Targeted degradation system, screening method therefor, and use thereof

By designing a multispecific fusion protein, the easy aggregation of p62 protein is used to promote the degradation of inherent disordered proteins by using the autophagy pathway, which solves the problem of difficult degradation of disordered proteins in the prior art, and achieves effective regulation and disease treatment of target proteins.

WO2025153033A1PCT designated stage expired Publication Date: 2025-07-24TSINGHUA UNIVERSITY

Patent Information

Application Number
PCT/CN2025/072876
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-16
Filing Date
2025-01-16
Publication Date
2025-07-24

AI Technical Summary

Technical Problem

Existing targeted protein degradation technologies are difficult to effectively degrade inherent disordered proteins and proteins with disordered regions, especially due to the lack of suitable ligands and the difficulty of high-throughput library construction, which makes it difficult to develop drugs.

Method used

A multispecific fusion protein is designed, including a first affinity peptide specifically bound to the autophagy receptor p62 protein and a second affinity peptide specifically bound to the target, and promotes p62 protein activation through the easy aggregation of the inherent disordered protein and achieves targeted degradation of the autophagy pathway.

Benefits of technology

The specific degradation of inherent disordered proteins is achieved, and the biological activity regulation of target proteins is enhanced, and it is suitable for the prevention and treatment of various diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025072876_24072025_PF_FP_ABST
    Figure CN2025072876_24072025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a targeted degradation system constructed by a multispecific fusion protein comprising a p62 nanobody, a method for screening the fusion protein, and a method and use for targeted degradation of a target protein by using the fusion protein.
Need to check novelty before this filing date? Find Prior Art

Description

Directed degradation system, screening method and use thereof Technical Field

[0001] The present invention relates to a targeted degradation system constructed by a multi-specific fusion protein comprising a p62 nanobody, a method for screening the fusion protein, and a method and application of using the fusion protein to target and degrade a target protein. Background Art

[0002] Over the past few decades, tremendous breakthroughs have been made in the discovery of drug targets, with new targets being discovered every year. However, approximately 62% of these disease-related target proteins are undruggable or difficult to drug. This is mainly due to the fact that most of these protein molecules have a large amount of disordered structure, which makes it impossible to resolve three-dimensional crystals suitable for drug development, or they lack suitable protein-ligand interaction regions (for example, lack of clear hydrophobic pockets), making the design of specific targeted drugs for them a huge challenge.

[0003] Targeted protein degradation (TPD), represented by PROTAC, is considered to be one of the technologies most likely to achieve breakthroughs for these undruggable targets. PROTAC includes various bifunctional molecules obtained by connecting target protein (POI) ligands and E3 ligase ligands through linkers. In studies using PROTAC, it was found that the mechanism for achieving targeted degradation is to promote the physical proximity of POI and E3 ligase through two target heads, thereby triggering E3 ligase to polyubiquitinate POI. This proximity is even short-lived, and does not require the ligand molecule as the PROTAC target head to have the property of directly inhibiting POI activity or being able to maintain long-term and high-intensity binding to POI. Therefore, many small molecule compounds that failed in research and development as target inhibitors and E3 ligase inhibitors can also be reused for the research and development of PROTAC molecules (see Liu, Z et al., An overview of PROTACs: a promising drug discovery paradigm. Mol Biomed 3, 46 (2022)). Peptide molecules (e.g., peptide substrate binding motifs of POI and / or E3 ligase, or antibodies against POI and / or E3 ligase) can also achieve specific targeting of POI and E3 ligase, but they are clearly not considered a good choice for PROTAC target heads. At least to date, all clinical-stage PROTACs have only used small molecules rather than peptide ligands. The reason for this may be that the success rate of constructing PROTACs using peptide ligands as target heads is extremely low. For example, S Matsuzawa et al. (Method for targeting protein destruction by using a ubiquitin-independent, proteasome-mediated degradation pathway. PNAS (2005), vol. 102, no. 42, 14982-14987) reported that none of the dozens of chimeric peptides generated by combining 12 different POI binding motifs with 7 different E3 ligase binding motifs could degrade the target protein.On the other hand, the use of peptide elements will inevitably affect pharmacokinetics (such as difficulty in permeating the membrane and difficulty in oral administration). In this regard, the PROTAC concept was clearly pointed out when it first appeared. The ultimate goal of developing such bifunctional molecules is to identify small molecules with E3 targeting activity that can replace peptide motifs (KM Sakamoto et al., Protacs: Chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Proc Natl Acad Sci US A. 2001 Jul 17; 98(15): 8554-8559).

[0004] In addition, it has also been reported that bifunctional molecules using dual antibodies are used for targeted degradation, mainly including AbTAC technology (see CN114867752A) that has both the specificity of targeting the cell membrane surface E3 ligase RNF43 and the specificity of targeting the cell membrane surface protein, PROTAB technology (see CN116761825A) that has both the specificity of targeting the cell membrane surface E3 ligase RNF43 or ZNRF3 and the specificity of targeting the cell membrane surface protein, and KineTAC technology (see WO2022212593A1) that has both the specificity of targeting the cell membrane surface receptor (such as CXCL12) and the specificity of targeting the cell membrane surface or extracellular protein. The first two are still based on the design idea of ​​the ubiquitin-proteasome pathway. After the POI and the E3 ligase are spatially close through the two arms of the dual antibody molecule, ubiquitination and proteasome degradation occur. The third type utilizes the internalization property of the antibody, so that the POI protein bound by the dual antibody is degraded as it is internalized into the endosome. It can be seen that the current bispecific antibody-based targeted degradation technology is mainly limited to utilizing E3 ligases or receptors on the cell membrane surface to degrade adjacent membrane proteins or extracellular proteins. This is probably mainly due to the poor membrane permeability of antibody molecules, which cannot reach effective concentrations inside cells.

[0005] In addition to the ubiquitin-proteasome pathway mentioned above, targeted degradation technologies can also be achieved through the lysosomal pathway, which is further divided into the endosome-lysosome pathway and the autophagy-lysosome pathway. Among them, the autophagy-lysosome pathway uses autophagosomes to encapsulate the intracellular target to be degraded, and then fuses the lysosomes to form autophagolysosomes. Technologies based on the autophagy-lysosome pathway include AUTAC, AUTOTAC, and ATTEC. Among them, the structure of ATTEC is similar to PROTAC. It is a dual-target head molecule obtained by connecting the small molecule ligand of LC3 protein and the POI ligand through a linker. The autophagy marker LC3 protein is located on the autophagic vacuole membrane after activation. It is a key factor inducing autophagic vacuole to encapsulate the target protein and form autophagosomes. The autophagosomes are then transported to lysosomes to achieve degradation of the target protein (see Zhaoyang Lia et al., ATTEC: a potential new approach to target proteinopathies. AUTOPHAGY (2020), Vol. 16, No. 1, 185-187). AUTAC's dual-target heads also use small molecule ligands, but one of its ligands uses cGMP (cysteine-S-guanine), which can trigger K63 ubiquitination. This small molecule triggers K63 ubiquitination, thereby directing the target protein to selective autophagy (see Daiki Takahashi et al., AUTACs: Cargo-Specific Degraders Using Selective Autophagy. Molecular Cell (2019), Vol. 76, No. 5, P797-810. E10). AUTOTAC uses a peptide motif that specifically recognizes the p62 protein on one target head. This peptide motif must not only be able to specifically recognize and bind to the p62 protein, but also be able to activate the p62 protein, which is usually in an inactive state, and produce a conformational change. The conformationally modified p62 protein can self-aggregate and specifically bind to the LC3 protein, entering the autophagosome induced by LC3, ultimately leading to the degradation of the target protein bound by AUTOTAC.

[0006] Compared with the ubiquitin-proteasome pathway, one of the advantages of the autophagy-lysosome pathway is that the molecular size of the targets it degrades is not restricted by the proteasome pore size. Moreover, this pathway can not only degrade soluble proteins or membrane proteins, but also degrade many targets including extracellular membrane proteins, protein aggregates, organelles and non-proteins (such as lipid droplets). It has a wider application scenario than the ubiquitin-proteasome. However, whether considering the lack of inhibitory ligand accumulation of autophagy markers like ubiquitin ligases, or the high difficulty of developing specific ligands for refractory targets (especially proteins with disordered structures) (Joshi, P., Vendruscolo, M. (2015). Druggability of Intrinsically Disordered Proteins. In: Felli, I., Pierattelli, R. (eds) Intrinsically Disordered Proteins Studied by NMR Spectroscopy. Advances in Experimental Medicine and Biology, vol 870. Springer, Cham.), it can be seen that the difficulty of constructing high-throughput libraries of such bifunctional molecules has seriously restricted the development of related drugs. Moreover, the roles of LC3 and p62 proteins in the corresponding pathways are different from those of E3 ligases. As mentioned above, PROTAC can achieve targeted degradation as long as it can bring the target protein, which is a ubiquitination substrate, close to the E3 ligase in physical space to facilitate the ubiquitination enzymatic reaction. However, this is obviously not enough for several bifunctional molecules targeting autophagy pathway proteins, especially AUTOTAC molecules targeting p62 proteins, to achieve their targeted degradation function.

[0007] Liquid-Liquid Phase Separation (LLPS, also referred to herein as "phase separation") describes the process by which multivalent biomacromolecules aggregate through intermolecular or intramolecular interactions, separating from the surrounding solution phase to form a separate liquid phase enriched with the macromolecules. This process, also known as a "phase transition," is also known as a "phase transition." Following LLPS, numerous small droplets enriched with the macromolecules can be observed within cells, reaching diameters of several microns or even larger. These highly recognizable droplets are referred to as "phase transition droplets." It has been reported that activated p62 and polyubiquitinated proteins are key factors for the aggregation of p62 bodies, which act as nucleation sites in selective autophagy (see Agudo-Canalejo J et al., Wetting regulates autophagy of phase-separated compartments and the cytosol. Nature. 2021 Mar; 591(7848): 142-146; Turco E et al. FIP200 Claw Domain Binding to p62 Promotes Autophagosome Formation at Ubiquitin Condensates. Mol Cell. 2019 Apr 18; 74(2): 330-346.e11). However, it has not been reported that for proteins that are prone to LLPS (such as intrinsically disordered proteins), autophagy can be directly triggered without relying on p62 activation and / or polyubiquitination to achieve targeted degradation of the target protein. Summary of the Invention

[0008] Through in-depth research, the inventors have discovered that by utilizing a multi-specific fusion protein that simultaneously targets the autophagy receptor p62 protein and intrinsically disordered proteins or proteins with intrinsically disordered regions, the aggregation-prone nature of intrinsically disordered proteins can be exploited to promote the aggregation necessary for the activation of p62 protein, thereby promoting p62 activation and allowing the specifically targeted intrinsically disordered proteins or proteins with intrinsically disordered regions to be degraded through the autophagy pathway, thereby achieving regulation of the biological activities or signaling pathways in which the intrinsically disordered proteins or proteins with intrinsically disordered regions participate.

[0009] Therefore, one object of the present invention is to provide a multi-specific fusion protein comprising at least one first affinity peptide that specifically binds to the autophagy receptor p62 protein and at least one second affinity peptide that specifically binds to a target, wherein the first affinity peptide and the second affinity peptide are covalently linked via a linker sequence / linker. In some embodiments, the first affinity peptide and the second affinity peptide are directly linked via a covalent bond.

[0010] In some embodiments, the multi-specific fusion protein disclosed herein, when coexisting with the p62 protein and the target, can form a ternary complex comprising the fusion protein, the p62 protein and the target. In some embodiments, the multi-specific fusion protein disclosed herein increases the liquid-liquid phase separation of the p62 protein compared to the absence of the fusion protein. In some embodiments, the increase in liquid-liquid phase separation is selected from an increase in the number of liquid-liquid phase separation droplets comprising the p62 protein, an increase in the area of ​​the liquid-liquid phase separation droplets comprising the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets comprising the p62 protein, or a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets comprising the p62 protein, or any combination thereof. In some embodiments, the target is an intrinsically disordered protein, or an aggregate protein, membrane complex and / or organelle comprising an intrinsically disordered protein as a monomer or component. In some embodiments, the target is selected from a cytoplasmic protein, a nuclear protein, a membrane protein or an organelle. In some embodiments, the target is selected from TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, or STAT3.

[0011] In some embodiments, the first affinity peptide and the second affinity peptide in the multi-specific fusion protein disclosed herein are each independently selected from nanobodies or synthetic binding proteins. In some embodiments, nanobodies are selected from single domain antibodies, single chain antibodies (scFv), mini antibodies, half antibodies, or antigen binding fragments of antibodies. In some embodiments, the synthetic binding protein is selected from monobody, affibody, anticalin or DARPin. In a preferred embodiment, the single domain antibody is selected from V H H domain antibody, heavy chain variable domain (VH) antibody, V NAR Domain antibodies, V L Domain antibodies.

[0012] In some embodiments, the first affinity peptide comprises a CDR1, CDR2, and CDR3 selected from any one of SEQ ID NOs: 9, 11, 13, 67, or 72. In preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 51, 52, and 53, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 54, 55, and 56, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 57, 58, and 59, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 68, 69, and 70, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 73, 74, and 75, respectively. In some embodiments, the first affinity peptide comprises the amino acid sequence of SEQ ID NO: 9, 11, 13, 67, or 72. In some embodiments, the first affinity peptide comprises an amino acid sequence that is at least 90%, 95%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 9, 11, 13, 67, or 72. In some embodiments, the first affinity peptide comprises an amino acid sequence that has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) deletions, substitutions, or additions compared to the amino acid sequence of SEQ ID NO: 9, 11, 13, 67, or 72.

[0013] In some embodiments, the second affinity peptide comprises a CDR1, a CDR2, and a CDR3 selected from SEQ ID NO: 19 or 77. In a preferred embodiment, the second affinity peptide comprises the amino acid sequence of SEQ ID NO: 19 or 77. In some embodiments, the second affinity peptide comprises an amino acid sequence that is at least 90%, 95%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 19 or 77. In some embodiments, the second affinity peptide comprises an amino acid sequence that has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) deletions, substitutions, or additions compared to the amino acid sequence of SEQ ID NO: 19 or 77.

[0014] In some embodiments, the fusion proteins disclosed herein further comprise an oligomerization element. In some embodiments, the oligomerization element is directly covalently linked to the first affinity peptide and / or the second affinity peptide. In some embodiments, the oligomerization element is covalently linked to the first affinity peptide and / or the second affinity peptide via a linker. In some embodiments, the oligomerization element is derived from an oligomerization domain of a protein capable of oligomerization. In some embodiments, the oligomerization element is an artificially constructed coiled-coil domain. In some embodiments, the oligomerization element is capable of causing the fusion protein to form dimers to hexadecanomers. In some embodiments, the oligomerization element is a dimer or higher oligomerization domain. In preferred embodiments, the oligomerization element is a tetramer or higher oligomerization domain. In more preferred embodiments, the oligomerization element is an octamer or higher oligomerization domain. In most preferred embodiments, the oligomerization element is a dodecamer or higher oligomerization domain. In some embodiments, each fusion protein comprises one or more oligomerization elements. In preferred embodiments, each fusion protein comprises one oligomerization element. In some embodiments, the oligomerization element comprises the amino acid sequence of any one of SEQ ID NOs: 60 to 62. In some embodiments, the oligomerization element comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 60 to 62. In some embodiments, the oligomerization element comprises an amino acid sequence that has one or more deletions, substitutions, or additions compared to any one of SEQ ID NOs: 60 to 62, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or additions.

[0015] In some embodiments, the fusion protein disclosed herein further comprises a phase separation element. In some embodiments, the phase separation element is directly covalently linked to the first affinity peptide and / or the second affinity peptide. In some embodiments, the phase separation element is covalently linked to the first affinity peptide and / or the second affinity peptide via a connecting sequence / linker. In some embodiments, each fusion protein comprises one or more phase separation elements, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, the phase separation units are connected in series with each other. In some embodiments, the phase separation element is selected from the intrinsically disordered region of a protein having phase separation ability, or a tandemly repeated interacting domain having phase separation ability. In some embodiments, the phase separation element comprises the amino acid sequence shown in any one of SEQ ID NOs: 63 to 66. In some embodiments, the phase separation element comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to any one of SEQ ID NOs: 63 to 66. In some embodiments, the phase separation element comprises an amino acid sequence that has one or more deletions, substitutions, or additions compared to any one of SEQ ID NOs: 63 to 66, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions, substitutions, or additions.

[0016] In some embodiments, the connecting sequence or linker in the multi-specific fusion proteins disclosed herein is a rigid linker or a flexible linker. In a preferred embodiment, the connecting sequence or linker is a flexible linker. In a more preferred embodiment, the connecting sequence or linker is a linker comprising the sequence set forth in SEQ ID NO: 50.

[0017] In some embodiments, the multi-specific fusion proteins disclosed herein comprise a first affinity peptide and a second affinity peptide. In some embodiments, the multi-specific fusion proteins disclosed herein comprise a first affinity peptide and two or more identical or different second affinity peptides. In some embodiments, the multi-specific fusion proteins disclosed herein comprise two or more identical or different first affinity peptides and a second affinity peptide. In some embodiments, the multi-specific fusion proteins disclosed herein comprise two or more identical or different first affinity peptides and two or more identical or different second affinity peptides.

[0018] Another object of the present invention is to provide a nucleic acid comprising a nucleotide sequence encoding a multi-specific fusion protein disclosed herein. In some embodiments, the encoding nucleotide sequence is operably linked to a promoter.

[0019] Another object of the present invention is to provide a recombinant vector comprising the nucleic acid disclosed herein. In some embodiments, the recombinant vector is a recombinant viral vector.

[0020] Another object of the present invention is to provide an engineered cell that expresses the fusion protein, nucleic acid or recombinant vector disclosed herein.

[0021] Another object of the present invention is to provide a method for producing the multi-specific fusion protein disclosed herein, which method includes the steps of expressing the nucleic acid or recombinant vector disclosed herein in a suitable host cell, or includes the steps of culturing the engineered cells disclosed herein, and the steps of purifying the fusion protein.

[0022] Another object of the present invention is to provide a composition comprising the multi-specific fusion protein, nucleic acid, recombinant vector, or engineered cell disclosed herein.

[0023] Another object of the present invention is to provide a method for degrading a target substance in a cell, the method comprising expressing a multi-specific fusion protein, nucleic acid, or recombinant vector disclosed herein in the cell, thereby reducing the amount of the target substance compared to the absence of the fusion protein, nucleic acid, or recombinant vector. In preferred embodiments, the methods disclosed herein reduce the amount of the target substance by at least about 30 to about 90%.

[0024] Another object of the present invention is to provide a method for preventing and / or treating a disease, comprising administering to a subject the multi-specific fusion protein, nucleic acid, recombinant vector, engineered cell, or composition disclosed herein.

[0025] Another object of the present invention is to provide use of the multi-specific fusion protein, nucleic acid, recombinant vector, engineered cell, or composition disclosed herein in the preparation of a medicament for preventing and / or treating a disease.

[0026] In some embodiments, the disease to be prevented and / or treated is selected from a disease associated with protein misfolding, misaggregation or misproduction. In a preferred embodiment, the disease to be prevented and / or treated is selected from a neurodegenerative disease, cardiovascular disease, neuromuscular disease, tumor, metabolic disease or autoimmune disease. In some embodiments, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, hereditary ataxia, Vici syndrome or BPAN syndrome. In some embodiments, the cardiovascular disease is selected from coronary artery disease, atherosclerosis or pulmonary hypertension. In some embodiments, the neuromuscular disease is selected from hereditary cardiomyopathy, distal myopathy, muscular dystrophy, congenital myopathy, spinal muscular atrophy (SMAs), motor neuron disease, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, myotubular myopathy, centronuclear myopathy, nemaline myopathy, selenoprotein N-related myopathy, Pompe disease, glycogen storage disease III or amyotrophic lateral sclerosis. In some embodiments, the tumor is selected from lung cancer, colorectal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioma (e.g., glioma), neuroblastoma, melanoma, breast cancer, bladder cancer, kidney cancer, ovarian cancer, pancreatic cancer, cervical cancer, esophageal cancer, sarcoma, esophageal cancer (e.g., esophageal squamous cell carcinoma), thyroid cancer (e.g., papillary thyroid cancer) or prostate cancer, B cell lymphoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia, diffuse large B cell lymphoma (DLBCL), follicular lymphoma, myelodysplastic syndrome (MDS), non-Hodgkin lymphoma (NHL), acute lymphoblastic leukemia (ALL), acute monocytic leukemia, multiple myeloma, acute myeloid leukemia (AML), mixed lineage leukemia, NUT midline carcinoma, Burkitt lymphoma or mycosis fungoides (MF), or a metastatic form thereof. In some embodiments, the metabolic disease is selected from hyperlipidemia, atherosclerosis, non-alcoholic fatty liver disease or diabetes. In some embodiments, the autoimmune disease is selected from systemic lupus erythematosus, atopic dermatitis, myasthenia gravis or type I diabetes.

[0027] Another object of the present invention is to provide a method for screening multi-specific fusion proteins, which comprises the following steps: (a) obtaining one or more first affinity peptides capable of specifically binding to the autophagy receptor p62 protein, and one or more second affinity peptides capable of specifically binding to the target, and connecting at least one of the first affinity peptides to at least one of the second affinity peptides to obtain a candidate fusion protein library; (b) selecting from the library candidate fusion proteins that significantly increase the co-localization of the p62 protein and the target compared to a control in the absence of the candidate fusion protein; and (c) selecting from the candidate fusion proteins selected in step (b) a fusion protein that increases the liquid-liquid phase separation of the p62 protein compared to a control in the absence of the candidate fusion protein.

[0028] In some embodiments, in step (c) of the screening method disclosed herein, the increase in liquid-liquid phase separation is selected from: an increase in the number of liquid-liquid phase separation droplets containing p62 protein, an increase in the area of ​​liquid-liquid phase separation droplets containing p62 protein, an increase in the degree of oligomerization of p62 protein in liquid-liquid phase separation droplets containing p62 protein, and a decrease in the fluidity of p62 protein in liquid-liquid phase separation droplets containing p62 protein, or any combination thereof.

[0029] In some embodiments, the target of the screening method disclosed herein is an intrinsically disordered protein, or an aggregate protein, membrane complex, and / or organelle comprising an intrinsically disordered protein as a monomer or component. In some embodiments, the target of the screening method disclosed herein is selected from a cytoplasmic protein, a nuclear protein, or an organelle. In some embodiments, the target is selected from TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, or STAT3.

[0030] In some embodiments, the screening methods disclosed herein further comprise step (d): determining the level of the target, and selecting a fusion protein that reduces the amount of the target compared to a control in which the candidate fusion protein is absent. In a preferred embodiment, the fusion protein selected in step (d) is a fusion protein that reduces the amount of the target by at least about 30 to about 90%.

[0031] In some embodiments, the linking in step a is direct covalent linking of the first affinity peptide to the second affinity peptide. In some embodiments, the linking in step a is covalent linking of the first affinity peptide to the second affinity peptide via a linker sequence or a linker. In some embodiments, the linking in step a further comprises linking the first affinity peptide and / or the second affinity peptide to an oligomerization element or a phase separation element. In some embodiments, the oligomerization element or the phase separation element in step a is covalently linked to the affinity peptide or to each other via a linker sequence or a linker.

[0032] In some embodiments, the first affinity peptide and the second affinity peptide in the screening method disclosed herein are each independently selected from a nanobody or a synthetic binding protein. In some embodiments, the nanobody is selected from a single domain antibody, a single chain antibody (scFv), a mini antibody, a half antibody, or an antigen-binding fragment of an antibody. In a preferred embodiment, the single domain antibody is selected from V H H domain antibody, heavy chain variable domain (VH) antibody, V NAR Domain antibodies, V L Domain Antibodies. In some embodiments, the synthetic binding protein is selected from a monobody, an affibody, anticalin, or DARPin.

[0033] In some embodiments, the first affinity peptide comprises a CDR1, CDR2, and CDR3 selected from any one of SEQ ID NOs: 9, 11, 13, 67, or 72. In preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 51, 52, and 53, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 54, 55, and 56, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 57, 58, and 59, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 68, 69, and 70, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 comprised by the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 73, 74, and 75, respectively.

[0034] In some embodiments, the second affinity peptide comprises CDR1, CDR2, and CDR3 selected from SEQ ID NO: 19 or 77. In a preferred embodiment, the second affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 19 or 77.

[0035] In some embodiments, the linker sequence or linker is a rigid linker or a flexible linker. In a preferred embodiment, the linker sequence or linker is a flexible linker. In a more preferred embodiment, the linker sequence or linker is a linker comprising the sequence shown in SEQ ID NO: 50.

[0036] In some embodiments, the candidate fusion proteins in the library obtained in step (a) may comprise one first affinity peptide and one second affinity peptide, one first affinity peptide and two or more identical or different second affinity peptides, two or more identical or different first affinity peptides and one second affinity peptide, or two or more identical or different first affinity peptides and two or more identical or different second affinity peptides.

[0037] Another object of the present invention is to provide a fusion protein obtained by the screening method disclosed herein.

[0038] Another object of the present invention is to provide an affinity peptide disclosed herein, comprising the CDR1, CDR2, and CDR3 of any one of SEQ ID NOs: 9, 11, 13, 67, or 72. In some embodiments, the CDR1, CDR2, and CDR3 of the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 51, 52, and 53, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 of the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 54, 55, and 56, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 of the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 57, 58, and 59, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 of the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 68, 69, and 70, respectively. In other preferred embodiments, the CDR1, CDR2, and CDR3 of the first affinity peptide have the amino acid sequences set forth in SEQ ID NOs: 73, 74, and 75, respectively.

[0039] Another object of the present invention is to provide a nucleic acid molecule encoding the affinity peptide disclosed herein, which comprises the nucleotide sequence shown in any one of SEQ ID NOs: 10, 12, 14, 71 or 76.

[0040] Another object of the present invention is to provide a recombinant vector comprising a nucleic acid molecule disclosed herein, an engineered cell expressing a Nanobody, a nucleic acid molecule or a recombinant vector disclosed herein, and a composition comprising a Nanobody, a nucleic acid molecule, a recombinant vector or an engineered cell disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 shows the results of bio-layer interferometry (BLI) detection of the interaction between p62 nanobodies and p62 protein. The horizontal axis represents the reaction time, and the vertical axis represents the displacement distance of the interference spectrum. The black curve is the actual detection result, and the red curve is the fitting result. The table on the right shows the binding constant (Ka), dissociation constant (Kd), and equilibrium dissociation constant (KD) of the three nanobodies binding to p62.

[0042] Figure 2 shows snapshots of laser confocal microscopy live cell imaging of U-2OS cells transiently transfected with a construct of a p62 nanobody (Pn) fused to an mCherry fluorescent tag and a construct of p62 fused to an EGFP fluorescent tag, as well as a snapshot of U-2OS cells transiently transfected with a construct of a single mCherry fluorescent tag and an EGFP-p62 construct as a control; wherein mCherry-Pn and EGFP-p62 show fluorescence excitation images of exogenous Pn and p62, respectively, Merge is the result of in situ superposition of the above two images and the cell nucleus (blue), A1E, D9A, and E12C show three p62 nanobodies, respectively; the scale bar in each small figure is 10 μm;

[0043] FIG3 shows the colocalization statistics obtained by Pearson colocalization analysis of the images in FIG2 ; the horizontal axis represents the conditions of treatment with the mCherry fluorescent tag as a control or the three Pn treatments, and the vertical axis represents the Pearson colocalization coefficient calculated for the corresponding treatment conditions; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0044] Figure 4 shows the number of p62 droplets measured in Example 2;

[0045] Figure 5 shows snapshots of laser confocal microscopy live cell imaging of U-2OS cells transiently transfected with mCherry-Pn; wherein mCherry-Pn and p62 show fluorescence excitation images of exogenous Pn and endogenous p62, respectively; Merge is the result obtained by superimposing the above two images and the cell nucleus (blue) in situ; A1E, D9A, and E12C show three nanobodies to p62, respectively; the scale bar in each small figure is 10 μm; Zoom in is a magnified image of the white box area, showing the live cell imaging results of the co-localization analysis of the fluorescence signals representing mCherry-Pn and p62 in the spots marked by the white arrows;

[0046] FIG6 is a statistical result of the grayscale value of the fluorescence signal measured at the white arrow mark in FIG5 ; the horizontal axis in the figure represents the distance along the direction indicated by the arrow mark, and the vertical axis represents the relative fluorescence intensity measured at the corresponding position;

[0047] FIG7 shows the structure of p62 protein and the construct structure of the CoPIC method;

[0048] Figure 8 shows snapshots of laser confocal microscopy live cell imaging of U-2OS cells transiently transfected with constructs of p62 truncated variants fused to EGFP-NUP98N using an mCherry-Pn plasmid; A1E, D9A, and E12C represent three types of Pn, shown in red; ΔPB1, 103-330, 331-388, 389-440, 368-407, and 73-132 represent six truncated variants of p62 fused to NUP98N, shown in green; the image with a scale bar is the result of in situ superposition of the above two images and the cell nucleus (blue), and the scale bar in each small figure is 10 μm;

[0049] FIG9 is a statistical result of the enrichment degree of the fluorescence signal of mCherry-Pn in NUP98N spots under each treatment condition in FIG8 ; the horizontal axis in the figure represents the different truncated variants of p62 fused with NUP98N, and the vertical axis represents the enrichment degree of the fluorescence signal of mCherry-Pn in NUP98N droplets; the statistical results shown are the mean ± standard error of the mean of three independent experiments;

[0050] Figure 10 shows a schematic diagram of three nanobodies binding to different positions of the p62 protein;

[0051] Figure 11 shows snapshots of laser confocal microscopy live-cell imaging of U-2OS cells stably expressing EGFP-TDP43 transfected with the specified constructs; wherein mCherry, EGFP-TDP43, and p62 show fluorescence excitation images of the exogenous specified constructs, TDP43, and endogenous p62, respectively, and Merge is the result obtained by superimposing the above three images and the cell nucleus (blue) in situ; the scale bar in each inset is 10 μm; Zoom in is a magnified image of the white box area in Figure 11, showing the live-cell imaging results of the co-localization analysis of the fluorescence signals representing the mCherry fusion construct, EGFP-TDP43, and p62 in the puncta marked by the white arrows;

[0052] FIG12 is a statistical result of the grayscale value of the fluorescence signal measured at the white arrow mark in FIG11 ; the horizontal axis in the figure represents the distance along the direction indicated by the arrow mark, and the vertical axis represents the relative fluorescence intensity measured at the corresponding position;

[0053] Figure 13 shows a snapshot of laser confocal microscopy live cell imaging of U-2OS cells stably expressing EGFP-TDP43 transfected with a construct of mCherry-Pn fused to GFP nanobody (Gn); wherein mCherry, EGFP-TDP43 and p62 respectively show the fluorescence excitation images of the exogenous mCherry-Pn-Gn construct, TDP43 and endogenous p62, Merge is the result of in situ superposition of the above three images and the cell nucleus (blue), mCherry-A1E-Gn, mCherry-D9A-Gn and mCherry-E12C-Gn respectively show the three mCherry-Pn-Gn constructs; the scale bar in each small figure is 10 μm; Zoom in is a diagram obtained by enlarging the white box area in FIG13 , showing the live cell imaging results of co-localization analysis of the fluorescent signals representing mCherry-Pn-Gn, EGFP-TDP43, and p62 in the puncta marked by white arrows;

[0054] FIG14 shows the statistical results of the grayscale values ​​of the fluorescence signals measured at the locations marked by white arrows in FIG13 , where the horizontal axis represents the distance along the arrowed direction, and the vertical axis represents the relative fluorescence intensity measured at the corresponding locations;

[0055] Figure 15 shows snapshots of laser confocal microscopy live cell imaging of HEK-293T cells co-transfected with mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62 constructs; wherein mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62 represent fluorescence excitation images of exogenous mCherry-D9A-Gn, EGFP-TDP43, and BFP-p62, respectively, and Merge represents the result obtained by in situ superposition of the above three images. The scale bar is 10 μm.

[0056] Figure 16 shows the results of HEK-293T cells stably expressing EGFP-TDP43 transfected with the specified constructs, and the content of EGFP-TDP43 in the cells was detected by Western blotting 48 hours after expression, wherein anti-GFP rabbit polyclonal antibody was used for labeling, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein was used as an internal reference; and the statistical results of the grayscale values ​​of the bands of Western blotting, in which the horizontal axis represents the treatment conditions of the specified construct, and the vertical axis represents the ratio of the grayscale value of the band of the specified construct to the grayscale value of the band treated with mCherry, all grayscale values ​​were normalized by the grayscale value of the internal reference band, and the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value was calculated by a two-tailed t-test;

[0057] Figures 17A to 17H show snapshots of laser confocal microscopy live cell imaging of U-2OS cells stably induced to express mCherry-fused p62 nanoantibodies A1E and Gn (mCherry-A1E-Gn) transfected with different designated fusion EGFPs or EGFP controls; wherein A1E-Gn and p62 show fluorescence excitation images of exogenous mCherry-A1E-Gn and endogenous p62, respectively, Merge is the result of in situ superposition of the above two images with three designated fusion EGFPs, -DOX means that the cells were treated with two fluorophores after transfection. Methyl sulfoxide (DMSO) treatment for 24 hours; +DOX means that the cells were treated with 1 μg / mL doxycycline (DOX) for 24 hours after transfection; the scale bar in each panel is 10 μm, and the white dotted line shows the cell outline; Among them, the designated fusion EGFPs in Figures 17A to 17H are EGFP-TDP43, EGFP-G3BP1, TSPAN4-EGFP, EGFP-HTT-Q103, EGFP control, EGFP-hnRNPK, EGFP-PD-L1, and EGFP-APP, respectively;

[0058] FIG18 shows the colocalization statistics obtained by performing Pearson colocalization analysis on the images in FIG17A-17H ; the horizontal axis represents the specified treatment condition, and the vertical axis represents the Pearson colocalization coefficient calculated for the corresponding treatment condition; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0059] Figure 19A shows HEK-293T cells stably expressing inducible mCherry-A1E-Gn transfected with the indicated constructs, -DOX indicates that the cells were treated with DMSO for 48 hours after transfection, and +DOX indicates that the cells were treated with 1 μg / mL DOX for 48 hours after transfection; the levels of the indicated EGFP fusion proteins in the cells were detected by western blotting; anti-GFP rabbit polyclonal antibody or anti-mCherry rabbit polyclonal antibody was used for labeling, and GAPDH protein was used as an internal control;

[0060] Figure 19B shows the statistical results of the grayscale values ​​of the Western blot bands in Figure 19A. The horizontal axis represents the experimental conditions of the specified cell line, and the vertical axis represents the percentage of degradation of the specified construct. The statistical results shown are the average of three independent experiments, and the degradation percentage is displayed by the corresponding gradient color.

[0061] Figure 20 shows the mRNA transcription levels of the specified genes in U-2OS cells stably expressing EGFP-TDP43 and stably inducibly expressing mCherry-A1E-Gn detected by fluorescent quantitative PCR, using RPL13A protein as an internal reference. The horizontal axis of the figure shows the specified genes, and the vertical axis shows the degree of change in the mRNA of the specified genes;

[0062] Figure 21A shows snapshots of laser confocal microscopy imaging of U-2OS cells stably expressing EGFP-TDP43 and stably induced mCherry-A1E-Gn after treatment with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; wherein, EGFP-TDP43, mCherry-A1E-Gn and p62 show the fluorescence excitation images of exogenous EGFP-TDP43 and mCherry-A1E-Gn and endogenous p62, respectively, and Merge is the result obtained by superimposing the above three images with the cell nucleus (blue) in situ; the scale bar in each inset is 10 μm, and Zoom in is the image obtained by magnifying the white box area on the left;

[0063] Figure 21B shows the colocalization statistics (left) and p62 body counts (right) obtained by Pearson colocalization analysis of the images in Figure 21A; the horizontal axis represents the specified treatment condition, and the vertical axis represents the Pearson colocalization coefficient (left) and the number of (p62) bodies (right) calculated for the corresponding treatment condition; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0064] Figure 22 shows the results of immunoprecipitation and mass spectrometry analysis of U-2OS cells stably expressing EGFP-TDP43 and stably induced expressing mCherry-A1E-Gn treated with 1 μg / mL DOX or an equal volume of DMSO for 48 hours; the horizontal axis in the figure represents the fold change of the detected protein after DOX treatment, and the vertical axis represents the p value of the fold change (FC) of the protein; red data points indicate high enrichment (log2FC>1.3, p<0.05), blue data points indicate low enrichment (log2FC<1.3, p<0.05), and gray data points indicate no difference (p>0.05);

[0065] Figure 23 shows snapshots of laser confocal microscopy imaging of U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn after treatment with 1 μg / mL DOX for the specified time periods; wherein, EGFP-TDP43 and mCherry-A1E-Gn show fluorescence excitation images of exogenous EGFP-TDP43 and mCherry-A1E-Gn, respectively, and Merge is the result of in situ superposition of the above two images with the cell nucleus (blue) and β-actin (β-actin, purple); the scale bar in each inset is 10 μm; the white dotted line shows the cell outline;

[0066] FIG24 shows the statistical results of fluorescence intensity analysis of the images in FIG23 ; the horizontal axis represents the specified DOX treatment time, and the vertical axis represents the average GFP fluorescence intensity calculated for the corresponding treatment conditions; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value was calculated by a two-tailed t-test; ns. indicates p>0.05;

[0067] Figure 25 shows the protein immunoblot bands after U-2OS cells stably expressing EGFP-TDP43 and stably induced expressing mCherry-A1E-Gn were treated with 1 μg / mL DOX for the indicated time periods; EGFP-TDP43 was labeled with an anti-GFP rabbit polyclonal antibody, mCherry-A1E-Gn was labeled with an anti-mCherry rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0068] Figure 26 is the statistical results of the grayscale values ​​of the protein immunoblot bands in Figure 25; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the grayscale value of the EGFP-TDP43 band at the specified time point to the grayscale value of the band at the treatment starting point (0 hours), and all grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value is calculated by two-tailed t-test and displayed by nonlinear fitting;

[0069] Figure 27 shows the protein immunoblot bands of U-2OS cells stably expressing EGFP-TDP43 and stably induced expressing mCherry-A1E-Gn treated with the indicated concentrations of DOX for 48 hours; EGFP-TDP43 was labeled with anti-GFP rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0070] Figure 28 is the statistical results of the grayscale values ​​of the protein immunoblot bands in Figure 27; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the grayscale value of the EGFP-TDP43 band at the specified time point to the grayscale value of the band at the treatment starting point (0 hours), and all grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value is calculated by two-tailed t-test and displayed by linear fitting;

[0071] Figure 29 shows the protein immunoblot bands of U-2OS cells stably expressing EGFP-TDP43 and stably induced to express mCherry-A1E-Gn treated with the inhibitor MG-132 or bafilomycin A1 (Baf A1); EGFP-TDP43 was labeled with an anti-GFP rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0072] Figure 30 is the statistical results of the grayscale values ​​of the protein immunoblot bands in Figure 29; the horizontal axis in the figure represents the specified treatment conditions, and the vertical axis represents the ratio of the grayscale value of the EGFP-TDP43 band under the specified treatment conditions to the grayscale value of the band without DOX treatment. All grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value was calculated by a two-tailed t-test;

[0073] Figure 31 shows the results of Western blotting after U-2OS cells stably expressing EGFP-TDP43 and stably induced expressing mCherry-A1E-Gn were treated with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; anti-p62 rabbit polyclonal antibody was used for labeling, and GAPDH protein was used as an internal control;

[0074] FIG32 shows the statistical results of the grayscale values ​​of the protein immunoblot bands in FIG31 ; the horizontal axis represents the specified treatment time, and the vertical axis represents the grayscale value of the p62 bands under the specified treatment conditions. All grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0075] Figure 33 shows the mRNA transcription levels of the specified genes in U-2OS cells stably expressing EGFP-TDP43 and stably inducibly expressing mCherry-A1E-Gn detected by fluorescent quantitative PCR, using RPL13A protein as an internal reference; the horizontal axis in the figure shows the specified gene, and the vertical axis shows the degree of change in the mRNA of the specified gene;

[0076] The left figure of FIG34 shows a schematic diagram of PDF-Bin targeting STAT3; the right figure shows that A549 cells stably express A1E-MS3-6 labeled with EGFP in a DOX-induced manner (A549 / A1E-MS3-6 TRE ).

[0077] Figure 35 shows snapshots of laser confocal microscopy imaging of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with 1 μg / mL DOX (DOX+) or an equal volume of DMSO (DOX-) for 24 hours; wherein, EGFP-A1E-MS3-6, STAT3, and p62 show the fluorescence excitation images of exogenous EGFP-A1E-MS3-6, endogenous STAT3, and p62, respectively, and Merge is the result of in situ superposition of the above three images with the cell nucleus (blue); the scale bar in each inset is 10 μm;

[0078] FIG36 shows the co-localization statistical results obtained by performing mCherry fluorescence intensity enrichment analysis on the images in FIG35 ; the horizontal axis in the figure represents the specified treatment condition, and the vertical axis represents the degree of mCherry fluorescence signal enrichment calculated for the corresponding treatment condition; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0079] FIG36 shows the statistical results of the number of p62 spots in the images of FIG35 ; the horizontal axis represents the specified treatment condition, and the vertical axis represents the average number of p62 spots per cell calculated for the corresponding treatment condition; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0080] Figure 37 shows the protein immunoblot bands of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with 1 μg / mL DOX for the indicated time periods; STAT3 was labeled using an anti-STAT3 rabbit polyclonal antibody, EGFP-A1E-MS3-6 was labeled using an anti-GFP rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0081] Figure 38 is the statistical results of the grayscale values ​​of the protein immunoblot bands in Figure 37; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the grayscale value of the STAT3 band at the specified time point to the grayscale value of the band at the treatment starting point (0 hour), and all grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value is calculated by two-tailed t-test and displayed by nonlinear fitting;

[0082] Figure 39 shows the protein immunoblot bands of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with the indicated concentrations of DOX for 48 hours; STAT3 was labeled using anti-STAT3 rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0083] Figure 40 shows the statistical results of the grayscale values ​​of the protein immunoblot bands in Figure 39; the horizontal axis in the figure represents the specified treatment time, and the vertical axis represents the ratio of the grayscale value of the STAT3 band at the specified time point to the grayscale value of the band at the treatment starting point (0 hour), and all grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p value is calculated by two-tailed t-test and displayed by linear fitting;

[0084] Figure 41 shows the protein immunoblot bands of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with the inhibitor MG-132 or Baf A1; STAT3 was labeled using an anti-STAT3 rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0085] FIG42 is a statistical result of the grayscale values ​​of the protein immunoblot bands in FIG41 ; the horizontal axis represents the specified treatment conditions, and the vertical axis represents the ratio of the grayscale value of the STAT3 band under the specified treatment conditions to the grayscale value of the band without DOX treatment. All grayscale values ​​are normalized by the grayscale value of the internal reference band; the statistical results shown are the mean ± standard error of the mean of three independent experiments, and the p-value was calculated by a two-tailed t-test;

[0086] Figure 43 shows the protein immunoblot bands of A549 cells stably induced to express EGFP-A1E-MS3-6 after treatment with cycloheximide (CHX) for the indicated time periods; p62 was labeled using an anti-p62 rabbit polyclonal antibody, and GAPDH protein was used as an internal control;

[0087] FIG44 is a statistical result of the grayscale values ​​of the protein immunoblot bands in FIG43 ; the horizontal axis represents the specified treatment time, and the vertical axis represents the grayscale value of the p62 bands under the specified treatment conditions, and all grayscale values ​​are normalized by the grayscale value of the internal reference band;

[0088] Figure 45 shows microscopic snapshots of a scratch migration assay performed on A549 cells stably expressing EGFP-A1E-MS3-6; the scale bar in each panel is 100 μm; the white dotted line indicates the edge of the scratch area;

[0089] FIG46 shows a microscopic snapshot of a clone formation experiment of A549 cells stably induced to express EGFP-A1E-MS3-6; the purple spots in the figure indicate cell clone areas;

[0090] FIG47 shows the statistical results of the degree of wound healing in FIG45 (left) and the number of colony formation in FIG46 (right); the horizontal axis in the figure represents the specified treatment conditions, and the statistical results shown are the mean ± standard error of the mean of three independent experiments;

[0091] Figure 48A shows the effect of using oligomerization elements with different oligomerization degrees to enhance the degradation of endogenous TDP43 protein induced by PDF-Bin molecules (PmSE10-Tm12D with monobody PmSE10 and Tm12D as binding arms); the white dotted line represents cells expressing mCherry fusion protein, green represents endogenous TDP43 protein, red represents PmSE10-Tm12D fusion protein, and purple represents endogenous p62 protein; Figure 48B shows the results of fluorescence statistical analysis of Figure 48A. The X-axis is the average fluorescence intensity of the mCherry channel, representing the expression level of the mCherry fusion protein; the Y-axis is the percentage of TDP43 fluorescence intensity in transfected cells compared to untransfected cells in the same field of view, representing the relative content of endogenous TDP43 protein; displayed by nonlinear fitting;

[0092] FIG49A shows the effect of using oligomerization elements of different oligomerization degrees to enhance the degradation of endogenous TDP43 protein induced by another PDF-Bin molecule (PnA5-Tm12D with nanobody PnA5 and monobody Tm12D as binding arms); FIG49B shows the results of fluorescence statistical analysis of FIG49A ; the display and analysis methods are the same as FIG48 ;

[0093] Figure 50A shows the effect of using different types of phase separation elements to enhance the degradation of endogenous TDP43 protein induced by PnA5-Tm12D molecules; Figure 50B shows the fluorescence statistical analysis results of Figure 50A; the display and analysis methods are the same as Figure 48. DETAILED DESCRIPTION

[0094] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0095] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples, unless otherwise specified, are the average values ​​of three repeated experiments. In the following examples, unless otherwise specified, the nucleotide sequences in the sequence listing are written from left to right in the order from 5' to 3' end, and the amino acid sequences are written from left to right in the order from amino terminus to carboxyl terminus.

[0096] definition

[0097] As used in the description of the present invention, the following words and phrases are generally deemed to have the meanings set forth below, unless the context in which the word or phrase is used indicates otherwise.

[0098] As used herein, the singular forms "a," "an," and "the" refer to both the singular and the plural, unless the context clearly indicates otherwise. As used herein, the terms "comprising," "including," and "having" mean that compositions and methods include the recited elements or steps, but do not exclude other elements or steps.

[0099] As used herein, the term "about" refers to the typical error range of the corresponding value that is readily known to those skilled in the art. For example, relative to the described numerical value, ±10% or less, ±5% or less, ±2% or less, ±1% or less, or ±0.1% or less. A value or parameter described herein as "about" includes the value or parameter itself.

[0100] As used herein, the term "liquid-liquid phase separation" (LLPS, also referred to herein as "phase separation" or "phase transition") refers to the following transition process that occurs between multivalent macromolecules: under suitable solution conditions, multivalent macromolecules aggregate through interactions to form larger complexes. These complexes then separate from the common solution phase upon reaching a corresponding solubility, forming a separate liquid phase enriched with the complexes. Biomacromolecules can aggregate and undergo phase separation due to either intermolecular or intramolecular interactions. Modules or motifs that can lead to the above-mentioned intermolecular or intramolecular interactions include, but are not limited to, (1) structural modules or motifs that are linearly arranged and have similar functions in proteins or polypeptides; (2) structural modules or motifs that promote oligomerization of proteins or polypeptides; (3) multimeric binding sites generated based on post-translational modifications; (4) intrinsically disordered regions or low-complexity domains in proteins or polypeptides (see, for example, Wang et al., Cell 174(3):688-699, 2018; Nott, Timothy J et al., Molecular Cell 57(5):936-947, 2015).

[0101] The term "phase-change droplets" refers to highly recognizable droplets with diameters of several microns or even larger that exist within the liquid phase formed by phase separation. In this article, "phase-change droplets" are sometimes simply referred to as "droplets."

[0102] As used herein, the term "oligomerization" or "condensation" or "aggregation" when describing biomacromolecules such as proteins means that several biomacromolecules, such as several receptor molecules, aggregate into a complex through non-covalent bonds, and their functional states may change.

[0103] The term "intact antibody" is used to refer to an antibody having a structure substantially similar to that of a natural antibody. Herein, "intact antibody" can be used interchangeably with "full-length antibody" and "whole antibody".

[0104] The term "antigen-binding fragment" or its equivalent refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds to the same antigen as the intact antibody. Examples of antigen-binding fragments include, but are not limited to, bis-Fab, Fv, Fab, Fab, Fab'-SH, and F(ab')2.

[0105] As used herein, the term "nanobody" refers to an antibody or antigen-binding fragment that is much smaller in size than a conventional four-chain antibody. Most known nanobodies are derived from the variable region (V H ), usually composed of about 120 amino acids, with a molecular weight of about 12-15 kD and a size of about 4x2.5 nM. This type of antibody was first reported in 1989 as a "single domain antibody" by Ward, E. et al., who found that two mouse V H The domain showed a certain affinity for lysozyme (see Ward, E. et al., Nature 341, 544-546 (1989)). Subsequently, a large number of natural IgG (HCAb) containing only heavy chains were found in the serum of camelids, accounting for 45% to 75% of the total serum immunoglobulins depending on the species. HCAb naturally lacks the light chain in conventional four-chain antibodies and consists of two heavy chain variable regions (V HH ), a hinge region and two CH2 and CH3 domains, which are called "heavy chain antibodies" or "heavy chain antibodies". Similar natural heavy chain antibodies can also be found in cartilaginous fish (V NAR (Feng et al., Antib Ther, 2, 1-11, 2019) and some human heavy chain diseases (Prelli and Frangione, J Immunol, 148, 949-952, 1992).HH Recombinant nanobodies with structural domains are the mainstream direction of nanobody research and development. H Compared with the structural domain, the following structural features make the naturally evolved Camelidae V HH The domain has better solubility and stability: According to Kabat numbering, human V H V37 in the germline HH The domain is usually F37 or Y37, which makes the hydrophobic packing of the domain more compact and stable (Riechmann and Muyldermans, J Immunol Methods, 231, 25-38, 1999; Shinozaki et al., J Biosci Bioeng, 125, 654-661, 2018); human V H The germline light chain contact residues G44, L45, and W47 are in the V HH corresponding to E44 (or Q44), R45 (or C45) and G47 (or Ser, Leu, Phe) (Holt et al., Trends Biotechnol, 21, 484-490, 2003), making the accessible surface area more hydrophilic and less aggregated; some V HH In the domain, W103 can be replaced by R103; V HH Typically have a higher V than humans / rodents H Longer CDR3, and its CDR3 generally contains Cys, which can form an additional disulfide bond with the Cys at the end of CDR1 (camel) or the beginning of CDR2 (llama) in addition to the classic C22-C92 disulfide bond (Wesolowsk et al., Med Microbiol Immunol, 198, 157-174, 2009), making V HH The domain is more stable (Tm value range is 60-78°C) and can be reversibly unfolded / refolded (Holt et al., Trends Biotechnol, 21, 484-490, 2003).

[0106] The term "single-chain antibody", also known as "single-chain Fv", "single-chain variable fragment", "sFv" or "scFv", is a single-chain antibody comprising a V linked to a single polypeptide chain. H and V L Preferably, the scFv polypeptide is in the V H and V LThe domains further comprise polypeptide linkers to enable the scFv to form the desired antigen-binding structure. For a review of scFv, see Pluckthun, The Pharmacology of Monoclonal Antibodies, Vol. 113, Rosenburg and Moore (eds.), Springer-Verlag, New York, pp. 269-315 (1994); Malmborg et al., J. Immunol. Methods 183: 713, 1995.

[0107] The term "single domain antibody" refers to an antibody fragment that contains all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In certain aspects, a single domain antibody is a human single domain antibody (see, e.g., U.S. Patent No. 6,248,516B1). Examples of single domain antibodies include, but are not limited to, V HH .

[0108] The term "complementarity determining region" or "CDR" refers to the region of an antibody variable region primarily responsible for binding to an epitope on an antigen. Positioning and alignment of the CDRs can be performed in the three-dimensional space formed by the antibody framework regions, and the amino acid sequence boundaries of a given CDR can be readily determined using any of a number of well-known numbering schemes, such as those of Kabat et al. (see Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, 1991; “Kabat” numbering scheme), Chothia et al. (see Chothia and Lesk, J Mol Biol 196:901-917, 1987; Chothia et al., Nature 342:877, 1989; and Al-Lazikani et al., JMB 273, 927-948, 1997; “Chothia” numbering scheme), Kunik et al. (see Kunik et al., PLoS Comput Biol 8:e1002388, 2012; and Kunik et al., Nucleic Acids Res 40 (Web Server No. 5000106). The Kabat, Paratome, and IMGT databases are all publicly available on the Internet.

[0109] The term "small molecule" refers to any molecule having a molecular weight of about 2000 Daltons or less, such as about 1000 Daltons or less. In some aspects, a small molecule can be an organic molecule. In other aspects, a small molecule can be an inorganic molecule.

[0110] As used herein, "p62 protein" is a component of inclusion bodies found in protein aggregation diseases of the brain and liver, has been identified as having a molecular weight of 62 kDa, and binds to the src homology 2 (SH2) domain of the tyrosine kinase Lckp56 in a phosphotyrosine-independent manner (Park et al., Proc Natl Acad Sci USA, 92: 12338 (1995)). The term "p62" or "p62 protein" broadly refers to any native p62 molecule from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus macaques), and rodents (e.g., mice and rats). The term encompasses full-length p62 and isolated regions or domains of p62. The term also encompasses naturally occurring variants of p62, such as splice variants or allelic variants. The DNA sequence of an exemplary human p62 can be referenced as shown in SEQ ID NO: 8, and the amino acid sequence can be referenced as shown in SEQ ID NO: 7. The present invention also contemplates minor sequence variations, particularly conservative amino acid substitution variants that do not affect the function and / or activity of p62. p62 has been reported to exhibit ubiquitin binding activity in vivo (Vadlamudi et al., J. Biol. Chem., 271: 20235 (1996)). Furthermore, it is not homologous to the ubiquitin C-terminal hydrolase nor to the S5a subunit of the 26S proteasome complex (the only known protein that non-covalently binds to ubiquitin), indicating that p62 belongs to a new class of ubiquitin-binding proteins. Protein aggregates containing p62 have been found to be degraded by autophagy. Some believe that this function of p62 may have a protective effect against huntingtin-induced cell death ( et al., J Cell Biol., 171: 603 (2005)).

[0111] The term "intrinsically disordered protein" (also referred to as "disordered protein" in the text) refers to a class of protein / polypeptide fragments that do not have stable and ordered secondary and / or tertiary structures under physiological conditions, are not folded as a whole or partially in the natural state, but can normally perform biological functions. The term "intrinsically disordered region" (also referred to as "disordered region" in the text) refers to a region that does not fold into a fixed three-dimensional structure under physiological conditions, but exists in a heterogeneous set of conformations. Intrinsically disordered proteins are widely present in organisms. Since disordered proteins and disordered regions have high flexibility and lack stable secondary / tertiary structures, they are not limited to interacting with a single object and usually play an important role in cell signal transduction and protein interaction networks. Naturally occurring intrinsically disordered proteins are known in the art through literature or databases. For example, the DisProt database compiles intrinsically disordered proteins selected from the literature (Hatos, A. et al., DisProt: Intrinsic protein disorder annotation in 2020, Nucleic Acids Research (2020) 48 (D1) 269-276). It is known that many peptides and proteins associated with various diseases (including cancer, cardiovascular disease, and neurodegenerative diseases) have disordered structures, including but not limited to important regulatory factors such as p53 and c-Myc. Disordered structures generally have preferences in amino acid composition, such as being rich in polar amino acids such as G, P, E, S, Q, K, D, T, and R, as well as aromatic amino acids such as Y and F.

[0112] The term "oligomerization element" refers to an amino acid sequence that forms a structure capable of interacting with oligomerization elements (the same or different) in other polypeptides, thereby allowing these polypeptides to form oligomers through non-covalent interactions. Common oligomerization elements are oligomerization domains from proteins that naturally form oligomers (homo-oligomers or hetero-oligomers), such as β-sheet associations, α-helical associations, hydrophobic surface patch associations, etc. within different monomers. A common motif for protein oligomerization is the coiled-coil domain. The coiled α-helical structural motif can form a helix on its own, and 2, 3, 4, or 5 α-helices can wrap around each other to form a left-handed supercoil called a "coiled-coil." The simplicity of the coiled-coil domain makes it a common choice for designing fusion proteins with a defined oligomerization state. Hundreds of coiled-coil domain sequences are known in the art, see, for example, Arai, R. (2021). Design of helical linkers for fusion proteins and protein-based nanostructures. Methods Enzymol 647, 209-230; Bozic, S., Doles, T., Gradisar, H., and Jerala, R. (2013). New designed protein assemblies. Curr Opin Chem Biol 17, 940-945; Dawson, WM, Martin, FJO, Rhys, GG, Shelley, KL, Brady, RL, and Woolfson, DN (2021). Coiled coils 9-to-5: rational de novo design of α-helical barrels with tunable 01igomeric states. Chemical Science 12, 6923-6928; Fletcher, JM, Boyle, AL, Bruning, M., Bartlett, GJ, Vincent, TL, Zaccai, NR, Armstrong, CT, Bromley, EHC, Booth, PJ, Brady, RL, et al. (2012). A Basis Set of de Novo Coiled-Coil Peptide Oligomers for Rational Protein Design and Synthetic Biology.ACS Synthetic Biology 1, 240-250; Fletcher, JM, Harniman, RL, Barnes, FRH, Boyle, AL, Collins, A., Mantell, J., Sharp, TH, Antognozzi, M., Booth, PJ, Linden, N., et al. (2013). Self-Assembling Cages from Coiled-Coil Peptide Modules.Science 340, 595-599; Hsia, Y., Bale, JB, Gonen, S., Shi, D., Sheffler, W., Fong, KK, Nattermann, U., Xu, C., Huang, PS., Ravichandran, R., et al. (2016). Design of a hyperstable 60-subunit protein dodecahedron. [corrected]. Nature 535, 136-139 etc. Any suitable sequence that can oligomerize with other coiled-coil domains and does not disrupt the antigen-binding function of the Nanobody can be used as the oligomerization element of the present invention. Non-limiting examples of oligomerization domains include α-helices with the seven-residue repeats of abcdefg, which form a nonpolar band on one side of each helix where hydrophobic residues interact with each other. Electrostatic interactions may also occur between the side chains on either side of the helix. The nonpolar band is defined by the hydrophobic side chains at residues a and d, with position a most commonly Leu, Ile, or Ala, and position d typically Leu or Ala. Electrostatic interactions primarily occur at residues e and g, which are typically Glu or Gln, with Arg and Lys also primarily occurring at position g. Charged residues interact with the solvent and are typically present at positions b, c, and f. Another type of oligomerization domain is the left-handed triple helix known as the collagen helix, which comprises the basic tripeptide repeat sequence 1Gly-2Xaa-3Xaa, where 2Xaa is typically Pro and 3Xaa is typically 4-hydroxyproline. .

[0113] The term "phase separation element" refers to an element comprising multiple structural modules or motifs associated with phase separation. Biomacromolecules can aggregate and phase separate due to intermolecular or intramolecular interactions. Modules or motifs that can lead to the above-mentioned intermolecular or intramolecular interactions include, but are not limited to, (1) linearly arranged structural modules or motifs with similar functions in proteins or polypeptides; (2) structural modules or motifs that promote oligomerization of proteins or polypeptides; (3) multimerization binding sites generated based on post-translational modifications; (4) intrinsically disordered regions or low-complexity domains in proteins or polypeptides. See, for example, Wang et al., Cell 174(3):688-699, 2018; Nott, Timothy J et al., Molecular Cell 57(5):936-947, 2015. In some cases, the phase separation element of the present invention is composed of one or more SUMO3 motifs and one or more SIM motifs in series. In other cases, the phase separation element of the present invention is composed of one or more PRMH motifs and one or more SH3 motifs in series.

[0114] The term "increase" or "activate" as used herein means the ability to cause an overall increase, e.g., an overall increase of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, or 75%, 85%, 90%, 95% or more. In certain aspects, increase or activation can refer to the downstream activity of a ligand-cell surface molecule interaction.

[0115] The term "reduce" or "inhibit" as used herein means the ability to cause an overall decrease, e.g., an overall decrease of 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, or 75%, 85%, 90%, 95% or more. In certain aspects, reduction or inhibition can refer to a downstream activity of a ligand-cell surface molecule interaction.

[0116] The following describes a preferred embodiment of the present invention. It should be noted that the embodiments described below are examples showing representative embodiments of the present invention, but the present invention is not limited to these examples.

[0117] Two or more of the embodiments described below may be combined, and such combinations are also included in the present invention.

[0118] Example

[0119] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0120] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or according to product specifications. The materials, reagents, and instruments used in the following examples are all commercially available unless otherwise specified. Relevant nucleic acid chains, genes, and enzymes can also be obtained using conventional molecular biology experimental techniques based on information from public databases.

[0121] Unless otherwise specified, nucleotide sequences referred to herein are written from left to right in the order from 5' to 3' terminus, and amino acid sequences are written from left to right in the order from amino terminus to carboxyl terminus. In the event of any discrepancy between the sequence described in the specification and the sequence listing, the sequence described in the specification shall prevail.

[0122] Experimental materials, reagents, instruments and experimental methods

[0123] Plasmid construction:

[0124] The plasmids used herein can be constructed from commercially available original plasmids by conventional gene cloning and recombination methods in the art (see, for example, Molecular Cloning Experiment Guide (3rd Edition) (Science Press), Microbiology Experiment (4th Edition) (Higher Education Press)). The coding gene sequences involved can be obtained from public database information by conventional molecular biology experimental techniques and commissioned to be synthesized by Xianghong Biological Company. The recombination kit used was seamless cloning kit (Biyuntian, D7010M), the competent state was Stbl3 (Kangti Life, KTSM110L), and the screening medium was LB agar plate with ampicillin resistance.

[0125] (1)pcDNA3.1-mCherry-4xGGS-Xho I-Apa I

[0126] pcDNA3.1 (Invitrogen, V79020) was used as the initial backbone plasmid to construct a eukaryotic expression vector. Its ampicillin resistance was exploited for selection and amplification in Escherichia coli. The coding sequence for the fluorescently labeled mCherry (SEQ ID NO: 1), the flexible linker sequence 4xGGS (SEQ ID NO: 2), and Xho I and Apa I endonuclease sites for inserting the target gene were inserted between the restriction sites BamH I and Xho I. Antibodies or PDF-BIN fused to the mCherry fluorescent tag (red) can be tracked.

[0127] (2)pcDNA3.1-EGFP-4xGGS-Xho I-Xba I

[0128] The construction method is basically the same as that in (1), but the inserted fluorescent marker is the coding sequence of EGFP (SEQ ID NO: 15), and the restriction enzyme sites are Xho I and Xba I sites. EGFP fluorescent tag (green) can be used to trace p62 and its variants.

[0129] (3)pcDNA3.1-EGFP-NUP98N-Xho I-Xba I

[0130] The construction method is basically the same as that in (2), except that the linker sequence 4xGGS is replaced with the coding sequence of the N-terminal disordered domain (NUP98N) of the NUP98 protein (SEQ ID NO: 4).

[0131] (4)pLVX-EGFP-TDP43

[0132] pLVX (Takara, 632164) was used as the initial backbone plasmid to construct a lentiviral expression vector, which can be used to package lentivirus, establish stable cell lines, and transiently transfect to detect the expression status of the target protein. The ampicillin resistance of this plasmid is used for prokaryotic cells, and its puromycin resistance is used for eukaryotic cells. After linearizing the vector by PCR, the target gene can be inserted. The primers used for PCR linearization of the vector are as follows:

[0133] pLVX-F:ACCGGTTAACTCGAGCATGC (SEQ ID NO: 5)

[0134] pLVX-R: GCGGCCGCAAGCTTGGGTCT (SEQ ID NO: 6)

[0135] (5)pLVX-TETONE-EcoR I-Age I

[0136] pLVX-TETONE (Takara, 631847) was used as the initial backbone plasmid to construct a lentiviral expression vector. This vector can be used to package lentivirus, establish stable cell lines, and control target gene expression through the plasmid's built-in tet-on system. The plasmid's ampicillin resistance is utilized for prokaryotic cells, while its puromycin resistance is utilized for eukaryotic cells. The target gene is inserted into the vector site linearized with the enzymes EcoR I and Age I.

[0137] Cell lines:

[0138] HEK-293T: ATCC, CRL-3216;

[0139] U-2OS: ATCC, HTB-96;

[0140] A549:ATCC.CCL-185.

[0141] Cell culture:

[0142] The cell lines HEK-293T, U-2OS, and A549 used in the examples were cultured in high-glucose DMEM medium (HyClone, SH30243.01) containing 10% fetal bovine serum (FBS) (Gibco, 10099-141) and 1% penicillin-streptomycin solution (Gibco, 15140122). Culture conditions were a 37°C constant temperature, moisturizing incubator with 5% CO2. When the cells grew to a density of 85%, they were digested and passaged using Trypsin. Depending on the needs of the screening, the culture medium may also be supplemented with puromycin or other corresponding antibiotics to a final concentration of 1 μg / mL.

[0143] Cell transfection:

[0144] According to experimental requirements, cells were inoculated into culture plates or culture dishes of different pore sizes and materials and cultured. When the cell density reached 50-80%, transfection was performed using the Lipo8000 transfection kit (Beyotime, C0533) according to the manufacturer's instructions.

[0145] Lentiviral infection:

[0146] All stable cell lines described in this article were constructed using lentivirus. The lentiviral packaging plasmids used were pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260). The cell line to be transfected was cultured to an appropriate density (e.g., approximately 50% confluence). Before transfection, the culture medium was replaced with preheated culture medium without antibiotics. Then, according to the manufacturer's instructions, the transfection reagent PEI (Polysciences, 23966-100), two packaging plasmids psPAX2 and pMD2.G, a lentiviral plasmid containing the gene of interest, and Opti-MEM culture medium were mixed and left at room temperature for 10 minutes to prepare a transfection mixture. The mixture was then evenly added dropwise to the culture dish and cultured in a cell culture incubator for 8 to 12 hours. Replace with fresh culture medium. Every 24 hours thereafter, the culture supernatant was collected and filtered with a 0.22 μm syringe filter, and the recombinant virus was added to the cells to be infected (about 50% confluence), and the HEK-293T cells that packaged the virus continued to be cultured with fresh culture medium; the viral supernatant could be collected 2 to 3 times in succession. An appropriate method (such as flow cytometry or antibiotic selection) can be selected to enrich the stably transfected cells. The stably transfected cell lines used in this article are all monoclonal cell lines that are selected by flow cytometry to extract single cells from the stably transfected cell population, and then based on the fluorescence intensity or induced expression effect after expansion culture.

[0147] Immunofluorescence staining:

[0148] The cells were seeded into 4-well glass-bottom culture dishes (In Vitro Scientific, #D35C4-20-1-N) and cultured for 12-18 hours. The cells were transfected with the specified vectors or subjected to the specified treatments. After discarding the culture medium, the cells were gently rinsed with PBS buffer. The cells were fixed with 200 μL of 4% paraformaldehyde solution (Biyuntian, P0099) at room temperature for 15 minutes. The liquid was then aspirated and the cells were gently rinsed 3 times with PBS buffer. The cells were permeabilized with permeabilization solution (Biyuntian, P0097) at room temperature for 15 minutes, the liquid was then aspirated and the cells were gently rinsed 3 times with PBS buffer. The cells were blocked with immunofluorescence staining blocking solution / primary antibody diluent (Sangong, E674004) at room temperature for 1 hour, and the liquid was then aspirated. The cells were incubated with the specified primary antibody at room temperature for 1 hour, the liquid was then aspirated and the cells were gently rinsed 3 times with PBS buffer. Incubate cells with the designated fluorophore-conjugated secondary antibody at room temperature in the dark for 1 hour. Aspirate the solution and gently rinse the cells three times with PBS. Dilute Hoechst 33342 staining solution 1:2,000 in PBS and add to the cells. Incubate in the dark for 5–10 minutes. Aspirate the solution and gently rinse the cells three times with PBS. Store the cells in PBS.

[0149] Bio-Layer Interferometry (BLI):

[0150] The antibody to be assayed was biotinylated and immobilized on the SA biosensor. Human p62 protein (SEQ ID NO: 7) was diluted in assay buffer (1×PBS, pH 7.4, 0.05% Tween-20) to obtain 5nM, 15nM, 40nM, and 60nM p62 protein solutions, which were reacted with the immobilized antibody, respectively. The reaction process was detected using the Octet K2 Protein Analysis System (Sartorius, Octet K2) and a streptavidin (SA) biosensor. The reaction data were normalized using Octet Data Analysis Studio 12.2, and the images were plotted using GraphPad Prism 8.

[0151] Cell-based protein-protein interaction system CoPIC:

[0152] See, for example, Xu, W et al., Compartmentalization-aided interaction screening reveals extensive high-order complexes within the SARS-CoV-2 proteome. Cell Reports 36, 2021, for the CoPIC method. The purified plasmids were co-transfected into U-2OS cells, and the nuclei of the living cells were stained with Hochest 33342 (Thermo Scientific, 62249) after 24 hours of culture. The cells were then observed and photographed using a Nikon laser confocal microscope, and the average fluorescence signal intensity of the mCherry signal inside and outside the EGFP droplets was measured using Nikon NIS image analysis software. The enrichment of the mCherry signal in the EGFP droplets was calculated according to the following method:

[0153] mCherry enrichment degree = (I(T) 液滴内 / I(T) 液滴外 )-(I(C) 液滴内 / I(C) 液滴外 )

[0154] Western Blotting:

[0155] Cell samples were lysed on ice for 10 minutes using a low-salt lysis buffer (50 mM Tris-HCl, 2% Triton X-100, 2 mM EDTA, pH 7.4) to obtain total cellular protein. 5× loading buffer (0.6 M Tris-HCl, pH 6.8, 2% SDS, 25% glycerol, 14.4 mM DTT, 0.1% bromophenol blue) was then added and heated in a 98°C metal bath for 10 minutes. An appropriate amount of the protein sample solution was loaded onto a precast gradient gel and run at 110 V for approximately 70 minutes. Electrophoretic bands were transferred to a PVDF membrane pre-activated with anhydrous methanol at a constant current of 150 mA for 60 minutes. Following transfer, the membrane was blocked in TBST containing 5% nonfat dry milk for approximately 1 hour at room temperature. After rinsing the membrane three times with TBST, the membrane was incubated in the primary antibody solution at 4°C overnight. The PVDF membrane was then rinsed three times with TBST solution and placed in a horseradish peroxidase (HRP)-conjugated secondary antibody solution. The membrane was incubated on a shaker at room temperature for 1 hour. All antibody solutions were diluted according to the specified ratio in TBST containing 5% skim milk powder. After rinsing the PVDF membrane three times with TBST solution, the membrane was placed in an imaging device and a color development solution was evenly added for color development and imaging.

[0156] Fluorescence quantitative PCR (RT-qPCR):

[0157] RNA was extracted using the Polymer RNA Rapid Extraction Kit (MF159) according to the manufacturer's instructions. RNA concentration was determined using Nanodrop and stored at −80°C. Reverse transcription was performed using the Polymer Super plus qPCR RT Kit with gDNA Remover (MF166-plus) using total RNA as a template, following the kit's instructions. Specifically, a 10 μL reaction system containing 1 μg of RNA, 1 μL of 10x gDNA remover mix, and the remainder of DEPC water was incubated at 42°C for 2 minutes and then cooled on ice. Next, 4 μL of 5x M5 RT Super plus and 6 μL of DEPC water were added to the reaction solution. The reaction was incubated at 37°C for 15 minutes, inactivated at 85°C for 5 seconds, and then cooled on ice to obtain reverse-transcribed cDNA. The resulting cDNA solution was diluted to 120 μL and used as a template for RT-qPCR using Polymer HiPer SYBR Premix EsTaq (MF787). Specifically, a 10 μL reaction system contained 5 μL 2x M5 HiPer SYBR Premix EsTaq (with Tli RNaseH), 1 μL template cDNA, 0.5 μL each of forward and reverse primers, and 3 μL DEPC water. The primer pairs shown in Table 1 were used by Roche RT-PCR reaction was performed using 480Instrument II.

[0158] Table 1:

[0159] Immunoprecipitation coupled with mass spectrometry (IP-MS):

[0160] First, perform immunoprecipitation. Lyse cells with a low-salt lysis buffer containing a protease inhibitor cocktail at 4°C for 30 minutes, then centrifuge at 10,000 g for 5 minutes. Mix the supernatant with a rabbit anti-p62 polyclonal antibody and protein A / G magnetic beads (Bimake, #B23201) and incubate overnight at 4°C. Wash the beads thoroughly five times with the low-salt lysis buffer, and elute the immunoprecipitate with 2× SDS loading buffer for SDS-PAGE analysis.

[0161] Mass spectrometry was then performed. The target protein band was excised from SDS-PAGE and incubated in the dark with 25 mM chloroacetamide for 45 minutes at 55°C for alkylation, followed by trypsin digestion at 37°C for 14 hours. Peptides were extracted three times with 50% acetonitrile and 0.1% formic acid, and the vacuum-dried peptides were dissolved in 20 μL of 0.1% (v / v) formic acid. For mass spectrometry analysis, peptides were loaded onto a trapping column, separated using a Thermo-Dionex Ultimate 3000 HPLC system (Thermo Fisher Scientific, Waltham, MA, USA), and detected using an Obitrap Fusion LUMOS Tribrid mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA). Proteome identification was performed using label-free quantification using Proteome Discoverer 2.3 software. Identification results were analyzed and plotted using GraphPad Prism 8.

[0162] Example 1

[0163] This example describes the preparation and screening of Nanobodies that specifically recognize and bind to p62.

[0164] In vitro phage display was performed using a recombinant alpaca-derived nanoantibody library (from the Li Zengpeng Laboratory of the Third Institute of Oceanography, Ministry of Natural Resources, constructed according to the method described in Moutel, S. et al., NaLi-H1: A universal synthetic library of humanized nanobodies providing highly functional antibodies and intrabodies. Elife 5, 2016). Three rounds of panning were performed using human p62 protein purchased from Proteintech (Cat. No. Ag13131) as the antigen. The antigen concentrations used for coating immunotubes (purchased from Wiesbaden, Germany) in each round were 50 μM, 25 μM, and 25 μM, respectively.

[0165] Specifically, 1 mL of phage library (1×10 13pfu / mL) and incubated with rotation at room temperature for 1 hour. The plate was then washed five times with 0.1% PBST (PBS containing 0.1% Tween-20) to remove unbound phage. Bound phage were eluted by adding 100 mM hydrochloric acid and incubating at room temperature for 7 minutes. After neutralization with 1 M Tris buffer (pH 7.4), the eluted phage were infected into exponentially growing E. coli TG1 cells and re-amplified. The amplified phage were purified and used for the next round of panning.

[0166] The phage library after three rounds of panning was re-infected into Escherichia coli, and 96 monoclonal colonies were randomly selected for phage ELISA detection. Screening was performed by measuring the absorbance at 450nm, among which the monoclonal clones with an absorbance of more than 5 times that of the milk control group were identified as positive clones. A total of 66 VHH single-domain antibodies that specifically bind to human p62 were obtained, of which three were identified as being able to bind to the p62 protein. Their antibody sequences are shown in SEQ ID NO: 9, 11, and 13, respectively, and the CDR sequences are shown in Table 2 below.

[0167] Table 2: Anti-p62 single domain antibodies

[0168] The affinity of the antibodies for human p62 protein was measured using BLI, and the results are shown in Figure 1. The results show that the three anti-p62 single-domain antibodies (hereinafter collectively referred to as Pn) have affinities for p62 ranging from nanomolar to picomolar, indicating strong binding capacity.

[0169] Example 2

[0170] This example describes that the p62 nanobody can specifically bind to the recombinant p62 protein fused with a fluorescent marker and the endogenous p62 protein in cells.

[0171] The coding nucleotide sequences of three single-domain antibodies A1E, D9A, and E12C (SEQ ID NOs: 10, 12, and 14) were respectively inserted between the restriction enzyme sites Xho I and Apa I of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector to obtain recombinant vectors pcDNA3.1-mCherry-4xGGS-A1E, pcDNA3.1-mCherry-4xGGS-D9A, and pcDNA3.1-mCherry-4xGGS-E12C, all of which can express the fusion protein of the mCherry fluorescent marker (red) and the nanobody (hereinafter collectively referred to as mCherry-Pn).

[0172] The coding nucleotide sequence of human p62 (SEQ ID NO: 8) was inserted between the restriction sites Xho I and Xba I of the pcDNA3.1-EGFP-4xGGS-XhoI-XbaI vector to obtain the recombinant vector pcDNA3.1-EGFP-4xGGS-p62, which can express the fusion protein EGFP-P62 of EGFP fluorescent marker (green) and p62.

[0173] Three mCherry-Pn expression plasmids were co-transfected with pcDNA3.1-EGFP-4xGGS-p62 plasmids into U-2OS cells to observe the co-localization of mCherry-Pn and EGFP-p62 in the cells. Co-transfection of pcDNA3.1-mCherry-4xGGS-XhoI-ApaI and EGFP-p62 was used as a control. After 24 hours of culture, the nuclei of living cells were stained using Hochest 33342 (Thermo Scientific, 62249), and then observed and photographed using a Nikon laser confocal microscope. The Pearson colocalization coefficient of EGFP and mCherry signals was calculated using Nikon NIS image analysis software to determine the binding ability of the above-mentioned nanoantibodies to the p62 protein in the cells. The results are shown in Figures 2 and 3.

[0174] The three mCherry-Pn expression plasmids were co-transfected with the pcDNA3.1-EGFP-4xGGS-p62 plasmid into HEK-293T cells with SQSTM1 knockout (from Cui Jun Laboratory, Sun Yat-sen University, according to Xie W. et al., OTUD7B deubiquitinates SQSTM1 / p62 and promotes IRF3 degradation to regulate antiviral immunity. Autophagy, 2022). After 24 hours of culture, the nuclei of living cells were stained with Hochest 33342 (Thermo Scientific, 62249), and then observed and photographed with a Nikon laser confocal microscope. The number of p62 droplets in each cell was measured using Nikon NIS image analysis software, and the results are shown in Figure 4.

[0175] Figures 2 and 3 show that all three nanobodies can produce obvious co-localization with EGFP-p62 in cells, while the control mCherry fluorescent protein lacks co-localization with EGFP-p62, indicating that the nanobodies of the present invention can bind to p62 protein in cells. It should be noted that Figure 4 shows that compared with the control expressing mCherry fluorescent protein, none of the three nanobodies increased the number of EGFP droplets in cells. The self-aggregation of p62 protein after activation is the key to promoting droplet formation, which shows that none of the three nanobodies disclosed herein can activate p62 protein after binding to it.

[0176] Three mCherry-Pn expression plasmids based on A1E, D9A, or E12C were individually transfected into U-2OS cells to investigate their ability to specifically bind to and recognize endogenous p62 protein. After culturing the transfected cells for 20 hours, they were starved with Earle's Balanced Salt Solution (EBSS, Pronose, PB180337) and treated with 200 nM bafilomycin (Baf A1, MCE, HY-100558) to block autophagy and stimulate p62 body production. After 4.5 hours, the cells were fixed with 4% paraformaldehyde and immunofluorescence stained using a p62 rabbit polyclonal antibody (MBL, PM045, 1:400), Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody (Thermo Scientific, A-11035), and Hochest 33342. Colocalization of fluorescent signals was observed as described above, and the results are shown in Figures 5 and 6. As can be seen from the figure, A1E, D9A, and E12C can also recognize and specifically bind to the endogenous p62 protein of the cell, forming obvious co-localization with the endogenous p62 protein.

[0177] Example 3

[0178] This example describes the target binding sites recognized by several exemplary p62 nanobodies and their enrichment in phase-separated droplets of p62 bodies within cells.

[0179] p62 is a multi-domain modular scaffold protein. Its N-terminal PB1 domain (amino acids 3-102 of SEQ ID NO: 7) is involved in mediating p62 oligomerization, and the C-terminal UBA domain (amino acids 389-434 of SEQ ID NO: 7) is responsible for binding to ubiquitin proteins. Both are crucial for inducing liquid-liquid phase separation and autophagic degradation of p62 (Sun, D. et al., Polyubiquitin chain-induced p62 phase separation drives autophagic cargo segregation. Cell Res 28, 405-415, 2018). In addition, amino acids 336-341 of the p62 protein serve as the LC3 interacting region (LIR) motif, responsible for directing p62 protein to bind to the LC3 protein, which is known to be anchored on the autophagic membrane (Birgisdottir, AB et al., The LIR motif-crucial for selective autophagy. J Cell Sci 126, 3237-3247, 2013).

[0180] Using the coding nucleotide sequence of human p62 as a template sequence, a series of p62 truncation mutants were obtained by PCR to determine the target binding site of the nanobody disclosed herein on the p62 protein. The amplified truncated variant coding sequences were inserted between the restriction sites Xho I and Xba I of the pcDNA3.1-EGFP-NUP98N-Xho I-Xba I vector to obtain the recombinant vectors pcDNA3.1-EGFP-NUP98N-ΔPB1, pcDNA3.1-EGFP-NUP98N-103-330, pcDNA3.1-EGFP-NUP98N-331-388, pcDNA3.1-EGFP-NUP98N-389-440, pcDNA3.1-EGFP-NUP98N-368-407 and pcDNA3.1-EGFP-NUP98N-73-132. Wherein, ΔPB1 is amino acids 103-440 of SEQ ID NO: 7, 103-330 is amino acids 103-330 of SEQ ID NO: 7, 331-388 is amino acids 331-388 of SEQ ID NO: 7, 389-440 is amino acids 389-440 of SEQ ID NO: 7, 368-407 is amino acids 368-407 of SEQ ID NO: 7, and 73-132 is amino acids 73-132 of SEQ ID NO: 7 (see Figure 7).

[0181] The correct plasmid identified by sequencing was amplified and purified, and co-transfected into U-2OS cells with any of the Cherry-Pn recombinant plasmids prepared in Example 2. The fluorescence of the co-expressed fusion protein was observed and measured using a Nikon laser confocal microscope and NIS image analysis software, and the enrichment of the mCherry signal in the EGFP droplets was calculated:

[0182] mCherry enrichment degree = (I(T) 液滴内 / I(T) 液滴外 )-(I(C) 液滴内 / I(C) 液滴外 )

[0183] Among them, I(T) 液滴内 and I(T) 液滴外 Respectively represent the droplets formed by each p62 truncation mutant (I(T) 液滴内 ) or outside the droplet (I(T) 液 漓外 ) average gray value of mCherry fluorescence signal; I(C) 液滴内 and I(C) 液滴外 Respectively represent the droplets formed by pcDNA3.1-EGFP-NUP98N-Xho I-Xba I vector (I (C) 液滴内 ) or outside the droplet (I(C) 液滴外 ) mCherry fluorescence signal average grayscale value. The results are shown in Figures 8 and 9. It can be seen that the three nanobodies bind to different positions of the p62 protein, with A1E binding to the UBA domain of p62, D9A binding to amino acids 73-132 of p62, and E12C binding to amino acids 368-407 of p62 (Figure 10).

[0184] Example 4

[0185] This example describes the preparation of an exemplary PDF-Bin based on p62 nanobody and the use of this PDF-Bin to recruit an exemplary target protein (POI) to the p62 body for targeted degradation.

[0186] First, a cell line stably expressing EGFP-POI was constructed. TDP43 is a ubiquitously expressed DNA / RNA binding protein that is closely associated with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (Keating, SS et al., TDP-43 pathology: From noxious assembly to therapeutic removal. Prog Neurobiol 211, 102229, 2022). Pathological aggregates of TDP43 in the cytoplasm are closely related to damage to neurons and brain regions, and also drive the destruction of neuromuscular junctions in disease model mice and ALS patients (Neumann, M. et al., Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130-133, 2006; Altman, T. et al., Axonal TDP-43 condensates drive neuromuscular junction disruption through inhibition of local synthesis of nuclear encoded mitochondrial proteins. Nat Commun 12, 6914, 2021). In addition, TDP43 has a typical disordered region at the N-terminus, which can oligomerize under physiological conditions and promote its own liquid-liquid phase separation (Carter GC et al., N-terminal Domain of TDP43 Enhances Liquid-Liquid Phase Separation of Globular Proteins. J Mol Biol. 2021 May 14; 433(10): 166948.).

[0187] The recombinant lentiviral vector pLVX-EGFP-TP43, containing the EGFP-TDP43 encoding nucleotide sequence (SEQ ID NO: 18), was co-transfected with the packaging plasmids pMD2.G (Addgene, 12259) and psPAX2 (Addgene, 12260) into HEK-293T cells to obtain viable lentiviral culture medium. The lentiviral culture medium was used to infect HEK-293T cells and U-2OS cells, respectively. Two stable transfected cell lines were obtained through resistance screening and flow cytometry analysis: HEK-293T / EGFP-TDP43 cells and U-2OS / EGFP-TDP43 cells.

[0188] A GFP nanobody (hereinafter referred to as Gn) that can specifically bind to the GFP fluorescent protein has been reported, and its amino acid sequence and encoding nucleotide sequence are shown in SEQ ID NOs: 19 and 20, respectively, see, for example, Kubala, MH et al., Structural and thermodynamic analysis of the GFP:GFP-nanobody complex. Protein Sci 19, 2389-2401, 2010. Using this nanobody Gn as the second binding specificity, conventional molecular cloning techniques were used to construct the bispecific fusion proteins of the present invention: A1E-fused Gn (A1E-Gn), D9A-fused Gn (D9A-Gn), and E12C-fused Gn (E12C-Gn), whose amino acid sequences are shown in SEQ ID NOs: 21-23, respectively, and their encoding nucleotide sequences are shown in SEQ ID NOs: 24-26, respectively. The nucleotide sequence encoding Gn and the three Pn-Gn encoding nucleotide sequences were inserted between the Xho I and Apa I restriction sites of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector, respectively, to obtain the recombinant vectors pcDNA3.1-mCherry-4xGGS-Gn, pcDNA3.1-mCherry-4xGGS-A1E-Gn, pcDNA3.1-mCherry-4xGGS-D9A-Gn and pcDNA3.1-mCherry-4xGGS-E12C-Gn, which were used to express the fusion proteins mCherry-Gn, mCherry-A1E-Gn, mCherry-D9A-Gn and mCherry-E12C-Gn, respectively. The formed bispecific fusion protein has both Gn-based binding activity specifically targeting EGFP fusion target protein (EGFP-POI) and Pn-based binding activity specifically targeting p62 protein, and is collectively referred to as PDF-Bin in this article.

[0189] Then, the recombinant vectors pcDNA3.1-mCherry-4xGGS-Gn, pcDNA3.1-mCherry-4xGGS-A1E-Gn, pcDNA3.1-mCherry-4xGGS-D9A-Gn, pcDNA3.1-mCherry-4xGGS-E12C-Gn, as well as the blank vector pcDNA3.1-mCherry-4xGGS-Xho I-Apa I, the recombinant vector pcDNA3.1-mCherry-4xGGS-A1E, pcDNA3.1-mCherry-4xGGS-D9A, or pcDNA3.1-mCherry-4xGGS-E12C encoding the Pn nanobody prepared in Example 2 were individually transfected into the U-2OS / EGFP-TDP43 stable cell line, and the cells were fixed after 24 hours. The cells were then immunostained using a rabbit anti-p62 polyclonal antibody (MBL, PM045, 1:400) and Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody (Thermo Scientific, A-11035) and Hochest 33342. Observation and imaging were performed using a Nikon laser confocal microscope, and colocalization of EGFP, mCherry, and Alexa Fluor 647 fluorescence signals was analyzed using Nikon NIS image analysis software. The results are shown in Figures 11 to 14. Fluorescence colocalization results showed that no colocalization of the nanobody, EGFP-TDP43, and p62 was observed when the Pn or Gn nanobody was transfected alone (Figures 11 and 12), while significant colocalization was observed when the A1E- and E12C-based PDF-Bin were transfected alone, indicating that they can effectively recruit EGFP-POI to p62 bodies (Figures 13 and 14). While no obvious ternary complex formation was observed when D9A-based PDF-Bin was transfected alone, by further co-transfecting the recombinant vector pcDNA3.1-EGFP-4xGGS-p62 into the cells to overexpress the p62 protein, the ternary complex formed by the nanobody, EGFP-TDP43 and p62 was also detected, as shown in Figure 15.

[0190] Without wishing to be bound by theory, we believe that the above results indicate that although the fusion protein disclosed herein does not contain a ligand capable of directly activating the p62 protein as one of its binding specificities, it is able to recruit TDP43 and p62 proteins to form a spatially close ternary complex, utilize and further amplify the liquid-liquid phase separation properties of the TDP43 protein with an intrinsically disordered region, and ultimately promote the oligomerization and activation of the bound p62 protein to form observable and detectable p62 bodies.

[0191] The same vectors as above (blank vector, recombinant vector expressing only one nanobody, and recombinant vector expressing the bispecific binding molecule PDF-Bin of the present invention) were separately transfected into the HEK-293T / EGFP-TDP43 stable cell line, and total cell protein was extracted after 48 hours of culture, and the content of intracellular EGFP-TDP43 was detected by protein immunoblotting. The immunoblotting was first incubated with rabbit anti-p62 polyclonal antibody and goat anti-rabbit conjugated HRP secondary antibody. After the results were visualized and imaged, the membrane was incubated, visualized and imaged again using rabbit anti-GAPDH polyclonal antibody and goat anti-rabbit conjugated HRP secondary antibody. The results are shown in Figure 16 (left). The grayscale values ​​of the immunoblot bands were quantified using ImageJ FIJI. After normalization according to the grayscale value of the GAPDH band, GraphPad Prism 8 was used for analysis and processing, and the results are shown in Figure 16 (right).

[0192] Immunoblotting results showed that cells transfected with A1E-, D9A-, or E12C-based PDF-Bin significantly increased the degradation of EGFP-TDP43. Combined with the above fluorescence co-localization experimental results, it can be concluded that unlike AUTOTEC molecules, which require a p62-activating ligand as one of their dual targets, the PDF-Bin disclosed herein can promote the formation of p62 bodies by forming a ternary complex, thereby promoting the degradation of target proteins via p62 bodies.

[0193] Example 5

[0194] This example describes the use of an exemplary PDF-Bin to control the targeted degradation of multiple different types of target proteins.

[0195] By conventional molecular cloning methods, the EGFP-TDP43 coding sequence in the pLVX-EGFP-TDP43 vector of Example 2 was replaced with the coding sequence of the target protein G3BP1, hnRNPK, or HTT-Q103 fused with EGFP at the N-terminus, or the coding sequence of the target protein TSPAN4, PD-L1, or APP fused with EGFP at the C-terminus, respectively, to construct a series of recombinant vectors shown in Table 3 below.

[0196] Table 3:

[0197] The coding fragment of mCherry-4xGGS-A1E-Gn in Example 4 was amplified by PCR and then homologously recombined between the EcoR I and Age I restriction sites of the pLVX-TETONE-EcoR I-Age I vector to obtain the pLVX-TETONE-mCherry-4xGGS-A1E-Gn recombinant vector, which can produce lentivirus with the assistance of the packaging plasmid and express the mCherry-A1E-Gn fusion protein under the induction of DoX.

[0198] Using the pLVX-TETONE-mCherry-4xGGS-A1E-Gn recombinant vector, the lentiviral culture medium was prepared in the same manner as in Example 4 and used to infect HEK-293T cells and U-2OS cells, respectively. Finally, the following two stable transfected cell lines were obtained through resistance screening and flow cytometry sorting: HEK-293T / A1E-Gn TRE cells and U-2OS / A1E-Gn TRE All cells can express mCherry-A1E-Gn fusion protein under DOX induction.

[0199] The recombinant vectors pLVX-EGFP, pLVX-EGFP-G3BP1, pLVX-EGFP-hnRNPK, pLVX-EGFP-HTT-Q103, pLVX-TSPAN4-EGFP, pLVX-PD-L1-EGFP and pLVX-APP-EGFP were transfected into U-2OS / A1E-Gn TRE After 6 hours, the medium was replaced with fresh medium containing 1 μg / mL DOX or the same volume of DMSO and cultured for another 24 hours. The cells were then immunostained using a rabbit anti-p62 polyclonal antibody and an Alexa Fluor 647 goat anti-rabbit IgG fluorescent secondary antibody. Images were observed and photographed using a Nikon laser confocal microscope, and the Pearson colocalization coefficients of EGFP and Alexa Fluor 647 fluorescence signals were analyzed using Nikon NIS image analysis software. The results are shown in Figures 17A to 17H and Figure 18.

[0200] Laser confocal imaging results showed that all target proteins were independently distributed when transfected alone and lacked colocalization with p62 bodies. However, after DOX-induced expression of mCherry-A1E-Gn (PDF-Bin), all EGFP-POIs, except EGFP protein, were enriched in p62 bodies, forming colocalized ternary complexes with PDF-Bin. Without wishing to be bound by theory, we believe this may be due to the highly ordered and well-soluble EGFP protein structure, which has a low or even absent tendency to undergo liquid-liquid phase separation under physiological conditions. Therefore, in normal cells with low autophagy levels, PDF-Bin was not detected to promote the formation of visible p62 bodies. On the other hand, intrinsically disordered proteins, proteins with intrinsically disordered regions, or membrane proteins all have a tendency to phase separate or be membrane-anchored under physiological conditions. Therefore, for various target proteins, the PDF-Bin disclosed herein can effectively promote the formation of p62 bodies by leveraging these properties of the target protein, resulting in distinct colocalized spots.

[0201] The above eight recombinant vectors pLVX-EGFP, pLVX-EGFP-G3BP1, pLVX-EGFP-hnRNPK, pLVX-EGFP-HTT-Q103, pLVX-TSPAN4-EGFP, pLVX-PD-L1-EGFP and pLVX-APP-EGFP were also transfected into HEK-293T / A1E-GnTRE cells or wild-type HEK-293T cells as controls. After 6 hours, the culture medium was replaced with fresh culture medium containing 1 μg / mL DOX or the same volume of DMSO and cultured for another 48 hours. Total cell protein was then extracted, and EGFP rabbit polyclonal antibody or mCherry rabbit polyclonal antibody was used as the primary antibody for the first incubation. Protein immunoblotting was performed by the same method as in Example 4, and the results are shown in Figure 19A. For the electrophoresis bands in the figure, grayscale value quantitative analysis was performed using ImageJ FIJI, and the degree of EGFP-POI degradation was calculated as follows:

[0202] All gray values ​​were normalized by the gray value of the GAPDH band and analyzed using GraphPad Prism 8. The results are shown in Figure 19B.

[0203] The results of the above-mentioned protein immunoblotting are consistent with the results of fluorescence co-localization, indicating that the PDF-Bin disclosed herein not only promotes the formation of the target protein-fusion protein-p62 ternary complex, but also shows a significant improvement in the targeted degradation efficiency to varying degrees when targeting target proteins with inherently disordered regions. Without wishing to be bound by theory, we believe that the effect of targeted degradation mediated by the multi-specific fusion protein PDF-Bin disclosed herein is likely related to the degree of disorder of the target protein and its tendency to liquid-liquid phase separation / self-aggregation. Proteins with a high degree of inherent disorder are prone to triggering liquid-liquid phase separation and self-aggregation, making it easy to achieve a significant targeted degradation effect when using the multi-specific fusion protein disclosed herein, thus becoming a good druggable target for the multi-specific fusion protein disclosed herein, which is difficult to achieve when using activating ligands and small molecule compounds that require an ordered structure as a binding site as the target head.

[0204] Example 6

[0205] This example describes a kinetic study of an exemplary PDF-Bin-mediated targeted degradation of a target protein.

[0206] The pLVX-EGFP-TDP43 plasmid was infected into the U-2OS / A1E-Gn prepared in Example 5. TRE Finally, a stable monoclonal cell line U-2OS / EGFP-TDP43; A1E-Gn TRE .

[0207] The stably transfected cell line was inoculated into a 12-well culture plate and cultured for 12 to 18 hours. It was then replaced with fresh culture medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for 24 hours. Then, a portion of the cells was used to extract total cell protein, and protein immunoblotting was performed using the same method as in Example 4 (using rabbit anti-EGFP polyclonal antibody or rabbit anti-p62 polyclonal antibody or rabbit anti-mCherry polyclonal antibody as the primary antibody, and goat anti-rabbit conjugated HRP secondary antibody); another portion of the cells was used to extract total RNA in the cells using an RNA rapid extraction kit (MF159) for qPCR detection. Each gene was repeated 2 times independently, and each treatment method was repeated 3 times independently. RPL13A was used as a standardized internal reference to calculate the standardized fold change of each target gene. The results are shown in Figure 20. The results showed that the cell line was able to stably and continuously express the EGFP-TDP43 fusion protein, and could significantly increase the expression level of the mCherry-A1E-Gn fusion protein under DOX induction (data not shown). Furthermore, no statistically significant effect of A1E-Gn on the expression of EGFP-TDP43 and other proteins at the transcriptional (mRNA) level was observed.

[0208] The stably transfected cell lines were seeded into 12-well culture plates and cultured for 12-18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX or a corresponding volume of DMSO and cultured for another 24 hours. The Pearson colocalization coefficient of EGFP and Alexa Fluor 647 fluorescence signals was determined using the same fluorescence confocal microscopy and analysis methods as in Example 3, and the number of p62 bodies was counted. The results are shown in Figures 21A and 21B. Furthermore, the stably transfected cells, after the culture medium was replaced as described above, were cultured for an additional 48 hours and analyzed by immunoprecipitation coupled to mass spectrometry (IP-MS). The results are shown in Figure 22.

[0209] The results of fluorescence confocal imaging and IP-MS showed that after the use of DOX to induce the expression of A1E-Gn, the formation of a ternary complex of EGFP-TDP43, mCherry-A1E-Gn and p62 was promoted, indicating that A1E-Gn can recruit EGFP-TDP43 to the p62 body (Figure 21A). At the same time, the number of p62 bodies increased significantly by about 6 times (Figure 21B), which means that increasing the interaction between TDP43 and p62 can promote the liquid-liquid phase separation of p62, thereby promoting the subsequent degradation process. Moreover, after the addition of DOX, it was observed that A1E-Gn only recruited TDP43 to the p62 body (Figure 22), and had no recruitment effect on proteins other than TDP43, which shows that the PDF-Bin disclosed in this article has significant specificity as a protein targeted degradation tool.

[0210] Subsequently, the kinetics of A1E-Gn-mediated EGFP-TDP43 directional degradation were characterized by a series of time gradient and DOX concentration gradient tests (Figures 23 to 28). The above-mentioned stably transfected cells were seeded into 12-well culture plates and cultured for 12 to 18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX and cultured for 12, 24, 36, 48, 60, or 72 hours, or replaced with fresh medium containing specified concentrations of DOX (0, 0.025, 0.05, 0.1, 0.25, 0.5, 0.75, 1, 2.5, 5, 7.5, 10 μg / mL) and cultured for 48 hours. The changes in the fluorescence signal excited by the cells under laser confocal microscopy snapshots were observed, and the results are shown in Figures 23 and 24; the total cell protein was extracted and subjected to protein immunoblotting, and the results are shown in Figures 25 and 26. The results showed that 12 hours after the addition of DOX, the fluorescence signal of EGFP-TDP43 significantly decreased (Figures 23 and 24), and the target protein reached maximum degradation after 36 to 48 hours (Figures 25 and 26). In addition, the results of the concentration gradient experiment showed that A1E-Gn-mediated target protein degradation was also concentration-dependent, with the degradation effect increasing with increasing DOX concentration (Figures 27 and 28).

[0211] Example 7

[0212] This example describes pathway studies for exemplary PDF-Bin-mediated targeted degradation of target proteins.

[0213] The stable monoclonal cell line U-2OS / EGFP-TDP43; A1E-Gn prepared in Example 6 was TRE Cells were seeded into 12-well plates and cultured for 12-18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and continued to culture. After 12 hours, 1 μM of the proteasome inhibitor MG-132 or 200 nM of the lysosomal acidification inhibitor bafilomycin A1 (Baf A1) was added to the designated experimental groups and cultured for an additional 36 hours. Total cell protein was then extracted and analyzed by western blotting. The results are shown in Figure 29.

[0214] The above results show that there was no statistically significant change in EGFP-POI levels before and after Baf A1 treatment, whereas MG-132 treatment significantly increased EGFP-POI levels, indicating that proteasome inhibitors can significantly inhibit A1E-Gn-mediated targeted degradation. Simultaneous addition of a proteasome inhibitor and an autophagy inhibitor almost completely inhibited target protein degradation (Figure 30). This suggests that A1E-Gn-mediated degradation primarily relies on the proteasome pathway.

[0215] Furthermore, Figures 31 to 33 show that p62 protein levels increased significantly with DOX treatment, but its mRNA level did not change statistically significantly. This suggests that A1E-Gn can also reduce the degradation of p62 protein itself, leading to higher accumulation of p62 protein in cells. This phenomenon is consistent with A1E-Gn's primary reliance on the proteasomal pathway for degradation. This is because p62 protein may be more involved in the proteasomal degradation pathway through its interaction with PDF-Bin, thus avoiding its fate of entering the autophagosome and being degraded in the lysosome.

[0216] Example 8

[0217] This example describes the preparation of another exemplary PDF-Bin molecule and the study of its properties related to the targeted degradation of target proteins.

[0218] Signal transducer and activator of transcription 3 (STAT3), a convergence node of many cancer-related signaling pathways, is ubiquitously expressed in various cell types and activated by interleukins, interferons, growth factors, and kinases such as SRC and MET. STAT3 is constitutively activated in various cancers such as non-small cell lung cancer (NSCLC), melanoma, lymphoma, and leukemia, as well as in non-cancerous cells in the tumor microenvironment, and plays a key role in regulating cancer cell proliferation, differentiation, and angiogenesis. Although STAT3 is a promising target for cancer therapy, it is generally recognized that its drugability is poor. To date, only a few antisense oligonucleotides (ASOs) or PROTACs targeting STAT3 have been developed that can effectively reduce STAT3 mRNA or protein levels and show certain anti-tumor activity. The C-terminal transactivation domain (TAD) of STAT3 has been reported to be highly disordered, with more than 50 amino acid residues forming an intrinsically disordered region (see Jacopo Sgrignani et al., Structural Biology of STAT3 and Its Implications for Anticancer Therapies Development. Int. J. Mol. Sci. 2018, 19(6), 1591). In this example, another exemplary PDF-Bin was prepared by selecting the endogenous STAT3 protein of tumor cells as a target to explore the degradation effect of the PDF-Bin molecule disclosed herein on endogenous targets and its anti-tumor potential.

[0219] This example uses the reported STAT3 antibody analog (monobody) MS3-6 (La Sala, G. et al., Selective inhibition of STAT3 signaling using monobodies targeting the coiled-coil and N-terminal domains. Nat Commun 11, 4115, 2020), which can specifically recognize and bind to the core fragment of STAT3. A nucleotide fragment encoding a fusion protein of EGFP fluorescent protein marker, p62 nanobody A1E, and MS3-6 (SEQ ID NO: 39) and a nucleotide fragment encoding a fusion protein of EGFP, A1E, and mCherry fluorescent protein nanobody Cn (SEQ ID NO: 16) were inserted between the restriction sites EcoR I and Age I of the pLVX-TETONE-EcoR I-Age I vector to obtain recombinant vectors pLVX-TETONE-EGFP-A1E-MS3-6 and pLVX-TETONE-EGFP-A1E-Cn, respectively. These recombinant vectors can produce lentiviruses with the assistance of packaging plasmids and express EGFP-A1E-MS3-6 and EGFP-A1E-Cn fusion proteins, respectively, under the induction of DOX.

[0220] The above recombinant vectors were co-transfected with the packaging plasmid into HEK-293T cells to obtain viable lentiviral culture medium. The lentiviral culture medium was used to infect A549 cells, and finally A549 / EGFP-A1E-MS3-6 was obtained through resistance screening and flow cytometry sorting. TRE and A549 / EGFP-A1E-Cn TRE Cell lines.

[0221] Immunofluorescence confocal localization

[0222] A549 / EGFP-A1E-MS3-6 TRE Cells were seeded into 4-well glass-bottomed culture dishes and cultured for 12-18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for an additional 24 hours. Immunofluorescence staining was performed using a rabbit anti-STAT3 polyclonal antibody and Alexa Fluor 546 goat anti-rabbit IgG fluorescent secondary antibody, as well as a mouse anti-p62 monoclonal antibody and Alexa Fluor 647 goat anti-mouse IgG fluorescent secondary antibody. Images were observed and photographed using a Nikon laser confocal microscope. Nikon NIS Image Analysis software was used to analyze the enrichment of STAT3 fluorescence signals in p62 bodies and the number of p62 bodies. GraphPad Prism 8 was used for analysis and processing. The results are shown in Figures 34 to 36.

[0223] The calculation method for the enrichment degree of STAT3 fluorescence signal is as follows:

[0224]

[0225] I(in) represents the mean fluorescence intensity of STAT3 inside the p62 body, and I(out) represents the mean fluorescence intensity of STAT3 outside the p62 body (intracellular).

[0226] The results showed that after A1E-MS3-6 expression was induced by DOX, STAT3 was significantly recruited to p62 bodies (Figures 34 to 36), and the number of p62 bodies was significantly increased (Figure 36), demonstrating that A1E-MS3-6 can interact with p62 and STAT3 proteins to form a ternary complex, and that the liquid-liquid phase separation properties of STAT3 promote the formation of p62 aggregates.

[0227] Time gradient degradation and concentration gradient degradation

[0228] Subsequently, A549 / EGFP-A1E-MS3-6 TRE After the stably transfected cells were seeded into 12-well culture plates and cultured for 12 to 18 hours, they were replaced with fresh culture medium containing 1 μg / mL DOX and cultured for 6, 12, 18, 24, 30, 36, 42, or 48 hours, or replaced with fresh culture medium containing a specified concentration (0, 0.05, 0.1, 0.25, 0.5, 1 μg / mL) of DOX and cultured for 48 hours. Total cell protein was then extracted and subjected to Western blotting. The results are shown in Figures 37 to 40. The results showed that 6 hours after the addition of DOX, the level of endogenous STAT3 protein began to decrease (Figures 37 and 38). In addition, the exemplary PDF-Bin-mediated degradation of the target protein also showed a DOX dose-dependent manner (Figures 39 and 40).

[0229] Degradation inhibitors to detect degradation pathways

[0230] We also studied the pathway of STAT3 targeted degradation mediated by A1E-MS3-6 using the same method as in Example 7. TREStably transduced cells were seeded into 12-well plates and cultured for 12-18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for an additional 12 hours. Subsequently, 1 μM of the proteasome inhibitor MG-132 or 200 nM of the lysosomal acidification inhibitor bafilomycin A1 (Baf A1) was added to the designated experimental groups and cultured for an additional 36 hours. Total cell protein was then extracted and analyzed by western blotting. The results are shown in Figures 41 and 42. As shown, unlike the degradation of EGFP-TDP43, treatment with proteasome inhibitors had no statistically significant effect on endogenous STAT3 levels. In contrast, Baf A1, an autophagy inhibitor, significantly inhibited STAT3 degradation. This suggests that A1E-MS3-6-mediated degradation primarily relies on the autophagy-lysosomal pathway. We believe this difference is likely due to the fact that inactive STAT3 is localized in the cytoplasm, while p62 in the cytoplasm primarily functions as a selective autophagy receptor for degradation.

[0231] p62 protein half-life

[0232] A549 / EGFP-A1E-MS3-6 TRE Stably transfected cells were seeded into 12-well culture plates and cultured for 12 to 18 hours. The culture medium was then replaced with fresh medium containing 1 μg / mL DOX or the corresponding volume of DMSO and cultured for another 12 hours. Cycloheximide (CHX), a protein synthesis inhibitor, was then added at 100 μg / mL for 4, 8, or 12 hours, with 0 hour representing no CHX treatment. Total cell protein was then extracted and subjected to Western blotting. The immunoblotting results were visualized using the same method as in Example 4, and the grayscale values ​​of the p62 bands were quantitatively analyzed. All grayscale values ​​were normalized by the grayscale values ​​of the GAPDH bands. The results are shown in Figures 43 and 44.

[0233] CHX treatment eliminated the interference of p62 protein synthesis on immunoblotting results, showing that DOX-induced expression of PDF-Bin significantly shortened the half-life of p62 protein in cells, indicating that A1E-MS3-6 can significantly increase the clearance rate of p62 itself. This phenomenon is consistent with A1E-MS3-6's primary lysosomal degradation, as more p62 protein participates in STAT3 degradation through the lysosomal pathway, simultaneously shortening the half-life of p62 itself.

[0234] Example 9

[0235] This example describes the inhibitory effect on tumor cells after treating tumor cells with the exemplary PDF-Bin of the present invention.

[0236] Specifically, the non-small cell lung cancer cell line A549 was treated with the aforementioned EGFP-A1E-MS3-6, and a fusion protein of A1E and an anti-mCherry nanobody (A1E-Cn) was used as a control (Fridy, PC et al., A robust pipeline for rapid production of versatile nanobody repertoires. Nat Methods 11, 1253-1260, 2014). The migration rate of tumor cells was assessed by a wound healing assay, and the proliferation ability of tumor cells was assessed by a colony formation assay.

[0237] Scratch test

[0238] A549 / EGFP-A1E-MS3-6 TRE Stable cells were seeded into 6-well plates and replaced with fresh culture medium containing the specified concentration of DOX or the corresponding volume of DMSO after 12 to 18 hours of culture. Culture for 48 hours until the cells reached 90-100% confluence. Then, scratches were made in the well plate with a 200 μL pipette tip. The culture medium was replaced with DMEM culture medium containing 2% fetal bovine serum, 50 μg / ml penicillin / streptomycin and the corresponding concentration of DOX or DMSO. The scratches were then immediately photographed using a Nikon inverted microscope 4x objective, which was counted as 0 hours. After the photography was completed, the cells were continued to be cultured and photographed again after 24 hours, which was counted as 24 hours. The results are shown in Figure 45. The scratch area was measured using ImageJ FIJI, and the wound healing rate was calculated using the following formula, and the wound healing efficiency was normalized:

[0239] Among them S (t=0h) and S (t=24h) Respectively represent the wound area at 0 hours and 24 hours. Use GraphPad Prism 8 to draw the image and statistical significance. The results are shown in Figure 47 (left).

[0240] Clone formation assay

[0241] A549 / EGFP-A1E-MS3-6 TREStable cells were seeded into 12-well plates at 400 cells / well and cultured for 12 to 18 hours before being replaced with fresh culture medium containing a specified concentration of DOX or a corresponding volume of DMSO. The culture medium containing DOX was replaced every 48 hours to prevent DOX from failing. After 9 days of DOX treatment, the cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes and then stained with crystal violet stain for 10 to 20 minutes until cell clones were visible to the naked eye and dark purple. The cells were rinsed three times with ultrapure water and then photographed with a SONYIMX800 camera. The results are shown in Figure 46. Image J was used to calculate the number of clones, and GraphPad Prism 8 was used to draw the images and statistically analyze the significance. The results are shown in Figure 47 (right).

[0242] From the above results, it can be seen that compared with tumor cells treated with control molecules, the migration and proliferation abilities of tumor cells treated with A1E-MS3-6 were significantly reduced ( FIG. 47 ), indicating that PDF-Bin disclosed herein has the potential to become a tumor suppressor or even a therapeutic agent.

[0243] Example 10

[0244] This example describes that the degradation-inducing ability of the PDF-Bin molecule of the present application can be enhanced by an oligomerization element or a phase separation element.

[0245] The following PDF-Bin molecules were prepared by the same method as in Example 4:

[0246] The PDF-Bin molecule is formed by connecting the monobody molecule PmSE10 (SEQ ID NO: 67) that specifically targets the human p62 protein and the monobody molecule Tm12D (SEQ ID NO: 77) that specifically targets the human TDP43 protein via a flexible linker shown in SEQ ID NO: 50, and is abbreviated as PmSE10-Tm12D below.

[0247] The PDF-Bin molecule is formed by connecting the nanobody PnA5 (SEQ ID NO: 72) that specifically targets human p62 protein and Tm12D through a flexible linker shown in SEQ ID NO: 50, and is abbreviated as PnA5-Tm12D below.

[0248] The following oligomerization elements or phase separation elements were fused to the C-terminus of the above-mentioned PmSE10-Tm12D or PnA5-Tm12D, respectively, and connected in the middle through a flexible linker to obtain the enhanced PDF-Bin molecule:

[0249] Tetramerization domain: SEQ ID NO: 60;

[0250] Tetradecamer domain: SEQ ID NO: 61;

[0251] Sexagenary domain: SEQ ID NO: 62;

[0252] NUP98_IDR: SEQ ID NO: 63;

[0253] FUS_IDR: SEQ ID NO: 64;

[0254] SFPQ_IDR: SEQ ID NO: 65;

[0255] P2S2: SEQ ID NO: 66.

[0256] The nucleotide sequences encoding the aforementioned PDF-Bin and enhanced PDF-Bin molecules were inserted between the Xho I and Apa I restriction sites of the pcDNA3.1-mCherry-4xGGS-Xho I-Apa I vector to express the PDF-Bin molecules. The recombinant vectors and the blank vector pcDNA3.1-mCherry-4xGGS-Xho I-Apa I were then transfected into U-2OS cells, and the cells were fixed 48 hours later. The cells were then immunostained using a rabbit anti-TDP43 polyclonal antibody (Proteintech, 10782-2-AP, 1:400), a mouse anti-p62 polyclonal antibody (MBL, M162-3, 1:400), Alexa Fluor 488 goat anti-rabbit IgG fluorescent secondary antibody (A-11034, 1:200), Alexa Fluor 647 goat anti-mouse IgG fluorescent secondary antibody (Thermo Scientific, A-21236, 1:200), and Hochest 33342. Observation and photography were performed using a Nikon laser confocal microscope, and the mean fluorescence intensity of Alexa Fluor 488 and mCherry fluorescence signals was analyzed using Nikon NIS image analysis software. GraphPad Prism 8 was used to plot the images and perform nonlinear fitting. The results are shown in Figures 48 to 50.

[0257] As shown in the figure, the tandem connection of the present invention's PDF-Bin molecules with oligomerization or phase separation elements further enhances p62 body aggregation and activation, with the magnitude of this enhancement being somewhat dependent on the degree of oligomerization or phase separation strength. These enhanced PDF-Bin molecules can enhance the targeted degradation activity of target proteins and, as expected, enhance the regulation of pathways associated with the target protein, such as its anti-tumor activity.

[0258] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A multispecific fusion protein comprising at least one first affinity peptide that specifically binds to the autophagy receptor p62 protein and at least one second affinity peptide that specifically binds to a target, wherein the first affinity peptide and the second affinity peptide are optionally covalently linked by a linker sequence.

2. The fusion protein according to claim 1, which is capable of forming a ternary complex comprising the fusion protein, the p62 protein, and the target when co-existing with the p62 protein and the target; Optionally, compared with the situation without the fusion protein, the fusion protein increases the liquid-liquid phase separation of the p62 protein. Optionally, the increase in the liquid-liquid phase separation is selected from any one of the following or any combination thereof: an increase in the number of liquid-liquid phase separation droplets containing the p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, and a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein. Optionally, the target is an intrinsically disordered protein, a protein with an intrinsically disordered region, or an aggregate protein, membrane complex, and / or organelle comprising the intrinsically disordered protein or the protein with the intrinsically disordered region as a monomer or component; Optionally, the intrinsically disordered region in the protein with the intrinsically disordered region comprises about 30 or more consecutive amino acid residues; Optionally, the target is selected from cytoplasmic proteins, nuclear proteins, membrane proteins, or organelles; Optionally, the target is any one selected from the group consisting of TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, and STAT3; Optionally, the first affinity peptide and the second affinity peptide are each independently selected from nanobodies or synthetic binding proteins; Optionally, the nanobody is selected from single-domain antibodies, single-chain antibodies (scFv), minibodies, half-antibodies, or antigen-binding fragments of antibodies; preferably, the single-domain antibody is selected from V H H domain antibodies, heavy chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies; Optionally, the synthetic binding protein is selected from monobodies, affibodies, anticalins, or DARPins; Optionally, the first affinity peptide comprises CDR1, CDR2, and CDR3 selected from any one of SEQ ID NO: 9, 11, 13, 67, or 72; Optionally, the CDR1, CDR2, and CDR3 comprised in the first affinity peptide have the amino acid sequences shown in SEQ ID NO: 51 to 53; the amino acid sequences shown in SEQ ID NO: 54 to 56; the amino acid sequences shown in SEQ ID NO: 57 to 59; the amino acid sequences shown in SEQ ID NO: 68 to 70; or the amino acid sequences shown in SEQ ID NO: 73 to 75, respectively; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67, or 72; Optionally, the second affinity peptide comprises CDR1, CDR2, and CDR3 selected from SEQ ID NO: 19 or 77; Optionally, the second affinity peptide contains CDR1, CDR2, and CDR3 having the amino acid sequences shown in SEQ ID NOs: 78 to 80, respectively; or the amino acid sequences shown in SEQ ID NOs: 81 to 83. Optionally, the second affinity peptide contains the amino acid sequence shown in SEQ ID NO: 19 or 77. Optionally, the linker sequence or linker is a rigid or flexible linker, preferably a flexible linker, more preferably a linker containing the sequence shown in SEQ ID NO:

50. Optionally, the fusion protein further comprises an oligomerization element, which is directly covalently linked to the first affinity peptide and / or the second affinity peptide or covalently linked through a linker sequence / linker. Optionally, each fusion protein contains one or more of the oligomerization elements, preferably one. Optionally, the oligomerization element is a dimer or higher oligomerization domain, preferably a tetramer or higher oligomerization domain, more preferably an octamer or higher oligomerization domain, most preferably a dodecamer or higher oligomerization domain. Optionally, the oligomerization element contains the amino acid sequence shown in any one of SEQ ID NOs: 60 to 62, or contains an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 60 to 62, or contains an amino acid sequence having one or several deletions, substitutions, or additions compared to any one of SEQ ID NOs: 60 to 62. Optionally, the fusion protein further comprises a phase separation element, which is directly covalently linked to the first affinity peptide and / or the second affinity peptide or covalently linked through a linker sequence / linker. Optionally, each fusion protein contains one or more of the phase separation elements. Optionally, the phase separation element contains the amino acid sequence shown in any one of SEQ ID NOs: 63 to 66, or contains an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 63 to 66, or contains an amino acid sequence having one or several deletions, substitutions, or additions compared to any one of SEQ ID NOs: 63 to 66. Optionally, the fusion protein further comprises an element beneficial for delivery, preferably an element beneficial for delivering it to a target site, and the element is optionally selected from a cell-penetrating peptide, a nuclear localization signal, an organelle localization signal, an endoplasmic reticulum retention signal, a peroxisome targeting signal, a mitochondrial transit peptide. Optionally, the fusion protein contains one first affinity peptide and one second affinity peptide, or one first affinity peptide and two or more identical or different second affinity peptides, or two or more identical or different first affinity peptides and one second affinity peptide, or two or more identical or different first affinity peptides and two or more identical or different second affinity peptides.

3. A nucleic acid comprising a nucleotide sequence encoding the fusion protein of claim 1 or 2. Optionally, the coding nucleotide sequence is operably linked to a promoter.

4. A recombinant vector, which comprises the nucleic acid according to claim 3, optionally, the vector is a recombinant viral vector.

5. An engineered cell, which expresses the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4.

6. A method for producing a fusion protein, which comprises expressing the nucleic acid according to claim 3 or the recombinant vector according to claim 4 in a suitable host cell, or culturing the engineered cell according to claim 5, and purifying the expressed fusion protein.

7. A composition, which comprises the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4, or the engineered cell according to claim 5.

8. A method for degrading a target in a cell, which comprises causing the cell to express the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, or the recombinant vector according to claim 4, such that the amount of the target is reduced compared to the case where the fusion protein, the nucleic acid or the recombinant vector is not present, preferably reduced by at least about 30 to 90%.

9. A method for preventing and / or treating a disease, which comprises administering to a subject the fusion protein according to claim 1 or 2, the nucleic acid according to claim 3, the recombinant vector according to claim 4, the engineered cell according to claim 5, or the composition according to claim 7, optionally, the disease is selected from diseases associated with protein misfolding, misaggregation or misproduction, preferably, the disease is selected from neurodegenerative diseases, cardiovascular diseases, neuromuscular diseases, tumors, metabolic diseases or autoimmune diseases, optionally, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, hereditary ataxia, Vici syndrome or BPAN syndrome, optionally, the cardiovascular disease is selected from coronary artery disease, atherosclerosis or pulmonary arterial hypertension, optionally, the neuromuscular disease is selected from hereditary cardiomyopathy, distal myopathy, muscular dystrophy, congenital myopathy, spinal muscular atrophy (SMAs), motor neuron disease, Duchenne muscular dystrophy, Becker muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, myotubular myopathy, central core myopathy, nemaline myopathy, selenoprotein N-related myopathy, Pompe disease, glycogen storage disease III or amyotrophic lateral sclerosis, Optionally, the tumor is selected from lung cancer, colorectal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), glioma (e.g., glioblastoma), neuroblastoma, melanoma, breast cancer, bladder cancer, kidney cancer, ovarian cancer, pancreatic cancer, cervical cancer, esophageal cancer, sarcoma, esophageal cancer (e.g., esophageal squamous cell carcinoma), thyroid cancer (e.g., papillary thyroid carcinoma), or prostate cancer, B-cell lymphoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, myelodysplastic syndrome (MDS), non-Hodgkin lymphoma (NHL), acute lymphocytic leukemia (ALL), acute monocytic leukemia, multiple myeloma, acute myeloid leukemia (AML), mixed lineage leukemia, NUT midline carcinoma, Burkitt lymphoma, or mycosis fungoides (MF), or metastatic forms thereof. Optionally, the metabolic disease is selected from hyperlipidemia, atherosclerosis, non-alcoholic fatty liver, or diabetes. Optionally, the autoimmune disease is selected from systemic lupus erythematosus, atopic dermatitis, myasthenia gravis, type I diabetes, sarcoidosis, asthma, graft-versus-host disease, autoimmune arthritis, rheumatoid arthritis, Sjogren's syndrome, psoriasis, multiple sclerosis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, uveitis, or polychondritis.

10. A method for screening a multispecific fusion protein, comprising the steps of: (a) obtaining one or more first affinity peptides capable of specifically binding to the autophagy receptor p62 protein, and one or more second affinity peptides capable of specifically binding to a target, and covalently linking at least one of the first affinity peptides and at least one of the second affinity peptides, optionally via a linker sequence or a linker, to obtain a candidate fusion protein library; (b) selecting, from the library, a candidate fusion protein that significantly increases the co-localization of the p62 protein with the target compared to a control in which the candidate fusion protein is absent; (c) selecting, from the candidate fusion proteins selected in step (b), a fusion protein that increases the liquid-liquid phase separation of the p62 protein compared to a control in which the candidate fusion protein is absent; Optionally, the increase in liquid-liquid phase separation in step (c) is selected from any one of the following or any combination thereof: an increase in the number of liquid-liquid phase separation droplets containing the p62 protein, an increase in the area of the liquid-liquid phase separation droplets containing the p62 protein, an increase in the degree of oligomerization of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein, or a decrease in the mobility of the p62 protein in the liquid-liquid phase separation droplets containing the p62 protein; Optionally, the target is an intrinsically disordered protein, a protein having an intrinsically disordered region, or a protein containing an intrinsically disordered protein or the protein having an intrinsically disordered region, or an aggregate protein, membrane complex, and / or organelle containing an intrinsically disordered protein or the protein having an intrinsically disordered region as a monomer or a component. Optionally, the target is selected from cytoplasmic proteins, nuclear proteins, membrane proteins or organelles; Optionally, the target is any one selected from the group consisting of TDP43, hnRNPK, G3BP1, HTT-Q103, TSPAN4, PD-L1, APP, and STAT3; Optionally, the method further includes step (d) of measuring the level of the target, and selecting a fusion protein in which the amount of the target is reduced compared to a control without the candidate fusion protein; preferably, the amount of the target is reduced by at least about 30-90%; Optionally, the first affinity peptide and the second affinity peptide are each independently selected from nanobodies or synthetic binding proteins; Optionally, the nanobody is selected from single-domain antibodies, single-chain antibodies (scFv), minibodies, half-antibodies, or antigen-binding fragments of antibodies; preferably, the single-domain antibody is selected from V H H domain antibodies, heavy chain variable domain (VH) antibodies, V NAR domain antibodies, V L domain antibodies; Optionally, the synthetic binding protein is selected from monobody, affibody, anticalin or DARPin; Optionally, the first affinity peptide comprises CDR1, CDR2 and CDR3 selected from any one of SEQ ID NO: 9, 11, 13, 67 or 72; Optionally, the CDR1, CDR2 and CDR3 comprised by the first affinity peptide have, respectively: the amino acid sequences shown in SEQ ID NO: 51 to 53; the amino acid sequences shown in SEQ ID NO: 54 to 56; the amino acid sequences shown in SEQ ID NO: 57 to 59; the amino acid sequences shown in SEQ ID NO: 68 to 70; or the amino acid sequences shown in SEQ ID NO: 73 to 75; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 9, 11, 13, 67 or 72; Optionally, the second affinity peptide comprises CDR1, CDR2 and CDR3 of SEQ ID NO: 19 or 77; Optionally, the CDR1, CDR2 and CDR3 comprised by the second affinity peptide have, respectively: the amino acid sequences shown in SEQ ID NO: 78 to 80; or the amino acid sequences shown in SEQ ID NO: 81 to 83; Optionally, the first affinity peptide comprises the amino acid sequence shown in SEQ ID NO: 19 or 77; Optionally, the linker connecting the first affinity peptide and the second affinity peptide in step (b) comprises the sequence shown in SEQ ID NO:

50.

11. A fusion protein obtained by the method according to claim 10.

12. A nanobody comprising CDR1, CDR2 and CDR3 of any one of SEQ ID NO: 9, 11, 13, 67, 72, 19 or 77, Preferably, the CDR1, CDR2 and CDR3 it comprises have, respectively: The amino acid sequences shown in SEQ ID NO: 51 to 53; The amino acid sequences shown in SEQ ID NO: 54 to 56; The amino acid sequences shown in SEQ ID NO: 57 to 59; The amino acid sequences shown in SEQ ID NO: 68 to 70; The amino acid sequences shown in SEQ ID NO: 73 to 75; The amino acid sequences shown in SEQ ID NO: 78 to 80; or The amino acid sequences shown in SEQ ID NOs: 81 to 83.

13. A nucleic acid encoding the affinity peptide according to claim 12, wherein, The coding nucleotide sequence preferably has a nucleotide sequence as described in any one of SEQ ID NOs: 10, 12, 14, 71 or 76.

Citation Information

Patent Citations

  • Degradation of surface proteins using bispecific binding agents

    CN114867752A

  • Multi-specific binding protein degradation agent platforms and methods of use

    CN116761825A

  • Single domain ligands, receptors comprising said ligands methods for their production, and use of said ligands and receptors

    US6248516B1

  • Bispecific binding agent-ligand fusions for the degradation of target proteins

    WO2022212593A1

  • Novel autophagy-targeting chimera (autotac) compound, and composition for preventing, alleviating, or treating diseases through target protein degradation comprising same

    CN112672993A

Cited By

  • Small peptide for preventing and treating colon cancer and application thereof

    CN121378411A