Regulatory sequence that drives gene expression, construct including ATM gene operably linked to said regulatory sequence, and adenovirus vector including said construct
By employing a control sequence and adenoviral vector with a 6 kbp region and transposase integration, the ATM gene is expressed at wild-type levels, overcoming vector capacity and expression challenges, effectively treating ataxia-telangiectasia.
Patent Information
- Application Number
- PCT/JP2025/003848
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-07
- Filing Date
- 2025-02-06
- Publication Date
- 2025-08-14
AI Technical Summary
Current gene therapy vectors, such as retroviruses and adeno-associated viruses, are limited by their capacity to carry large genes, and existing adenoviral vectors face challenges in achieving long-term expression and immunogenicity, making them unsuitable for treating diseases like ataxia-telangiectasia caused by mutations in the ATM gene.
A control sequence driving gene expression, an adenoviral vector containing a 6 kbp region upstream of the ATM gene, and transposase recognition sequences to integrate and express the ATM gene efficiently, ensuring equivalent expression levels to wild-type cells, using helper-dependent adenoviral vectors and transposase systems.
The solution enables stable, long-term expression of the ATM gene in patient cells, addressing the limitations of existing vectors and providing therapeutic benefits for ataxia-telangiectasia, including improved DNA repair and immune function.
Smart Images

Figure 00000028_0000 
Figure 00000028_0001 
Figure 00000028_0002
Abstract
Description
A construct comprising a control sequence that drives gene expression, an ATM gene operably linked to the control sequence, and an adenoviral vector comprising the construct
[0001] The present disclosure relates to a control sequence that drives gene expression, a construct comprising an ATM gene operably linked to the control sequence, and an adenoviral vector comprising the construct.
[0002] Ataxia-telangiectasia (AT) is an intractable disease that manifests from childhood with symptoms such as impaired coordination, telangiectasia, cerebellar ataxia, immunodeficiency, high carcinogenicity, progeria, and impaired glucose tolerance. The average life expectancy of AT patients is estimated to be 25 years. The causative gene for AT has been determined to be the ataxia telangiectasia mutated (ATM) gene. The ATM gene is located at 11q22.3 and encodes a large protein of 3056 amino acids. It is inherited in an autosomal recessive manner. The ATM protein encoded by the ATM gene is thought to play an important role in cell cycle regulation, double-strand DNA damage repair, and antibody and T-cell receptor recombination. AT is treated symptomatically; no cure exists. Antisense oligonucleotide (ASO)-based treatments for AT are currently being developed. However, because there are no hotspots for ATM mutations, developed treatments are limited to patients with the specific mutation targeted by the ASO.
[0003] Gene therapy aims to resolve the cause of a disease in cells by introducing normal genes into those cells. Gene therapy requires the intracellular expression of a foreign gene using a vector. Vectors derived from viruses such as retroviruses, lentiviruses, and adeno-associated viruses have been developed. These vectors have a low limit on the size of the gene they can carry, making them unsuitable for carrying large genes. Adenovirus vectors have been developed as vectors capable of carrying large genes (Non-Patent Document 1). Helper-dependent gutless adenovirus vectors have been developed to reduce immunogenicity (Non-Patent Document 1 and Patent Document 1).
[0004] Gene therapy requires continuous expression of the introduced gene. Some vectors are not suitable for long-term expression, and to prolong gene transfer using such vectors, viral vectors incorporating the piggyBac system have been developed (Non-Patent Documents 2 and 3).
[0005] WO2002 / 092786A
[0006] Willis et al., Molecular Therapy Oncology, 23: 571-581, 2021Cooney et al., Molecular Therapy, 23(4): 667-674, 2015Cooney et al., Nucleic Acid Research, 46(18): 9591-9600, 2018 Problem to be solved by the invention
[0007] The present disclosure provides a control sequence that drives gene expression, a construct comprising an ATM gene operably linked to the control sequence, and an adenoviral vector comprising the construct. The present disclosure also provides, for example, a control sequence that enables ATM protein expression equivalent to the amount of ATM protein expressed in wild-type cells, a construct comprising an ATM gene operably linked to the control sequence, and an adenoviral vector comprising the construct.
[0008] According to the present disclosure, we have discovered that an approximately 6 kbp region upstream of the ATM gene is important and sufficient for natural mRNA expression from the ATM gene, and that it is possible to construct a vector containing a gene expression cassette including this regulatory sequence and the ATM gene. Based on this, the present inventors have discovered a gene expression vector that drives natural mRNA expression of the ATM gene. According to the present disclosure, the following inventions may be provided: (1) A gene regulatory sequence, comprising a human genomic region at coordinates corresponding to chr11: 108,221,500-108,227,624 of the GRCh38 / hg38 reference genome, and optionally further comprising an adjacent region upstream of the coordinates, capable of driving expression of a gene operably linked to the regulatory sequence; (2) A gene construct comprising the regulatory sequence described in (1) above and a gene encoding human ataxia telangiectasia mutated (human ATM) protein, wherein the gene is operably linked to the regulatory sequence. (3) An adenoviral vector comprising the gene construct described in (2) above. (4) An adenoviral vector comprising the gene construct described in (2) above, but not comprising a gene encoding a viral protein. (5) The adenoviral vector according to (3) or (4) above, further comprising two transposase recognition sequences, with the gene construct being interposed between the two recognition sequences. (6) A composition comprising the adenoviral vector according to any one of (3) to (5) above. (7) A pharmaceutical composition comprising the adenoviral vector according to any one of (3) to (5) above. (8) The pharmaceutical composition according to (7) above, for use in treating a human subject having a mutation in ataxia telangiectasia mutated (human ATM) protein. (9) A pharmaceutical product comprising: the adenoviral vector according to (3) or (4) above, which further has recognition sequences for two transposases, with the gene construct intervening between the two recognition sequences; and an adenoviral vector comprising a gene encoding a transposase operably linked to a control sequence, wherein the transposase can recognize the recognition sequences.
[0009] (21) The control sequence according to (1) above, comprising a human genomic region at coordinates corresponding to chr11: 108,220,202-108,227,624 of the GRCh38 / hg38 reference genome. (22) The construct according to (2) above, comprising a human genomic region at coordinates corresponding to chr11: 108,220,202-108,227,624 of the GRCh38 / hg38 reference genome. (23) An adenoviral vector comprising the gene construct according to (22) above. (24) An adenoviral vector comprising the gene construct according to (22) above, but not containing a gene encoding a viral protein. (25) The adenoviral vector according to (23) or (24) above, further comprising two transposase recognition sequences, with the gene construct being interposed between the two recognition sequences. (26) A composition comprising the adenoviral vector according to any one of (23) to (25) above. (27) A pharmaceutical composition comprising the adenoviral vector according to any one of (23) to (25) above. (28) The pharmaceutical composition according to (27) above, for use in treating a human subject having a mutation in ataxia telangiectasia mutated (human ATM) protein. (29) A pharmaceutical product comprising: the adenoviral vector according to (23) or (24) above, further having two transposase recognition sequences, with the gene construct intervening between the two recognition sequences; and an adenoviral vector comprising a gene encoding a transposase operably linked to a regulatory sequence, wherein the transposase can recognize the recognition sequence.
[0010] (41) An adenovirus vector comprising a native promoter sequence of 5 kbp or more and a functionally normal gene of interest of 8 kbp or more, wherein the gene of interest is operably linked to the native promoter sequence and may further comprise a marker gene operably linked to an additional promoter sequence. (42) An adenovirus vector comprising a native promoter sequence of 5 kbp or more and a functionally normal gene of interest of 8 kbp or more, wherein the gene of interest is operably linked to the native promoter sequence and may further comprise a marker gene operably linked to an additional promoter sequence. (43) An adenovirus vector comprising a gene of interest expression unit comprising a native promoter sequence of 5 kbp or more and a functionally normal gene of interest of 8 kbp or more, wherein the adenovirus comprises transposase recognition sequences in the upstream and downstream flanking regions of the gene of interest expression unit, and the gene of interest is operably linked to the native promoter sequence. (44) A gutless adenovirus comprising an adenovirus vector comprising a gene-of-interest expression unit containing a native promoter sequence of 5 kbp or more and a functionally normal gene of interest of 8 kbp or more, wherein the gene-of-interest expression unit contains transposase recognition sequences in the upstream and downstream flanking regions, respectively, and the gene of interest is operably linked to the native promoter sequence. (45) An adenovirus vector comprising a native promoter sequence of 5 kbp or more, a functionally normal gene of interest of 8 kbp or more, and its 3' untranslated region, wherein the gene of interest is operably linked to the native promoter sequence and may further comprise a marker gene operably linked to an additional promoter sequence.(46) A gutless adenoviral vector comprising a native promoter sequence of 5 kbp or more, a functionally normal gene of interest of 8 kbp or more, and its 3' untranslated region, wherein the gene of interest is operably linked to the native promoter sequence and may further comprise a marker gene operably linked to an additional promoter sequence. (47) An adenoviral vector comprising a gene of interest expression unit comprising a native promoter sequence of 5 kbp or more, a functionally normal gene of interest of 8 kbp or more, and its 3' untranslated region, wherein the gene of interest expression unit contains transposase recognition sequences in the upstream and downstream flanking regions, respectively, and the gene of interest is operably linked to the native promoter sequence. (48) A gutless adenoviral vector comprising a gene-of-interest expression unit including a native promoter sequence of 5 kbp or more, a functionally normal gene of interest of 8 kbp or more, and its 3' untranslated region, wherein the gene-of-interest expression unit contains transposase recognition sequences in the upstream and downstream flanking regions, respectively, and the gene of interest is operably linked to the native promoter sequence. (49) The adenoviral vector according to (45) above, wherein the 3' untranslated region is 2 kbp or more in length. (50) The gutless adenoviral vector according to (46) above, wherein the 3' untranslated region is 2 kbp or more in length. (51) The adenoviral vector according to (47) above, wherein the 3' untranslated region is 2 kbp or more in length. (52) The gutless adenoviral vector according to (48) above, wherein the 3' untranslated region is 2 kbp or more in length. (53) The adenovirus vector according to (45), wherein the natural promoter sequence, the target gene, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more.(54) The gutless adenovirus vector according to (46), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (55) The adenovirus vector according to (47), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (56) The gutless adenovirus vector according to (48), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (57) The adenovirus vector according to (49), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (58) The gutless adenovirus vector according to (50), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (59) The adenovirus vector according to (51), wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (60) The gutless adenovirus vector according to (52) above, wherein the native promoter sequence, the gene of interest, and its 3' untranslated region have a total length of 15 kbp or more, 20 kbp or more, 25 kbp or more, or 30 kbp or more. (61) The adenovirus according to (43) above, which results in an expression level equivalent to that of a gene of interest in a normally expressing cell (about 0.5 to about 2 times, preferably about 0.7 to about 1.4 times, more preferably about 0.8 to about 1.25 times, for example, about 1 time). (62) The gutless adenovirus according to (44) above, which results in an expression level equivalent to that of a gene of interest in a normally expressing cell.(63) The adenovirus vector according to (47) above, which results in an expression level of a target gene equivalent to that in normal expression cells. (64) The gutless adenovirus vector according to (48) above, which results in an expression level of a target gene equivalent to that in normal expression cells.
[0011] (71) Any of the above-mentioned inventions, wherein the transposase is piggyBac transposase. (72) Any of the above-mentioned inventions, wherein the transposase is Sleeping Beauty transposase.
[0012] (81) The invention according to (71) above, which is used in combination with an expression vector (transient vector) expressibly carrying a gene encoding piggyBac transposase. (82) The invention according to (72) above, which is used in combination with an expression vector (transient vector) expressibly carrying a gene encoding Sleeping Beauty transposase. (83) The invention according to (81) above, in which the expression vector is an adenovirus vector. (84) The invention according to (82) above, in which the expression vector is an adenovirus vector.
[0013] A schematic diagram of an example of the structural elements of an ATM expression cassette is shown. A schematic diagram of an example construct consisting of an ATM expression cassette and a marker flanked by inverted terminal repeats (ITRs) is shown. Bright-field images of AT patient-derived fibroblasts (ATM-deficient cells or AT cells) infected with an adenovirus containing a construct containing an ATM expression cassette and the fluorescent protein mCherry gene are shown, along with a fluorescent image demonstrating mCherry expression. Western blot results of FLAG-tagged ATM protein produced from the ATM gene operably linked to three promoters (candidates 1-3) are shown. The acetylation pattern of lysine 27 of histone H3 (H3K27) and its relative position relative to the three promoters (candidates 1-3) are shown. Acetylation is observed around chr11: 108,221,500-108,227,624 of the GRCh38 / hg38 reference genome. The figure shows the expression of the introduced ATM gene after 10 passages in AT patient-derived fibroblasts (ATM-deficient cells) infected with an adenoviral vector containing a construct containing an ATM expression cassette and the fluorescent protein mCherry gene, with piggyBac transposase ITRs on both sides of the construct, in the presence of piggyBac transposase. AT cells into which the ATM expression cassette has been introduced were treated with bleomycin to induce genomic DNA damage, and the phosphorylation of p53 Ser15 was examined by Western blotting. AT patient-derived fibroblasts (ATM-deficient cells) were used as negative controls, and normal cells were used as positive controls. The figure shows the survival rate (bleomycin sensitivity) of AT cells into which the ATM expression cassette has been introduced after bleomycin treatment. The figure shows the main signaling pathways involved in the ATM protein. A schematic diagram of the ATM protein structure is shown.
[0014] <Definition of Terms> As used herein, terms in the singular include the plural. As used herein, "comprise" encompasses "consist of." "Comprise" allows for the inclusion of a third element other than the elements listed, whereas "consist of" does not allow for the inclusion of a third element other than the elements listed.
[0015] As used herein, a "gene" is a region of DNA that encodes messenger RNA (mRNA).
[0016] As used herein, a "regulatory sequence" refers to a DNA sequence that can drive expression of a gene when operably linked to the gene. A regulatory sequence typically drives expression of a gene linked downstream of the regulatory sequence. As used herein, "driving expression of a gene" means inducing expression of mRNA from the gene.
[0017] As used herein, "operably having" means being in a state of being operably linked to a control sequence.
[0018] As used herein, "GRCh38 / hg38" refers to the human reference genome sequence, with GRCh38 released by the National Center for Biotechnology Information (NCBI) and the Genome Reference Consortium (GRC) and hg38 released by the University of California, Santa Cruz in December 2013. Although there are differences in the sequences between GRCh38 and hg38, there are no differences in the coordinates across all chromosomes.
[0019] As used herein, "ATM" stands for ataxia telangiectasia mutated. The gene encoding ATM (ATM gene) has been identified as the gene responsible for ataxia-telangiectasia (AT). Ataxia-telangiectasia is a disease characterized by ataxia, telangiectasia, immunodeficiency, growth retardation, and progeria, typically resulting in impaired coordination in toddlers as they begin to walk. Patients with ataxia-telangiectasia have an average life expectancy of approximately 25 years, with death usually occurring by age 30. Diagnosis is by blood and genetic testing. The ATM gene is located on 11q22.3 in the human genome, consisting of 66 exons and spanning a total length of 150 kbp. The gene product, ATM, is a key molecule in DNA damage repair responses and immune induction through antibody and T-cell receptor recombination. Its functional disruption leads to impaired gene repair responses and immunodeficiency. There are diverse mutations in the ATM gene responsible for ataxia-telangiectasia. The ATM protein is a 350 kDa nuclear protein (see Figure 9). Human ATM typically has a length of 3,056 amino acids and has an amino acid sequence registered, for example, at UniProtKB / Swiss-Prot: Q13315.4. Upon genetic damage, ATM is phosphorylated, arresting the cell cycle and inducing gene repair (see Figure 8).
[0020] As used herein, "adenovirus vector" refers to a gene expression vector that utilizes a non-enveloped virus (adenovirus), which has a viral genome of approximately 36 kbp of double-stranded DNA. Adenovirus types 2 and 5 exhibit exceptionally high replication potential and are used as vectors that enable gene transfer into cells by direct administration in vivo. The adenovirus genome contains, in this order, inverted terminal repeats (ITRs), a packaging sequence (Ψ), E1A, E1B, E2, L1-4, E3, L5, E4, and ITRs. First-generation adenovirus vectors have E1 and / or E3 deleted, disrupting their ability to replicate autonomously. Second-generation adenovirus vectors also have E2 and / or E4 deleted, reducing immunogenicity. Helper-dependent adenoviral vectors contain the packaging sequence (Ψ), transgene, stuffer gene, and ITRs, but lack other regions of the adenoviral genome. Vector production can be carried out, for example, in 293 cells, and can be achieved by supplying the missing factors in trans from a helper virus and cells.
[0021] <Control Sequence of the Present Disclosure> According to the present disclosure, a control sequence is provided. The control sequence is separated from other sequences in the genome. While the specific sequence of the control region varies depending on the human cell, the control region includes a human genomic region located at coordinates corresponding to chr11: 108,221,500-108,227,624 of the GRCh38 / hg38 reference genome in cells of a human subject who does not develop AT.
[0022] In certain embodiments, the regulatory region may further comprise a human genomic region adjacent to and upstream of the coordinates (chr11: 108,221,500-108,227,624 of the GRCh38 / hg38 reference genome) (i.e., the region at or below chr11: 108,221,499). The regulatory sequence may further comprise a flanking region, preferably having a length of at least 100 bp, at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, at least 1 kbp, at least 1.1 kbp, at least 1.2 kbp, at least 1.3 kbp, at least 1.4 kbp, or at least 1.5 kbp from chr11: 108,221,499. The flanking region can have a length of, for example, 3 kbp or less, 2.5 kbp or less, 2 kbp or less, 1.9 kbp or less, 1.8 kbp or less, 1.7 kbp or less, 1.6 kbp or less, 1.5 kbp or less, 1.4 kbp or less, 1.3 kbp or less, 1.2 kbp or less, 1.1 kbp or less, or 1 kbp or less. In one embodiment, the flanking region has a length of 1 kbp to 3 kbp.
[0023] In one embodiment, the regulatory region comprises, or consists of, chr11:108,221,000 to 108,227,624 of the GRCh38 / hg38 reference genome. In one embodiment, the regulatory region comprises, or consists of, chr11:108,220,800 to 108,227,624 of the GRCh38 / hg38 reference genome. In one embodiment, the regulatory region comprises, or consists of, chr11:108,220,600 to 108,227,624 of the GRCh38 / hg38 reference genome. In one embodiment, the regulatory region comprises, or consists of, chr11:108,220,400 to 108,227,624 of the GRCh38 / hg38 reference genome. In one embodiment, the regulatory region comprises or consists of chr11:108,220,202 to 108,227,624 of the GRCh38 / hg38 reference genome.
[0024] <Gene construct of the present disclosure> The present disclosure provides a gene construct. The gene construct includes an expression unit for a gene of interest. The expression unit includes a control sequence and the gene of interest, and the gene of interest is operably linked to the control sequence. The control sequence is sufficient to drive expression of the gene of interest.
[0025] In a preferred embodiment, the target gene is a human ATM gene, and the control sequence is a control sequence of the present disclosure, i.e., the expression unit may comprise the control sequence and the human ATM gene. Such an expression unit is called a human ATM gene expression unit. The human ATM gene is a functional gene. A functional gene means that it does not cause AT. In the gene construct, the human ATM gene is operably linked to the control sequence. Those skilled in the art can appropriately operably link the human ATM gene to the control sequence. To operably link the human ATM gene to the control sequence, for example, the human ATM gene can be linked adjacent to the downstream of the control sequence.
[0026] The human ATM gene has, for example, an amino acid sequence registered in UniProtKB / Swiss-Prot: Q13315.4 or an amino acid sequence having 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity to the amino acid sequence, and retains the function of the human ATM gene. The human ATM gene may be tagged. Examples of tags include, but are not limited to, FLAG tags (e.g., DYKDDDDK or DYKDHD-G-DYKDHD-I-DYKDDDDK), his tags (e.g., including HHHHHH (6xHis)), HA tags (e.g., YPYDVPDYA), Myc tags (e.g., EQKLISEEDL), and V5 tags (e.g., GKPIPNPLLGLDST). The tag can be linked in-frame to the ATM gene. When a tag is added to the N-terminus, the start codon of the ATM gene can be removed and a gene encoding the tag can be directly linked in frame.
[0027] <Vector Comprising the Construct of the Present Disclosure> The present disclosure provides an adenoviral vector comprising an ATM gene, and a nucleic acid (e.g., DNA) encoding the genome of the adenoviral vector. In a preferred embodiment, the adenoviral vector comprises the ATM gene operably linked to a regulatory sequence.
[0028] Adenovirus vectors are typically based on adenovirus type 5 (or type 2). The viral particle of an adenovirus vector forms an icosahedral structure with protruding structures called pentons at each vertex. The penton contains a shaft-like structure called a fiber, which has a knob at its tip. The fiber infects cells by binding to the coxsackievirus and adenovirus receptor (CAR) on the cell surface. Inserting a targeting peptide into the HI loop or C-terminal region of the fiber knob region is useful for conferring cell targeting capabilities to adenovirus vectors. For example, vectors with an RGD peptide (which has affinity for αV integrin) inserted into the HI loop (AdRGD), vectors with the HIV Tat peptide inserted into the HI loop (AdTat), and vectors with polylysine (which has affinity for heparan sulfate) inserted into the C-terminal region (AdK7) have been developed, enabling highly efficient gene transfer into CAR-negative cells. Furthermore, AdF35 vectors, in which the fiber region has been replaced with that derived from Ad type 35, infect cells via CD46, which is expressed on almost all cells. Furthermore, Ad35 vectors in which RGD peptides have been inserted into the HG and HI loops of the Ad type 35 fiber knob achieve more efficient gene transfer into cells than AdF35.
[0029] In a preferred embodiment, the adenoviral vector does not contain genes encoding viral proteins. In a preferred embodiment, the adenoviral vector does not contain genes encoding viral factors. Such adenoviral vectors require a helper virus for their production and are therefore called helper-dependent adenoviral (HDAd) vectors, or gutless adenoviral vectors because of their reduced immunogenicity. Helper-dependent adenoviruses typically contain packaging sequences and cis-acting elements (e.g., ITRs). Helper-dependent adenoviruses also typically contain a stuffer gene introduced into them to adjust the genome size to a packageable size. The human hypoxanthine guanine phosphoribosyltransferase (hHPRT) gene is commonly used as a stuffer gene.
[0030] The present disclosure provides an adenoviral vector comprising an ATM gene operably linked to the regulatory sequence.The present disclosure provides a helper-dependent adenoviral (HDAd) vector or gutless adenoviral vector comprising an ATM gene operably linked to the regulatory sequence.
[0031] <Adenoviral Vector for Genome Integration of the Present Disclosure> Transposons are elements that enable the insertion of a gene of interest into a genome. However, transposons cannot be efficiently introduced into cells without a delivery method for transferring them from the outside of the cell to the inside of the cell. This also applies to the delivery of a gene of interest in vivo. Adenoviral vectors are not particularly suitable for long-term maintenance in host cells (such as human cells infected with adenovirus). In the present disclosure, two transposase recognition sequences can be arranged to flank the region of the gene of interest to be integrated into the host genome in the adenoviral vector. This can promote integration of the region into the host genome in the presence of a transposase that recognizes the recognition sequences and induces recombination.
[0032] Thus, in the present disclosure, a genetic construct may comprise an expression unit for the gene of interest and two transposon recognition sequences located in the upstream and downstream flanking regions of the expression unit for the gene of interest, respectively.Furthermore, in the present disclosure, an adenoviral vector (preferably an HDAd) may comprise a genetic construct comprising an expression unit for the gene of interest and two transposon recognition sequences located in the upstream and downstream flanking regions of the expression unit for the gene of interest, respectively.
[0033] The transposase recognition sequence can be, for example, the inverted terminal repeat (ITR) of a transposon. The transposase can be supplied by a transposase expression unit, for example, another vector (preferably an adenoviral vector, more preferably an HDAd) containing a gene encoding the transposase operably linked to a regulatory sequence. Hereinafter, a vector (preferably an adenoviral vector, more preferably an HDAd) that supplies the transposase is referred to as a transposase supplying vector. Transposase expression can be transient, allowing the construct to be inserted into the host genome via this transient expression. To prevent the sequence once inserted into the genome from being mobilized or deleted, the transposase supplying vector preferably does not have a transposase recognition sequence. Once the construct is inserted into the host cell genome, it stably expresses the gene of interest (particularly a functional ATM) in the host cell, so a single administration can be effective.
[0034] In a preferred embodiment, the transposon is a class 1 or class 2 transposon, preferably a piggyBac transposon. The piggyBac transposase recognizes inverted terminal repeats (ITRs). In a preferred embodiment, the transposon is a transposon of the Tc1 / mariner transposon family, preferably a sleeping beauty transposon. The sleeping beauty transposase recognizes inverted repeats / direct repeats (IR / DRs).
[0035] <Adenoviral Vector Achieving Expression Equivalent to a Natural Gene of Interest in Host Cells> The present disclosure provides an adenoviral vector comprising a gene of interest expression unit including a natural promoter sequence and a functionally normal gene of interest, wherein the gene of interest is operably linked to the natural promoter sequence and may further include a marker gene operably linked to an additional promoter sequence. In this aspect, the natural promoter sequence of the adenoviral vector is the original promoter sequence of the gene of interest. The adenoviral vector may further include a 3' untranslated region (UTR) of the gene of interest.
[0036] In one embodiment, the native promoter sequence may have a length, for example, but is not limited to, 3 kbp or more, 4 kbp or more, 5 kbp or more, 6 kbp or more, 7 kbp or more, or 8 kbp or more. In one embodiment, the native promoter sequence may have a length, for example, but is not limited to, 15 kbp or less, 14 kbp or less, 13 kbp or less, 12 kbp or less, 11 kbp or less, 10 kbp or less, 9 kbp or less, or 8 kbp or less. In one embodiment, the native promoter sequence may have a length, for example, but is not limited to, 3 kbp to 15 kbp, or 5 kbp to 10 kbp.
[0037] In certain embodiments, a functionally normal gene of interest may have a length, for example, but is not limited to, 8 kbp or more, 9 kbp or more, 10 kbp or more, 11 kbp or more, 12 kbp or more, 13 kbp or more, 14 kbp or more, 15 kbp or more, 16 kbp or more, 17 kbp or more, 18 kbp or more, 19 kbp or more, or 20 kbp or more. In certain embodiments, a functionally normal gene of interest may have a length, for example, but is not limited to, 25 kbp or less, 24 kbp or less, 23 kbp or less, 22 kbp or less, 21 kbp or less, 20 kbp or less, 19 kbp or less, 18 kbp or less, 17 kbp or less, 16 kbp or less, 15 kbp or less, 14 kbp or less, 13 kbp or less, 12 kbp or less, 11 kbp or less, or 10 kbp or less. In one embodiment, the functionally normal gene of interest may have a length of, for example, but not limited to, 5 kbp to 20 kbp, or 10 kbp to 15 kbp.
[0038] In one aspect, the 3' untranslated region (UTR) has a length, but is not limited to, for example, 500 bp or more, 1 kbp or more, 2 kbp or more, or 3 kbp or more, e.g., 500 bp to 3 kbp, or 1 kbp to 2 kbp.
[0039] In a preferred embodiment, the gene of interest expression unit may have a length of, but is not limited to, 10 kbp or more, 11 kbp or more, 12 kbp or more, 13 kbp or more, 14 kbp or more, 15 kbp or more, 16 kbp or more, 17 kbp or more, 18 kbp or more, 19 kbp or more, or 20 kbp or more. In a preferred embodiment, the gene of interest expression unit may have a length of, but is not limited to, 34 kbp or less, 33 kbp or less, 32 kbp or less, 31 kbp or less, 30 kbp or less, 25 kbp or less, 24 kbp or less, 23 kbp or less, 22 kbp or less, 21 kbp or less, 20 kbp or less, 19 kbp or less, 18 kbp or less, 17 kbp or less, 16 kbp or less, 15 kbp or less, 14 kbp or less, 13 kbp or less, 12 kbp or less, 11 kbp or less, or 10 kbp or less. In a preferred embodiment, the gene of interest expression unit may have a length of, for example, but not limited to, 10 kbp to 34 kbp, 15 kbp to 30 kbp, or 20 kbp to 25 kbp.
[0040] In one embodiment, the adenoviral vector contains the gene-of-interest expression unit and transposase recognition sequences in the upstream and downstream flanking regions of the gene-of-interest expression unit. In the presence of transposase, the gene-of-interest expression unit can be integrated into the genome of a host cell. The copy number of the gene-of-interest expression unit integrated into the genome of a host cell can be about 1 to about 2 copies, or about 1 to about 1.5 copies. Furthermore, in the host cell (a gene-of-interest deficient cell), the gene-of-interest expression unit can result in expression of the gene of interest at an amount equivalent to that of the gene of interest in a normal cell. Here, "equivalent" can mean about 0.5 to about 2 times, about 0.6 to about 1.7 times, about 0.7 to about 1.4 times, about 0.8 to about 1.25 times, or about 1 times. The expression level can be measured, for example, by Western blotting, ELISA, or the like.
[0041] Ensuring an expression level equivalent to that of normal cells is important from the perspective of ensuring the expression level, but is preferably important from the perspective of reducing side effects in cases where excessive expression causes side effects in cells. The advantage of using a native promoter sequence as a regulatory sequence is that when a target gene expression unit is integrated into the genome, it drives the target gene in the genome just as if it were a natural gene, produces protein, and its expression level is likely to be equivalent to that of normal cells. The transposase recognition sequence does not affect the expression level, and the adenoviral vector can be free of factors (other than the native promoter) that significantly affect the gene expression level by the target gene expression unit in the genome.
[0042] <Combined Use of Transposase Expression Vectors> A transposase expression vector can transiently express a transposase. This is because the gene of interest has no role after integration into the genome of the host cell, and therefore does not need to exhibit constitutive expression. Therefore, the transposase expression vector does not need to integrate a gene encoding the transposase into the host cell genome. The transposase expression vector may disappear from the cell after transposase expression (preferably after the ATM expression cassette is integrated into the genome by the transposase). In this respect, an adenovirus vector is preferably used as the transposase expression vector. In a preferred embodiment, the adenovirus vector (preferably an HDAd) contains the construct and two transposon recognition sequences located in the upstream and downstream flanking regions of the construct, respectively, and is administered in combination with another vector (preferably an adenovirus vector, more preferably an HDAd) that is a transposase expression unit containing a gene encoding the transposase operably linked to a regulatory sequence. In the context of combined administration, the adenoviral vector (preferably HDAd) containing the construct is referred to as the first vector, and the vector (preferably an adenoviral vector, more preferably HDAd) containing the transposase expression unit is referred to as the second vector. In one preferred embodiment, the gene of interest in the construct is the human ATM gene.
[0043] The first vector is administered to a human subject in combination with the second vector. In a preferred aspect of the present disclosure, a pharmaceutical composition comprising the first vector and the second vector is provided. By administering the pharmaceutical composition comprising the first vector and the second vector to a human subject, the construct can be introduced into the cellular genome of the human subject. In a preferred aspect of the present disclosure, a combined pharmaceutical product is provided, comprising a pharmaceutical composition comprising the first vector and a pharmaceutical composition comprising the second vector. By administering the pharmaceutical composition comprising the first vector and the pharmaceutical composition comprising the second vector to a human subject simultaneously, sequentially, or sequentially, the construct can be introduced into the cellular genome of the human subject. In a preferred aspect of the present disclosure, a pharmaceutical composition comprising the first vector is provided for use in combination with a pharmaceutical composition comprising the second vector. By administering the pharmaceutical composition comprising the first vector and the pharmaceutical composition comprising the second vector to a human subject simultaneously, sequentially, or sequentially, the construct can be introduced into the cellular genome of the human subject.
[0044] In a preferred embodiment, the dosage of the first vector and the second vector can be adjusted so that approximately one copy of the construct is inserted into one human cell. In a preferred embodiment, the dosage of the first vector and the second vector can be adjusted so that approximately 1 to 1.5 copies of the construct are inserted into one human cell. The number of copies to be inserted into one human cell can be determined based on the expression level of the target protein (particularly, ATM protein). The dosage of the first vector and the second vector can be adjusted so that the expression level of the target protein (particularly, ATM protein) is approximately 0.5 to 2 times (preferably 0.7 to 1.5 times, more preferably 0.8 to 1.25 times, e.g., approximately 1 time) compared to that in normal target protein (particularly, ATM protein)-expressing human cells. This allows the target protein (particularly, ATM) to be expressed from the target gene (particularly, human ATM gene) in target gene-mutated cells (particularly, ATM mutant cells) and function normally. Such dosage adjustment and determination are within the skill of those skilled in the art.
[0045] <Method for Producing the Vector of the Present Disclosure> Methods for producing adenoviral vectors are well known. Cosmids containing the genomic DNA of an adenoviral vector can be introduced into animal cells (e.g., human cells, preferably 293 cells and 293-derived cells). The genomic DNA can include the construct. Viral factors missing from the cosmid can be supplied in trans. To supply viral factors in trans, for example, the animal cells can be simultaneously infected with a helper virus containing the viral factors in an expressible manner. When conditions for viral particle formation in the cells are met, adenoviral vector particles containing the genomic DNA are produced. The resulting viral particles are collected and, if necessary, isolated or purified to obtain an adenoviral vector infectious to cells. Alternatively, adenoviral vectors can be prepared with reference to Ugai et al. (2005, J. Gene Med. 7, 1148-1157). When using other viral vectors, methods suitable for preparing the respective viral vectors can be adopted as appropriate. This applies to both the first and second vectors.
[0046] The helper virus expresses all components (proteins) necessary for the production of adenovirus vector particles. The helper virus is preferably a helper adenovirus, and contains the adenovirus 3' ITR, adenovirus packaging signal, and adenovirus 5' ITR, and also supplies the remaining elements deleted from the helper-dependent adenovirus with the cells. Preparation of the vector genome and helper adenovirus genome can be carried out based on techniques well known in the art (e.g., the techniques described in "Current Protocols in Molecular Biology," John Wiley, 1987-1988, and Sambrook, et al., "Molecular Cloning, A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory Press, 1989).
[0047] Pharmaceutical Compositions, Pharmaceutical Combination Products, and Administration Methods of the Present Disclosure In a preferred embodiment, the adenoviral vector containing the construct can be administered to a human subject having a mutation in the human ATM gene. In a preferred embodiment, the first vector and the second vector can be administered to a human subject having a mutation in the human ATM gene. The human subject having a mutation in the human ATM gene is a human subject with ataxia-telangiectasia. By administering the vectors, ataxia-telangiectasia can be treated in the human subject.
[0048] Thus, the present disclosure provides a pharmaceutical composition for use in treating ataxia-telangiectasia in a human subject having a mutation in the human ATM gene, the pharmaceutical composition comprising the adenoviral vector containing the construct. The present disclosure also provides a pharmaceutical composition or combined pharmaceutical product for use in treating ataxia-telangiectasia in a human subject having a mutation in the human ATM gene, the pharmaceutical composition comprising a first vector and a second vector, or a combined pharmaceutical product comprising a pharmaceutical composition comprising the first vector and the second vector.
[0049] The pharmaceutical compositions and combined pharmaceutical products of the present disclosure can be administered orally or parenterally (e.g., topically, intravenously, intramuscularly, subcutaneously, intradermally, etc.) Therefore, the pharmaceutical compositions and combined pharmaceutical products of the present disclosure can be formulated to be suitable for the above-mentioned administration routes.
[0050] The pharmaceutical compositions and combined pharmaceutical products of the present disclosure may further contain pharmaceutically acceptable additives. Examples of pharmaceutically acceptable additives include solvents (e.g., water), salts, isotonicity agents, pH adjusters, etc. The viruses can be stably maintained in the pharmaceutical compositions and combined pharmaceutical products of the present disclosure.
[0051] The present disclosure provides a method for treating a human subject having a mutation in the ATM gene. The method comprises administering to the human subject a pharmaceutical composition or combination pharmaceutical product of the present disclosure. The administered dose is a therapeutically effective amount. The administered dose can be determined so that ATM protein expression from the ATM gene introduced into the human subject is, for example, approximately 0.5 to approximately 2 times higher than that in cells of a normal subject. The same applies when an adenoviral vector for genomic integration is used. According to the present disclosure, in a human subject having a mutation in the ATM gene, any one or more diseases selected from the group consisting of coordination disorders, infertility, diabetes, immunodeficiency, chronic lung diseases such as pneumonia and bronchiectasis, cancer (particularly leukemia, lymphoma, brain tumor, and gastric cancer), paralysis, and dementia can be treated.
[0052] Human patients with ataxia-telangiectasia, for example, have loss-of-function mutations in the ATM gene. Loss-of-function mutations are present in both alleles in patients. Patients with ataxia-telangiectasia develop impaired coordination from the time they begin to walk. Patients with ataxia-telangiectasia develop visible dilated capillaries in the skin and eyes between the ages of one and six. Endocrine disruption in patients with ataxia-telangiectasia can lead to infertility and diabetes. Patients with ataxia-telangiectasia also suffer from recurrent sinus and lung infections that often worsen, leading to chronic lung diseases such as pneumonia and bronchiectasis. Patients with ataxia-telangiectasia are also at increased risk for cancer, particularly leukemia, lymphoma, brain tumors, and stomach cancer. As the disease progresses, patients with ataxia-telangiectasia develop paralysis and dementia, typically resulting in death by the age of 30. Patients with ataxia-telangiectasia can be identified by blood or genetic testing. Blood tests can examine IgA levels. Genetic testing can examine mutations in the ATM gene. Human patients may or may not exhibit one or more of the symptoms listed above. Treatment can be expected to slow or stop the progression of one or more of the above symptoms, or to delay or prevent the onset of one or more of the above symptoms. Early initiation of treatment is recommended.
[0053] The present disclosure provides an adenoviral vector comprising a construct of the present disclosure for use in a method of treating a human subject having a mutation in the ATM gene. The present disclosure also provides use of a construct of the present disclosure, or an adenoviral vector comprising a construct of the present disclosure, in the manufacture of a medicament for use in a method of treating a human subject having a mutation in the ATM gene.
[0054] The subject may also be receiving other symptomatic treatments (eg, gamma globulin replacement therapy for hypogammaglobulinemia, antibiotic or antimicrobial therapy for infections, and aspiration prevention).
[0055] 1. Design of ATM expression cassette We attempted to clone the promoter and 5' untranslated region of human ATM. Specifically, candidate 1: 108,223,400 from GRCh38 / hg38 chr11:108,222,537, candidate 2: 108,227,624 from GRCh38 / hg38 chr11:108,222,537, and candidate 3: 108,227,624 from GRCh38 / hg38 chr11:108,220,202 were obtained, and the Kozak sequence CGCCACC was inserted after this region (3' side), and the FLAG sequence ATGGATTACAAGGATGACGACGATAAGAGTCTAG (SEQ ID NO: 1) was inserted further after that (3' side). Following this sequence, the entire sequence of the ATM coding region excluding the first initiation codon ATG, as well as the entire 3' untranslated region, were cloned to create an ATM expression cassette (see Figure 1).
[0056] 2. Design and Preparation of ATM Expression Vector The resulting ATM expression cassette was introduced into a helper-dependent adenoviral vector (HDAd). HDAd lacks all viral coding sequences and retains only the packaging sequence and viral cis-acting elements necessary for vector genome replication and packaging. The 5' ITR sequence and core insulator sequence of a Piggybac transposon were inserted in front of the ATM expression cassette in the ATM-expressing adenoviral vector. The core insulator sequence followed by the 3' TR sequence was inserted after the ATM expression cassette.
[0057] To monitor vector introduction and expression induction, a gene encoding a fluorescent protein (mCherry) was introduced into the vector. Specifically, the resulting vector contained a stuffer sequence followed by an SV40 promoter sequence for mCherry gene expression, the mCherry gene, and a 3' ITR sequence for integration into the genome via Piggybac transposon.
[0058] The above sequence (see Figure 2) from the 5' ITR sequence to the 3' ITR sequence containing the ATM expression cassette and the mCherry gene was subcloned into a cosmid for producing adenovirus.
[0059] In addition, the piggybac transposase sequence driven by the POLP2A promoter was subcloned into a separate cosmid.
[0060] After cleavage of the ATM-inserted cosmid DNA insert at both ends with NotI, it was transfected into human FLPe-expressing 293 cells using Lipofectamine LTX reagent (Thermo). The next day, the cells were infected with a helper adenovirus containing FRP recognition sequences (FRT) inserted on both sides of the packaging signal of the adenovirus genome, and harvested three days later. The resulting first seed virus was used to infect human FLPe-expressing 293 cells four times together with the helper virus to serve as virus seed. Furthermore, piggybac transposase-expressing adenovirus was produced in 293 cells by infecting the cosmid with the piggybac transposase-expressing adenovirus, and the resulting virus was isolated.
[0061] 3. Evaluation of the performance of the constructed ATM-expressing adenoviruses The constructed ATM-expressing adenoviruses and piggybac transposase-expressing adenoviruses were infected into ATM-deficient fibroblasts derived from an ATM patient to express the exogenous ATM expression cassette and mCherry. mCherry was expressed in almost all cells, demonstrating that the infection efficiency was nearly 100% (see Figure 3).
[0062] Western blotting was also used to examine the expression of exogenous ATM in fibroblasts derived from AT patients. When the promoter of candidate 3 was used, the expression level was almost equivalent to that of native ATM in fibroblasts derived from normal subjects (positive control) (see Figs. 4A and 5). No expression was observed with candidate 1, but significant expression was observed with candidate 2, albeit at a low level (see Fig. 4A).
[0063] The acetylation level of histone H3 K27 on the ATM genome was elevated at chr11: 108,221,500-108,226,000 (Fig. 4B). Therefore, the sequence of candidate 3, including chr11: 108,221,500-108,226,000, is considered to be important for driving ATM gene expression. In the following experiments, candidate 3, which drives ATM gene expression equivalent to that of the wild-type promoter, was used as the promoter.
[0064] Furthermore, these cells continued to express ATM even after 10 or more passages in culture (see Figure 6), suggesting that ATM introduced using adenovirus was integrated into the genome and replicated.
[0065] Thirteen cell clones were obtained, and the copy number of ATM integrated into the genome was examined for each clone using digital PCR. The RPP30 gene was used as a control, and the ratio of the number of ATM introduced to RPP30 was calculated. The results showed that the ATM expression cassette had been integrated into the genome at 1.14 to 1.45 copies per cell.
[0066] 5. Signal transduction in ATM expression cassette-transfected cells ATM is known to be activated by DNA damage and phosphorylate p53, which is located downstream of ATM (see Figure 8). Therefore, we examined the phosphorylation of p53 in response to DNA damage induced by bleomycin in ATM expression cassette-transfected cells. While ATM-deficient cells showed little phosphorylation of p53 at serine 15, ATM expression cassette-transfected cells showed phosphorylation of p53 at serine 15, similar to that in normal cells (see Figure 7).
[0067] ATM-deficient cells are known to be highly sensitive to anticancer drugs. Therefore, we investigated whether cells transfected with an adenovirus could restore this high sensitivity to anticancer drugs. As a result, cells transfected with an ATM expression cassette by adenovirus were able to restore sensitivity to the anticancer drug bleomycin to a level almost equivalent to that of normal cells (see Figure 7).
Claims
1. A genetic regulatory sequence comprising a human genomic region at coordinates corresponding to chr11: 108,221,500-108,227,624 of the GRCh38 / hg38 reference genome, and optionally further comprising flanking regions upstream of said coordinates, wherein the regulatory sequence is capable of driving expression of a gene operably linked to the regulatory sequence.
2. A genetic construct comprising the regulatory sequence of claim 1 and a gene encoding human ataxia telangiectasia mutated (human ATM) protein, said gene being operably linked to said regulatory sequence.
3. An adenoviral vector comprising the genetic construct of claim 2.
4. An adenoviral vector comprising the genetic construct of claim 2, but not containing any genes encoding viral proteins.
5. The adenoviral vector according to claim 3 or 4, further comprising two transposase recognition sequences, with the gene construct being interposed between the two recognition sequences.
6. A composition comprising the adenoviral vector of any one of claims 3 to 5.
7. A pharmaceutical composition comprising the adenoviral vector according to any one of claims 3 to 5.
8. The pharmaceutical composition of claim 7 for use in treating a human subject having a mutation in the ataxia telangiectasia mutated (human ATM) protein.
9. A pharmaceutical product comprising: the adenoviral vector of claim 3 or 4, which further has recognition sequences for two transposases, with the gene construct interposed between the two recognition sequences; and an adenoviral vector comprising a gene encoding a transposase operably linked to a regulatory sequence, wherein the transposase can recognize the recognition sequences.
10. An adenoviral vector comprising a native promoter sequence of 5 kbp or more in length and a functionally normal gene of interest of 8 kbp or more in length, wherein the gene of interest is operably linked to the native promoter sequence and may further comprise a marker gene operably linked to a further promoter sequence.
11. The adenoviral vector of claim 10, which is a gutless adenoviral vector.
Citation Information
Patent Citations
Adipocyte differentiation promotor containing ATM protein or its expression vector
JP2009126823A
Undifferentiation maintenance promoting agent for melanocyte stem cell
JP2011012045A
Variants of the human ATM protein for the treatment of diseases related to at least one mutation of the ATM gene
WO2023152668A1