is replaced with serine; amino acid position 131 is replaced with glutamine; and amino acid position 190 is replaced with histidine.

[0071] The above position number may be a position corresponding to the position of the polypeptide of sequence number 1.

[0072]

[0073] As a specific example of any one of the above specific examples, the mutant polypeptide may form a disulfide bond between cysteines pairs selected from the following:

[0074] Cysteine ​​173 and cysteine ​​197; and / or

[0075] Cysteine ​​236 and cysteine ​​281;

[0076] Here, the position number corresponds to the position of the polypeptide of sequence number 1.

[0077]

[0078] As one of the above specific examples, the mutant polypeptide may have one or more of the following altered characteristics i) to vii) compared to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1:

[0079] i) Increase or decrease in enzyme activity;

[0080] ii) Increase or decrease in specific activity;

[0081] iii) Increase or decrease pH stability;

[0082] iv) Increase or decrease storage stability;

[0083] v) Increase or decrease in acid resistance;

[0084] vi) Increase or decrease in heat resistance or heat stability; and

[0085] vii) Change in substrate specificity.

[0086]

[0087] Another aspect of the present application is a composition comprising a mutant polypeptide having the PET decomposition activity.

[0088] As one of the above specific examples, the composition may be a composition for decomposing PET.

[0089] Another aspect of the present application is a polynucleotide encoding the mutant polypeptide.

[0090] Another aspect of the present application is a nucleic acid structure comprising the polynucleotide.

[0091] Another aspect of the present application is a vector comprising the polynucleotide or the nucleic acid construct.

[0092] Another aspect of the present application is a host cell comprising the mutant polypeptide, the polynucleotide, the nucleic acid construct, and / or the vector.

[0093]

[0094] Another aspect of the present application is a method for producing a mutant polypeptide, comprising the steps of culturing the host cell; and recovering the mutant polypeptide expressed in the culturing step.

[0095]

[0096] Another aspect of the present application is a method for degrading a polyester, comprising treating the polyester with the mutant polypeptide, or a polypeptide having SEQ ID NO: 1 or at least 70% sequence identity thereto; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide.

[0097] As one of the above specific examples, the polyester may be PET.

[0098] As one specific example of the above specific examples, the method for decomposing the polyester may include a step of performing a glycolysis reaction by a polypeptide having the PET decomposition activity.

[0099] As one specific example of the above specific examples, the method for decomposing the polyester may include a step of converting the polyester into BHET in the presence of a polypeptide having the PET decomposition activity and ethylene glycol.

[0100]

[0101] Another aspect of the present application is a method for producing BHET, MHET, TPA and / or EG, comprising contacting a polyester with the mutant polypeptide, or a polypeptide having SEQ ID NO: 1 or at least 70% sequence identity thereto; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide.

[0102] As one specific example of the above specific examples, the polyester may be PET.

[0103] As one of the above specific examples, a step of recovering BHET, MHET, TPA, and / or EG produced by the method may be additionally included.

[0104]

[0105] Another aspect of the present application is a method for producing polyester, comprising the step of synthesizing polyester using the BHET, MHET, TPA, and / or EG manufactured above.

[0106] As one specific example of the above specific examples, the polyester may be PET.

[0107]

[0108] Another aspect of the present application is a host cell overexpressing the mutant polypeptide, or a polypeptide having sequence number 1 or a sequence identity of at least 70% thereto.

[0109] Another aspect of the present application is a use of the mutant polypeptide, or a polypeptide having at least 70% sequence identity thereto; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide, for PET degradation.

[0110] Another aspect of the present application is the use of the mutant polypeptide, or a polypeptide having SEQ ID NO: 1 or at least 70% sequence identity thereto; a host cell expressing the polypeptide; and / or a composition comprising the polypeptide, for reaction with a polyester in the production of BHET, MHET, TPA, and / or EG.

[0111]

[0112] The specific details for implementing the invention are as follows. Furthermore, each description and embodiment disclosed in this application can be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0113] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments of the present application described herein. Furthermore, such equivalents are intended to be encompassed by this application.

[0114]

[0115] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless the context clearly dictates otherwise, the singular terms include the plural and the plural terms include the singular. In the specification and appended claims of this application, unless the context clearly dictates otherwise, the use of "or" is intended to include "and / or."

[0116]

[0117] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.

[0118]

[0119] In this application, the terms "first, second, third…" "i), ii), iii)…" or "(a), (b), (c), (d)…" are used to distinguish similar configurations, and these terms do not imply that the steps are performed consecutively or in order. For example, when the terms are used in relation to steps of a method, use, or analysis, these steps may be performed simultaneously, without a time interval, or may be performed at intervals of seconds, minutes, hours, days, or months.

[0120]

[0121] In this application, the term "consisting essentially of" means that a non-specific component may be present if the characteristics of the subject matter claimed in this application are not substantially affected by the presence of the non-specific component.

[0122] In this application, the term "consisting of" means that the proportion of a specific component(s) totals 100%. The components or features listed below the term "consisting of" may be essential or mandatory. In some embodiments, other than the components or features listed below "consisting of," other optional or nonessential components may be excluded.

[0123] In this application, the term "comprising" means the presence of a feature, step, or component described below, and does not exclude the presence or addition of one or more features, steps, or components. The components or features described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential components or features may be further included.

[0124] In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of.”

[0125] In the present application, with respect to an amino acid sequence, even if it is described as a polypeptide “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number, it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be used in the present application, as long as it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it may be a case in which the amino acid sequence has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution, but is not limited thereto.

[0126]

[0127] In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably with "amino acid sequence."

[0128] In some cases, an amino acid sequence that exhibits activity may be referred to as an "enzyme." In this application, amino acid sequences are described in N-terminal → C-terminal orientation, unless otherwise indicated.

[0129]

[0130] In relation to a cell, nucleic acid, polypeptide, or vector, the term "recombinant" in this application means that the cell, nucleic acid, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by alteration of a native nucleic acid or polypeptide, or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the native (non-recombinant) form of the cell, or may express a native gene that is expressed or not expressed at all, or otherwise abnormally expressed.

[0131]

[0132] As used herein, the term "isolated" refers to a substance that exists in an environment where it does not occur naturally, or in a form that does not occur naturally. This includes the substance (sequence, enzyme, or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated and found in nature, such as a sequence, enzyme, or nucleic acid.

[0133] For example, the isolated sequences, enzymes or nucleic acids provided in the present application may be provided in a form substantially free of one or more contaminants.

[0134] Examples of isolated substances may include, but are not limited to, i) any non-naturally occurring substance, ii) any substance from which one, more, or all naturally occurring components associated with it in nature have been removed (e.g., an enzyme, variant, nucleic acid, protein, peptide, or cofactor), iii) any substance found in nature that has been artificially modified, or iv) a substance that has been modified to alter the amount of that substance relative to other naturally associated components (e.g., increasing the number of copies of a gene encoding the substance; modifying a promoter naturally associated with a gene encoding the substance to a more active promoter, etc.).

[0135]

[0136] In this application, the term "wild type" means a naturally occurring polypeptide without any artificial modifications. When the term "wild type" is used in relation to a polypeptide, it means a naturally occurring polypeptide that does not have any artificial mutations (substitutions, insertions, deletions, etc.) at one or more amino acid positions. Similarly, when the term "wild type" is used in relation to a polynucleotide, it means a polypeptide that does not have any artificial modifications (substitutions, insertions, deletions) at one or more nucleotides. However, a polynucleotide encoding a wild type polypeptide is not limited to a naturally occurring polynucleotide, and also includes a sequence encoding any wild type polypeptide.

[0137]

[0138] In the present application, the parent sequence or backbone refers to a reference sequence into which a modification is introduced to become a mutant polypeptide. That is, the parent sequence may be a starting sequence into which mutations such as substitutions, insertions, and / or deletions are introduced. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence. If the parent sequence is an amino acid sequence that exhibits activity, i.e., an amino acid sequence of an enzyme, it may be referred to as a parent enzyme.

[0139]

[0140] In this application, the term "reference sequence" refers to a sequence used to determine the position of an amino acid within an arbitrary amino acid sequence. By aligning an arbitrary amino acid sequence with a reference sequence, the position of an amino acid corresponding to a specific position of the reference sequence within the arbitrary amino acid sequence can be determined.

[0141]

[0142] In the present application, with respect to an amino acid or nucleic acid sequence, the term "fragment" means a portion of a parent sequence. For example, it may be a polypeptide in which one or more amino acids from the parent sequence are removed from the C or N terminus.

[0143] In the present application, a "fragment" of an enzyme may refer to a "functional fragment." A "functional fragment," also referred to as an "active fragment," refers to a polypeptide that is part of a parent enzyme and possesses the enzymatic activity of the parent enzyme. For example, a functional fragment of an enzyme may include the catalytic site of the enzyme.

[0144] The enzyme fragment may comprise a portion of the full length of the parent enzyme, for example, but not limited to, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or less than 100% of the amino acids of the full length of the parent enzyme.

[0145]

[0146] In this application, "mutating / modifying" means changing or altering. This may be a change from a naturally occurring sequence. For example, an enzyme may be modified in such a way that it is altered from its parent sequence or reference sequence.

[0147] In the present application, the modified enzyme may be a non-naturally occurring enzyme, i.e., an enzyme that does not exist in nature itself.

[0148] The term "modified" in this application means, for example, something that has been altered from its naturally occurring form. The modified enzymes of this application include enzymes that do not occur naturally or naturally occurring variants. For example, the modified enzymes of this application are enzymes that are not found in nature. For example, the modified enzymes of this application may be, but are not limited to, enzymes that do not occur spontaneously.

[0149] When the term "modification" is used in relation to an amino acid / nucleic acid sequence in this application, it may include substitution of an amino acid / nucleic acid residue of the parent sequence for a different amino acid / nucleic acid residue at one or more sites in the amino acid sequence, deletion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, insertion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, truncation of the N-terminal and / or C-terminal amino acid sequence or 5' and / or 3' nucleic acid sequence, and any combination thereof.

[0150]

[0151] In the present application, a "variant" or "modified polypeptide" of an enzyme refers to a protein that differs from the parent enzyme in one or more amino acids by conservative substitution and / or modification. The terms "variant" and "modified polypeptide" may be used interchangeably. The variant or modified polypeptide may be, but is not limited to, a non-naturally occurring one.

[0152] The variant differs from the sequence of the parent enzyme by one or more modifications, e.g., amino acid substitutions, deletions and / or insertions.

[0153] Such variants can generally be identified by altering one or more amino acids in the parent enzyme and evaluating the properties of the altered protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the parent enzyme.

[0154] Additionally, some variants may comprise mutant polypeptides in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted.

[0155] Other variants may include variants in which portions are removed from the N- and / or C-terminus of the mature protein.

[0156] The term "variant" or "variant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, and mutation (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0157] Variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0158]

[0159] In this application, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0160]

[0161] Throughout this application, the conventional one-letter and three-letter codes for naturally occurring amino acids are used. Furthermore, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

[0162]

[0163] Alanine Ala, A Arginine Arg, R

[0164] Asparagine Asn, N Aspartic acid Asp, D

[0165] Cysteine ​​Cys, C Glutamic acid Glu, E

[0166] Glutamine Gln, Q Glycine Gly, G

[0167] Histidine His, H Isoleucine Ile, I

[0168] Leucine Leu, L Lysine Lys, K

[0169] Methionine Met, M Phenylalanine Phe, F

[0170] Proline Pro, P Serine Ser, S

[0171] Threonine Thr, T Tryptophan Trp, W

[0172] Tyrosine Tyr, Y Valine Val, V

[0173]

[0174] Meanwhile, any amino acid can be written as Xaa, X.

[0175] Additionally, the generally accepted three-letter codes for other amino acids, such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), and α-methyl-glutamic acid, may be used, as well as for naturally occurring amino acids.

[0176]

[0177] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Accordingly, amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0178] For example, among the amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; among the amino acids having uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the nonpolar amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine.

[0179]

[0180] As used herein, the term "gene" refers to a polynucleotide encoding a polypeptide and a polynucleotide comprising regions preceding and following the coding region. In some embodiments, a gene may have a sequence (intron) inserted between each coding region (exon).

[0181]

[0182] As used herein, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0183] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons that are considered codon degenerate.

[0184] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using, but is not limited to, BLAST from the National Center for Biotechnology Information Database, or ClustalW.

[0185] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1s for identity and 0s for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0186] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, but are not limited thereto).

[0187]

[0188] In this application, the term "mature polypeptide" refers to a polypeptide in a form that lacks a signal sequence or a propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. A mature polypeptide may be a final form that has undergone post-translational or post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, and leader sequence removal.

[0189]

[0190] The term "nucleic acid construct" in this application means a single or double-stranded nucleic acid molecule that contains one or more regulatory sequences and is artificially synthesized, engineered to contain a specific sequence in a manner that does not exist in nature, or isolated from nature.

[0191]

[0192] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0193] As used herein, the term "expression vector" means a linear or circular nucleic acid molecule comprising a coding sequence and regulatory sequences operably linked thereto for expression thereof.

[0194]

[0195] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately to direct the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target in accordance with the known or desired activity.

[0196]

[0197] As used herein, the term "cDNA" refers to a DNA sequence that can be produced by reverse transcription from a mature, spliced ​​mRNA molecule, which can be obtained from a eukaryotic or prokaryotic cell. The cDNA sequence does not include intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA before being processed through a series of steps, including splicing, to form the mature, spliced ​​mRNA.

[0198]

[0199] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary for the expression of a coding sequence. Each regulatory sequence may be native to the coding sequence (having the same origin) or foreign (derived from another gene). Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0200]

[0201] To describe the variants provided in this application, the following nomenclature is used.

[0202] In this application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 003" may be described as "position 3," "amino acid 3," or "the third amino acid." Furthermore, for example, if the amino acid at position 3 is serine (S), it may be described as "S3" or "Ser3."

[0203] Amino acid substitutions can be expressed by listing the amino acid before substitution, the position, and the amino acid being replaced. These amino acids can be expressed using conventional one-letter and three-letter codes. For example, if alanine, the amino acid at position 8 in a specific sequence, is replaced with valine, it can be written as "A8V" or "Ala8Val."

[0204] Any amino acid at a particular position can be designated as "X". For example, X6 refers to any amino acid at position 6. Also, when a substituted amino acid is designated as X, it means that it is replaced with an amino acid different from the amino acid present before the substitution. For example, "V6X" indicates that V is replaced with any amino acid other than V at position 6.

[0205] Different alternations can be expressed by simultaneously listing multiple amino acids using symbols such as ",". For example, a substitution of the amino acid at position 12 (D) with S or K can be written as D12S,K.

[0206] Multiple mutations can be specified using a " / ". For example, T95R / D239S means that the amino acid at position 95, threonine, is substituted with arginine, and the amino acid at position 239, aspartic acid, is substituted with serine.

[0207] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the protein or polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0208] In the present application, SEQ ID NO. 1 can be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

[0209] That is, SEQ ID NO: 1 disclosed in the present application can be used to determine the corresponding amino acid residue in a polypeptide having any PET degrading activity, and unless otherwise indicated in the present application, residues of a specific amino acid sequence are numbered based on SEQ ID NO: 1.

[0210] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0211] These alignments can be performed using, but are not limited to, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), and Trends Genet. 16: 276-277).

[0212] Additionally, multiple sequence alignment can be used to identify corresponding amino acid residues in other PETases. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.

[0213] Additionally, if enzymes diverged from the mature polypeptide of SEQ ID NO: 1 and their relationships cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for this purpose.

[0214] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or Combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).

[0215] The above methods are examples and are not limiting.

[0216]

[0217] Hereinafter, specific examples of the present application will be described in more detail as follows.

[0218]

[0219] In the present application, "polypeptide having PET decomposition activity", "PET decomposition enzyme (PETase)" is a polypeptide having depolymerization activity of polyethylene terephthalate (PET), and may also include a polypeptide having depolymerization activity of a low-molecular-weight polymer obtained by depolymerizing PET, for example, bis-2-hydroxyethyl terephthalate (BHET). The term "depolymerization" means a process in which a polymer or at least one polymer of the plastic material is depolymerized into smaller molecules, such as monomers and / or oligomers.

[0220] In the present application, PET degradation activity can be measured and evaluated using methods known in the art, including the embodiments described in the present application. For example, it can be evaluated by measuring the amount of BHET, MHET, or TPA produced.

[0221]

[0222] In this application, the term "parent PET degrading enzyme" refers to a PET degrading enzyme that has been modified to produce a variant or mutant polypeptide of the present application. Specifically, the parent PET degrading enzyme, parent enzyme, or parent sequence may be a naturally occurring polypeptide or a wild-type polypeptide, may be a mature polypeptide thereof, may include a variant or functional fragment thereof, but is not limited to any polypeptide that has PET degrading enzyme activity and can be a parent of a variant.

[0223] The parent PET degrading enzyme provided in the present application may be, but is not limited to, a polypeptide having SEQ ID NO: 1. In addition, as long as it has PET degrading activity, it may be a polypeptide having a sequence identity of at least about 60%, 70%, 75%, 77%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% with the polypeptide having SEQ ID NO: 1, and as long as it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, it may be included without limitation in the scope of the parent PET degrading enzyme.

[0224] The parent PETase of the variant provided in the present application may be derived from a microorganism of the genus Kutzneria. Specifically, it may be derived from Kutzneria buriramensis.

[0225] Meanwhile, the above-mentioned microorganism is an example of a microorganism from which the parent PETase provided in the present application can be derived, and includes a microorganism derived from a microorganism that is taxonomically homologous thereto, regardless of the name of the microorganism.

[0226] The above-mentioned microorganisms can be obtained from known microorganism depositories such as ATCC, DSMZ, CBS, NRRL, KCTC, and KCCM.

[0227] In the present application, a sequence "derived from" a particular microorganism is not limited to a sequence that is naturally produced or can be produced in the microorganism, but also includes a sequence encoded by a gene that is produced and isolated from the microorganism containing the gene.

[0228] For example, PETase derived from Kutzneria sp. includes not only enzymes having PETase activity that are naturally produced in Kutzneria sp., but also those produced in other host cells through genetic modification known in the art (e.g., transformation with a sequence encoding the enzyme).

[0229] In addition, the present application newly discovered that the polypeptide of SEQ ID NO: 1 has PET decomposition activity, and produced a mutant polypeptide with altered or enhanced characteristics by introducing mutations thereto using SEQ ID NO: 1 as a parent sequence. Accordingly, one aspect of the present application provides the use of a polypeptide having the same or corresponding activity as a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 as a PET decomposition enzyme. The description of the parent PET decomposition enzyme of the mutant provided in the present application may be applied to the polypeptide having the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1.

[0230] Mutant of Mo Tase

[0231] In the present application, the “variant polypeptide having PET decomposition activity” may be a variant of the parent PET decomposition enzyme.

[0232] In this application, the term "variant of PET degrading enzyme" or "PET degrading enzyme variant" refers to a protein having one or more amino acids different from the amino acid sequence of the parent PETase and having PET degrading activity.

[0233] The above “mutant polypeptide having PET decomposition activity”, “mutant of PETase” and “mutant of PET decomposition enzyme” can be used interchangeably.

[0234] The variants provided in the present application may possess PETase activity and include modifications of one or more amino acids in the parent PETase sequence. The modifications may be deletions, insertions, substitutions with other amino acids, disulfide bond formation, and / or combinations thereof. Specifically, the modifications may be amino acid substitutions and / or disulfide bond formation, and more specifically, combinations thereof.

[0235] In addition, the variant is i) a polypeptide having a sequence identity of at least 70% and less than 100% with SEQ ID NO: 1; and / or ii) the variant is a polypeptide encoded by a polynucleotide having a sequence identity of at least 70% and less than 100% with a sequence encoding a mature polypeptide of SEQ ID NO: 1; and / or iii) the variant is a polypeptide encoded by a polynucleotide that hybridizes to (a) the mature polypeptide coding sequence of SEQ ID NO: 1, (b) a cDNA thereof, or (c) the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions; and / or iv) the variant may be a functional fragment of the polypeptide i), ii) or ii) having PET degrading activity.

[0236] Specifically, the variants provided in the present application may have PET decomposition activity and may have one or more altered functions or properties compared to the parent PETase, including modification of one or more amino acids in the parent PETase sequence.

[0237] In one specific example, the variants provided in the present application have PETase activity, and may have one or more altered functions or properties compared to the parent PETase, including modification of one or more amino acids in the parent PETase sequence, and may have one or more conservative substitutions.

[0238]

[0239] The variant provided in the present application is a variant of the parent PETase and may be a polypeptide having PET decomposition activity.

[0240] In one specific example, the variant provided in the present application may include a modification at one or more positions selected from amino acids corresponding to positions 95, 119, 184, 239, 279, 173, 197, 236, 281, 127, 131, and 190 of SEQ ID NO: 1.

[0241] In this application, the position number is a position corresponding to the position of the polypeptide of sequence number 1, and “corresponding” is as described above.

[0242] In any one of the specific examples described above, the variant provided in the present application may include a modification of an amino acid corresponding to one or more of T95, T119, V184, D239, A279, A173, K197, A236, S281, Q127, E131, D190 of SEQ ID NO: 1.

[0243]

[0244] In any one of the specific examples described above, amino acid position 95 provided in the present application before modification may be threonine (T); amino acid position 119 may be threonine (T); amino acid position 184 may be valine (V); amino acid position 239 may be aspartic acid (D); amino acid position 279 may be alanine (A); amino acid position 173 may be alanine (A); amino acid position 197 may be lysine (K); amino acid position 236 may be alanine (A); amino acid position 281 may be serine (S); amino acid position 127 may be glutamine (Q); amino acid position 131 may be glutamic acid (E); and / or amino acid position 190 may be aspartic acid (D).

[0245]

[0246] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 95 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, C, Y, N, Q, D, E, K, R or H, and specifically may include a substitution with R, H or K.

[0247] In any one of the specific examples described above, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 119 with G, A, V, L, I, M, F, W, P, S, C, Y, N, Q, D, E, K, R or H, and specifically may comprise a substitution with N, Q, R, H, K, D or E.

[0248] In any one of the specific examples described above, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 184 of SEQ ID NO: 1 with G, A, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R or H, and specifically may comprise a substitution with I.

[0249] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 239 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, E, K, R or H, and specifically may include a substitution with S or T.

[0250] In any one of the specific examples described above, the variant provided in the present application may comprise a substitution of the amino acid corresponding to position 279 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R or H, and specifically may comprise a substitution with S.

[0251] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 173 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R or H, and specifically may include a substitution with C, I, L, or V.

[0252] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 197 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, R or H, and specifically may include a substitution with C, A, I, L or V.

[0253] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 236 of SEQ ID NO: 1 with G, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, E, K, R or H, and specifically may include a substitution with C, L or S.

[0254] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 281 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, T, C, Y, N, Q, D, E, K, R or H, and specifically may include a substitution with C, A or L.

[0255] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 127 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, D, E, K, R or H, and specifically may include a substitution with S.

[0256] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 131 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, D, K, R or H, and specifically may include a substitution with Q, N or C.

[0257] In any one of the specific examples described above, the variant provided in the present application may include a substitution of the amino acid corresponding to position 190 of SEQ ID NO: 1 with G, A, V, L, I, M, F, W, P, S, T, C, Y, N, Q, E, K, R or H, and specifically, may include a substitution with H, R, K or E.

[0258]

[0259] In any one of the specific examples described above, the variant provided in the present application may comprise one or more of the following substitutions:

[0260] Substitution of the amino acid corresponding to position 95 with arginine, histidine, or lysine;

[0261] The amino acid corresponding to position 119 is replaced with asparagine, glutamine, arginine, histidine, lysine, aspartic acid, or glutamic acid;

[0262] The amino acid corresponding to position 184 is substituted with isoleucine;

[0263] Substitution of the amino acid corresponding to position 239 with serine or threonine;

[0264] The amino acid corresponding to position 279 is replaced with serine;

[0265] The amino acid corresponding to position 173 is substituted with cysteine, isoleucine, leucine, or valine;

[0266] The amino acid corresponding to position 197 is substituted with cysteine, alanine, isoleucine, leucine, or valine;

[0267] The amino acid corresponding to position 236 is substituted with cysteine, leucine, or serine;

[0268] The amino acid corresponding to position 281 is substituted with cysteine, alanine, or leucine;

[0269] The amino acid corresponding to position 127 is substituted with serine;

[0270] The amino acid corresponding to position 131 is replaced with glutamine, asparagine, or cysteine; and

[0271] The amino acid corresponding to position 190 is replaced with histidine, arginine, lysine, or glutamic acid;

[0272] Here, the position number is the position corresponding to the position of the polypeptide of sequence number 1.

[0273]

[0274] In any one of the specific examples described above, the variant provided in the present application may comprise one or more of the following substitutions:

[0275] T95R,H,K;

[0276] T119N,Q,R,H,K,D,E;

[0277] V184I;

[0278] D239S,T;

[0279] A279S;

[0280] A173C, I, L, V;

[0281] K197C, A, I, L, V;

[0282] A236C, L, S;

[0283] S281C, A, L;

[0284] Q127S;

[0285] E131Q, N, C; and

[0286] D190H, R, K, E;

[0287] Here, the position number is the position corresponding to the position of the polypeptide of sequence number 1.

[0288]

[0289] In any one of the specific examples described above, the variant provided in the present application may comprise a substitution of amino acids 173 and 297 of SEQ ID NO: 1 with cysteine, and may form a disulfide bridge (disulfide bond; disulfide bond) between the substituted amino acids.

[0290] In any one of the specific examples described above, the variant provided in the present application may comprise a substitution of amino acids 236 and 281 of SEQ ID NO: 1 with cysteine, and may form a disulfide bridge between the substituted amino acids.

[0291]

[0292] In any one of the specific examples described above, the variant provided in the present application is

[0293] A173C / K197C; and one or more substitutions selected from A236C / S281C; and

[0294] Q127S; E131Q, N, C; and D190H, R, K, E; and / or one or more substitutions selected from T95R,H,K; T119N,Q,R,H,K,D,E; V184I; D239S,T; and A279S.

[0295]

[0296] In any one of the specific examples described above, the variant provided in the present application is

[0297] A173I / K197I;

[0298] A173L / K197L;

[0299] A173V / K197V;

[0300] A236L / S281L;

[0301] Q127S / E131N; and

[0302] Q127S / E131C; may include one or more substitutions selected from among:

[0303]

[0304] In any one of the specific examples described above, the variant provided in the present application may comprise one or more of the following substitutions:

[0305] One or more substitutions selected from T95R, D239S, A279S, T119N, V184I;

[0306] A173C / K197C;

[0307] A236C / S281C; and

[0308] One or more substitutions selected from Q127S, E131Q, D190H;

[0309] Here, the position number is the position corresponding to the position of the polypeptide of sequence number 1.

[0310]

[0311]

[0312] In any one of the specific examples described above, the variant provided in the present application may comprise one or more of the following substitutions:

[0313] T95R / D239S / A279S / T119N / V184I;

[0314] A173C / K197C;

[0315] A236C / S281C; and

[0316] Q127S / E131Q / D190H;

[0317] Here, the position number is the position corresponding to the position of the polypeptide of sequence number 1.

[0318]

[0319] In one specific example,

[0320] A variant containing the T95R substitution in SEQ ID NO: 1 is SEQ ID NO: 3,

[0321] A variant containing the D239S substitution in SEQ ID NO: 1 is SEQ ID NO: 4,

[0322] A variant containing the A279S substitution in SEQ ID NO: 1 is SEQ ID NO: 5,

[0323] A variant containing the T119N substitution in SEQ ID NO: 1 is SEQ ID NO: 6,

[0324] A variant containing the V184I substitution in SEQ ID NO: 1 is SEQ ID NO: 7,

[0325] A variant containing the T95R / D239S substitution of SEQ ID NO: 1 is SEQ ID NO: 8.

[0326] A variant containing the T95R / A279S substitution of SEQ ID NO: 1 is SEQ ID NO: 9,

[0327] A variant containing the T95R / T119N substitution of SEQ ID NO: 1 is SEQ ID NO: 10,

[0328] A variant containing the T95R / V184I substitution of SEQ ID NO: 1 is SEQ ID NO: 11,

[0329] A variant containing the D239S / A279S substitution of SEQ ID NO: 1 is SEQ ID NO: 12,

[0330] A variant containing the D239S / T119N substitution of SEQ ID NO: 1 is SEQ ID NO: 13,

[0331] A variant containing the D239S / V184I substitution of SEQ ID NO: 1 is SEQ ID NO: 14,

[0332] A variant containing the A279S / T119N substitution of SEQ ID NO: 1 is SEQ ID NO: 15,

[0333] A variant containing the A279S / V184I substitution of SEQ ID NO: 1 is SEQ ID NO: 16.

[0334] A variant containing the T119N / V184I substitution of SEQ ID NO: 1 is SEQ ID NO: 17.

[0335] A variant containing the T95R / D239S / A279S substitutions of SEQ ID NO: 1 is SEQ ID NO: 18.

[0336] A variant containing the T95R / D239S / T119N substitutions of SEQ ID NO: 1 is SEQ ID NO: 19.

[0337] A variant containing the T95R / D239S / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 20.

[0338] A variant containing the T95R / A279S / T119N substitutions of SEQ ID NO: 1 is SEQ ID NO: 21,

[0339] A variant containing the T95R / A279S / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 22.

[0340] A variant containing the T95R / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 23.

[0341] A variant containing the D239S / A279S / T119N substitutions of SEQ ID NO: 1 is SEQ ID NO: 24.

[0342] A variant containing the D239S / A279S / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 25,

[0343] A variant containing the D239S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 26.

[0344] A variant containing the A279S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 27.

[0345] A variant containing the T95R / D239S / A279S / T119N substitutions of SEQ ID NO: 1 is SEQ ID NO: 28.

[0346] A variant containing the T95R / D239S / A279S / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 29.

[0347] A variant containing the T95R / D239S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 30.

[0348] A variant containing the T95R / A279S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 31.

[0349] A variant containing the D239S / A279S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 32.

[0350] A variant containing the T95R / D239S / A279S / T119N / V184I substitutions of SEQ ID NO: 1 is SEQ ID NO: 33.

[0351] A variant containing the A173C / K197C substitution of SEQ ID NO: 1 is SEQ ID NO: 34.

[0352] A variant containing the A236C / S281C substitution of SEQ ID NO: 1 is SEQ ID NO: 35,

[0353] A variant containing the A173C / K197C / A236C / S281C substitutions of SEQ ID NO: 1 is SEQ ID NO: 36.

[0354] A variant containing the E131Q substitution in SEQ ID NO: 1 is SEQ ID NO: 37,

[0355] A variant containing the Q127S / E131Q substitution of SEQ ID NO: 1 is SEQ ID NO: 38.

[0356] A variant containing the D190H substitution in SEQ ID NO: 1 is SEQ ID NO: 39,

[0357] A variant containing the Q127S / E131Q / D190H substitutions of SEQ ID NO: 1 is SEQ ID NO: 40.

[0358] A variant containing the T95R / D239S / A279S / T119N / V184I / A173C / K197C / A236C / S281C substitutions of SEQ ID NO: 1 is SEQ ID NO: 41.

[0359] A variant containing the substitutions A173C / K197C / A236C / S281C / Q127S / E131Q / D190H of SEQ ID NO: 1 is SEQ ID NO: 42.

[0360] A variant containing the substitutions T95R / D239S / A279S / T119N / V184I / A173C / K197C / A236C / S281C / Q127S / E131Q / D190H of SEQ ID NO: 1 is SEQ ID NO: 43.

[0361] A variant containing the T95H substitution in SEQ ID NO: 1 is SEQ ID NO: 44,

[0362] A variant containing the T95K substitution in SEQ ID NO: 1 is SEQ ID NO: 45,

[0363] A variant containing the D239T substitution in SEQ ID NO: 1 is SEQ ID NO: 46,

[0364] A variant containing the K197A substitution in SEQ ID NO: 1 is SEQ ID NO: 47,

[0365] A variant containing the A173I / K197I substitution of SEQ ID NO: 1 is SEQ ID NO: 48.

[0366] A variant containing the A173L / K197L substitution of SEQ ID NO: 1 is SEQ ID NO: 49.

[0367] A variant containing the A173V / K197V substitution of SEQ ID NO: 1 is SEQ ID NO: 50.

[0368] A variant containing the T119Q substitution in SEQ ID NO: 1 is SEQ ID NO: 51,

[0369] A variant containing the T119R substitution in SEQ ID NO: 1 is SEQ ID NO: 52,

[0370] A variant containing the T119H substitution in SEQ ID NO: 1 is SEQ ID NO: 53,

[0371] A variant containing the T119K substitution in SEQ ID NO: 1 is SEQ ID NO: 54.

[0372] A variant containing the T119D substitution in SEQ ID NO: 1 is SEQ ID NO: 55,

[0373] A variant containing the T119E substitution in SEQ ID NO: 1 is SEQ ID NO: 56,

[0374] A variant containing the S281A substitution in SEQ ID NO: 1 is SEQ ID NO: 57.

[0375] A variant containing the A236L / S281L substitution of SEQ ID NO: 1 is SEQ ID NO: 58.

[0376] A variant containing the A236S substitution in SEQ ID NO: 1 is SEQ ID NO: 59.

[0377] A variant containing the E131N substitution in SEQ ID NO: 1 is SEQ ID NO: 60,

[0378] A variant containing the D190R substitution in SEQ ID NO: 1 is SEQ ID NO: 61,

[0379] A variant containing the D190K substitution in SEQ ID NO: 1 is SEQ ID NO: 62,

[0380] A variant containing the D190E substitution in SEQ ID NO: 1 is SEQ ID NO: 63,

[0381] A variant containing the Q127S / E131N substitution of SEQ ID NO: 1 is SEQ ID NO: 64.

[0382] A variant containing the Q127S / E131C substitution of SEQ ID NO: 1 is SEQ ID NO: 65

[0383] can be displayed as

[0384]

[0385] In one specific example, the variants provided in the present application include all possible combinations of the modifications described above.

[0386] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 77%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100% with the parent PET degrading enzyme; its mature polypeptide or a functional fragment thereof.

[0387] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 77%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% with SEQ ID NO: 1.

[0388] In one specific example, the variant provided in the present application may be a polypeptide encoded by a polynucleotide having a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 77%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100%, with a sequence encoding a mature polypeptide of SEQ ID NO: 1.

[0389] In one specific example, the variant provided in the present application may have a sequence identity of at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 77%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% with a functional fragment of SEQ ID NO: 1.

[0390]

[0391] The variants provided in the present application may have one or more altered properties or attributes of the polypeptide that can be selected or detected compared to other parent PET degrading enzymes, such as wild type PET degrading enzymes, parent PET degrading enzymes, other PET degrading enzyme variants, etc.

[0392] The above properties or attributes include oxidation stability, substrate specificity, catalytic activity, thermal stability, alkaline stability, pH activity profile, resistance to proteolysis, Km, k cat , k cat / Km ratio, protein folding, induction of an immune response, ability to bind a ligand, ability to bind a receptor, ability to be secreted, ability to be displayed on the surface of a cell, ability to form oligomers, ability to signal, ability to promote cell proliferation, ability to inhibit cell proliferation, ability to induce apoptosis, ability to be modified by phosphorylation or glycosylation, and / or ability to treat a disease, but are not limited thereto.

[0393]

[0394] Specifically, the variants provided in the present application may have one or more of the following altered activities compared to the parent sequence:

[0395] i) Increase or decrease in enzyme activity;

[0396] ii) Increase or decrease in specific activity;

[0397] iii) Increase or decrease pH stability;

[0398] iv) Increase or decrease storage stability;

[0399] v) Increase or decrease in acid resistance;

[0400] vi) Increase or decrease in heat resistance or heat stability; and

[0401] vii) Change in substrate specificity;

[0402] However, it is not limited to this.

[0403]

[0404] As another example, the PET degrading enzyme provided in the present application may have one or more of the following altered activities compared to LCC (GenBank: AEV21261.1) and IsPETase (GenBank: GAP38373.1):

[0405] i) Increased enzyme activity;

[0406] ii) Increased specific activity;

[0407] iii) Increased pH stability;

[0408] iv) Increased storage stability;

[0409] v) Increased acid resistance;

[0410] vi) increased heat resistance; and

[0411] vii) Change in substrate specificity;

[0412] However, it is not limited to this.

[0413]

[0414] In the present application, "enzymatic activity" refers to at least one catalytic activity. Specifically, k cat / It may be, but is not limited to, the conversion efficiency of the enzyme, which is mainly expressed as Km.

[0415] k cat When the enzyme is completely saturated with the substrate, it refers to the catalytic constant for the conversion of a single enzyme into a product per unit time, also called the turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

[0416] As an example of how to express enzyme activity, specific activity (umol of converted substrate x mg) -1 x min -1 ) or volumetric activity (umol of converted substrate x mL -1 x min -1 ) etc.

[0417] However, the definition of enzyme activity is not limited to the above-mentioned content, and can be defined and evaluated based on known content such as Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; AG Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, WH Freeman, 1999; Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet et al., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity.

[0418]

[0419] In one specific example, the variants provided in the present application may have an increased enzyme activity of about 100%, about 110%, about 120%, about 130%, about 140%, about 150%, about 160%, about 170%, about 180%, about 190%, or about 200% or more compared to the parent enzyme.

[0420] In another specific example, the variants provided in the present application may have a reduced enzyme activity of about 99%, about 95%, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, or about 20% or less compared to the parent enzyme.

[0421]

[0422] The term "specific activity" in this application refers to the activity of an enzyme per unit weight of protein, expressed as unit / mg. Protein quantification can be performed, for example, using SDS-PAGE or the Bradford assay.

[0423]

[0424] Enzyme stability refers to the preservation of enzyme activity during storage or reaction time. To measure changes in this stability, the initial enzyme activity is measured at time zero (100%) and after a specified time (x%) under defined conditions. This comparison allows for the expression of enzyme stability, or the level at which enzyme activity is lost.

[0425]

[0426] Factors that affect enzyme activity include, for example, pH, heat, and the presence of other substances (e.g., oxidizing agents, chelating agents).

[0427]

[0428] As used herein, the term "pH stability" refers to the ability of a protein to function within a specific pH range. In one specific example, the variants provided in the present application may be active at a pH ranging from about 4.0 to about 12.0, but are not limited thereto.

[0429] A protein can be defined as having "pH stability" if it maintains its function over a specific pH range, and can be defined as having "acid resistance", "alkali resistance", etc., depending on the pH range.

[0430]

[0431] As used herein, the term "thermal stability" refers to the ability of a protein to function within a specific temperature range. In one specific example, the variants provided in this application may exhibit activity in a temperature range of about 20°C to about 90°C, and specifically, but not limited to, activity in a temperature range of about 25°C to about 75°C.

[0432] As used herein, the term "thermal tolerance" refers to the ability of a protein to function after exposure to a specific temperature, such as high or low temperatures. For example, a protein that is thermostable may not function at the temperature to which it is exposed, but may regain function when returned to its optimal temperature environment.

[0433]

[0434] Increased stability includes maintaining high enzymatic activity compared to other enzymes, e.g., wild-type enzyme, parent enzyme and / or other variants; increasing the range of pH, temperature and / or time over which the protein remains functional.

[0435] Decreased stability includes lower retention of enzyme activity compared to other enzymes, e.g., wild-type enzyme, parent enzyme, and / or other variants; reduced range of pH, temperature, and / or time over which the protein remains functional.

[0436]

[0437] As used herein, the term "substrate specificity" refers to the ability of an enzyme to distinguish between substrates and molecules that compete with the substrate. Substrate specificity can be determined by measuring the activity of an enzyme toward different substrates. In one embodiment, the change in substrate specificity may be a change in the direction of increasing specificity toward a substrate capable of producing a desired product. In another embodiment, the change in substrate specificity may be a change in the direction of decreasing specificity toward a substrate capable of producing a desired product.

[0438]

[0439] A "polynucleotide" encoding a variant of the present invention may comprise the coding sequence of the aforementioned variant. The polynucleotide may undergo various modifications to the coding region, without altering the amino acid sequence of the polypeptide, due to codon degeneracy or in consideration of codon preference in the organism intended to express the polypeptide.

[0440] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the base sequence, so long as it encodes a variant of the present application.

[0441] The above "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0442] For example, conditions under which polynucleotides having a high degree of homology or identity hybridize with each other, specifically at least 40%, specifically at least 90%, more specifically at least 95%, at least 96%, at least 97%, at least 98%, and even more specifically at least 99%, and polynucleotides having a lower degree of homology or identity than that hybridize, or conditions under which washing is performed once, specifically twice or three times, at a salt concentration and temperature corresponding to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, can be listed.

[0443] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0444] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0445] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0446] For example, “high stringency” may occur at about 5 to 10°C below the Tm of the probe; “medium stringency” may occur at about 10 to 20°C below the Tm of the probe; and “low stringency” may occur at about 20 to 25°C below the Tm, but is not limited thereto.

[0447] For example, “low stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 25% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 50°C.

[0448] For example, “medium stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 55°C. For example, “medium-high stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 1 to 2 X SSC, 0.1 to 0.2% SDS at 60°C.

[0449] For example, “high stringency conditions” can be prehybridization and hybridization at 42°C in 5 X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 65°C.

[0450]

[0451] The "nucleic acid construct" provided in the present application comprises a polynucleotide encoding a variant provided in the present application, operably linked to one or more regulatory sequences that direct expression of the coding sequence in a suitable host cell under conditions suitable for the regulatory sequences.

[0452] Polynucleotides can be manipulated in a variety of ways to enable expression of variants. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide before inserting it into the vector. Such manipulations can be performed using methods known in the art.

[0453]

[0454] The "vector" provided in this application refers to a DNA construct containing a base sequence of a polynucleotide encoding a variant of the present application, operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the variant in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0455] The vector that can be used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0456] For example, a polynucleotide encoding a variant provided in the present application can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0457]

[0458] The “host cell” of the present application may include, without limitation, any cell capable of expressing a polypeptide having PET decomposition activity of the present application.

[0459] The host cell of the present application may comprise the above-described variant, a polynucleotide encoding the variant, a nucleic acid construct comprising the same, and / or a vector.

[0460] In one specific example, the host cell of the present application may overexpress a polypeptide having PET degrading activity, wherein the polypeptide having PET degrading activity may be a variant and / or a parent PET degrading enzyme described above.

[0461] The nucleic acid construct or vector may be integrated into a chromosome as described above, or may be maintained as an extrachromosomal vector that replicates autonomously.

[0462] The host cell of the present invention includes any progeny of the parent cell that are not identical to the parent cell due to mutations that occur during replication.

[0463] The host cell can be any cell useful for recombinant production of variants, e.g., a prokaryotic or eukaryotic cell.

[0464] The prokaryotic host cell can be any gram-positive or gram-negative bacterium.

[0465] Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, Kuzneria, Corynebacterium, and Streptomyces.

[0466] Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, Vibrio (e.g., Vibrio natriegens), and Ureaplasma.

[0467] In one specific example, the bacterial host cell can be a Bacillus genus host cell, specifically including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells.

[0468] In one specific example, the bacterial host cell can be a Streptococcus genus host cell, specifically including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subspecies Zooepidemicus cells.

[0469] In one specific example, the bacterial host cell can be a host cell of the genus Streptomyces, specifically including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicol, Streptomyces griseus and Streptomyces lividans cells.

[0470] In one specific example, the bacterial host cell may be a host cell of the genus Corynebacterium, such as Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes. ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0471] In one specific example, the bacterial host cell may be a host cell of the genus Escherichia, such as, but not limited to, Escherichia coli (E. coli).

[0472] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0473] The host cell may be a fungal cell. In the present application, "fungus" includes the Ascomycota, Basidiomycota, Fasciomycota, and Zygomycota, as well as the Oomycota and all imperfect fungi.

[0474] The fungal host cell may be a yeast cell. The term "yeast" in the present application includes yeasts belonging to the order ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and Fungi imperfecti (Blastomycetes). However, this classification may vary and may be defined according to the Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0475] The yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, Schizosaccharomyces or Yarrowia cell, for example, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces These may be cells of Saccharomyces norbensis, Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica.

[0476] The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the phylum Eumycota and the subphylum Oomycota (as defined in the above reference (Hawksworth et al., 1995)). Filamentous fungi are typically characterized by a hyphal wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbonation is strictly aerobic. In contrast, vegetative growth in yeasts, such as Saccharomyces cerevisiae, is by germination of a unicellular thallus, and carbonation may be fermentative.

[0477] The filamentous fungal host cells are Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycellioptora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, It may be a cell of Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.

[0478] For example, the filamentous fungal host cells include Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Mysellioptora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum,It may be a cell of Trichoderma reesei or Trichoderma viride, but is not limited thereto.

[0479]

[0480] The "composition" of the present application may include a polypeptide having PET decomposition activity, having an activity corresponding to a polypeptide consisting of an amino acid sequence of SEQ ID NO: 1; and / or a variant thereof or a host cell expressing the polypeptide.

[0481] For a polypeptide having PET decomposition activity that has an activity corresponding to a polypeptide consisting of the amino acid sequence of the above SEQ ID NO: 1, the description regarding the parent PET decomposition enzyme of the variant provided in the present application may be applied. In addition, for a variant of the above polypeptide and a host cell expressing the same, the description above regarding the variant polypeptide provided in the present application and the host cell expressing the same may be applied.

[0482] The composition of the present application can be used to convert polyester into a final product.

[0483] The term "polyester" refers to a polymer that contains an ester functional group in the main chain of its structure. For example, polyethylene terephthalate is a semi-aromatic copolymer composed of two monomers, terephthalic acid and ethylene glycol.

[0484] The polyester may be selected from polyethylene terephthalate (PET), polyethylene terephthalate glycol (PETG), polyethylene co-isosorbide-terephthalate (PEIT), polytrimethylene terephthalate (PTT), polybutylene adipate terephthalate (PBAT), polycyclohexylenedimethylene terephthalate (PCT), and polybutylene terephthalate (PBT). Specifically, the polyester may be PET.

[0485] The polypeptide of the present invention or a composition comprising the same can be used to depolymerize PET into bis(2-hydroxyethyl) terephthalate (BHET), and / or to decompose PET into mono(2-hydroxyethyl) terephthalate (MHET), terephthalic acid (TPA), and ethylene glycol (EG).

[0486] In one specific example, the polypeptide of the present application can decompose polyester by a glycolysis reaction.

[0487] For example, in the presence of the polypeptide of the present invention and ethylene glycol (EG), degradation of the polyester can be performed, including a step in which the polyester is converted to BHET.

[0488] For example, in the presence of the polypeptide of the present application and ethylene glycol (EG), a step of reacting an ester group of a polyester with an amino acid residue of the polypeptide to form an acyl-enzyme intermediate; and a deacylation step of reacting the formed intermediate with ethylene glycol; the polyester can be converted to BHET, thereby performing decomposition of the polyester.

[0489]

[0490] The composition of the present application may further comprise other components in addition to the polypeptide having PET decomposition activity provided in the present application. Those skilled in the art can appropriately select the components to be added to the composition of the present application.

[0491] In one specific example, the composition of the present application may further comprise any component suitable for application in converting PET into a final product.

[0492] In one specific example, the composition of the present application may further comprise any component suitable for application to PET degradation.

[0493] Examples of substances that may be added include, but are not limited to, stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, compounding agents, lubricants, disintegrants, excipients, solubilizers, suspending agents, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, diluents, lubricants, preservatives, and the like.

[0494] In one specific example, the composition provided in the present application may further comprise, in addition to the variant provided in the present application, a naturally occurring substance or a non-naturally occurring substance. In one specific example, the composition provided in the present application may further comprise water.

[0495] In one specific example, the composition provided in the present application may further comprise an additional enzyme in addition to the variant provided in the present application.

[0496] A method for producing a variant of the present invention may include a step of culturing a host cell; and a step of recovering a variant expressed in the culturing step.

[0497] In this application, the term "cultivation" refers to growing the host cells under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, or fed-batch, but is not limited thereto.

[0498] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the host cells, and supplies nutrients and growth factors, including water, which is essential for survival and development. Specifically, the medium and other culture conditions used for culturing the host cells of the present application may be any medium used for culturing conventional host cells without particular limitation, but the host cells of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0499] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0500] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0501] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0502] In addition, during the cultivation of the host cells, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas can be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without injecting gas, but is not limited thereto.

[0503] The temperature of the medium may be, but is not limited to, 20°C to 50°C, specifically 25°C to 40°C. The incubation period may continue until the desired amount of useful material is produced, and specifically, but is not limited to, 24 hours to 196 hours.

[0504]

[0505] In one specific example, the mutant expressed in the above-described culturing step can be recovered using methods known in the art. For example, the mutant can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

[0506] The above recovery method may be to collect the mutant using a suitable method known in the art according to the culture method of the host cell of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC and a combination of these methods may be used, and the mutant may be recovered from the medium or host cell using a suitable method known in the art.

[0507] In another specific embodiment, the variant expressed by the host cell during the culture step may not be recovered. In this specific embodiment, the host cell expressing the variant itself may be used as a source of the variant.

[0508]

[0509] The present application may include a method for preparing bis-2-hydroxyethyl terephthalate (BHET), (mono(2-hydroxymethyl) terephthalate (MHET), terephthalic acid (TPA) and / or ethylene glycol (EG), comprising contacting a polyester with a polypeptide having PET degrading activity described above or a variant thereof or a host cell expressing the polypeptide or a composition comprising the same.

[0510] Specifically, polyester may include the above-mentioned content.

[0511] In the present application, the term "degrading" a polyester means, but is not limited to, "contacting" the polyester with a mutant polypeptide, a host cell expressing the polypeptide, or a composition comprising the same. Degradation may also be used as depolymerization.

[0512] The time required to degrade a polyester can vary depending on several process parameters (e.g., temperature, pH, additional chemicals, etc.), as well as the nature and origin of the polyester-containing article itself (i.e., the properties and origin of the plastic article, its composition, shape, etc.), the form and amount of the variant polypeptide used, etc. The process parameters can be readily adapted to the article containing the polyester using techniques known in the art.

[0513] For example, the degradation process can be carried out at a temperature of from 20° C. to 90° C., specifically from 40° C. to 80° C., and more specifically from 50° C. to 70° C. More specifically, the temperature can be maintained below an inactivation temperature corresponding to the temperature at which the mutant polypeptide is inactivated and / or below a temperature at which the host cell no longer synthesizes the mutant polypeptide.

[0514] For example, the decomposition process can be carried out at pH 5 to pH 11, and specifically at pH 6 to pH 9.

[0515] As a specific example in the present application, an article comprising polyester may be pretreated prior to contact with the mutant polypeptide of the present invention to physically or chemically modify its structure, thereby increasing the area of ​​contact with the mutant polypeptide.

[0516] Specifically, BHET, MHET, TPA and / or EG that may result from decomposition by the above contact can be recovered sequentially or continuously.

[0517] Specifically, the recovered BHET, MHET, TPA and / or EG can be further purified using any suitable purification method and produced in a re-polymerizable form. More specifically, the purification may include, but is not limited to, a stripping process, separation by aqueous solution, steam selective condensation, filtration and concentration of the post-biological process medium, separation, distillation, vacuum evaporation, extraction, electrodialysis, absorption, ion exchange, precipitation, crystallization, concentration and acid addition dehydration and precipitation, nanofiltration, acid catalyzed treatment, semi-continuous mode distillation or continuous mode distillation, solvent extraction, evaporative concentration, evaporative crystallization, liquid / liquid extraction, hydrogenation, an azeotropic distillation process, absorption, column chromatography, simple vacuum distillation and microfiltration.

[0518]

[0519] The final products BHET, MHET, TPA, and / or EG obtained using the composition of the present application can be reused for polymerization of polyester.

[0520] Specifically, the obtained final products, BHET, MHET, TPA, and / or EG, can be reused as repolymerizable monomers and / or oligomers to synthesize polyesters. Specifically, polyesters with the same properties can be repolymerized and, by mixing with other monomers and / or oligomers, can be synthesized, for example, into new copolymers.

[0521] The polyester may be selected from polyethylene terephthalate (PET), polyethylene terephthalate glycol (PETG), polyethylene co-isosorbide-terephthalate (PEIT), polytrimethylene terephthalate (PTT), polybutylene adipate terephthalate (PBAT), polycyclohexylenedimethylene terephthalate (PCT), and polybutylene terephthalate (PBT). Specifically, the polyester may be PET.

[0522] Methods for synthesizing polyesters using BHET, MHET, TPA, and / or EG are known in the art.

[0523]

[0524] Example

[0525] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0526]

[0527]

[0528] Example 1: Discovery of a Novel PETase

[0529] In addition to the well-known PET hydrolase (IsPETase) of Ideonella sakaiensis201-F6, we performed sequence homology analysis using the NCBI database to identify novel PETases. To test these ten PETase candidates, we first attempted to produce them in a signal peptide-cleaved form, and successfully produced nine PETase candidates. The PET hydrolysis activities of the nine PETase candidates were then measured by monitoring the amounts of released PET hydrolysis products, MHET and TPA, using PET bottle powder (a PET sample derived from PET bottles; referred to as "B-PET") as a substrate. B-PET was obtained through the following process. Transparent PET bottles were crushed using a crusher, and the crushed PET was melted in a high-temperature oven at 270°C. The melted PET was immediately immersed in water at 4°C to harden. The obtained cured PET was subjected to a cryogenic grinding process and then passed through a steel mesh to obtain PET powder of 300 μm or less. The B-PET obtained in this way was mixed with each PETase candidate and reacted at 50°C for 24 hours. While most PETase candidates showed very small amounts of PET hydrolysis products, WP_116180173.1, an alpha-beta hydrolase from Kutzneria buriramensis, showed a significant amount of PET hydrolysis products compared to the other enzymes. In addition, the melting temperature (Tm) of nine PETase candidates was measured to investigate the thermostability of these enzymes, and these PETase candidates showed various Tm values ​​ranging from 38.6°C to 87.6°C. WP_116180173.1, which had extremely high PET hydrolysis activity compared to other enzymes, also showed high temperature stability with a Tm value of 87.6°C, and WP_116180173.1 showed a relatively high solubility expression level. These results are from WP_116180173.1 showed that it has excellent characteristics for efficient PET degradation, such as enzyme activity, thermal stability, and protein expression level. Therefore, WP_116180173.1 (PETase of Kutzneria buriramensis, hereinafter referred to as "KbPETase"; sequence number 1) was selected as a novel PETase in the present invention.

[0530]

[0531] Example 2: Preparation of PET-degrading protein

[0532] Expression and purification of KbPETase were performed under the following conditions. The gene of KbPETase codon-optimized for E. coli (SEQ ID NO: 2) was synthesized and amplified by polymerase chain reaction (PCR). The nucleotide sequence corresponding to the signal peptide was removed from the synthesized DNA. The PCR product was then subcloned (Nde I and Xho I) into pET22b(+) (Novagen), which lacks its own signal peptide. The resulting expression vector pET22b(+): KbPETase was transformed into E. coli Rosetta gami-B (DE3). The E. coli strain was cultured in a flask containing 1 L of lysogeny broth medium containing 100 mg / L ampicillin at 37°C to an optical density (OD) of 0.6 at 600 nm.

[0533] Protein expression was induced by adding 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG), and the culture medium was further cultured at 18°C ​​for 18 hours. Cells were then harvested by centrifugation at 4000 rpm for 20 minutes at 4°C.

[0534] The cell pellet was resuspended in buffer A (40 mM Tris-HCl, pH 8.0) and disrupted by sonication. Cell debris was removed by centrifugation at 13,500 rpm for 30 min, and the supernatant was applied to a Ni-NTA agarose column (Qiagen). After washing with buffer A containing 30 mM imidazole, bound proteins were eluted with 300 mM imidazole in buffer A. All purification steps were performed at 4°C. Protein purity was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The purified protein was concentrated in buffer A. Similarly, known PET hydrolases, LCC (GenBank: AEV21261.1) and IsPETase (GenBank: GAP38373.1), were prepared and used as comparison groups. The primers used for cloning are listed in Table 1.

[0535] Sequence number Enzyme primer sequence 66Kb PETase WT FATATCATATGGCTGACCAAGTGGGACAAGCACCG67RATATCTCGAGACACGCGGTCGAGCGAAACGC68IsPETase WT FTATACATATGCGCGGTCCGAA TCCGACAGCC GCC69RGCGCCTCGAGGCTGCAATTCGCTGTACGAAAATC70LCC WT FTATATCATATGCAATCCAACCCGTACCAG CGCGG71RTATATCTCGAGCTGGCAGTGGCGGTTGTTCGTC

[0536]

[0537] Example 3: Analysis of PET degradation activity of KbPETase and known PET-degrading proteins

[0538] To compare the PET-hydrolyzing activity of KbPETase with that of LCC (GenBank: AEV21261.1) and IsPETase (GenBank: GAP38373.1), which are well-known PET hydrolases, 15 mg of B-PET was prepared using the same method as in Example 1 and immersed in 1 mL of 50 mM Glycine-NaOH (pH 9.0) buffer together with 500 nM enzyme. The reaction mixture was reacted at 40°C and 50°C for 12 hours. After the reaction, the products of each reaction were analyzed by HPLC to evaluate the PET degradation activity.

[0539] As the reaction temperature increased, KbPETase showed relatively much higher activity than IsPETase and LCC, and in particular, at 50°C, it showed 2.5 times higher activity than LCC enzyme and 5.5 times higher activity than IsPETase. Even at 40°C, it showed about 2 times higher activity than these two enzymes. (Fig. 1) These results imply that KbPETase can have higher PET hydrolysis activity than IsPETase and LCC, and in particular, it can have high PET hydrolysis activity even at high temperatures.

[0540]

[0541] Example 4: Preparation of KbPETase variants and measurement of their thermal stability and PET degradation activity.

[0542] To improve the PET degradation activity and thermostability of the enzyme, 41 mutant KbPETases were prepared using the same method as in Example 2. To compare the activities of wild-type KbPETase and mutant KbPETase, 15 mg of B-PET was prepared and soaked in 1 mL of 50 mM Glycine-NaOH (pH 9.0) buffer together with 500 nM enzyme. The reaction mixture was reacted at 60°C for 6 to 24 hours. After the reaction, the PET degradation activity was evaluated by analyzing the products of each reaction using HPLC. In addition, the thermostability was confirmed by measuring the melting temperature (temperature at which protein modification occurs, Tm) of each mutant. The melting temperature was measured by measuring the melting curve using StepOnePlus Real-Time PCR (Thermo Fisher Scientific) using Protein thermal shift dye (Applied Biosystems). Specifically, 5 μg of KbPETase was mixed with 20 μl of protein thermal shift dye, and the signal change indicating the initiation of protein modification was monitored while the temperature was changed by 0.1°C per second from 25°C to 99°C. Based on the melting curves, the melting temperatures (Tm) of KbPETaseWT and 41 mutants were determined.

[0543]

[0544] The M1 variant showed approximately 1.24-fold increased PET degradation activity compared to KbPETaseWT. The M2 variant showed approximately 1.12-fold increased PET degradation activity compared to KbPETaseWT. The M3 variant showed approximately 1.07-fold increased PET degradation activity compared to KbPETaseWT. The M4 variant showed approximately 1.36-fold increased PET degradation activity compared to KbPETaseWT. The M5 variant showed approximately 1.03-fold increased PET degradation activity compared to KbPETaseWT. The M6 ​​variant showed approximately 1.17-fold increased PET degradation activity compared to KbPETaseWT. The M7 variant showed approximately 1.14-fold increased PET degradation activity compared to KbPETaseWT. The M8 variant showed approximately 1.27-fold increased PET degradation activity compared to KbPETaseWT. The M9 variant showed approximately 1.1-fold increased PET degradation activity compared to KbPETaseWT. The M10 variant showed approximately 1.09-fold increased PET degradation activity compared to KbPETaseWT. The M11 variant showed approximately 1.25-fold increased PET degradation activity compared to KbPETaseWT. The M12 variant showed approximately 1.05-fold increased PET degradation activity compared to KbPETaseWT. The M13 variant showed approximately 1.2-fold increased PET degradation activity compared to KbPETaseWT. The M14 variant showed approximately 1.06-fold increased PET degradation activity compared to KbPETaseWT. The M15 variant showed approximately 1.19-fold increased PET degradation activity compared to KbPETaseWT. The M16 variant showed approximately 1.23-fold increased PET degradation activity compared to KbPETaseWT. The M17 variant showed approximately 1.54-fold increased PET degradation activity compared to KbPETaseWT. The M18 variant showed approximately 1.19-fold increased PET degradation activity compared to KbPETaseWT. The M19 variant showed approximately 1.55-fold increased PET degradation activity compared to KbPETaseWT. The M20 variant showed approximately 1.15-fold increased PET degradation activity compared to KbPETaseWT. The M21 variant showed approximately 1.31-fold increased PET degradation activity compared to KbPETaseWT.The M22 variant showed approximately 1.43-fold increased PET degradation activity compared to KbPETaseWT. The M23 variant showed approximately 1.11-fold increased PET degradation activity compared to KbPETaseWT. The M24 variant showed approximately 1.28-fold increased PET degradation activity compared to KbPETaseWT. The M25 variant showed approximately 1.23-fold increased PET degradation activity compared to KbPETaseWT. The M26 variant showed approximately 1.63-fold increased PET degradation activity compared to KbPETaseWT. The M27 variant showed approximately 1.26-fold increased PET degradation activity compared to KbPETaseWT. The M28 variant showed approximately 1.57-fold increased PET degradation activity compared to KbPETaseWT. The M29 variant showed approximately 1.59-fold increased PET degradation activity compared to KbPETaseWT. The M30 variant showed approximately 1.48-fold increased PET degradation activity compared to KbPETaseWT. The M31 mutant showed approximately 1.67-fold increased PET degradation activity compared to KbPETaseWT. The M32 mutant showed a Tm value that was 5.8℃ higher than KbPETaseWT, and its PET degradation activity was approximately 1.38-fold higher. The M33 mutant showed a Tm value that was 3.1℃ higher than KbPETaseWT, and its PET degradation activity was approximately 1.13-fold higher. The M34 mutant showed a Tm value that was approximately 11.4℃ higher than KbPETaseWT, and its PET degradation activity was approximately 1.45-fold higher. The M35 mutant showed a Tm value that was 1.6℃ higher than KbPETaseWT, and its PET degradation activity was approximately 1.02-fold higher. The M36 mutant showed a Tm value that was 0.8℃ higher than KbPETaseWT, and its PET degradation activity was approximately 1.24-fold higher. The M37 variant showed a Tm value that was 4.1℃ higher than that of KbPETaseWT, but its PET degradation activity was slightly reduced. The M38 variant showed a Tm value that was 9.2℃ higher than that of KbPETaseWT, and its PET degradation activity was increased by approximately 1.06 times. The M39 variant showed a Tm value that was approximately 12.3℃ higher than that of KbPETaseWT, and its PET degradation activity was increased by approximately 3.67 times.The M40 variant showed a Tm value approximately 12.3°C higher than that of KbPETaseWT, and its PET degradation activity increased approximately 2.37-fold. The M41 variant showed a Tm value approximately 12.3°C higher than that of KbPETaseWT, and its PET degradation activity increased approximately 3.95-fold.

[0545]

[0546] Based on this, it was confirmed that introducing mutations into the KbPETase protein increased the protein's temperature stability or enhanced PET degradation activity. [Table 2-4]

[0547]

[0548] 변이체생성물농도 (uM, 12hr)Tm (℃)KbPETaseWT1189.6087.6M1(KbPETaseT95R)1472.5386.7M2(KbPETaseD239S)1336.9083.5M3(KbPETaseA279S)1272.6286.3M4(KbPETaseT119N)1616.8186.8M5(KbPETaseV184I)1228.0084.8M6(KbPETaseT95R / D239S)1392.0185.7M7(KbPETaseT95R / A279S)1353.8786.7M8(KbPETaseT95R / T119N)1513.9486.8M9(KbPETaseT95R / V184I)1310.3685.4M10(KbPETaseD239S / A279S)1294.6184.9M11(KbPETaseD239S / T119N)1491.7285.1M12(KbPETaseD239S / V184I)1253.1884.2M13(KbPETaseA279S / T119N)1434.5486.5M14(KbPETaseA279S / V184I)1263.1285.4M15(KbPETaseT119N / V184I)1418.3786.0M16(KbPETaseT95R / D239S / A279S)1461.6485.9M17(KbPETaseT95R / D239S / T119N)1834.0986.3M18(KbPETaseT95R / D239S / V184I)1410.5785.3M19(KbPETaseT95R / A279S / T119N)1837.9486.7M20(KbPETaseT95R / A279S / V184I)1370.4885.6M21(KbPETaseT95R / T119N / V184I)1562.1685.6M22(KbPETaseD239S / A279S / T119N)1706.4985.9M23(KbPETaseD239S / A279S / V184I)1316.7284.9M24(KbPETaseD239S / T119N / V184I)1524.6485.0M25(KbPETaseA279S / T119N / V184I)1467.0585.6M26(KbPETaseT95R / D239S / A279S / T119N)1934.5486.2M27(KbPETaseT95R / D239S / A279S / V184I)1501.2785.5M28(KbPETaseT95R / D239S / T119N / V184I)1873.4685.4M29(KbPETaseT95R / A279S / T11 9N / V184I)1894.5185.6M30(KbPETaseD239S / A279S / T119N / V184I)1756.9785.3M31(KbPETaseT95R / D239S / A279S / T119N / V184I)1986.7685.7.

[0549] Mutant product concentration (uM, 24hr) Tm (℃) KbPETaseWT 1982.1487.6M 32 (KbPETaseA173C / K197C) 2745.099 3.4M 33 (KbPETaseA236C / S281C) 2247.899 0.7M 34 (KbPETaseA173C / K197C / A236C / S281C) 2876.67 >99.9

[0550] Mutant product concentration (uM, 6 hr) Tm (℃) KbPETaseWT 968.07 87.6 M 35 (KbPETaseE131Q) 984.93 89.2 M 36 (KbPETaseQ127S / E131Q) 1197.26 88.4 M 37 (KbPETaseD190H) 945.02 91.7 M 38 (KbPETaseQ127S / E131Q / D190H) 1023.48 96.8 M 39 (T95R / D239S / A279S / T119N / V1) 84I / A173C / K197C / A236C / S281C)3567.57>99.9M40(A173C / K197C / A236C / S281C / Q127S / E131Q / D190H)2289.7 3>99.9M41(T95R / D239S / A279S / T119N / V184I / A173C / K197C / A236C / S281C / Q127S / E131Q / D190H)3819.47>99.9

[0551]

[0552] Example 5: Effect of KbPETase variant position

[0553]

[0554] In order to confirm the change in protein thermal stability and PET degradation activity when the position of the introduced mutation identified in Example 4 was replaced with another amino acid, each mutant was prepared using the same method as Example 2, and PET degradation activity and thermal stability were evaluated using the same method as Example 4, and the results are shown in Tables 5 to 9.

[0555] 변이체생성물농도 (uM, 12hr)Tm (℃)변이체생성물농도 (Um, 12hr)Tm (℃)KbPETaseWT1189.6087.6M69(KbPETaseD239N)1162.7482.9M42 (KbPETaseT95A)916.7285.4M70(KbPETaseD239Q)992.6382.5M43(KbPETaseT95I)891.2584.7M71(KbPETaseD239C)794.7581.8M44(KbPETaseT95L)872.6184.9M72(KbPETaseD239G)1093.4682.2M45(KbPETaseT95V)904.3485.1M73(KbPETaseD239P)367.1181.1M46(KbPETaseT95M)909.3785.3M74(KbPETaseD239R)543.1682.7M47(KbPETaseT95F)784.5984.1M75(KbPETaseD239H)621.8382.9M48(KbPETaseT95Y)803.1484.8M76(KbPETaseD239K)564.9782.6M49(KbPETaseT95W)541.0083.9M77(KbPETaseD239E)937.2483.3M50(KbPETaseT95S)1013.4586.9M78(KbPETaseT119A)963.1784.1M51(KbPETaseT95N)1146.9787.1M79(KbPETaseT119I)916.0984.4M52(KbPETaseT95Q)1163.5887.1M80(KbPETaseT119L)918.3384.3M53(KbPETaseT95C)762.4985.7M81(KbPETaseT119V)934.7184.6M54(KbPETaseT95G)847.9386.2M82(KbPETaseT119M)846.0383.5M55(KbPETaseT95P)423.8284.0M83(KbPETaseT119F)416.1283.1M56(KbPETaseT95H)1210.2886.4M84(KbPETaseT119Y)431.9582.8M57(KbPETaseT95K)1198.9486.6M85(KbPETaseT119W)201.0882.5M58(KbPETaseT95D)862.8485.4M86(KbPETaseT119S)1030.6487.2M59(KbPETaseT95E)837.2985.6M87(KbPETaseT119Q)1531.6486.3M60(KbPETaseD239A)1126.2785.4M88(KbPETaseT119C)841.6085.6M61(KbPETaseD239I)1065.8985.2M89(KbPETaseT119G)807.1384.9M62(KbPETaseD239L)954.7385.1M90(KbPETaseT119P)751.4883.9M63(KbPETaseD239V)1097.4285.2M91(KbPETaseT119R)1474.1586.4M64(KbPETaseD239M)731.5385.0M92(KbPETaseT119H)1392.7686.2M65(KbPETaseD239F)319.8682.2M93(KbPETaseT119K)1423.5386.5M66(KbPETaseD239Y)276.1882.1M94(KbPETaseT119D)1272.8185.8M67(KbPETaseD239W)137.6481.2M95(KbPETaseT119E)1211.2885.7M68(KbPETaseD239T)1276.1883.1.

[0556] 변이체생성물농도 (uM, 24hr)Tm (℃)변이체생성물농도 (Um, 24hr)Tm (℃)KbPETaseWT1982.1487.6M112(KbPETaseA173E / K197E)1391.5785.3M96(KbPETaseK197A)2134.7286.9M113(KbPETaseS281A)2049.3787.3M97(KbPETaseA173I / K197I)2005.3686.7M114(KbPETaseA236I / S281I)1872.5386.8M98(KbPETaseA173L / K197L)2275.1586.3M115(KbPETaseA236L / S281L)2023.4886.9M99(KbPETaseA173V / K197V)2193.9287.3M116(KbPETaseA236V / S281V)1943.5987.1M100(KbPETaseA173M / K197M)1768.4984.2M117(KbPETaseA236M / S281M)1416.7685.3M101(KbPETaseA173F / K197F)234.8177.5M118(KbPETaseA236F / S281F)177.2373.4M102(KbPETaseA173S / K197S)1813.4484.4M119(KbPETaseA236S)1998.3986.5M103(KbPETaseA173T / K197T)1872.8583.6M120(KbPETaseA236T / S281T)1826.4186.3M104(KbPETaseA173N / K197N)1694.6383.3M121(KbPETaseA236N / S281N)1549.2784.7M105(KbPETaseA173Q / K197Q)1537.4582.7M122(KbPETaseA236Q / S281Q)1374.8584.4M106(KbPETaseA173G / K197G)1714.8287.4M123(KbPETaseA236G / S281G)1868.1387.1M107(KbPETaseA173P / K197P)556.1971.5M124(KbPETaseA236R / S281R)1023.5281.4M108(KbPETaseA173R / K197R)894.2883.9M125(KbPETaseA236H / S281H)437.7680.8M109(KbPETaseA173H / K197H)634.7981.2M126(KbPETaseA236K / S281K)735.8883.6M110(KbPETaseA173K)1439.0786.5M127(KbPETaseA236D / S281D)1641.3585.7M111(KbPETaseA173D / K197D)1625.4285.8M128(KbPETaseA236E / S281E)1596.7385.2.

[0557] 변이체생성물농도 (uM, 6hr)Tm (℃)변이체생성물농도 (uM, 6hr)Tm (℃)KbPETaseWT968.0787.6M147 (KbPETaseD190A)671.4881.9M129 (KbPETaseE131A)623.4385.1M148(KbPETaseD190I)642.1582.3M130(KbPETaseE131I)668.2885.6M149(KbPETaseD190L)702.5983.1M131(KbPETaseE131L)654.1685.3M150(KbPETaseD190V)623.7482.5M132(KbPETaseE131V)642.7185.3M151(KbPETaseD190M)572.1682.0M133(KbPETase131M)598.3684.9M152(KbPETaseD190F)713.5183.8M134(KbPETaseE131F)801.5786.1M153(KbPETaseD190Y)756.9484.2M135(KbPETaseE131Y)814.1586.7M154(KbPETaseD190W)361.2981.3M136(KbPETaseE131W)337.1379.3M155(KbPETaseD190S)754.1884.5M137(KbPETaseE131S)712.6686.0M156(KbPETaseD190T)772.3684.1M138(KbPETaseE131T)745.2786.3M157(KbPETaseD190N)816.8387.2M139(KbPETaseE131N)963.4988.7M158(KbPETaseD190Q)827.1687.5M140(KbPETaseE131C)798.3686.4M159(KbPETaseD190C)721.5785.4M141(KbPETaseE131G)648.1285.3M160(KbPETaseD190G)634.3984.7M142(KbPETaseE131P)275.4984.2M161(KbPETaseD190P)518.4583.2M143(KbPETaseE131R)876.6786.8M162(KbPETaseD190R)907.4090.3M144(KbPETaseE131H)732.1885.9M163(KbPETaseD190K)884.3789.9M145(KbPETaseE131K)754.6986.9M164(KbPETaseD190E)859.5687.8M146(KbPETaseE131D)921.7487.2.

[0558]

[0559] 변이체생성물농도 (uM, 6hr)Tm (℃)KbPETaseWT968.0787.6M165 (KbPETaseQ127S / E131A)472.4885.1M166 (KbPETaseQ127S / E131I)504.2785.5M167 (KbPETaseQ127S / E131L)511.2985.3M168 (KbPETaseQ127S / E131V)498.1385.2M169 (KbPETaseQ127S / E131M)440.9684.9M170 (KbPETaseQ127S / E131F)554.3185.7M171 (KbPETaseQ127S / E131Y)582.7485.8M172 (KbPETaseQ127S / E131W)189.2682.4M173 (KbPETaseQ127S / E131S)537.8785.9M174 (KbPETaseQ127S / E131T)569.4186.0M175 (KbPETaseQ127S / E131N)1007.6388.1M176 (KbPETaseQ127S / E131C)934.1587.8M177 (KbPETaseQ127S / E131G)542.7685.1M178 (KbPETaseQ127S / E131P)97.1579.2M179 (KbPETaseQ127S / E131R)726.4186.8M180 (KbPETaseQ127S / E131H)684.7286.7M181 (KbPETaseQ127S / E131K)712.9886.7M182 (KbPETaseQ127S / E131D)607.5986.2M183 (KbPETaseQ127S)623.7886.4

[0560] 변이체생성물농도 (uM, 12hr)Tm (℃)KbPETaseWT1189.6087.6M184 (KbPETaseA279I)1043.1986.1M185 (KbPETaseA279L)1064.6786.3M186 (KbPETaseA279V)1137.4386.4M187 (KbPETaseA279M)834.7685.9M188 (KbPETaseA279F)729.5483.7M189 (KbPETaseA279Y)682.1783.4M190 (KbPETaseA279W)418.9382.9M191 (KbPETaseA279T)1136.8186.1M192 (KbPETaseA279N)943.8485.8M193 (KbPETaseA279Q)907.1185.6M194 (KbPETaseA279C)889.3785.1M195 (KbPETaseA279G)1016.5584.9M196 (KbPETaseA279P)784.9183.7M197 (KbPETaseA279R)861.1484.8M198 (KbPETaseA279H)612.7384.7M199 (KbPETaseA279K)594.6785.0M200 (KbPETaseA279D)854.7986.1M201 (KbPETaseA279E)826.8185.9M202 (KbPETaseV184A)1026.4381.6M203 (KbPETaseV184L)1074.0883.7M204 (KbPETaseV184M)831.5981.6M205 (KbPETaseV184F)134.4568.1M206 (KbPETaseV184Y)92.1666.9M207 (KbPETaseV184S)752.4980.3M208 (KbPETaseV184T)768.2380.7M209 (KbPETaseV184N)483.7072.4M210 (KbPETaseV184Q)451.6371.3M211 (KbPETaseV184C)560.1184.5M212 (KbPETaseV184G)572.8281.8M213 (KbPETaseV184P)112.5764.7M214 (KbPETaseV184R)264.3173.6M215 (KbPETaseV184H)334.8479.9M216 (KbPETaseV184K)297.1376.1M217 (KbPETaseV184D)350.4976.3M218 (KbPETaseV184E)325.6676.1.

[0561]

[0562] From the above results, it was confirmed that when the 12 mutation positions of KbPETase were changed to other amino acids, some amino acid substitutions affected protein activity or improved thermostability. This suggests that the positions of the evaluated amino acids directly or indirectly affect protein activity or thermostability.

[0563]

[0564] Example 6: Measurement of PET depolymerization activity by glycolysis catalytic reaction of KbPETase mutant

[0565] The durability-enhanced M41 mutant KbPETase was tested for its resistance to ethylene glycol (EG) and its PET depolymerization activity via glycolysis catalysis. The M41 mutant KbPETase was prepared in the same manner as in Example 2, and an enzyme-EG mixture containing 5 μL of a 10.2 mg / mL enzyme solution, 45 μL of buffer A, and 950 μL of a 99.5% EG solution was prepared. To evaluate the resistance to EG, the enzyme-EG reaction mixture was exposed to conditions of 40, 50, 60, and 70 °C for 0, 2, 4, 6, 8, and 10 days. 50 mg of B-PET powder was immersed in each of the treated enzyme-EG reaction mixture solutions. The reaction mixture solutions were reacted at 40 °C for 24 hours. After the above reaction, the products of each reaction solution were analyzed by HPLC to measure PET depolymerization activity by glycolysis catalysis. The concentrations of the major products (TPA, BHET, and MHET) for the enzymatic PET glycolysis depolymerization reaction are presented in Table 10. As a result of the reaction under the given conditions, BHET was produced up to approximately 98% of the major reaction product. In particular, a BHET concentration of 5.26 mM was obtained after 24 hours of reaction at 40 °C.

[0566] PET glycolysis depolymerization reaction products of M41 mutant MpPETase.EG Exposure temperature (°C)EG Exposure time (days)TPA (mM)MHET (mM)BHET (mM)4000.0022960.0908195.2606314020.0018360.0811295.0178624040.0016270.0805274.7550634060.0016780.0649184.528674080.0017370.0911165.0880140100 .0011590.0606634.7423845000.0022960.0908195.2606315020.0016470.0842195.1259025040.001180.0848474.9029935060.0023270.0650494.1557935080.0020260.0694994.06752550100.0 012560.0577634.2428816000.0022960.0908195.2606316020.0014990.054253.7453116040.0012870.052253.5391756060.0014490.0410952.7034226080.0011760.0530772.91828460100.0018 60.0072450.4335897000.0022960.0908195.2606317020.0005060.0017530.1026967040.000985 0.0003790.0080727060.0011426.6E-050.0005757080.000426.31E-050.00047470100.00061600

[0567]

[0568] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

[0569]

[0570]

[0571]

Claims

1. A mutant polypeptide having PET (polyethylene terephthalate) decomposition activity, i) the mutant polypeptide has a sequence identity of 70% or more and less than 100% with SEQ ID NO: 1; and / or ii) the mutant polypeptide is a polypeptide encoded by a polynucleotide having a sequence identity of 70% or more and less than 100% with the sequence encoding the mature polypeptide of SEQ ID NO: 1; and / or iii) the mutant polypeptide is a polypeptide encoded by (a) a mature polypeptide coding sequence of SEQ ID NO: 1, (b) a cDNA thereof, or (c) a polynucleotide that hybridizes to the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions; and / or iv) the above mutant polypeptide is a functional fragment of i), ii) or iii) polypeptide having PET decomposition activity; and A variant polypeptide comprising any one of the following modifications: Deletion, insertion of an amino acid, substitution with another amino acid, formation of a disulfide bond, and / or combinations thereof at one or more of the amino acids at positions 95, 119, 184, 239, 279, 173, 197, 236, 281, 127, 131, and 190; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

2. In the first paragraph, before modification of the mutant polypeptide having the PET decomposition activity A variant polypeptide wherein amino acid position 95 is threonine (T); amino acid position 119 is threonine (T); amino acid position 184 is valine (V); amino acid position 239 is aspartic acid (D); amino acid position 279 is alanine (A); amino acid position 173 is alanine (A); amino acid position 197 is lysine (K); amino acid position 236 is alanine (A); amino acid position 281 is serine (S); amino acid position 127 is glutamine (Q); amino acid position 131 is glutamic acid (E); and / or amino acid position 190 is aspartic acid (D).

3. In the first paragraph, the mutant polypeptide comprises one or more of the following substitutions: Substitution of the amino acid corresponding to position 95 with arginine, histidine, or lysine; Substitution of the amino acid corresponding to position 119 with asparagine, glutamine, arginine, histidine, lysine, aspartic acid or glutamic acid; The amino acid corresponding to position 184 is replaced with isoleucine; The amino acid corresponding to position 239 is replaced with serine or threonine; The amino acid corresponding to position 279 is replaced with serine; The amino acid corresponding to position 173 is substituted with cysteine, isoleucine, leucine, or valine; The amino acid corresponding to position 197 is replaced with cysteine, alanine, isoleucine, leucine, or valine; The amino acid corresponding to position 236 is substituted with cysteine, leucine, or serine; The amino acid corresponding to position 281 is substituted with cysteine, alanine, or leucine; The amino acid corresponding to position 127 is replaced with serine; The amino acid corresponding to position 131 is replaced with glutamine, asparagine or cysteine; and Substitution of the amino acid corresponding to position 190 with histidine, arginine, lysine or glutamic acid; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

4. In the third paragraph, the mutant polypeptide One or more substitutions selected from T95R, D239S, A279S, T119N, V184I; A173C / K197C; A236C / S281C; and One or more substitutions selected from Q127S, E131Q, D190H; Contains one or more substitutions selected from among A mutant polypeptide, wherein the above position number corresponds to the position of the polypeptide of sequence number 1.

5. In the third paragraph, the mutant polypeptide Amino acid position 95 is replaced with arginine; amino acid position 239 is replaced with serine; amino acid position 279 is replaced with serine; amino acid position 119 is replaced with asparagine; amino acid position 184 is replaced with isoleucine; amino acid position 173 is replaced with cysteine; amino acid position 197 is replaced with cysteine; amino acid position 236 is replaced with cysteine; amino acid position 281 is replaced with cysteine; amino acid position 127 is replaced with serine; amino acid position 131 is replaced with glutamine; and amino acid position 190 is replaced with histidine. A mutant polypeptide, wherein the above position number corresponds to the position of the polypeptide of sequence number 1.

6. In the third paragraph, the mutant polypeptide is a mutant polypeptide that forms a disulfide bond between cysteine pairs selected from the following: Cysteine 173 and cysteine 197; and / or Cysteine 236 and cysteine 281; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

7. In the first paragraph, the mutant polypeptide has at least one of the following changed characteristics i) to vii) compared to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1: i) Increase or decrease in enzyme activity; ii) Increase or decrease in specific activity; iii) Increase or decrease pH stability; iv) Increase or decrease storage stability; v) Increase or decrease acid resistance; vi) Increase or decrease in heat resistance or heat stability; and vii) Change in substrate specificity.

8. A composition comprising a mutant polypeptide of any one of claims 1 to 7.

9. A mutant polypeptide of any one of claims 1 to 7, or a polypeptide having sequence number 1 or more than 70% sequence identity therewith; a host cell expressing said polypeptide; or Or a composition comprising said polypeptide for use in decomposing polyester.

10. A polynucleotide encoding a mutant polypeptide of any one of claims 1 to 7.

11. A host cell comprising a mutant polypeptide according to any one of claims 1 to 7; a polynucleotide encoding the mutant polypeptide; a nucleic acid construct comprising the polynucleotide; and / or a vector comprising the nucleotide or the nucleic acid construct.

12. A host cell overexpressing a mutant polypeptide of any one of claims 1 to 7, or a polypeptide having sequence number 1 or a sequence identity of at least 70% thereto.

13. A step of culturing a host cell comprising a mutant polypeptide of any one of claims 1 to 7; a polynucleotide encoding the mutant polypeptide; a nucleic acid structure comprising the polynucleotide; and / or a vector comprising the nucleotide or the nucleic acid structure; and A step of recovering a mutant polypeptide having PET decomposition activity expressed in the above culturing step, A method for producing a mutant polypeptide having PET decomposition activity.

14. A mutant polypeptide of any one of claims 1 to 7, or a polypeptide having sequence number 1 or more than 70% sequence identity thereto; a host cell expressing said polypeptide; and / or A method for decomposing a polyester, comprising treating a composition comprising the above polypeptide to a polyester.

15. A method for decomposing polyester, wherein the polyester is PET in the 14th paragraph.

16. A method for decomposing polyester, wherein the method comprises a step of performing a glycolysis reaction by the polypeptide.

17. A method for decomposing polyester, wherein the method comprises a step of converting the polyester into BHET in the presence of the polypeptide and ethylene glycol, in the 14th paragraph.

18. A mutant polypeptide of any one of claims 1 to 7, or a polypeptide having sequence number 1 or more than 70% sequence identity thereto; a host cell expressing said polypeptide; and / or A method for preparing bis-2-hydroxyethyl terephthalate (BHET), (mono(2-hydroxymethyl) terephthalate (MHET), terephthalic acid (TPA), and / or ethylene glycol (EG), comprising contacting a composition comprising the above polypeptide with a polyester.

19. A method for producing bis-2-hydroxyethyl terephthalate (BHET), (mono(2-hydroxymethyl) terephthalate (MHET), terephthalic acid (TPA) and / or ethylene glycol (EG), wherein the method further comprises a step of recovering the produced BHET, MHET, TPA, and / or EG.

20. A method for producing polyester, comprising the step of synthesizing polyester using BHET, MHET, TPA, and / or EG manufactured according to claim 19.

21. A method for producing polyester according to claim 20, wherein the polyester is PET.

Images