CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain

Abstract

The present invention relates to a CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain (CAR-CD19z.CD28.CD40) that has been genetically modified, particularly in the signaling domains of the CD28 / CD40 co- stimulatory domain, and transduced into T cells to generate specifically modified T cells expressing CAR-CD19z.CD28.CD40 on their surface. The said T cells are used for the treatment of cancers expressing CD19 antigen on the cell surface, such as leukemia and lymphoma. Additionally, they can effectively reduce the relapse or resistance to treatment.

Description

[0001] CD19-SPECIFIC CHIMERIC ANTIGEN RECEPTOR COMPRISING A

[0002] CD28 / CD40 CO-STIMULATORY DOMAIN

[0003] FIELD OF INVENTION

[0004] The invention relates to immunotherapy and biotechnology, more particularly, CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain (CAR-CD19z.CD28.CD40).

[0005] BACKGROUND OF THE INVENTION

[0006] The treatment of hematologic malignancies has become more successful due to the development of knowledge and understanding of the disease and its mechanisms. Although the current standard treatment is chemotherapy, complications in various systems in the body or long-term side effects from chemotherapy treatment reduce the patients’ quality of life. Additionally, patients with relapsed or resistant to standard treatment are often unsuccessful in treatment. Therefore, it is necessary to develop more effective treatment methods.

[0007] Leukemia is the most common cancer in children while acute lymphoid leukemia and B-cell non-Hodgkin lymphoma are more common in adult patients. When these diseases are resistant to standard treatment or relapsed (relap sed / refractory B-cell acute lymphoblastic leukemia and relap sed / refractory B-cell non-Hodgkin lymphoma), this group of patients requires additional treatment with chemotherapy and / or radiation therapy to achieve remission, followed by hematopoietic stem cell transplantation from a sibling or donor. The main problems of stem cell transplantation are whether the patient’s condition is suitable for receiving stem cell transplantation and the difficulty of finding a stem cell donor that is suitable for the patient. In the case of patients whose disease relapses after stem cell transplantation, the chance of treatment is even less.

[0008] Due to the shortcomings in the effectiveness of leukemia and lymphoma treatment, including the possibility of relapse or resistance to treatment, it is necessary to develop cell therapy that can effectively treat cancer, especially leukemia and B-cell lymphoma, to obtain modified T cells that can eliminate cancers expressing CD19 antigen on the cell surface. SUMMARY OF THE INVENTION

[0009] In one embodiment of the invention, the present invention relates to the CD 19- specific chimeric antigen receptor comprises the amino acid as shown in SEQ ID NO: 19.

[0010] In another aspect of the invention, the CD19-specific chimeric antigen receptor comprises the amino acid identity of at least 90% with SEQ ID NO: 19.

[0011] In another aspect of the invention, the CD19-specific chimeric antigen receptor comprises: a. an extracellular domain; b. an intracellular signaling domain; and c. the hinge and transmembrane domain that connects between the extracellular domain and intracellular signaling domain.

[0012] In another aspect of the invention, the intracellular signaling domain comprises a CD28 / CD40 co- stimulatory domain and a CD3 zeta (CD3z) signaling domain that is located after CD40.

[0013] In another aspect of the invention, the extracellular domain comprises a variable light chain domain (VL), a linker and a variable heavy chain domain (VH).

[0014] In another aspect of the invention, the variable light chain domain comprises the amino acid identity of at least 90% with SEQ ID NO:2.

[0015] In another aspect of the invention, the variable light chain domain comprises the amino acid as shown in SEQ ID NO:2.

[0016] In another aspect of the invention, the linker comprises the amino acid identity of at least 90% with SEQ ID NO:4.

[0017] In another aspect of the invention, the linker comprises the amino acid as shown in SEQ ID NO:4. In another aspect of the invention, the variable heavy chain domain comprises the amino acid identity of at least 90% with SEQ ID NO:6.

[0018] In another aspect of the invention, the variable heavy chain domain comprises the amino acid as shown in SEQ ID NO:6.

[0019] In another aspect of the invention, the hinge domain comprises the amino acid identity of at least 90% with SEQ ID NO:8.

[0020] In another aspect of the invention, the hinge domain comprises the amino acid as shown in SEQ ID NO:8.

[0021] In another aspect of the invention, the transmembrane domain comprises the amino acid identity of at least 90% with SEQ ID NO: 10.

[0022] In another aspect of the invention, the transmembrane domain comprises the amino acid as shown in SEQ ID NO: 10.

[0023] In another aspect of the invention, the CD3 zeta comprises the amino acid identity of at least 90% with SEQ ID NO: 16.

[0024] In another aspect of the invention, the CD3 zeta comprises the amino acid as shown in SEQ ID NO: 16.

[0025] In another aspect of the invention, the CD28 / CD40 co- stimulatory domain comprises the amino acid identity of at least 90% with SEQ ID NO: 17.

[0026] In another aspect of the invention, the CD28 / CD40 co -stimulatory domain comprises the amino acid as shown in SEQ ID NO: 17.

[0027] In one embodiment of the invention, the present invention also relates to T cell expressing CD 19- specific chimeric antigen receptor.

[0028] In another aspect of the invention, the present invention relates to the use of T cell expressing CD 19- specific chimeric antigen receptor for the manufacture of the pharmaceutical compositions for the treatment of cancers expressing CD19 antigen on the cell surface. More preferably, the cancers include B-cell lymphoma leukemia and nonHodgkin lymphoma.

[0029] In another aspect of the invention, T cell expressing CD19-specific chimeric antigen receptor can effectively reduce the relapse or resistance to cancer treatment.

[0030] In one embodiment of the invention, the present invention also relates to viral vector expressing CD19-specific chimeric antigen receptor, wherein the viral vector comprises: a. a vector containing at least a part of lentivirus; and b. the CD 19- specific chimeric antigen receptor.

[0031] BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 shows the structural compositions of a CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain.

[0033] Figure 2 shows the production and assembly of the CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain using CAR- CD19z.CD28 and CAR-CD19z.4O genes as templates. The CAR-CD19z.CD28.CD40 gene was ligated into a plasmid for gene expression.

[0034] Figure 3 shows the results of gene transduction of CAR-CD19z.CD28.CD40 (preselection) into T cells (post-selection) compared with the control group (CAR- CD19z.CD28 T cells) based on the percentage of tEGFR expression.

[0035] Figure 4 shows the efficacy of CAR-CD19z.CD28.CD40 T cell proliferation after stimulation with the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen compared with the control group in the medium without interleukin-2 (IL-2).

[0036] Figure 5 shows the efficacy of CAR-CD19z.CD28.CD40 T cell proliferation after stimulation with the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen compared with the control group in the medium with IL-2. Figure 6 shows the expression of program cell death- 1 (PD-1) compared with the control group in the medium with or without IL-2.

[0037] Figure 7 shows the efficacy of CAR-CD19z.CD28.CD40 T cells in the elimination of the Burkitt lymphoma cell line (Raji cells) expressing CD19 antigen at the effector cells (CAR T cells) to target cells (cancer cells) ratio (E:T ratio) of 1:1 (7a), 1:5 (7b), and 1:10 (7c) compared with the control group in the medium without IL-2.

[0038] Figure 8 shows the proliferation of CAR-CD19z.CD28.CD40 T cells after restimulation with the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen compared with the control group.

[0039] Figure 9 shows the expression of the PD-1 protein in CAR-CD19z.CD28.CD40 T cells after re- stimulation with the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen compared with the control group.

[0040] Figure 10 shows the efficacy of CAR-CD19z.CD28.CD40 T cells in the elimination of the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen using bioluminescence imaging (BLI) compared with the control-group mice.

[0041] Figure 11 shows the efficacy of CAR-CD19z.CD28.CD40 T cells in the elimination of the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen using body weight compared with the control-group mice.

[0042] Figure 12 shows the efficacy of CAR-CD19z.CD28.CD40 T cells in the elimination of the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen using the mean value of fluorescent cancer cells per volume area compared with the control- group mice.

[0043] Figure 13 shows the efficacy of CAR-CD19z.CD28.CD40 T cells in the elimination of the Burkitt lymphoma cell line (Raji cells) expressing CD 19 antigen using the survival rate compared with the control-group mice.

[0044] Figure 14 shows nucleotide sequence no: 18 (SEQ ID NO: 18) and amino acid sequence no: 19 (SEQ NO: 19). DETAILED DESCRIPTION OF THE INVENTION

[0045] The present invention relates to a CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co- stimulatory domain, T cells expressing CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co- stimulatory domain, and a pharmaceutical composition for use in the treatment of cancers expressing CD 19 antigen on the cell surface.

[0046] Any embodiments depicted herein shall encompass modification to other aspects of this invention, unless stated otherwise.

[0047] Definition

[0048] Technical terms or scientific terms used herein have definitions as understood by those having ordinary skills in the art unless stated otherwise.

[0049] Equipment, apparatus, methods, or chemicals mentioned here refer to those commonly operated or used by those skilled in the art, unless explicitly stated otherwise, that they are equipment, apparatus, methods, or chemicals specifically used in this invention.

[0050] The terms “a,” “an,” and “the” in the claims or the specification should be interpreted as “one” as well as “one or more,” “at least one,” and “one or more than one,” unless the context clearly dictates otherwise, and so forth.

[0051] The use of singular or plural nouns with the term “comprising” in the claims or the specification should be interpreted as “one” as well as “one or more,” “at least one,” and “one or more than one.”

[0052] All compositions and / or processes disclosed and claimed are intended to encompass aspects of the invention that involve actions, operation, modifications, or changes of any parameters without deviating from experiments performed, examples described, or data shown in this invention, and obtaining similar objects with the same utilities and results as those described in the present invention by persons skilled in the art, even without specific mention in the claims. Therefore, substitutions or similar objects to the present invention, including minor modifications or changes that are apparent to persons skilled in the art, should be considered within the scope, and concept of the invention as defined by the appended claims.

[0053] Throughout this application, the term “about” is used to indicate that any value presented herein may potentially vary or deviate due to variety of factors, such as calculation errors, discrepancies in apparatus or methods, or differences between individual operators implementing the apparatus or methods.

[0054] The following specification is not intended to limit the scope of the invention in any manner.

[0055] CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain

[0056] A CD19-specific chimeric antigen receptor comprising a CD28 / CD40 costimulatory domain comprises: a. an extracellular domain; b. an intracellular signaling domain; and c. a hinge and transmembrane domain that connects between the extracellular domain and intracellular signaling domain; wherein the intracellular signaling domain comprises the CD28 / CD40 costimulatory domain and a CD3 zeta signaling domain that is located after CD40.

[0057] The details of each composition of CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain according to the present invention (as shown in Table 1 and Figure 1) are described as follows.

[0058] Extracellular Domain

[0059] The extracellular domain comprises a variable heavy chain (VH) and a variable light chain (VL) domain, connected by a short chain of amino acids called a linker. The extracellular domain connects to the linker and crosses the cell membrane. The linker comprises the amino acid sequence GGGGS, which may contain 1 to 5 repeats, depending on a proper modification of the shape of each composition of the chimeric antigen receptor. For example, it may contain 4 repeats of the said amino acid sequence. Therefore, the amino acid sequence of the linker is GGGGS GGGGS GGGGS GGGGS according to the amino acid as shown in SEQ ID NO:4.

[0060] Intracellular Signaling Domain

[0061] The intracellular signaling domain comprises the CD28 / CD40 co- stimulatory domain (co-stimulatory domain of T cells) and the CD3 zeta signaling domain (T cells signaling domain). The CD28 / CD40 co-stimulatory domain comprises the amino acid as shown in SEQ ID NO: 17. The CD3 zeta signaling domain comprises the amino acid as shown in SEQ ID NO: 16.

[0062] Hinge and Transmembrane Domain

[0063] The hinge and transmembrane domain comprise a hinge domain for connecting the extracellular domain and transmembrane domain that bind to the cell membrane. The transmembrane domain according to the present invention (TM_CD28) comprises the amino acid as shown in SEQ ID NO: 10.

[0064] The CD28 protein is presented in both transmembrane domain and intracellular signaling domain (IC_CD 28), which is a co-stimulatory domain alongside CD40, as mentioned earlier. The intracellular signaling domain comprises the amino acid as shown in SEQ ID NO: 12.

[0065] The CAR-CD19z.CD28.CD40 gene is created by ligating a CD40 gene to CAR- CD19z.CD28 construct using gene modification techniques.

[0066] The CD19-specific chimeric antigen receptor T cells with a CD28 / CD40 co- stimulatory domain according to the present invention comprises the nucleotide as shown in SEQ ID NO: 18 and / or the amino acid as shown in SEQ ID NO: 19.

[0067] In a preferred embodiment of the invention, the CAR-CD19z.CD28.CD40 gene is shown in Table 2 and Figure 14. Table 1 shows the nucleotide sequences and amino acid sequences of the compositions of CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain according to the present invention. Table 2 shows the nucleotide sequences and amino acid sequences of CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain according to the present invention.

[0068] The gene modification method used in this invention is described as follows.

[0069] 1. DNA synthesis by the overlap polymerase chain reaction (the overlap PCR) and gene assembly.

[0070] CAR-CD19z.CD28 and CAR-CD19z.CD40 genes were used as templates for the overlap PCR. Ten specific DNA primers were designed to target template genes, resulting in the creation of five overlapped DNA fragments that were then assembled to form CAR- CD19z.CD28.CD40 gene. The structure of the template genes and the overlap PCR are shown in Figure 2.

[0071] 1.1) The synthesis of DNA fragment 1 (HpaI-CD19scFV-28TM-CD28-CD3z).

[0072] CAR-CD19z.CD28 gene was used as a template for the overlap PCR. The inventor had designed primers that contain overlapping nucleotide sequences. To enhance the specificity of the forward primer, the nucleotide sequence of the enzyme Hpal (GTTAAC) was added at the beginning of the primers. Additionally, to ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 80 percent. The melting temperature (Tm), which indicates the temperature at which double-stranded DNA separates into single strands, was optimized to fall between 70 to 90 degrees Celsius.

[0073] Primers for DNA fragment 1 synthesis:

[0074] Forward primer: HpaI-19scFv

[0075] 5’ GTTAAC ATGGAGTTTGGGCTGAGCTGGCTTTTT 3’

[0076] Reverse primer: tEGFR-CD3z

[0077] 5’ TCCGCCGCCCTCGAGGCGAGGGGGCAGGGCCTG 3’ Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase):

[0078] - CAR-CD19z.CD28 cDNA about 100 to 200 nanograms

[0079] Primestar Max Premix (2X) enzyme about 25 microliters

[0080] Forward primer (10 Micromolar) about 1 microliter

[0081] Reverse primer (10 Micromolar) about 1 microliter

[0082] Distilled water, added to the total volume of about 50 microliters

[0083] The optimum conditions for DNA amplification using PCR were:

[0084] Step 1 about 98 degrees Celsius, 30 seconds

[0085] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds

[0086] Step 3 about 72 degrees Celsius, 4 minutes

[0087] Unpurified HpaI-CD19scFV-28TM-CD28-CD3z was obtained after completion of PCR.

[0088] 1.2) DNA purification of HpaI-CD19scFV-28TM-CD28-CD3z.

[0089] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0090] 1.3) The synthesis of DNA fragment 2 (tEGFR). CAR-CD 19z.CD40 gene was used as a template for the overlap PCR to obtain the DNA fragment of truncated epidermal growth factor receptor (tEGFR), which is a marker for tracking. CD3 zeta cDNA was added at the beginning of the forward primer. Nucleotide sequence of the enzyme Hpal (GTTAAC) was added at the end of the reverse primer. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be about 33 bases long and a GC content of about 60 to 80 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which doublestranded DNA separates into single strands, was optimized to fall between 70 to 90 degrees Celsius.

[0091] Primers for DNA fragment 2 synthesis:

[0092] Forward primer: CD3z-tEGFR

[0093] 5’ GCCCTGCCCCCTCGCCTCGAGGGCGGCGGAGAG 3’

[0094] Reverse primer: Hpal-tEGFR

[0095] 5’ GTTACCTCACATGAAGAGGCCGATCCCCAGGGC 3’

[0096] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase):

[0097] - CAR-CD 19z.CD40 cDNA about 100 to 200 nanograms

[0098] Primestar Max Premix (2X) enzyme about 25 microliters

[0099] Forward primer (10 Micromolar) about 1 microliter

[0100] Reverse primer (10 Micromolar) about 1 microliter

[0101] Distilled water, added to the total volume of about 50 microliters

[0102] The optimum conditions for DNA amplification using PCR were:

[0103] Step 1 about 98 degrees Celsius, 30 seconds

[0104] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds

[0105] Step 3 about 72 degrees Celsius, 4 minutes

[0106] An unpurified tEGFR DNA fragment was obtained after completion of PCR.

[0107] 1.4) DNA purification of tEGFR.

[0108] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0109] 1.5) DNA assembly for HpaI-CD19scFV-28TM-CD28-CD3z and tEGFR.

[0110] DNA assembly was performed using the overlap PCR products with NEBuilder® HiFi DNA Assembly Cloning.

[0111] Compositions used for DNA assembly:

[0112] 3 fragments of DNA ratio of 1 : 1 : 1 total amount about 0.03 to 0.2 picomole

[0113] Master Mix enzyme about 10 microliters

[0114] Distilled water, added to the total volume of about 20 microliters

[0115] The mixture was incubated at about 50 degrees Celsius for 30 minutes to 1 hour. The ends of each DNA fragment containing overlapping nucleotide sequence were assembled. After completion of reaction, CAR-CD19z.CD28 containing tEGFR was obtained by joining two DNA fragments together (Figure 2). The complete DNA fragment was then cloned using the PCR to obtain CAR-CD19z.CD28 / tEGFR gene that was ready to be ligated into a plasmid. cDNA of enzyme Hpal (GTTAAC) and pHIV plasmid were added at the beginning of the forward primer. cDNA of Clal (ATCGAT) and pHIV plasmid were added at the end of the reverse primer. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double-stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0116] Primers for DNA fragment synthesis:

[0117] Forward primer: pHIV-HpaI-19scFv

[0118] 5’ GTGAGCGGCCGCTGAGTTAACATGGAGTTTGGG 3’

[0119] Reverse primer: pHIV-Clal-tEGFR

[0120] 5’ GAGGTCGACGGTATCGATTCACATGAAGAGGCC 3’

[0121] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase):

[0122] - CAR-CD19z.CD28 / tEGFR cDNA about 100 to 200 nanograms

[0123] Primestar Max Premix (2X) enzyme about 25 microliters

[0124] Forward primer (10 Micromolar) about 1 microliter

[0125] Reverse primer (10 Micromolar) about 1 microliter

[0126] Distilled water, added to the total volume of about 50 microliters

[0127] The optimum conditions for DNA amplification using PCR were:

[0128] Step 1 about 98 degrees Celsius, 30 seconds

[0129] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds Step 3 about 72 degrees Celsius, 4 minutes

[0130] An unpurified HpaI-CAR-CD19z.CD28 / tEGFR-ClaI gene was obtained after completion of PCR.

[0131] 1.6) DNA purification of Hpal-CAR-CD 19z.CD28 / tEGFR-ClaI.

[0132] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0133] 1.7) The synthesis of DNA fragment 3 (HpaI-CAR-CD19z.CD28).

[0134] HpaI-CAR-CD19z.CD28 / tEGFR-ClaI gene was used as a template for the overlap PCR. cDNA of CD40 was added at the end of the reverse primer. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double- stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0135] Primers for DNA fragment 3 synthesis:

[0136] Forward primer: pHIV-HpaI-19scFv

[0137] 5’ GTGAGCGGCCGCTGAGTTAACATGGAGTTTGGG 3’

[0138] Reverse primer: CD40-CD28

[0139] 5’ CTTTTTCCCTCCGCCGGAGCGATAGGCTGCGAA 3’

[0140] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase): - HpaI-CAR-CD19z.CD28 / tEGFR-ClaI cDNA about 100 to 200 nanograms

[0141] Primestar Max Premix (2X) enzyme about 25 microliters

[0142] Forward primer (10 Micromolar) about 1 microliter

[0143] Reverse primer (10 Micromolar) about 1 microliter

[0144] Distilled water, added to the total volume of about 50 microliters

[0145] The optimum conditions for DNA amplification using PCR were:

[0146] Step 1 about 98 degrees Celsius, 30 seconds

[0147] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds

[0148] Step 3 about 72 degrees Celsius, 4 minutes

[0149] An unpurified HpaI-CAR-CD19z.CD28 DNA fragment was obtained after completion of PCR.

[0150] 1.8) DNA purification of HpaI-CAR-CD19z.CD28.

[0151] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0152] 1.9) The synthesis of DNA fragment 4 (CD3z-tEGFR-ClaI). HpaI-CAR-CD19z.CD28 / tEGFR-ClaI gene was used as a template for the overlap PCR. cDNA of CD40 was added at the beginning of the forward and reverse primers. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which doublestranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0153] Primers for DNA fragment 4 synthesis:

[0154] Forward primer: CD40-CD3z

[0155] 5’ GTGCAGGAGAGACAGAGAGTGAAGTTCAGCAGG 3’

[0156] Reverse primer: pHIV-Clal-tEGFR

[0157] 5’ GAGGTCGACGGTATCGATTCACATGAAGAGGCC 3’

[0158] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase):

[0159] - HpaI-CAR-CD19z.CD28 / tEGFR-ClaI cDNA about 100 to 200 nanograms

[0160] Pnmestar Max Premix (2X) enzyme about 25 microliters

[0161] Forward primer (10 Micromolar) about 1 microliter

[0162] Reverse primer (10 Micromolar) about 1 microliter

[0163] Distilled water, added to the total volume of about 50 microliters

[0164] The optimum conditions for DNA amplification using PCR were:

[0165] Step 1 about 98 degrees Celsius, 30 seconds

[0166] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds Step 3 about 72 degrees Celsius, 4 minutes

[0167] An unpurified CD3z-tEGFR-ClaI DNA fragment was obtained after completion of PCR.

[0168] 1.10) DNA purification of CD3z-tEGFR-ClaI.

[0169] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0170] 1.11) The synthesis of DNA fragment 5 (CD40).

[0171] CAR-CD19z.CD40 gene was used as a template for the overlap PCR. cDNA of CD28 was added at the beginning of the forward primer. cDNA of CD3 zeta was added at the end of the reverse primer. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double-stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0172] Primers for DNA fragment 5 synthesis:

[0173] Forward primer: CD28-CD40

[0174] 5’ GCAGCCTATCGCTCCGGCGGAGGGAAAAAGGTG 3’

[0175] Reverse primer: CD3z-CD40

[0176] 5’ GCTGAACTTCACTCTCTGTCTCTCCTGCACTGA 3’

[0177] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase): CAR-CD19z.CD40 cDNA about 100 to 200 nanograms

[0178] Primestar Max Premix (2X) enzyme about 25 microliters

[0179] Forward primer (10 Micromolar) about 1 microliter

[0180] Reverse primer (10 Micromolar) about 1 microliter

[0181] Distilled water, added to the total volume of about 50 microliters

[0182] The optimum conditions for DNA amplification using PCR were:

[0183] Step 1 about 98 degrees Celsius, 30 seconds

[0184] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds

[0185] Step 3 about 72 degrees Celsius, 4 minutes

[0186] An unpurified CD40 DNA fragment was obtained after completion of PCR.

[0187] 1.12) DNA purification of CD40.

[0188] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1.5 to 2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius.

[0189] 2. DNA assembly for CAR-CD19z.CD28.CD40 by joining DNA fragments 2, 3, and 5, and the synthesis of DNA that is ready to be ligated into a plasmid. 2.1 DNA assembly was performed using the overlap PCR products with NEBuilder® HiFi DNA Assembly Cloning.

[0190] Compositions used for DNA assembly:

[0191] 3 fragments of DNA at ratio of 1:1:1 total amount about 0.03 to 0.2 picomole

[0192] NEBBuilder HiFi DNA Assembly Master Mix about 10 microliters

[0193] Distilled water, added to the total volume of about 20 microliters

[0194] The mixture was incubated at about 50 degrees Celsius for 30 minutes to 1 hour in the PCR machine. The ends of each DNA fragment containing overlapping nucleotide sequence were assembled. After completion of reaction, CAR-CD19z.CD28.CD40 was formed by joining 3 DNA fragments (Figure 2). The complete DNA fragment was then cloned using PCR to obtain HpaI-CAR-CD19z.CD28.CD40-ClaI gene that was ready to be ligated into a plasmid. cDNA of enzyme Hpal (GTTAAC) was added at the beginning of the forward primer. cDNA of Clal (ATCGAT) was added at the end of the reverse primer. To enhance the specificity and ensure effective binding to the target DNA, the primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double-stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0195] Primers for DNA synthesis:

[0196] Forward primer: pHIV-HpaI-19scFv

[0197] 5’ GTGAGCGGCCGCTGAGTTAACATGGAGTTTGGG 3’

[0198] Reverse primer: pHIV-Clal-tEGFR

[0199] 5’ GAGGTCGACGGTATCGATTCACATGAAGAGGCC 3’

[0200] Compositions used for PCR (PrimeSTAR® MAX DNA Polymerase): CAR-CD19z.CD28.CD40 cDNA about 100 to 200 nanograms

[0201] Primestar Max Premix (2X) enzyme about 25 microliters

[0202] Forward primer (10 Micromolar) about 1 microliter

[0203] Reverse primer (10 Micromolar) about 1 microliter

[0204] Distilled water, added to the total volume of about 50 microliters

[0205] The optimum conditions for DNA amplification using PCR were:

[0206] Step 1 about 98 degrees Celsius, 30 seconds

[0207] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 10 seconds

[0208] Step 3 about 72 degrees Celsius, 4 minutes

[0209] An unpurified HpaI-CAR-CD19z.CD28.CD40-ClaI gene was obtained after completion of PCR.

[0210] 2.2 DNA purification of HpaI-CAR-CD19z.CD28.CD40-ClaI.

[0211] The size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 40 minutes. The agarose gel was then analyzed using gel image analysis. DNA was extracted using a DNA extraction kit according to the manufacturer's instructions. After that, the purity and amount of DNA were analyzed by an analyzer. The pure DNA was stored at about -20 degrees Celsius. 3. The ligation of HpaI-CAR-CD19z.CD28.CD40-ClaI gene into the pHIV-EGFP plasmid, and the transformation of the plasmid containing CAR-CD19z.CD28.CD40 gene into the competent Escherichia coli (E. coli).

[0212] HpaI-CAR-CD19z.CD28.CD40-ClaI gene and pHIV-EGFP plasmid containing the specific restriction site were cut by Hpal and Clal, as shown in Figure 2.

[0213] Compositions used for restriction enzyme cutting:

[0214] Chimeric DNA or plasmid about amount 25 microliters

[0215] Hpal enzyme (5,000 unit per milliliter) about amount 1 microliter

[0216] Clal enzyme (10,000 unit per milliliter) about amount 1 microliter

[0217] Buffer about amount 3 microliters

[0218] (Total volume of about 30 microliters)

[0219] The mixture was incubated at about 37 degrees Celsius for at least 16 hours in a water bath. Unpurified CAR-CD19z.CD28.CD40 and pHIV plasmid with restriction enzyme cut were the products after completing the reaction.

[0220] 3.1 Purification of CAR-CD19z.CD28.CD40 and pHIV plasmid after restriction enzyme cutting.

[0221] CAR-CD19z.CD28.CD40 gene and pHIV plasmid, after restriction enzyme cutting, were purified using a purification kit. The amount of CAR-CD19z.CD28.CD40 and pHIV plasmid were measured by an analyzer. The purified CAR-CD19z.CD28.CD40 and pHIV plasmid were then stored at approximately -20 degrees Celsius.

[0222] 3.2 CAR-CD19z.CD28.CD40 ligation into pHIV plasmid.

[0223] The purified CAR-CD19z.CD28.CD40 and pHIV plasmid were ligated using T4 ligase (Figure 2).

[0224] Compositions used for gene ligation: CAR-CD19z.CD28.CD40 and pHIV plasmid in appropriate molar ratio

[0225] T4 ligase enzyme about 1 microliter

[0226] T4 DNA ligase buffer about 1 microliter

[0227] Distilled water, added to the total volume of about 10 microliters

[0228] The mixture was incubated at about 16 degrees Celsius for at least 16 hours in the PCR machine. pHIV plasmid containing CAR-CD19z.CD28.CD40 gene were obtained after completing the reaction.

[0229] 3.3 Transformation and purification of pHIV plasmid containing CAR- CD19z.CD28.CD40 and completion analysis.

[0230] The pHIV plasmid containing CAR-CD19z.CD28.CD40 gene was transferred into NEB 5-alpha competent E. coli. The bacteria were then cultured on petri dish with a medium containing approximately 100 micrograms per milliliters of Ampicillin and incubated at about 37 degrees Celsius for about 16 hours, a condition suitable for the growth of competent E. coli. Then, the presence of plasmid containing CAR- CD19z.CD28.CD40 in competent E. coli was verified by PCR analysis. Both forward and reverse primers were used for verifying the accuracy of CAR-CD19z.CD28.CD40 containing the nucleotide sequence of the plasmid. The primers were designed to be 33 bases long and a GC content of about 50 to 60 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double- stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0231] Primers:

[0232] Forward primer: pHIV-HpaI-19scFv

[0233] 5’ GTGAGCGGCCGCTGAGTTAACATGGAGTTTGGG 3’

[0234] Reverse primer: pHIV-Clal-tEGFR

[0235] 5’ GAGGTCGACGGTATCGATTCACATGAAGAGGCC 3’ Compositions used for PCR:

[0236] E. coli on petri dish about 1 colony

[0237] Primestar Max Premix (2X) enzyme about 10 microliters

[0238] Forward primer (10 Micromolar) about 0.4 microliter

[0239] Reverse primer (10 Micromolar) about 0.4 microliter

[0240] Distilled water, added to the total volume of about 20 microliters

[0241] The optimum conditions for DNA amplification using PCR were:

[0242] Incubate about 98 degrees Celsius, 5 minutes

[0243] Step 1 about 98 degrees Celsius, 30 seconds

[0244] Step 2 (25 to 35 cycles) about 98 degrees Celsius, 10 seconds about 60 to 70 degrees Celsius, 5 to 10 seconds about 72 degrees Celsius, 15 seconds

[0245] Step 3 about 72 degrees Celsius, 4 minutes

[0246] After the completion of PCR, the size of the DNA was analyzed using agarose gel electrophoresis, a technique that separates DNA based on size and charge. Agarose gel was prepared at a concentration of about 1 to 1.2 percent (w / v). Ethidium bromide was added to Tris / Borate / EDTA (TBE) buffer at a concentration of about lx. DNA was separated using an electric current of 120 to 150 volts for about 30 to 35 minutes. Then, the agarose gel was analyzed using gel image analysis. Bacterial colonies containing the correct size of CAR-CD19z.CD28.CD40 could be identified.

[0247] 3.4 The amplification of pHIV plasmid containing CAR-CD19z.CD28.CD40 gene.

[0248] The correct E. coli containing plasmid with CAR-CD19z.CD28.CD40 gene were cultured in a medium containing approximately 100 micrograms per milliliters of Ampicillin and incubated in a shaking incubator for about 16 hours. The purification of pHIV plasmid containing the CAR-CD19z.CD28.CD40 gene was performed according to the extraction kit manual. The amount and purity of plasmid were measured by an analyzer. The plasmid was stored at about -20 degrees Celsius.

[0249] The accuracy and completeness of the CAR-CD19z.CD28.CD40 gene were confirmed by DNA sequencing using three primers. The primers were designed to be 33 bases long, with a GC content of about 50 to 80 percent of the entire strand. The melting temperature (Tm), which indicates the temperature at which double- stranded DNA separates into single strands, was optimized to fall between 70 to 80 degrees Celsius.

[0250] The primers used for verifying the accuracy and completeness of CAR- CD19z.CD28.CD40 gene were:

[0251] Forward primer: pHIV-HpaI-19scFv

[0252] 5’ GTGAGCGGCCGCTGAGTTAACATGGAGTTTGGG 3’

[0253] Reverse primer: tEGFR-CD3z

[0254] 5’ TCCGCCGCCCTCGAGGCGAGGGGGCAGGGCCTG 3’

[0255] Reverse primer: pHIV-Clal-tEGFR

[0256] 5’ GAGGTCGACGGTATCGATTCACATGAAGAGGCC 3’

[0257] The whole plasmid containing the correct CAR-CD19z.CD28.CD40 gene was confirmed. The plasmid was stored at about -20 degrees Celsius.

[0258] Viral vector containing CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain

[0259] Viral vector containing CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain comprises: a. a vector comprises at least a part of a lentivirus; and b. the CD19-specific chimeric antigen receptor comprising a CD28 / CD40 costimulatory domain comprises the amino acid as shown in SEQ ID NO: 19; wherein the chimeric antigen receptor was transferred into the vector.

[0260] HIV plasmid containing CAR-CD19z.CD28.CD40 gene was transfected into the HEK293T cell line to produce lentiviral particles. Transfection was performed using lipid - base transfection (liposome) by endocytosis. The details will be explained below:

[0261] Day 0

[0262] HEK293T cells were cultured in the cell culture vessel containing medium with fetal bovine serum and penicillin- streptomycin at about 37 degrees Celsius in a carbon dioxide incubator for about 1 day.

[0263] Day 1

[0264] The transfection of pHIV-CAR-CD19z.CD28.CD40 was performed according to the transfection kit manual. The third-generation lentivirus plasmids, pMDLg / pRRE pRev and pMD2.G, were used as packaging virus. Then, the transfected HEK293T cells were cultured at about 37 degrees Celsius in a carbon dioxide incubator for about 1 day.

[0265] Day 2

[0266] The cell culture medium from day 1 was collected and centrifuged at high speed to increase the concentration of lentiviral particles, then stored in a refrigerator at about 4 degrees Celsius.

[0267] The medium was added in the cell culture vessel of transfected HEK293T containing pHIV-CAR-CD19z.CD28.CD40 plasmid. Then, cells were cultured at about 37 degrees Celsius in a carbon dioxide incubator for about 1 day.

[0268] Day 3

[0269] The cell culture medium from day 2 was collected and mixed with the collected virus from day 1. Then, the mixture was centrifuged at high speed to increase the concentration of lentiviral particles. The virus was collected by filtering and stored at about -80 degrees Celsius.

[0270] The lentiviral titer was analyzed. The virus was transfected into the SUPT1 cell line using standard transfection method. The expression of tEGFR was used as a marker for gene transfer.

[0271] At this step, lentiviral particles (viral vector) containing CAR-CD19z.CD28.CD40 was obtained, and the lentiviral titer was determined.

[0272] T cells expressing CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain (CAR-CD19z.CD28.CD40 T cells)

[0273] T cells expressing CD 19- specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain comprises: a. T cells; and b. the CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co- stimulatory domain; wherein the CD19-specific chimeric antigen receptor comprising a CD28 / CD40 co-stimulatory domain is transferred into cells to express CAR-CD19z.CD28.CD40 on the cell surface.

[0274] In particular, the chimeric antigen receptor gene comprises the amino acid as shown in SEQ ID NO: 19.

[0275] The details of the generation of CAR-CD19z.CD28.CD40 T cells are as follows.

[0276] The generation of CAR-CD19z.CD28.CD40 T cells from healthy donors using lentiviral-mediated gene transfer via viral vector.

[0277] Day 0

[0278] The peripheral blood mononuclear cells (PBMC) were isolated from healthy donors' blood. CD3 cells were isolated from PBMC by human CD3 MicroBeads via magnetic columns. Then, the CD3 cells were activated by Dynabeads Human T-Activator

[0279] CD3 / CD28. The details are as follows:

[0280] PBMC were centrifuged using density gradient centrifugation at approximately 1,500 RPM, at about 25 degrees Celsius for about 30 minutes. The buffy coat or PBMC layer was then isolated by pipetting and washed with phosphate buffer saline (PBS). Centrifugation was performed for two more rounds to remove platelets. PBMC were measured by counting with Turk solution at a ratio of about 1:1.

[0281] CD3 cells were isolated from PBMC using human CD3 microbeads antibody and Magnetic Activated Cell Sorting (MACS) buffer. The CD3 cells were incubated at about 4 degrees Celsius for about 15 minutes, then washed with MACS buffer. The centrifugation at about 300 g, at 4 degrees Celsius for about 10 minutes was performed. The Stained CD3 cells were then isolated with magnetic beads. The CD3 cells were measured by counting with trypan blue staining.

[0282] The CD3 cells were activated by antibody CD3 / CD28 microbeads at a ratio of about 1:1, then cultured with IL-2. Cells were incubated at about 37 degrees Celsius in a carbon dioxide incubator for 1 day.

[0283] Day 1

[0284] The activated CD3 cells were transduced with a multiplicity of infection (MOI) about 10 of lentiviral particles containing CAR-CD19z.CD28.CD40 gene using spinoculation. Polybrene was added to facilitate transduction. The CD3 cells were placed in a suitable cell culture vessel with IL-2. The vessel was centrifuged until cells and viral vectors settled at the bottom of the vessel. The centrifugation was performed at about 2,100 RPM, 32 degrees Celsius for 45 minutes. The cells were then incubated at about 37 degrees Celsius in a carbon dioxide incubator for about 2 days.

[0285] Day 3 The medium was replaced with IL-2 every 2 to 3 days, using an appropriate amount based on the increasing number of cells or when color of the cell culture medium changed. The cells were incubated at about 37 degrees Celsius in a carbon dioxide incubator for 4 to 5 days.

[0286] Days 7 to 8

[0287] The efficacy of transduction was measured. Cells expressing CAR- CD19z.CD28.CD40 on the cell surface were isolated using tEGFR marker. Both CAR- CD19z.CD28.CD40 and tEGFR were expressed on the cell surface at a ratio of approximately 1:1. Cells were stained with anti-human EGFR-biotinylated antibody in MACS buffer and incubated at approximately 4 degrees Celsius for about 15 minutes. The cells were then washed with MACS buffer and re-stained with biotin microbeads antibody in the appropriate amount according to the kit manual. The cells were incubated at about 4 degrees Celsius for 15 minutes, then washed with MACS buffer and centrifuged at about 300 g, 4 degrees Celsius for 10 minutes.

[0288] The number of isolated CAR-CD19z.CD28.CD40 T cells were measured. Cells were cultured at about 37 degrees Celsius in a carbon dioxide incubator or stored at about -80 degrees Celsius with cryopreservative medium for about 1 day, then transferred to a nitrogen tank at about -196 degrees Celsius.

[0289] The efficacy of transduction and cells selection by flow cytometry are shown in figure 3.

[0290] Figure 3 shows the results of transduction of CAR-CD19z.CD28 and CAR- CD19z.CD28.CD40 by measuring the percentage of tEGFR expression. The results indicate no significant difference in tEGFR expression between the two groups, suggesting that the transduction of both CAR-CD19z.CD28 and CAR-CD19z.CD28.CD40 was effective.

[0291] The present invention involves developing cell therapy using a lentivirus pHIV plasmid containing CAR-CD19. This therapy aims to treat patients with leukemia and B- cell lymphoma. The plasmid contains the end for bind single chain variable fragment CD 19 (CD19scFv) that connects with the hinge domain (CH3 of IgG2) and stimulatory domain (CAR-CD19z.CD28.CD40). The plasmid containing CAR-CD19z.CD28.CD40 gene was then transfected into a cell line to generate viral vector. The viral vector was used for generating genetically modified T cells. To generate modified T cells, T cells were isolated from donors’ blood and activated. CAR-CD19z.CD28.CD40 gene was then transduced into T cells by viral vector and then T cells expressing CAR-CD19z.CD28.CD40 on the cell surface were obtained.

[0292] The efficacy of transduction and the efficacy of eliminating cancer cells expressing CD 19 antigen were measured.

[0293] In vitro assay for efficacy testing of CAR-CD19z.CD28.CD40 T cells using immunological testing

[0294] 1. The proliferation of CAR-CD19z.CD28.CD40 T cells was measured after stimulation with cancer cells expressing CD 19 antigen.

[0295] CAR-CD19z.CD28.CD40 T cells were cultured with about 100 gray of gamma irradiated Burkitt lymphoma cell line (Raji cells) expressing CD19 antigen at a ratio of about 1:1. Raji cells were irradiated to stop cell division. The cells were cultured in the medium with or without IL-2. The cells were incubated at about 37 degrees Celsius in a carbon dioxide incubator for about 11 days. The number of cells was measured on days 3, 5, 7, 9 and 11 by staining dead cells with trypan blue. The program cell death- 1 (PD-1) staining was performed to study the T cell exhaustion after the completion of the experiment. The results of the experimental study (CAR-CD19z.CD28 T cells) were compared with the control group (untransduced T cells), which was produced and cultured in the same way as CAR-CD19z.CD28.CD40 T cells as shown in Figures 4 to 6.

[0296] Figures 4 and 5 show the proliferation of T cells in each group after stimulation with the Burkitt lymphoma cell line (Raji cells) in the medium with or without IL-2. The results show that CAR-CD19z.CD28.CD40 T cells proliferated more than the other two control groups, regardless of the medium with or without IL-2.

[0297] Figure 6 shows the percentage of PD-1 positive cells. The results show that, both before and after stimulation with Raji cells, the percentage of cells expressing PD-1 in CAR-CD19z.CD28.CD40 T cells was lower than that in CAR-CD19z.CD28 T cells, especially in the medium without IL-2.

[0298] 2. Efficacy testing of CAR-CD19z.CD28.CD40 T cells in eliminating cancer cells expressing the CD19 antigen using long-term co-culture assay.

[0299] CAR-CD19z.CD28.CD40 T cells were cultured with Raji cells expressing CD19 antigen at ratio of T cells:Raji cells of about 1:1, 1:5, and 1:10 in a medium without IL-2. The cells were incubated at about 37 degrees Celsius in a carbon dioxide incubator for about 12 days. The number of residual Raji cells was analyzed by flow cytometry at intervals until the end of the experiment. The results of the experimental group (CAR- CD19z.CD28 T cells) were compared with the control group (untransduced T cells), which were produced and cultured in the same manner as CAR-CD19z.CD28.CD40 T cells, as shown in Figure 7.

[0300] Figure 7 shows the number of residual Raji cells after co-cultured with CAR- CD19z.CD28.CD40 T cells at different cell ratios. On day 3 to 7, after co-cultured with CAR-CD19z.CD28.CD40 T cells, Raji cells had decreased, especially at a ratio of T cells: Raji cells of about 1:10. The results indicate that CAR-CD19z.CD28.CD40 T cells can significantly reduce cancer cells compared with other T cells.

[0301] 3. Efficacy testing of proliferation and expression of PD-1 in CAR- CD19z.CD28.CD40 T cells using repetitive antigen stimulation assay.

[0302] CAR-CD19z.CD28.CD40 T cells were cultured with about 100 gray of gamma irradiated Raji cells expressing CD19 antigen at a ratio of about 1:1. Raji cells were irradiated to stop cell division. CAR-CD19z.CD28.CD40 T cells were stimulated with Raji cells every 7 days for 2 times. The cells were cultured at about 37 degrees Celsius in a carbon dioxide incubator.

[0303] The number of cells was measured using staining dead cells with trypan blue on days 3, 5, and 7 of each stimulation cycle. The program cell death- 1 (PD-1) staining was performed to study the T cell exhaustion on days 0, 7, and 14 by flow cytometry. The results of the experimental group (CAR-CD19z.CD28 T cells) were compared with the control group (untransduced T cells), which were produced and cultured in the same manner as CAR-CD19z.CD28.CD40 T cells, as shown in Figures 8 and 9.

[0304] Figure 8 shows the proliferation of T cells after re- stimulation with Raji cells. The results show that CAR-CD19z.CD28.CD40 T cells have the highest proliferation rate compared to the other two control groups of T cells.

[0305] Figure 9 shows the percentage of PD-1 positive cells after re-stimulation with Raji cells. The results show that the expression of PD-1 in CAR-CD19z.CD28.CD40 T cells according to the present invention was less than that in the CAR-CD19z.CD28 T cells.

[0306] In vivo assay for efficacy study of CAR-CD19z.CD28.CD40 T cells using immunological testing

[0307] Efficacy testing of CAR-CD19z.CD28.CD40 T cells was performed in 6- to 8- week-old male NOD-scid common-gamma chain knockout (NSG) mice. Mice were tail vein injected with about 0.5 x 106Raji cells expressing CD19 antigen. Additionally, Raji cells were modified to express the firefly luciferase (ffluc) as a tracking marker. One week later, mice were injected via the tail vein with approximately 1 x 106untransduced T cells or CAR-CD19z.CD28.CD40 T cells. The number of cancer cells was measured weekly using bioluminescence imaging (BLI) with an animal imaging machine (IVIS Spectrum System, Caliper Life Science). Mortality was recorded weekly until day 60. The results are shown in Figures 10 to 13.

[0308] Figure 10 shows the efficacy of CAR-CD19z.CD28.CD40 T cells against Raji cells expressing the CD19 antigen. BLI was examined to monitor the number of cancer cells in mice. The results indicate that CAR-CD19z.CD28 T cells were more effective in reducing cancer cells compared to the other groups.

[0309] Figure 11 shows the body mass of the mice. The results show that mice treated with CAR-CD19z.CD28.CD40 T cells had a more stable weight than the other control groups.

[0310] Figure 12 shows the mean value of fluorescent cancer cells per volume area. The results show that mice treated with CAR-CD19z.CD28.CD40 T cells had a significant reduction in cancer cells by day 21 post-injection compared to the control group. Figure 13 shows the survival rate of mice. The results indicate that mice treated with CAR-CD19z.CD28.CD40 T cells had a longer survival rate than those in the control group.

[0311] Pharmaceutical composition for use in the treatment of cancers expressing CD19 antigen on the cell surface

[0312] A pharmaceutical composition for use in the treatment of cancers expressing CD19 antigen on the cell surface comprises: a. a plurality of T cells expressing a chimeric antigen receptor; and b. a pharmaceutically acceptable carrier for T cells expressing a chimeric antigen receptor; wherein the T cells expressing a chimeric antigen receptor are chemically combined with the carrier to enhance the suppression of cancer cells expressing CD19 antigen on the cell surface.

[0313] Based on the cancer cell elimination efficacy of CAR-CD19z.CD28.CD40 T cells against the above-mentioned cancer cells expressing CD19 antigen, the specific T cells according to the present invention have the potential to be used in the treatment of cancers expressing CD19 antigen on the cell surface. In particular, they may be applied in the form of pharmaceutical compositions, such as for downregulating PD-1 expression and / or for the treatment of cancers expressing CD 19 antigen on the cell surface, especially in leukemia and lymphoma.

[0314] BEST MODE OF THE INVENTION

[0315] Best mode of the invention is as provided in the description of the invention.

Claims

CLAIMS1. A CD 19-specific chimeric antigen receptor comprises the amino acid as shown in SEQ ID NO: 19.

2. The CD19-specific chimeric antigen receptor according to claim 1, wherein the said receptor comprises: a. an extracellular domain; b. an intracellular signaling domain; and c. the hinge and transmembrane domain that connects between the extracellular domain and intracellular signaling domain.

3. The CD19-specific chimeric antigen receptor according to claim 2, wherein the intracellular signaling domain comprises a CD28 / CD40 co- stimulatory domain and a CD3 zeta (CD3z) signaling domain that is located after CD40.

4. The CD 19- specific chimeric antigen receptor according to claim 3, wherein the CD28 / CD40 co- stimulatory domain comprises the amino acid as shown in SEQ ID NO:17.

5. The CD 19-specific chimeric antigen receptor according to claim 2, wherein the hinge domain comprises the amino acid as shown in SEQ ID NO:8.

6. T cell expressing CD19-specific chimeric antigen receptor, wherein T cell comprises the CD 19-specific chimeric antigen receptor according to claim 1.

7. The use of T cell expressing CD19-specific chimeric antigen receptor according to claim 6 for the manufacture of the pharmaceutical compositions for the treatment of cancers expressing CD 19 antigen on the cell surface.

8. Viral vector expressing CD19-specific chimeric antigen receptor according to claim 1, wherein the viral vector comprises: a. a vector containing at least a part of lentivirus; and b. the CD 19- specific chimeric antigen receptor.

Images