Methods and materials for treating prostate cancer

By targeting the poly(A) site in CE3 to regulate AR polypeptide splicing, the method addresses CRPC resistance by reducing AR-Vs and increasing full-length AR expression, offering a treatment for CRPC.

WO2025171083A1PCT designated stage Publication Date: 2025-08-14REGENTS OF THE UNIVERSITY OF MINNESOTA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/014712
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-08
Filing Date
2025-02-06
Publication Date
2025-08-14

AI Technical Summary

Technical Problem

Metastatic prostate cancer develops resistance to androgen deprivation therapies (ADTs), leading to castration-resistant prostate cancer (CRPC), which is responsible for the majority of prostate cancer-specific deaths due to the expression of AR variant polypeptides that function as ligand-independent, constitutively active transcription factors.

Method used

Regulating the splicing of nucleic acids encoding AR polypeptides by targeting a poly(A) site in cryptic exon 3 (CE3) using agents such as anti-sense oligonucleotides to control the expression of AR polypeptides, reducing AR-Vs and increasing full-length AR polypeptides, thereby restoring androgen sensitivity.

Benefits of technology

The method effectively reduces AR-V expression and increases the expression of full-length AR polypeptides, potentially restoring androgen sensitivity in CRPC, providing a treatment approach for CRPC.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025014712_14082025_PF_FP_ABST
    Figure US2025014712_14082025_PF_FP_ABST
Patent Text Reader

Abstract

This document provides methods and materials for treating cancer (e.g., prostate cancer). For example, methods for using one or more agents that can regulate splicing of a nucleic acid (e.g., a precursor-messenger ribonucleic acid (pre-mRNA)) encoding one or more androgen receptor (AR) polypeptides to treat a mammal having prostate cancer (e.g., castration-resistant prostate cancer (CRPC)) are provided.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND MATERIALS FOR TREATING PROSTATE CANCER

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 551,301, filed February 8, 2024. The disclosure of the foregoing applications is hereby incorporated by reference in their entirety.

[0004] STATEMENT REGARDING FEDERAL FUNDING

[0005] This invention was made with government support under W81XWH2010402 awarded by the U.S. Department of Defense. The government has certain rights in the invention.

[0006] SEQUENCE LISTING

[0007] This application contains a Sequence Listing that has been submitted electronically as an XML file named “09531-055 lW01_SL.xml.” The XML file, created on January 23, 2025, is 6,957 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0008] TECHNICAL FIELD

[0009] This document relates to methods and materials for treating cancer (e.g., prostate cancer). For example, this document provides agents that can regulate splicing of a nucleic acid (e.g., a precursor-messenger ribonucleic acid (pre-mRNA)) encoding one or more androgen receptor (AR) polypeptides. For example, this document provides methods for using one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) that can encode one or more AR polypeptides to treat a mammal having prostate cancer (e.g., castration -resistant prostate cancer (CRPC)).

[0010] Background

[0011] Prostate cancer is the second leading cause of male cancer death in the United States. While localized disease can be cured by radiation or surgery, metastatic prostate cancer presents a clinical challenge. Metastatic prostate cancer can initially be controlled by endocrine therapies that target the androgen receptor (AR) polypeptide, also referred to as androgen deprivation therapies (ADTs). However, metastatic prostate tumors will inevitably develop resistance to ADTs and advance to CRPC, which is responsible for the majority of prostate cancer-specific deaths. AR variant (AR-V) polypeptides are broadly enriched in CRPC models and patient samples, and can function as ligand-independent, constitutively active transcription factors.

[0012] Summary

[0013] A single polyadenylation (poly(A)) site in cryptic exon 3 (CE3) present in intron 3 of a nucleic acid (e g., a pre-mRNA) that can encode one or more AR polypeptides can be used to regulate splicing such that the nucleic acid can encode one or more different AR polypeptides (e.g., wild-type AR polypeptides and / or variant AR polypeptides). In some cases, a nucleic acid (e.g., a pre-mRNA) that can encode one or more AR polypeptides can encode an AR polypeptide comprising an AR ligand binding domain (LBD; e.g., a full-length AR polypeptide). In some cases, a nucleic acid (e.g., a pre- mRNA) that can encode one or more AR polypeptides can encode an AR-V polypeptide (e.g., an AR polypeptide that lacks an AR LBD such as an AR-V7 polypeptide).

[0014] This document provides methods and materials for treating cancer (e.g., prostate cancer) that are based, at least in part, on the discovery that a nucleic acid sequence located downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) that can encode one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can regulate splicing, and can be targeted to control expression of the nucleic acid capable of encoding one or more AR polypeptides. In some cases, this document provides one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides. For example, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can target (e.g., target and bind to) a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides), thereby controlling which AR polypeptides are encoded and expressed. In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal having prostate cancer (e.g., CRPC) to treat the mammal. In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal having prostate cancer (e.g., CRPC) to restore androgen sensitivity to the prostate cancer.

[0015] As described herein, nucleic acid molecules (e.g., anti-sense oligonucleotides such as morpholinos) that target (e.g., target and bind to) a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can reduce or eliminate non-canonical splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). For example, nucleic acid molecules that target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can reduce or eliminate expression of one or more AR-V polypeptides from that nucleic acid that is capable of encoding one or more AR polypeptides. For example, nucleic acid molecules that target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can increase expression of one or more AR polypeptides containing an AR LBD (e.g., a full-length AR polypeptide) from that nucleic acid that is capable of encoding one or more AR polypeptides.

[0016] In general, one aspect of this document features agents that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent includes a nucleic acid molecule having a nucleic acid sequence as set forth in SEQ ID NO:5, where the nucleic acid molecule includes at least one modified nucleotide. The nucleic acid molecule can be from about 6 nucleotides to about 45 nucleotides in length. The nucleic acid molecule can be 22 to 30 nucleotides in length. The nucleic acid molecule can be 25 or 26 nucleotides in length. The nucleic acid molecule can include the nucleic acid sequence set forth in SEQ ID NO:2. The nucleic acid molecule can include the sequence set forth in SEQ ID NO:3. The nucleic acid molecule can include the sequence set forth in SEQ ID NO:4. The agent can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide. The at least one modified nucleotide can include a morpholine ring. At least two consecutive nucleotides present in the nucleic acid molecule can be linked by a phosphorodiamidate linkage. The agent can be a morpholino. The agent can reduce expression of an AR-V that lacks an androgen receptor ligand binding domain. The AR-V can be AR-V2, ARVS, AR-V7, or AR-V9. The agent can inhibit expression of AR-V7. The agent can be effective to increase expression of an AR polypeptide including an AR ligand binding domain.

[0017] In another aspect, this document features agents that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent includes a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide, and where the agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain. The one or more AR- Vs that lack an androgen receptor ligand binding domain can be AR-V2, AR-V5, AR-V7, and / or AR-V9. The agent can inhibit expression of AR-V7. The agent can be effective to increase expression of an AR polypeptide including an AR ligand binding domain. The nucleic acid sequence downstream of the poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide can include the sequence set forth in SEQ ID NO: 1. The nucleic acid molecule can be from about 6 nucleotides to about 45 nucleotides in length. The nucleic acid molecule can be 22 to 30 nucleotides in length. The nucleic acid molecule can be 25 or 26 nucleotides in length. The nucleic acid molecule can include the nucleic acid sequence set forth in SEQ ID NO:2. The nucleic acid molecule can include the nucleic acid sequence set forth in SEQ ID N0:3. The nucleic acid molecule can include the nucleic acid sequence set forth in SEQ ID NO:4. The at least one modified nucleotide can include a morpholine ring. At least two consecutive nucleotides present in the nucleic acid molecule can be linked by a phosphorodiamidate linkage. The agent can be a morpholino.

[0018] In another aspect, this document features methods for restoring androgen sensitivity to a CRPC within a mammal. The methods can include, or consist essentially of, administering to a mammal having a CRPC an agent that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent: (a) includes a nucleic acid molecule having a nucleic acid sequence as set forth in SEQ ID NO:5, where the nucleic acid molecule including at least one modified nucleotide; and / or (b) includes a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide, and where the agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain. The mammal is a human. The mammal can be a male mammal. The method can include administering a cancer treatment to the mammal. The cancer treatment can include an ADT.

[0019] In another aspect, this document features methods for restoring androgen sensitivity to a CRPC in a mammal. The methods can include, or consist essentially of, administering to a mammal identified as having a CRPC having cancer cells expressing one or more androgen receptor variants (AR-Vs) an agent that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent: (a) includes a nucleic acid molecule having a nucleic acid sequence as set forth in SEQ ID NO:5, where the nucleic acid molecule including at least one modified nucleotide; and / or (b) includes a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide, and where the agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain. The mammal is a human. The mammal can be a male mammal. The method can include administering a cancer treatment to the mammal. The cancer treatment can include an ADT. In another aspect, this document features methods for restoring androgen sensitivity to a CRPC in a mammal. The methods can include, or consist essentially of, determining that a CRPC within a mammal includes cancer cells that express an AR-V; and administering to the mammal an agent that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent: (a) includes a nucleic acid molecule having a nucleic acid sequence as set forth in SEQ ID NO: 5, where the nucleic acid molecule including at least one modified nucleotide; and / or (b) includes a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide, and where the agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain. The mammal is a human. The mammal can be a male mammal. The method can include administering a cancer treatment to the mammal. The cancer treatment can include an ADT.

[0020] In another aspect, this document features methods for treating a mammal having a CRPC. The methods can include, or consist essentially of, administering to a mammal having a CRPC (a) an agent that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, where the agent: (i) includes a nucleic acid molecule having a nucleic acid sequence as set forth in SEQ ID NO:5, where the nucleic acid molecule including at least one modified nucleotide; and / or (ii) includes a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of the pre-mRNA capable of encoding the AR polypeptide, and where the agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain, and (b) an androgen deprivation therapy. The mammal can be a human. The mammal can be a male mammal. The method also can include subjecting the mammal to a cancer treatment selected from the group consisting of surgery, chemotherapy, radiation therapy, immunotherapy, and targeted therapy.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0022] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0023] BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figures 1A - 1C: Molecular effects of targeting the poly(A) site and flanking nucleic acid sequence in intron 3 oiAR in CPRC cells. Figure 1A) 14 antisense oligomers (ASOs) with partially overlapping sequences were designed to target a 250 nucleotide (nt) region of AR pre-mRNA (SEQ ID NO:6) spanning 100-nt upstream to 150-nt downstream of the poly(A) site. Bolded sequences denote elements driving AR-V expression, starred sequences denote elements repressing AR-V expression. Figure IB) Western blot analysis of 22Rvl cells treated with denoted ASOs using a pan AR antibody to detect full-length AR (FL-AR) and truncated AR-variants (AR-Vs). Tubulin was used as a loading control. Figure 1C) RT-qPCR of FL-AR mRNA (top) and AR-V7 mRNA (bottom) in 22Rvl cells treated with denoted ASOs.

[0025] Figures 2A and 2B: RNA-IP of the CPSF complex and CSTF2 to oligonucleotides including the poly(A) site in AR CE3 or including a mutated poly(A) site. Figure 2A) Illustration of the CFIIm, CFIm, CPSF, and CstF complexes interacting with pre-mRNA. Bolded factors were analyzed in (Figure 2B). Figure 2B) RNA-IP using a 60-nt biotinylated RNA oligomer representing the poly(A) site and flanking sequence in exon CE3 of AR or a 60-nt biotinylated RNA oligomer containing a mutated poly(A) site with the flanking sequence from AR exon CE3 remains unchanged. Binding of each factor of the CPSF complex as well as the CstF complex factor CSTF2 was detected by western blot. FT = flowthrough, EL = elution, MUT = mutated, USE = upstream sequence elements, DSE = downstream sequence elements. Figures 3 A-3C: Blocking AR mRNA polyadenylation. Figure 3 A) Design of antisense PMOs along a region of an J / ? pre-mRNA (SEQ ID NO:7). Figures 3B-3C) Western blot and RT-PCR analysis of AR and AR-V levels in cell lines transfected with PMOs shown in (Figure 3A). Tubulin is a loading control.

[0026] Detailed Description

[0027] This document provides methods and materials for treating cancer (e.g., prostate cancer). In some cases, this document provides one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can be a nucleic acid molecule that can target (e.g., target and bind to) a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides.

[0028] In some cases, one or more (e.g., one, two, three, four, or more) agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can be used to restore androgen sensitivity to a cancer (e.g., prostate cancer). For example, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC) to restore androgen sensitivity to that cancer.

[0029] A poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can have the nucleic acid sequence AAUAAA. A portion of an exemplary nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) and containing a poly(A) site present in CE3 is shown in Figure 1A.

[0030] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can reduce or eliminate expression of one or more AR-V polypeptides. For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can target (e.g., target and bind to) a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) to reduce or eliminate expression of one or more AR-V polypeptides from that nucleic acid. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can reduce or eliminate expression of an AR-V polypeptide that lacks an AR LBD. Examples of AR-V polypeptides that can be encoded by a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) and whose expression can be reduced or eliminated by one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein include, without limitation, AR-V1 polypeptides, AR-V2 polypeptides, AR-V3 polypeptides, AR-V4 polypeptides, AR-V5 polypeptides, AR-V6 polypeptides, AR-V7 polypeptides, AR-V8 polypeptides, AR-V9 polypeptides, AR-V10 polypeptides, AR-V 11 polypeptides, AR- VI 2 polypeptides, AR-V13 polypeptides, AR- V14 polypeptides, AR-V15 polypeptides, AR-V16 polypeptides, and AR-V18 polypeptides. In some cases, the methods and materials described herein can be effective to reduce expression of one or more AR-V polypeptides in a mammal having cancer (e.g., prostate cancer such as CRPC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the methods and materials described herein can be effective to eliminate expression of one or more AR-V polypeptides in a mammal having cancer (e g., prostate cancer such as CRPC).

[0031] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can increase expression of one or more AR polypeptides that contain an AR LBD (e.g., a full-length AR polypeptide). In some cases, an AR polypeptide that contains an AR LBD can be a full-length AR polypeptide. Examples of AR polypeptides that include an AR LBD include, without limitation, those polypeptides set forth in HUGO gene nomenclature committed (HGNC) ID: 644, National Center for Biotechnology Information (NCBI) Gene ID: 367; Ensembl ID: ENSG00000169083; Online Mendelian Inheritance in Man (OMIM) No: 313700; and UniProtKB (Swiss-Prot) Accession No: P10275. In some cases, the methods and materials described herein can be effective to increase expression of one or more AR polypeptides that contains an AR LBD (e.g., a full-length AR polypeptide) in a mammal having cancer (e.g., prostate cancer such as CRPC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0032] An agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can target any appropriate site. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can target (e.g., target and bind) a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). A nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can be any distance downstream of the poly(A) site present in CE3 of a nucleic acid capable of encoding one or more AR polypeptides. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can target a nucleic acid sequence that is from about 1 nucleotide to about 45 nucleotides downstream of a poly(A) site present in CE3 of a nucleic acid capable of encoding one or more AR polypeptides. A portion of an exemplary nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid capable of encoding one or more AR polypeptides is shown in Figure 1 A. For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can target (e.g., target and bind to) any portion of SEQ ID NO: 1 set forth below, provided that it maintains its basic ability to reduce or eliminate expression of one or more AR-V polypeptides and / or increase expression of one or more AR polypeptides that contain an AR LBD (e.g., a full-length AR polypeptide).

[0033] GCCAUUJ\AUACACCAAUCGUAUUUUCUUAUUUAC7\ACAGACUGA (SEQ ID NO: 1)

[0034] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein does not target a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein does not target the nucleic acid sequence AAUAAA present in CE3 of a nucleic acid capable of encoding one or more AR polypeptides.

[0035] An agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can be any appropriate type of molecule. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be a nucleic acid molecule. Examples of molecules that can be used as an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein include, without limitation, antisense oligonucleotides, nucleic acid molecules designed to induce RNA interference (e.g., a siRNA molecule or a shRNA molecule), and miRNAs.

[0036] When an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) is a nucleic acid molecule, the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be any appropriate length (e.g., can include any appropriate number of nucleotides). In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be from about 6 nucleotides to about 45 nucleotides in length.

[0037] When an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID N0:2, SEQ ID N0:3, or SEQ ID NO:4) is a nucleic acid molecule, the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can have any appropriate nucleic acid sequence. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can have a nucleic acid sequence that is complementary to at least a portion of a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid capable of encoding one or more AR polypeptides. For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can have a nucleic acid sequence that is complementary to at least a portion of SEQ ID NO: 1. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be as shown in Figure 1A. In some cases, an agent that can regulate splicing of a nucleic acid (e g., a pre-mRNA) capable of encoding one or more AR polypeptides can comprise, consist essentially of, or consist of the nucleic acid sequences set forth in Table 1.

[0038] Table 1. Exemplary agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides.

[0039] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides can be 100% complementary to at least a portion of SEQ ID NO: 1.

[0040] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides can be at least 85% (e.g., at least 88%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) complementary to at least a portion of SEQ ID NO: 1, provided that the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides maintains its basic ability to reduce or eliminate expression of one or more AR-V polypeptides and / or increase expression of one or more AR polypeptides that contain an AR LBD (e.g., a full-length AR polypeptide).

[0041] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can have one or more (e.g., one, two, three, four, or more) nucleotide substitutions, one or more (e.g., one, two, three, four, or more) additional 5' nucleotides, and / or one or more (e g., one, two, three, four, or more) additional 3' nucleotides relative to any one of SEQ ID NOs: 2-5, provided that the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) that can encode one or more AR polypeptides maintains its basic ability to reduce or eliminate expression of one or more AR-V polypeptides and / or increase expression of one or more AR polypeptides that contain an AR LBD (e.g., a full-length AR polypeptide).

[0042] In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can have at least 85% percent sequence identity (e.g., at least 87%, at least 90%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 2-5, provided that the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides maintains its basic ability to reduce or eliminate expression of one or more AR-V polypeptides and / or increase expression of one or more AR polypeptides that contain an AR LBD (e.g., a full-length AR polypeptide). Additional agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be readily designed based upon nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). Examples of nucleic acids (e.g., pre-mRNAs) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) include, without limitation, the human AR-V sequences set forth in NCBI Accession No. AH002607 (see, e g., Version AH002607.1 and Version AH002607.2).

[0043] When an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) is a nucleic acid molecule, the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can include one or more (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) modified nucleotides. A nucleotide can be modified for any appropriate purpose including, for example, increased stability and / or detection. A modification in a nucleotide present in an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be in any appropriate component of the nucleotide (e.g., the backbone, the sugar, and the nucleobase). In some cases, a modified nucleotide can be a nucleic acid analog. Examples of modified nucleotides that can be present in an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein include, without limitation, nucleotides containing morpholine rings, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), glycol nucleic acids (GNAs), threose nucleic acids (TNAs), nucleotides containing allylamine, nucleotides containing biotin, nucleotides containing fluorescein, nucleotides containing- methyl dideoxynucleotides, and / or nucleotides containing 2'-O-(2-methoxyethyl) (MOE)- modified bases.

[0044] When an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) is a nucleic acid molecule, the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can include one or more e (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) modified linkages where a modified linkage is present between two nucleotides (e.g., two consecutive nucleotides) present in the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides. Examples of modified linkages that can be present between two nucleotides of an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein include, without limitation, phosphorodiamidate linkages, and / or phosphorothioate linkages. In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be a morpholino (e.g., a nucleic acid molecule having one or more nucleotides containing one or more morpholine rings and / or having one or more consecutive nucleotides that are linked by a phosphorodiamidate linkage).

[0045] An agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) also can include one or more additional molecules. For example, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can include one or more molecules that can facilitate cellular uptake and / or monitoring of the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides. Molecules that facilitate cellular uptake and / or monitoring can be nucleic acid sequences or polypeptide sequences. Molecules that facilitate cellular uptake and / or monitoring can be included by any appropriate manner. For example, when a molecule that facilitates cellular uptake and / or monitoring is a nucleic acid sequence, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can include a nucleic acid sequence that facilitates cellular uptake and / or monitoring of the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides. For example, when a molecule that facilitates cellular uptake and / or monitoring is a polypeptide, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be conjugated (e.g., through covalent and / or non-covalent linkages) to a polypeptide sequence that facilitates cellular uptake and / or monitoring of the agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides. Examples of nucleic acid sequences that can facilitate cellular uptake of an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides include, for example, a nuclear localization signal (NLS). Examples of polypeptide sequences that can facilitate cellular uptake of an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides include, for example, cell-penetrating peptides (CPPs; such as an 8 guanidine head group and / or 8 arginine residues (e.g., 8 D-arginine residues)). In some cases, an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein includes an 8-guanidine head group. Examples of polypeptides that can facilitate monitoring (e.g., in vivo, ex vivo, and / or in vitro monitoring) of an agent that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides include, for example, reporter sequences (e.g., fluorescent peptides, bioluminescent peptides, or selectable markers) and epitope tags (e.g., hemagglutinin (HA), FLAG®, maltose-binding protein (MBP), cellulose-binding domain (CBD), or glutathione S-transferase (GST)). Any appropriate amount (e.g., any appropriate dose) of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be administered to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC). An effective amount (e.g., a therapeutically effective amount) of a composition containing one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be any amount that can treat a mammal having cancer (e.g., prostate such as CRPC) as described herein without producing significant toxicity to the mammal. In some cases, an effective amount of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides can be about 80 milligrams per kilogram body weight (mg / kg) per week.

[0046] In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC) together with one or more androgen deprivation therapies (ADTs). Examples of ADTs that can be administered to a mammal having cancer together with one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein include, without limitation, antiandrogens (e.g., enzalutamide, abiraterone, flutamide, nilutamide, bicalutamide, apalutamide, finasteride, dutasteride, alfatradiol, and darolutamide), chemical castration (e.g., leuprolide, goserelin, triptorelin, histrelin, and degarelix), and AR PROTAC degraders (e.g., ARV- 110).

[0047] One or more agents that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be formulated into a composition (e.g., a pharmaceutically acceptable composition) for administration to a mammal having cancer (e.g., prostate cancer such as CRPC). For example, a therapeutically effective amount of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be formulated together with one or more pharmaceutically acceptable carriers (additives) and / or diluents. A pharmaceutical composition can be formulated for administration in solid or liquid form including, without limitation, sterile solutions, suspensions, sustained-release formulations, tablets, capsules, pills, powders, and granules.

[0048] In some cases, a therapeutically effective amount of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be packaged with one or more delivery vehicles. For example, a therapeutically effective amount of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be conjugated to delivery vehicle. For example, a therapeutically effective amount of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be encapsulated within a delivery vehicle. Delivery vehicles that can be formulated for administering one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC) include, without limitation, nanoparticles (e.g., lipid nanoparticles such as iRGD-liposomes). In some cases, a vehicle that can be formulated for administering one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) to a mammal (e.g., a human) having cancer (e g., prostate cancer such as CRPC) can be as described elsewhere (see, e.g., Guan et al., Adv. Funct. Mater., 31 (24):2100478 (2021)).

[0049] A composition (e.g., a pharmaceutically acceptable composition) including one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be administered locally or systemically. A composition containing one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be designed for oral, parenteral (including subcutaneous, intramuscular, intravenous, and intradermal), or inhaled administration. For example, a composition containing one or more agents that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be administered systemically by an oral administration to or inhalation by a mammal (e.g., a human). When being administered orally, a composition containing one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be in the form of a pill, tablet, or capsule.

[0050] This document also provides methods for using one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4). In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein and, optionally, one or more ADTs, can be administered to treat a mammal having cancer (e.g., prostate cancer such as CRPC). Administering one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein to a mammal having cancer can be effective to reduce the number of and / or eliminate cancer cells in a mammal (e.g., human male), to reduce and / or eliminate androgen-independent growth of CRPC cells, and / or to restore androgen sensitivity to a CRPC.

[0051] One or more agents that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) and, optionally, one or more ADTs, can be administered to any appropriate mammal. Examples of mammals that can have cancer (e.g., prostate cancer such as CRPC) and can be treated as described herein (e.g., by administering one or more agents that can regulate splicing of a nucleic acid (e g., a pre-mRNA) tha capable of encoding one or more AR polypeptides provided herein) include, without limitation, humans, non-human primates (e.g., monkeys), rats, mice, dogs, cats, horses, cows, goats, and pigs.

[0052] A mammal being treated as described herein (e.g., by administering one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein and, optionally, one or more ADTs) can have any type of cancer. In some cases, a cancer that can be treated as described herein can include one or more solid tumors. In some cases, a cancer that can be treated as described herein can be a blood cancer. In some cases, a cancer that can be treated as described herein can be a primary cancer. In some cases, a cancer that can be treated as described herein can be a metastatic cancer. In some cases, a cancer that can be treated as described herein can be a refractory cancer. In some cases, a cancer that can be treated as described herein can be a relapsed cancer. In some cases, a cancer that can be treated as described herein can express one or more AR-V polypeptides. Examples of cancers that can be treated using one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) and, optionally, one or more ADTs, include, without limitation, prostate cancers (e.g., CRPCs), breast cancers, salivary gland cancers, and melanomas. In some cases, a cancer that can be treated as described herein can be a cancer that was previously treated with one or more ADTs. For example, a cancer that can be treated as described herein can be a cancer that was previously treated with one or more ADTs (e.g., administration of one or more enzalutamide, abiraterone, flutamide, nilutamide, bicalutamide, apalutamide, finasteride, dutasteride, alfatradiol, leuprolide, goserelin, triptorelin, histrelin, degarelix, darolutamide, and ARV- 110) and developed ADT resistance following ADT treatment.

[0053] In some cases, one or more (e.g., one, two, three, four, or more) agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can be used to reduce or eliminate non-canonical splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). For example, one or more agents that can regulate splicing of a nucleic acid (e g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having cancer (e.g., a prostate cancer such as CRPC)) to reduce or eliminate expression of one or more AR-V polypeptides from a nucleic acid (e g., a pre-mRNA) capable of encoding one or more AR polypeptides. In some cases, the methods and materials described herein can be effective to reduce expression of one or more AR-V polypeptides from nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) in a mammal having cancer (e.g., prostate cancer such as CRPC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the methods and materials described herein can be effective to eliminate expression of one or more AR-V polypeptides from nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) in a mammal having cancer (e.g., prostate cancer such as CRPC).

[0054] In some cases, one or more (e.g., one, two, three, four, or more) agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly (A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) can be used to increase canonical splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). For example, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having cancer (e.g., a prostate cancer such as CRPC)) to increase expression of one or more AR polypeptides including an AR LBD from a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides). In some cases, the methods and materials described herein can be effective to increase expression of one or more AR polypeptides including an AR LBD from a nucleic acid (e.g., a pre-mRNA) that can encode one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) in a mammal having cancer (e.g., prostate cancer such as CRPC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0055] In some cases, one or more (e.g., one, two, three, four, or more) agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) and, optionally, one or more ADTs, can be effective to treat cancer (e.g., prostate cancer such as CRPC). For example, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein and, optionally, one or more ADTs, can be administered to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC) to reduce the size of a cancer (e.g., to reduce the number of cancer cells in the mammal and / or to reduce the volume of one or more tumors in the mammal) within a mammal (e.g., a human). For example, the methods and materials described herein can be used to reduce the size of a cancer (e.g., a prostate cancer such as a CRPC) present in a mammal (e.g., a human) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the methods and materials described herein can be used to reduce the size of a cancer by at least 2-fold (e.g., by 2-fold, 3-fold, 4-fold, 5-fold, or more). In some cases, the methods and materials described herein can be used such that the size (e.g., the number of cancer cells and / or the volume) of a cancer present within a mammal does not increase.

[0056] In some cases, one or more (e.g., one, two, three, four, or more) agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre- mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) and, optionally, one or more ADTs, can be effective to improve survival. For example, the methods and materials described herein can be used to improve disease-free survival (e.g., relapse-free survival). For example, the methods and materials described herein can be used to improve progression-free survival. For example, the methods and materials described herein can be used to improve the survival of a mammal having cancer (e.g., prostate cancer such as CRPC) in a mammal (e.g., a human) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the methods and materials described herein can be used to improve the survival of a mammal having prostate cancer by, for example, at least about 3 months (e.g., at least about 4 months, at least about 5 months at least about 6 months, at least about 8 months, at least about 10 months, at least about 1 year, at least about 1.5 years, at least about 2 years, at least about 2.5 years, or at least about 3 years).

[0057] In some cases, when treating a mammal (e.g., a human male) having prostate cancer (e.g., CRPC) as described herein, the treatment can be effective to reduce one or more symptoms of a cancer (e.g., a prostate cancer such as a CRPC). Examples of symptoms of prostate cancer that can be reduced using the methods and materials described herein include, without limitation, trouble urinating, decreased force in the stream of urine, blood in the urine, blood in the semen, bone pain, losing weight without trying, and erectile dysfunction. For example, the methods and materials described herein can be used to reduce one or more symptoms within a mammal having prostate cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0058] In some cases, methods for treating a mammal having cancer (e.g., prostate cancer such as CRPC) can include identifying the mammal as having cancer. Examples of methods for identifying the mammal as having cancer include, without limitation, physical examination, laboratory tests (e.g., blood, urine, and / or circulating tumor cells (CTCs)), biopsy, imaging tests (e.g., X-ray, PET / CT, MRI, and / or ultrasound), nuclear medicine scans (e.g., bone scans), endoscopy, and / or genetic tests. In some cases, identifying the mammal as having prostate cancer (e.g., CRPC) can include, without limitation, testing blood, urine, and / or CTCs for PSA and / or one or more AR-Vs (e.g., AR-V7).

[0059] In some cases, methods for treating a mammal having CRPC can include identifying the mammal as having a CRPC expressing one or more AR-V (e.g., AR-V7). Methods for treating a mammal having CRPC can include determining an AR-V (e.g., AR-V7) is expressed in the CRPC. Examples of methods for identifying if a CRPC expresses one or more AR-Vs and / or determining that an AR-V is expressed in a CRPC include, without limitation, reverse-transcriptase PCR, real-time PCR, northern blot analysis, western blot analysis, and / or sequencing (e.g., RNA-sequencing and DNA- sequencing) assays.

[0060] In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) can be administered to a mammal (e.g., a human) having cancer (e.g., prostate cancer such as CRPC) together with one or more (e.g., one, two, three, four, or more) additional agents / therapies used to treat having cancer (e.g., prostate cancer such as CRPC). In some cases, an anti-cancer agent can be a chemotherapeutic agent. In some cases, an anti-cancer agent can be an immunotherapeutic agent (e.g., an immune checkpoint inhibitor). Examples of anticancer agents that can be used as described herein include, without limitation, trametinib, dabrafenib, binimetinib, selumntinib, vemurafenib, encorafenib, cobimetinib, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), liposomal doxorubicin, melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, lutetium (e.g., Lu-177 vipivotide tetraxetan PSMA), and any combinations thereof. In cases where one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (and, optionally, one or more ADTs) are used with one or more additional agents treat a cancer, the one or more additional agents can be administered at the same time (e.g., in a single composition) or independently. In some cases, one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (and, optionally, one or more ADTs) can be administered first, and the one or more additional agents administered second, or vice versa.

[0061] Examples of therapies that can be used as described herein to treat cancer include, without limitation surgery, chemotherapy, radiation therapy, immunotherapy, and / or targeted therapy. In cases where one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides provided herein (and, optionally, one or more ADTs) are used in combination with one or more additional therapies used to treat cancer, the one or more additional therapies can be performed at the same time or independently of the administration of one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (and, optionally, the one or more ADTs). For example, the one or more agents that can regulate splicing of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (and, optionally, one or more ADTs) can be administered before, during, and / or after the one or more additional therapies are performed.

[0062] In certain instances, a cancer (e.g., prostate cancer such as CRPC) within a mammal can be monitored to evaluate the effectiveness of the cancer treatment. Any appropriate method can be used to determine whether or not a mammal (e.g., a human) having cancer (e g., prostate cancer such as CRPC) is treated. For example, imaging techniques or laboratory assays can be used to assess the number of cancer cells and / or the size of a tumor present within a mammal. For example, imaging techniques or laboratory assays can be used to assess the location of cancer cells and / or a tumor present within a mammal.

[0063] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

[0064] EXAMPLES

[0065] Example 1: Regulatory elements and factors driving alternative polyadenylation of AR pre-mRNA

[0066] AR-V polypeptides can support the growth of CRPC cells by driving expression of AR target genes that are normally suppressed by endocrine therapies. Expression of AR-Vs also can lack the ligand-binding domain (LBD) that is targeted by second- generation AR inhibitors, leading to resistance to those AR inhibitors. Consistent with this notion, expression of AR variant-7 (AR-V7) in circulating tumor cells (CTCs) from patients with CRPC can be used to predict resistance to AR inhibitors (e.g., enzalutamide and abiraterone).

[0067] Alternative polyadenylation plays a role in AR variant expression. Specifically, this Example identifies particular sequence elements in AR CE3 that recruit factors that regulate usage of the alternative poly(A) site.

[0068] To determine biological effects of disrupting sequence elements necessary for alternative poly(A) site of AR in CRPC, 14 antisense oligonucleotides (ASOs) were designed with partially overlapping sequences that target a 250 nucleotide (nt) region of AR pre-mRNA spanning 100-nt upstream to 150-nt downstream of the poly(A) site to encompass directly flanking regions, as well as a scrambled control ASO (scrASO) (Figure 1 A). The ASOs were transfected into 22Rvl cells expressing FL-AR and AR-Vs, and their effects on the AR polypeptide and the mRNA levels were assayed. Inhibiting a 63-nt region, spanning 12-nts upstream of the poly(A) site and 45-nts downstream caused loss of AR-V polypeptide and mRNA, and restored the FL-AR polypeptide and mRNA in 22Rvl cells (Figures IB and 1C). Additionally, a 12-nt region just downstream of the poly(A) site was identified, that when inhibited increased the AR-V expression and decreased the FL-AR expression, suggesting a negative regulation of poly(A) site (Figures IB and 1C). These results demonstrate that sequence elements directly upstream and downstream of the poly(A) site in AR cryptic exon CE3 drive AR-V expression. Also, a 12 nt region ~50 nts downstream of the poly(A) site was determined to repress the poly(A) site and AR-V expression.

[0069] To identify binding factors that regulate the alternative poly(A) site of AR, the cleavage and polyadenylation stimulation factor (CPSF1) and other members of the CPSF complex that interact with the poly(A) site in cryptic exon CE3 of AR were tested (Figure 2A). A 60-nt biotinylated RNA oligomer representing the poly(A) site and flanking the sequence in cryptic exon CE3 of AR was designed. To serve as a control, a second 60-nt biotinylated RNA oligomer was designed that contained a mutated poly(A) site with an intact flanking sequence from the AR cryptic exon CE3 (Figure 2B, top). The interaction of the CPSF1, as well as other factors of the CPSF complex, CPSF2, CPSF3, CPSF4, WDR33, and FIP1L1, known to interact with the poly(A) site, and CSTF2, a member of the CSTF complex, known to interact with a sequence downstream of the poly(A) site were evaluated (Figures 2A and 2B). CPSF1 and other members of the CPSF complex were found to bind with the RNA oligomer representing the poly(A) site of AR cryptic exon CE3. However, when the poly(A) site was mutated, the binding was lost (Figures 2A and 2B). The binding of CSTF2 was not detected in the wild type or the mutated poly(A) sequence, demonstrating that CSTF2 did not interact with the poly(A) site or the sequence 27-nt upstream or downstream of the poly(A) site (Figure 2B). This data showed that CPSF1, as well as the other members of the CPSF complex bound to the poly(A) site in CE3 of AR, and the AAUAAA poly(A) sequence was involved in the binding.

[0070] Together, these results demonstrate that one or more nucleic acid molecules that can target a sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can be used to reduce or eliminate expression of one or more AR-Vs and to restore expression of FL- AR. In some cases, using one or more nucleic acid molecules that can target a sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) to reduce or eliminate expression of one or more AR-Vs and to restore expression of FL-AR in a cancer cell can improve that cell’s response to endocrine therapies. In some cases, one or more nucleic acid molecules that can target a sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding one or more AR polypeptides (e.g., one or more AR polypeptides including an AR LBD and / or one or more AR-V polypeptides) can be administered to a mammal (e.g., a human) having a CRPC to restore androgen sensitivity to that cancer. For example, a mammal having a CRPC can be administered one or more agents that can regulate splicing of a nucleic acid (e.g., a pre- mRNA) capable of encoding one or more AR polypeptides provided herein (e.g., a nucleic acid molecule that can target a nucleic acid sequence downstream of a poly(A) site present in CE3 of a nucleic acid (e.g., a pre-mRNA) capable of encoding an AR-V polypeptide such as a nucleic acid molecule that comprises, consists essentially of, or consists of SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4) to restore androgen sensitivity to that CRPC and can be administered one or more ADTs to treat the mammal.

[0071] Example 2: Biological effects of disrupting the alternative poly(A) site

[0072] The biological effects of disrupting the nominated sequence elements of the alternative poly(A) site of AR by ASOs are tested. ASOs that show the strongest biological effect in vitro are packaged into lipid nanoparticles to test the therapeutic significance of disrupting the alternative poly(A) site of 4 / ? in vivo. Mass spectrometry analysis is used to define polypeptides that can recognize the AR cryptic exon CE3 poly(A) site. The nominated factors are knocked down to determine the biological effects in vitro in cell lines and organoids (generated from LuCaP 35CR PDX models injected into mice). Example 3: Blocking AR alternative mRNA polyadenylation

[0073] The results in this Example re-present and expand on at least some of the results provided in other Examples.

[0074] A series of ASOs with phosphorodiamidate morpholino oligomer (PMO) backbones were designed to bind and sterically block sequences upstream and downstream of the AAUAAA poly(A) site in AR exon CE3 (Fig. 3 A).

[0075] This revealed several PMOs that hybridized at or near the AAUAAA poly(A) site and blocked synthesis of AR-V7 in LNCaP95 and 22Rvl cells, including PMO #7 (also referred to as CE3DS), PMO #8 (also referred to as DS20), and PMO #9 (also referred to as DS40), which hybridized downstream of the AAUAAA poly(A) site (Figs. 3B and 3C). Sequences for PMOs #7-9 are also shown in Table 1. Further, an inhibitory region downstream of AAUAAA was identified that, when masked with antisense PMOs, induced AR-V7 synthesis (PMOs #10 & #11 in Figs. 3B and 3C). These data support the concept that the AR CE3 poly(A) site is an important regulatory node for coordinating AR mRNA splicing to produce multiple AR-Vs including AR-V7.

[0076] Together these results demonstrate that blocking AR alternative mRNA polyadenylation blocked AR alternative splicing. For example, these data demonstrate that the poly(A) site can be targeted with antisense PMOs to block AR-V production.

[0077] Example 4: Restoring androgen sensitivity to a CRPC

[0078] A human identified as having a CRPC is administered one or more agents that bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of an AR pre- mRNA (e.g., a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid sequence SEQ ID NO:2, a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid molecule comprises the sequence SEQ ID NO:3, or a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid molecule comprises the sequence SEQ ID NO:4). The administered inhibitors) can regulate splicing of an AR pre-mRNA to increase expression of one or more AR polypeptides containing an AR LBD (e.g., a full-length AR polypeptide), thereby restoring androgen sensitivity to the CRPC. Example 5: Treating prostate cancer

[0079] A human identified as having a CRPC is administered one or more agents that bind a nucleic acid sequence downstream of a poly(A) site present in CE3 of an AR pre- mRNA (e.g., a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid sequence SEQ ID NO:2, a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid molecule comprises the sequence SEQ ID NO:3, or a nucleic acid molecule comprising, consisting essentially of, or consisting of the nucleic acid molecule comprises the sequence SEQ ID NO:4) and is administered one or more androgen deprivation therapies. The administered agent(s) and androgen deprivation therapies can reduce the number of cancer cells present in the human.

[0080] OTHER EMBODIMENTS

[0081] It is to be understood that while the disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT Is CLAIMED IS:

1. An agent that can regulate splicing of a precursor-messenger ribonucleic acid (pre-mRNA) capable of encoding an AR polypeptide, wherein said agent comprises a nucleic acid molecule comprising a nucleic acid sequence as set forth in SEQ ID NO:5, wherein said nucleic acid molecule comprises at least one modified nucleotide.

2. The agent of claim 1, wherein said nucleic acid molecule is from about 6 nucleotides to about 45 nucleotides in length.

3. The agent of any one of claims 1-2, wherein said nucleic acid molecule is 22 to 30 nucleotides in length.

4. The agent of any one of claims 1-2, wherein said nucleic acid molecule is 25 or 26 nucleotides in length.

5. The agent of any one of claims 1-2, wherein said nucleic acid molecule comprises the nucleic acid sequence AAAATACGATTGGTGTATTAATGGC (SEQ ID NO:2).

6. The agent of any one of claims 1-2, wherein said nucleic acid molecule comprises the sequence TTGTAAATAAGAAAATACGATTGGTG (SEQ ID NO:3).

7. The agent of any one of claims 1-2, wherein said nucleic acid molecule comprises the sequence CTCAGTCTGTTGTAAATAAGAAAATA (SEQ ID NO:4).

8. The agent of any one of claims 1-7, wherein said agent binds a nucleic acid sequence downstream of a polyadenylation (poly(A)) site present in cryptic exon 3 (CE3) of said pre-mRNA capable of encoding said AR polypeptide.

9. The agent of any one of claims 1-8, wherein said at least one modified nucleotide comprises a morpholine ring.

10. The agent of any one of claims 1-8, wherein at least two consecutive nucleotides present in said nucleic acid molecule are linked by a phosphorodiamidate linkage.

11. The agent of any one of claims 1-8, wherein said agent is a morpholino.

12. The agent of any one of claims 1-11, wherein said agent can reduce expression of an AR-V that lacks an androgen receptor ligand binding domain.

13. The agent of any one of claims 1-12, wherein said AR-V is selected from the group consisting of AR-V2, AR-V5, AR-V7, and AR-V9.

14. The agent of claim 13, wherein said agent inhibits expression of AR-V7.

15. The agent of any one of claims 1-14, wherein said agent is effective to increase expression of an AR polypeptide comprising an AR ligand binding domain.

16. An agent that can regulate splicing of a pre-mRNA capable of encoding an AR polypeptide, wherein said agent comprises a nucleic acid molecule that can bind a nucleic acid sequence downstream of a poly(A) site present in cryptic exon 3 (CE3) of said pre- mRNA capable of encoding said AR polypeptide, and wherein said agent can reduce expression of an AR-V polypeptide that lacks an androgen receptor ligand binding domain.

17. The agent of claim 16, wherein said one or more AR-Vs that lack an androgen receptor ligand binding domain are selected from the group consisting of AR-V2, ARVS, AR-V7, and / or AR-V9.

18. The agent of claim 17, wherein said agent inhibits expression of AR-V7.

19. The agent of any one of claims 16-18, wherein said agent is effective to increase expression of an AR polypeptide comprising an AR ligand binding domain.

20. The agent of any one of claims 16-19, wherein said nucleic acid sequence downstream of said poly(A) site present in CE3 of said pre-mRNA capable of encoding said AR polypeptide comprises the sequenceGCCAUUAAUACACCAAUCGUAUUUUCUUAUUUACAACAGACUGA (SEQ ID NO: 1).

21. The agent of any one of claims 16-20, wherein said nucleic acid molecule is from about 6 nucleotides to about 45 nucleotides in length.

22. The agent of any one of claims 16-21, wherein said nucleic acid molecule is 22 to 30 nucleotides in length.

23. The agent of any one of claims 16-21, wherein said nucleic acid molecule is 25 or 26 nucleotides in length.

24. The agent of any one of claims 16-21, wherein said nucleic acid molecule comprises the nucleic acid sequence AAAATACGATTGGTGTATTAATGGC (SEQ ID NO: 2).

25. The agent of any one of claims 16-21, wherein said nucleic acid molecule comprises the nucleic acid sequence TTGTAAATAAGAAAATACGATTGGTG (SEQID NO:3).

26. The agent of any one of claims 16-21, wherein said nucleic acid molecule comprises the nucleic acid sequence CTCAGTCTGTTGTAAATAAGAAAATA (SEQ ID NO:4).

27. The agent of any one of claims 16-25, wherein said at least one modified nucleotide comprises a morpholine ring.

28. The agent of any one of claims 16-25, wherein at least two consecutive nucleotides present in said nucleic acid molecule are linked by a phosphorodiamidate linkage.

29. The agent of any one of claims 16-28, wherein said agent is a morpholino.

30. A method for restoring androgen sensitivity to a castration-resistant prostate cancer (CRPC) within a mammal, wherein said method comprises administering an agent of any one of claims 1-29.

31. A method for restoring androgen sensitivity to a CRPC, the method comprising: administering an agent of any one of claims 1-29 to a mammal identified as having a CRPC comprising cancer cells expressing one or more androgen receptor variants (ARVs).

32. A method for restoring androgen sensitivity to a CRPC in a mammal, the method comprising: determining that said CRPC comprises cancer cells that express an AR-V; and administering to said mammal an agent of any one of claims 1-29.

33. The method of any one of claims 30-32, wherein said mammal is a human.

34. The method of any one of claims 30-33, wherein said mammal is a male mammal.

35. The method of any one of claims 30-34, further comprising administering to said mammal a cancer treatment.

36. The method of any one of claims 16-18, wherein said cancer treatment comprises androgen deprivation therapy.

37. A method for treating a mammal having a CRPC, the method comprising: administering to said mammal (a) an agent of any one of claims 1-29, and (b) an androgen deprivation therapy.

38. The method of claim 37, wherein said mammal is a human.

39. The method of any one of claims 37-38, wherein said mammal is a male mammal.

40. The method of any one of claims 37-39, wherein said method further comprises subjecting the mammal to a cancer treatment selected from the group consisting of surgery, chemotherapy, radiation therapy, immunotherapy, and targeted therapy.

Citation Information

Patent Citations

  • Androgen receptor variant inhibitors and methods of using

    US20180119153A1

  • Antisense oligonucleotides for use in the treatment of crpc

    WO2020148400A1