Compounds, compositions, and methods for treating diseases and disorders related to splicing factor mutations

Compounds selectively target and kill mutant splicing factor-expressing cells, addressing the limitations of current therapies by reducing disease progression in MDS and AML without harming wild-type cells.

WO2025171395A1PCT designated stage Publication Date: 2025-08-14THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/015274
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-08
Filing Date
2025-02-10
Publication Date
2025-08-14

AI Technical Summary

Technical Problem

Current therapies for myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML) are inadequate, as they fail to selectively target cells with somatic mutations in splicing factors like SF3B1, U2AF1, and SRSF2, leading to off-target effects and poor prognosis, with no curative options available.

Method used

Development of compounds that specifically target and kill cells expressing mutant splicing factors, such as SF3B1, U2AF1, and SRSF2, by increasing DNA damage, inhibiting DNA repair mechanisms, and promoting cell cycle arrest, while sparing wild-type cells.

Benefits of technology

These compounds effectively kill mutant splicing factor-expressing cells, reducing disease progression and minimizing harm to healthy cells, offering a potential therapeutic approach for MDS and AML.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025015274_14082025_PF_FP_ABST
    Figure US2025015274_14082025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are compounds, compositions and methods directed to strategies that selectively kill cells comprising mutant splicing factors but conserve wild-type cells, and treating diseases and disorders in a subject (e.g., cancer, myelodysplastic syndromes, acute myeloid leukemia, and the like).
Need to check novelty before this filing date? Find Prior Art

Description

COMPOUNDS, COMPOSITIONS, AND METHODS FOR TREATING DISEASES AND DISORDERS RELATED TO SPLICING FACTOR MUTATIONSTECHNICAL FIELD

[0001] Disclosed herein are compounds, compositions and methods directed to strategies that selectively kill cells comprising mutant splicing factors, e.g., cells with somatic mutations in genes encoding a splicing factor, but conserve wild-type cells, and treating diseases and disorders in a subject (e.g., cancer, myelodysplastic syndromes, acute myeloid leukemia, and the like).CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 551,423, filed February 8, 2024, the content of which is herein incorporated by reference in its entirety.SEQUENCE LISTING STATEMENT

[0003] The content of the electronic sequence listing titledCOLUM_42752_601_SequenceListing .xml (Size: 14,012 bytes; and Date of Creation: February 10, 2025) is herein incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0004] This invention was made with Government support under GM118136 awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND

[0005] Myelodysplastic syndromes (MDS) are an often unrecognized, under-diagnosed rare group of bone marrow failure disorders, where the body no longer makes enough healthy, normal blood cells in the bone marrow. MDS and acute myeloid leukemia (AML) are hematological cancers of the myeloid lineage characterized by the overproduction of immature blood cells. The inability of hematopoietic stem cells in the bone marrow to effectively differentiate into mature, healthy blood cells causes anemia and an increased risk for infection and bleeding. There are currently no curative therapies for MDS and AML.

[0006] Somatic mutations in splicing factors (SF), such as SF3B1, U2AF1, and SRSF2, are the most common mutations in clonal myeloid disorders, including MDS and AML (up to 60%prevalence, > 40% VAF, high burden). Recurrent mutations in SF3B1, SRSF2, and U2AF1 are present in -50% of all MDS cases, and mutations in SF3B1 can be present in up to 86% of MDS with ring sideroblasts. Mutations in SRSF2 and U2AF1 are known to predict a poor prognosis in patients with MDS and increase the risk of progression to AML. SF mutations impair the sequence-specific recognition of splice sites by SFs which leads to dysregulated pre-mRNA splicing and differential expression of hundreds to thousands of genes, some of them involved in stem cell biology, hematopoiesis, B cell lymphopoiesis, erythropoiesis, and iron metabolism. Neomorphic contacts lead to mis-splicing of hundreds to thousands of transcripts that produce cancer-specific mRNA isoforms.

[0007] mRNA target-based approaches using RNA / CLIP-seq to identify genetic dependencies of SF-mutant cells have yielded limited insights. Chemical inhibition of SF proteins has led to adverse side effects largely due to off-targeting to the WT spliceosome, and ultimately failed phase I clinical trials. Thus, therapeutic strategies that selectively kill SF-mutant cells but conserve wild-type (WT) clones are needed.SUMMARY

[0008] In one aspect, disclosed herein are methods for specifically and selectively killing, promoting cell death, or inhibiting cell cycle progression or proliferation of a cell expressing a mutant splicing factor.

[0009] In some embodiments, the methods comprise contacting the cell with one or more compounds listed in Tables 2-6, or a composition thereof. In some embodiments, the methods comprise contacting the cell with one or more compounds selected from:

[0010] In some embodiments, the methods comprise contacting the cell with a compound of formula (I),or a pharmaceutically acceptable salt thereof, wherein,R1is a 5-membered heteroaryl;R2is a 5-membered heteroaryl;R3is hydrogen or hydroxy; andR4is a 5 or 6 membered cycloalkyl, cycloalkylene, heterocyclyl, aryl, or heteroaryl, optionally substituted with one or more R5, wherein each R5is independently halogen, Ci-6 haloalkyl, or cyano. In some embodiments, R1and R2are each independently selected fromsome embodiments, each of R1and R2are <fx. In some embodiments, each of R1and R2aresome embodiments,

[0012] In some embodiments, R4is a 5-membered heteroaryl, optionally substituted with one or more R5, wherein each R5is independently halogen, C1-6haloalkyl, or cyano. In some embodiments,each R5is independently halogen, C1- 6haloalkyl, or cyano. In some embodiments, n is 0 or 1. In some embodiments, R4is selected fromsome embodiments, R5is halogen. In some embodiments, R5is chloro, fluoro, or bromo.

[0013] In some embodiments, R4is a 6-membered aryl or cycloalkylene, optionally substituted with one or more R5, wherein each R5is independently halogen, C1-6haloalkyl, or cyano. In some embodiments,m is 0, 1, or 2, and each R5isindependently halogen, C1-6haloalkyl, or cyano. In some embodiments, R4is selected fromembodiments, each R5is independently selected from chloro, fluoro, and bromo.

[0014] In some embodiments, the compound of formula (I) is selected from:

[0015] In some embodiments, the mutant splicing factor is Splicing Factor 3b Subunit 1 (SF3B1) mutant, U2 Small Nuclear RNA Auxiliary Factor 1 (U2AF1) mutant, Serine And Arginine Rich Splicing Factor 2 (SRSF2) mutant, or a combination thereof. In some embodiments, the mutant splicing factor is K700E SF3B1, S34F U2AF1, P95H SRSF2, or a combination thereof.

[0016] In some embodiments, the mutant splicing factor is a U2AF1 mutant and the compound is one or more of those listed in Tables 2 and 5. In some embodiments, the mutant splicing factor is a U2AF 1 mutant and the compound is one or more of:some embodiments, the mutant splicing factor is a U2AF1 mutant, and the compound is a compound of formula (I). In some embodiments, the mutant splicing factor is a U2AF1 mutant and the compound is selected from:embodiments, the mutant splicing factor is a U2AF1 mutant, and the compound is

[0017] In some embodiments, the mutant splicing factor is an SF3B1 mutant and the compound is one or more of those listed in Tables 3 and 6. In some embodiments, the mutantsplicing factor is an SF3B1 mutant and the compound is one or more of:

[0018] In some embodiments, the mutant splicing factor is an SRSF2 mutant, and the compound is one or more of those listed in Table 4. In some embodiments, the mutant splicing factor is a SRSF2 mutant and the compound is one or more of:

[0019] In some embodiments, the methods promote cell death by increasing DNA damage, inhibiting DNA repair mechanisms, and / or increasing cell cycle arrest.

[0020] In some embodiments, the cell is in vitro or ex vivo. In some embodiments, the cell is in a subject.

[0021] In some embodiments, the methods comprise administering to the subject the compound or composition thereof. In some embodiments, the subject has or is suspected of having a disease or disorder mediated by the mutant splicing factor. In some embodiments, the subject has or is suspected of having cancer. In some embodiments, the subject has or is suspected of having a myelodysplastic syndrome. In some embodiments, the subject has or is suspected of having acute myeloid leukemia (AML).

[0022] In another aspect, disclosed herein are methods of treating a disease or disorder in a subject. In some embodiments, the methods comprise administering to the subject an effective amount of a compound as in Tables 2-6, or a pharmaceutical acceptable composition comprising a compound as in Tables 2-6. In some embodiments, the methods comprise administering to the subject an effective amount of a compound of formula (I), a pharmaceutically acceptable salt thereof, or a pharmaceutical acceptable composition comprising the compound of formula (I), a pharmaceutically acceptable salt thereof.

[0023] In some embodiments, the subject has or is suspected of disease cells expressing a mutant splicing factor. In some embodiments, the method further comprises determining if the subject disease or disorder comprises diseased cells expressing a mutant splicing factor.

[0024] In some embodiments, the mutant splicing factor is a SF3B1 mutant, a U2AF1 mutant, a SRSF2 mutant, or a combination thereof. In some embodiments, the mutant splicing factor is K700E SF3B1, S34F U2AF1, P95H SRSF2, or a combination thereof.

[0025] In some embodiments, the mutant splicing factor is a U2AF1 mutant and the compound is one or more of those listed in Tables 2 and 5. In some embodiments, the mutant splicing factor is a U2AF 1 mutant and the compound is one or more of:splicing factor is a U2AF1 mutant, and the compound is a compound of formula (I). In some embodiments, the mutant splicing factor is a U2AF1 mutant and the compound is selected from:embodiments, the mutant splicing factor is a U2AF1 mutant, and the compound is

[0026] In some embodiments, the mutant splicing factor is an SF3B1 mutant and the compound is one or more of those listed in Tables 3 and 6. In some embodiments, the mutant splicing factor is an SF3B1 mutant and the compound is one or more of:

[0027] In some embodiments, the mutant splicing factor is a SRSF2 mutant, and the compound is one or more of those listed in Table 4. In some embodiments, the mutant splicingfactor is a SRSF2 mutant and the compound is one or more of:

[0028] In some embodiments, the disease or disorder is cancer. In some embodiments, the disease or disorder is a myelodysplastic syndrome. In some embodiments, the disease or disorder is acute myeloid leukemia (AML).

[0029] In some embodiments, the methods further comprise administering one or more additional therapeutic agent.

[0030] In a further aspect, disclosed herein are pharmaceutical compositions. In some embodiments, the pharmaceutical compositions comprise one or more compounds listed in Tables 2-6 and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions comprise one or more compounds selected from:

[0031] In some embodiments, the pharmaceutical compositions compound of formula (I), a pharmaceutically acceptable salt thereof. In some embodiments, the pharmaceutical compositions comprise one or more compounds selected from:pharmaceutically acceptable salt thereof.

[0032] Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] FIG. 1 is a schematic of the high-throughput screening campaign in K562 cells harboring hotspot mutations in splicing factors.

[0034] FIGS. 2A and 2B show the hit compounds (left) targeting SF3BlK700Eknock-in K562 cell lines and their corresponding dose-response curves (right) in mutant (K) and WT (W) cell lines.

[0035] FIGS. 3A-3H show the hit compounds (left) targeting SRSF2P95Hknock-in K562 cell lines and their corresponding dose-response curves (right) in mutant (K) and WT (W) cell lines.

[0036] FIGS. 4A and 4B show the hit compounds (left) targeting U2AF1S34Fknock-in K562 cell lines and their corresponding dose-response curves (right) in mutant (K) and WT (W) cell lines.

[0037] FIG. 5 shows Annexin V apoptosis assays for Hit compounds (FIGS. 2-4) targeting SF-mutant knock-in K562 cell lines and WT controls.

[0038] FIGS. 6A and 6B show that compound 1, F6181-0028 shown in Table 2, specifically decreases the viability of U2AF1S34F+ / -cells using U2AF1S34F+ / -and WT K562 cells, CellTiterGlo luminescence viability assay, 48h. Selected for target deconvolution based on high specificity index, SI= IC50 WT / ICso Mut. SIci ~ 2.5 (viability difference » 10%); GR50 takes into account cellular growth rate to estimates IC50. FIG. 6A is a representative plot of dose-response curves (DRCs) using CellTiterGlo in 6 mutant cell lines and 5 WT cell lines treated with compound 1 for 72h. Each dot is the average of the viability normalized to DMSO in 6 mutant biological replicates and 5 WT biological replicates. The average IC50 calculated using GraphPad for U2AF1S34Fis 9.74 uM and for U2AF1WTis 26.61 uM. FIG. 6B is an average of IC50 from 5 DRCs calculated as previously. The left panel shows normal IC50, and the right panel shows growth-rate adjusted IC50 (GR50), using the GRCalculator software with input doubling times obtained using CellTiterGlo viability assays. An unpaired, two-tailed T-test was performed to calculate the p-values shown in the image.

[0039] FIGS. 7A-7E show that compound 1 specifically kills U2AF1S34F+ / -cells through increased DNA damage. Compound 1 leads to increased apoptosis (FIGS. 7A and 7B), G2 / M phase arrest (FIG. 7C and FIG. 7D) and ,H2AX staining (FIG. 7E) in U2AF1S34F+ / -cells. FIG. 7A is representative plots of apoptosis assay using Annexin V-FITC and propidium iodide (PI) staining of non- fixed U2AF 1 -mutant and WT cells after incubation with 10 uM of compound 1 for 72h. 10,000 events were collected in a BD Celesta flow cytometer and events were analyzed using FlowJo. Compensation controls using a 1: 1 mix of live and dead cells killed in a 60°C water bath for 20 minutes were used to establish a compensation matrix. Cells were gated to remove debris and doublets before FITC / PI analysis. U2AF1 -mutant cells show increased Annexin V and PI signal after treatment with compound 1 whereas WT do not. FIG. 7B is the average of 4 independent Annexin V / FITC apoptosis assays using 3 biological replicates of U2AF1 -mutant and WT cells as described in FIG 7A. The percentage of Annexin V-positive cells after subtracting the percentage of the DMSO control is shown for each cell line. A grouped, unpaired, two-tailed T-test was performed to calculate the p-value shown in the image. FIG. 7C is representative plots of cell cycle analysis of fixed U2AF1 -mutant and WT cells after incubation with 10 uM of compound 1 for 48h. Cells were stained with PI according to a typical cell cycle protocol and 10,000 events were collected in a BD Celesta flow cytometer and cell cycle analysis was performed using the Watson pragmatic model on FlowJo. Cells were gated to remove debris and identify single-cycling cells based on the linear PI signal. U2AF 1 -mutant cells show an increased percentage of cells in the G2 phase of the cell cycle after treatment. FIG. 7D is the statistical analysis of 2 independent cell cycle experiments as described in FIG. 7C. The percentage of G2-phase cells is shown for DMSO and compound 1 treated samples. FIG. 7E is analysis of gH2AX staining using flow-cytometry of fixed cells after incubation with 10 uM ofcompound 1 for 72h. 2 independent experiments using 3 biological replicates were carried out and the plots show the mean with the associated SEM. An unpaired, two-tailed, t-test was used to calculate the p-values shown.

[0040] FIGS. 8A-8D show that Cl specifically kills U2AF1S34F+ / -cells and spares U2AF1WTcells in a cell competition assay.

[0041] FIGS. 9A-9C show proteolytic stability as determined by drug affinity responsive target stability (DARTS) assay. FIG. 9A is a schematic of the DARTS assay. Compound 1 protects Ku70 from pronase digestion in vitro. FIG. 9B is SDS-PAGE gel of K52 cell lysates incubated with compound 1 for 2h followed by pronase digestion for 20 min. FIG. 9C is a summary table of proteins identified through mass spectrometry of drug-protected bands in the SDS-PAGE gel shown in FIG. 9B. U2AF1S34F+ / - cells have increased DNA damage, increased sensitivity for etoposide + topotecan, and reduced HR efficiency + sensitivity to PARPi.

[0042] FIGS. 10A-10D show thermal stability as determined by cellular thermal shift assay (CETSA). FIG. 10A is a schematic of the CETSA assay. FIG. 10B shows immunoblots of a CETSA assay performed in live K562 cells incubated with 10 uM compound 1 for 8h (top two blots) or 5 uM of a commercial Ku70 inhibitor for 8h (bottom). FIG. 10C shows calculations of the aggregation temperatures for compound 1 and the commercial Ku70 inhibitor using the sigmoid curve function in GraphPad. Two independent experiments were performed and an increase of Tagg above 5.94°C was observed. Compound 1 protects Ku70 from heat denaturation in vivo. Compound 1 targets to Ku70 / Ku80 heterodimer in vivo (FIG. 10D).

[0043] FIGS. 11A-1 IF show validation of Ku70 / XRCC6 as a genetic vulnerability of U2AF1S34F+ / -cells using siRNAs. FIG. 11A is immunoblotting of Ku70 after electroporation of U2AF1 -mutant and WT cells with 50uM of siRNAs targeting Ku70 and a control siRNA (siC) targeting the Renilla-luciferase gene that is absent from K562 cells. siRNAs decrease Ku70 protein expression. FIG. 1 IB shows immunofluorescence of U2AF1 -mutant cells after siRNA treatment showing that siRNA function at the phenotypic level by increasing DNA double-strand breaks as measured by increased intensity of yH2AX foci. The left and right panels correspond to 2 independent U2AF1S34F+ / -K562 cell lines. FIGS. 11C and 1 ID are representative plots of apoptosis assays using Annexin V-APC and the viability dye 7AAD in U2AF1 -mutant and WT cells following treatment with 50 uM of siRNAs. FIG. 1 IE is a representative plot showing that siRNAs targeting Ku70 also decrease the expression of its heterodimer partner protein Ku80.FIG. 1 IF is a representative plot showing siRNA targeting Ku70 increased DNA double-strand breaks, as marked by gH2AX, more prominently in mutant cells.

[0044] FIGS. 12A-12F are additional representative plots of cell cycle analysis of U2AF1- mutant after incubation with 10 uM of compound 1 for 48h, as in FIG. 7C.

[0045] FIG. 13 shows non-homologous end joining (NHEJ) as a genetic vulnerability of U2AF1S34F+ / - cells.DETAILED DESCRIPTION

[0046] Disclosed herein are a collection of compounds that specifically kill genetically engineered human leukemia cells harboring hotspot SF mutations without affecting the viability of WT cells. These compounds were discovered in a phenotypic high-throughput screen (HTS) of WT and engineered SF-mutant K562 leukemia cells. These compounds represent potential targeted therapies for SF-mutant MDS and AML. A cell-permeable Ku70 binder was identified that selectively kills U2AF1 -mutant K562 leukemia cells, indicating NHEJ inhibition as a genetic vulnerability of U2AF1S34Fmutant cells.

[0047] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.Definitions

[0048] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of,” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context.

[0049] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9,the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0050] As used herein, the modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (for example, it includes at least the degree of error associated with the measurement of the particular quantity). The modifier “about” should also be considered as disclosing the range defined by the absolute values of the two endpoints. For example, the expression “from about 2 to about 4” also discloses the range “from 2 to 4.” The term “about” may refer to ±10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean from 0.9 - 1.1. Other meanings of “about” may be apparent from the context, such as rounding off; for example, “about 1” may also mean from 0.5 to 1.4.

[0051] Unless otherwise defined herein, scientific, and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0052] An “effective amount” refers to an amount sufficient to elicit a desired biological response (e.g., treating a condition). As will be appreciated by those skilled in the art, the effective amount may vary depending on such factors as the desired biological endpoint, the pharmacokinetics, the condition being treated, the mode of administration, and the age and health of the subject. An effective amount encompasses therapeutic and prophylactic treatment. For example, a “therapeutically effective amount” is an amount sufficient to provide a therapeutic benefit in the treatment of a condition, or to delay or minimize one or more symptoms associated with the condition. In some embodiments, a therapeutically effective amount is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to minimize one or more symptoms associated with the condition. A therapeutically effective amount means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the condition. The term “therapeutically effective amount” can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the condition, or enhances the therapeutic efficacy of another therapeutic agent.

[0053] A “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, subject may include either adults or juveniles (e.g., children). Moreover, subject may mean any living organism, preferably a mammal (e.g., humans and nonhumans) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. In one embodiment, the mammal is a human.

[0054] A cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. For example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0055] As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease or condition, or one or more signs or symptoms thereof. In some embodiments, “treatment,” “treat,” and “treating” require that signs or symptoms of the disease disorder or condition have developed or have been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease or condition. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptomsand / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence.

[0056] As used herein, the terms “providing,” “administering,” and “introducing,” are used interchangeably herein and refer to the placement into a cell, organism, or subject by a method or route which results in at least partial localization to a desired site. The administration can be by any appropriate route which results in delivery to a desired location in the cell, organism, or subject.

[0057] Definitions of specific functional groups and chemical terms are described in more detail below. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Sorrell, Organic Chemistry, 2ndedition, University Science Books, Sausalito, 2006; Smith, March's Advanced Organic Chemistry: Reactions, Mechanism, and Structure, 7thEdition, John Wiley & Sons, Inc., New York, 2013; Larock, Comprehensive Organic Transformations, 3rdEdition, John Wiley & Sons, Inc., New York, 2018; and Carruthers, Some Modem Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987; the entire contents of each of which are incorporated herein by reference.

[0058] As used herein, “aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 it electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“Ce-i4 aryl”). In certain embodiments, an aryl group has six ring carbon atoms (“Ce aryl”; e.g., phenyl).

[0059] The term “cyano,” as used herein, refers to a group of formula -CN.

[0060] The term “cycloalkyl,” as used herein, refers to a saturated carbocyclic ring system containing three to ten carbon atoms and zero heteroatoms. The cycloalkyl may be monocyclic, bicyclic, bridged, fused, or spirocyclic. Representative examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, adamantyl, bicyclo[2.2.1]heptanyl, bicyclo[3.2.1]octanyl, and bicyclo[5.2.0]nonanyl.

[0061] As used herein, the term “cycloalkylene” refers to a divalent cycloalkyl radical.

[0062] The term “halogen” or “halo,” as used herein, means F, Cl, Br, or I.

[0063] The term “haloalkyl,” as used herein, means an alkyl group, as defined herein, in which at least one hydrogen atom (e.g., one, two, three, four, five, six, seven or eight hydrogen atoms) is replaced with a halogen. In some embodiments, each hydrogen atom of the alkyl group is replaced with a halogen. Representative examples of haloalkyl include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, and 3,3,3- trifluoropropyl.

[0064] As used herein, “heteroaryl” refers to a radical of a 5- to 14-membered monocyclic or polycyclic 4n+2 aromatic ring system (e.g., having 6, 10, or 14 it electrons shared in a cyclic array) having ring carbon atoms and 1-8 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5- to 14- membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more cycloalkyl or heterocyclyl groups wherein the point of attachment is on the heteroaryl ring, and in such instances, the number of ring members continues to designate the number of ring members in the heteroaryl ring system. When substitution is indicated in such instances, unless otherwise specified, substitution can occur on either(both) the heteroaryl or(and) the one or more cycloalkyl or heterocyclyl groups. In some embodiments, a heteroaryl is a 5- to 10-membered aromatic ring system having ring carbon atoms and 1 -4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 10-membered heteroaryl”); a 5- to 9-membered aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 9-membered heteroaryl”); a 5- to 8-membered aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 8-membered heteroaryl”); or a 5- to 6- membered aromatic ring system having ring carbon atoms and 1 -4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen,oxygen, and sulfur (“5- to 6-membered heteroaryl”). In certain embodiments, the 5- to 6- membered heteroaryl has 1 -3 ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5- to 6-membered heteroaryl has 1-2 ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, the 5- to 6- membered heteroaryl has 1 ring heteroatom selected from nitrogen, oxygen, and sulfur. Exemplary 5-membered heteroaryls containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5-membered heteroaryls containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryls containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryls containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6-membered heteroaryls containing one heteroatom include, without limitation, pyridinyl. Exemplary 6- membered heteroaryls containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryls containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively.

[0065] As used herein, “heterocyclyl” or “heterocyclic” refers to a radical of a 3- to 10- membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3- to 10-membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings.

[0066] In certain embodiments, a heterocyclyl group is a 5- to 10-membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“5- to 10- membered heterocyclyl”). In certain embodiments, a heterocyclyl group is a 5- to 8-membered non-aromatic ring system having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 8-membered heterocyclyl”). In certain embodiments, a heterocyclyl group is a 5- to 6-membered non-aromaticring system having ring carbon atoms and 14 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, and sulfur (“5- to 6-membered heterocyclyl”). In certain embodiments, the 5- to 6-membered heterocyclyl has 1-3 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, the 5- to 6-membered heterocyclyl has 1-2 ring heteroatoms selected from nitrogen, oxygen, and sulfur. In certain embodiments, the 5- to 6- membered heterocyclyl has one ring heteroatom selected from nitrogen, oxygen, and sulfur.

[0067] Exemplary 5 -membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5- membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, dioxanyl.Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl.

[0068] Hydroxy” refers to the radical -OH.

[0069] As used herein, the term “substituent” refers to a group substituted on an atom of the indicated group.

[0070] When a group or moiety can be substituted, the term “substituted” indicates that one or more (e.g., 1, 2, 3, 4, 5, or 6; in some embodiments 1, 2, or 3; and in other embodiments 1 or 2) hydrogen atoms on the group indicated in the expression using “substituted” can be replaced with a selection of recited indicated groups or with a suitable substituent group known to those of skill in the art (e.g., one or more of the groups recited below), provided that the designated atom’s normal valence is not exceeded. Substituent groups include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, acyl, amino, amido, amidino, aryl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkenyl, guanidino, halo, haloalkyl, haloalkoxy, heteroalkyl, heteroaryl, heterocyclyl, hydroxy, hydrazino, imino, oxo, nitro, phosphate, phosphonate, sulfonic acid, sulfonamide, thiol, thione, thioxo, or combinations thereof.

[0071] As used herein, in chemical structures the indication:A represents a point of attachment of one moiety to another moiety.

[0072] In some instances, the number of carbon atoms in a hydrocarbyl substituent (e.g., alkyl alkenyl) is indicated by the prefix “Cx-Cy”, wherein x is the minimum and y is the maximum number of carbon atoms in the substituent. Thus, for example, “C1-C3 alkyl” refers to an alkyl substituent containing from 1 to 3 carbon atoms.

[0073] For compounds described herein, groups and substituents thereof may be selected in accordance with permitted valence of the atoms and the substituents, such that the selections and substitutions result in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0074] The term “pharmaceutically acceptable salt” refers to salts or zwitterions of the compounds which are water or oil-soluble or dispersible, suitable for treatment of disorders without undue toxicity, irritation, and allergic response, commensurate with a reasonable benefit / risk ratio and effective for their intended use. The salts may be prepared during the final isolation and purification of the compounds or separately by reacting an amino group of the compounds with a suitable acid. For example, a compound may be dissolved in a suitable solvent, such as but not limited to methanol and water and treated with at least one equivalent of an acid, like hydrochloric acid. The resulting salt may precipitate out and be isolated by filtration and dried under reduced pressure. Alternatively, the solvent and excess acid may be removed under reduced pressure to provide a salt. Representative salts include acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, isethionate, fumarate, lactate, maleate, methanesulfonate, naphthylenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3 -phenylpropionate, picrate, oxalate, maleate, pivalate, propionate, succinate, tartrate, trichloroacetate, trifluoroacetate, glutamate, para-toluenesulfonate, undecanoate, hydrochloric, hydrobromic, sulfuric, phosphoric and the like. The amino groups of the compounds may also be quatemized with alkyl chlorides, bromides, and iodides such as methyl, ethyl, propyl, isopropyl, butyl, lauryl, myristyl, stearyl and the like.

[0075] Basic addition salts may be prepared during the final isolation and purification of the disclosed compounds by reaction of a carboxyl group with a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation such as lithium, sodium, potassium, calcium, magnesium, or aluminum, or an organic primary, secondary, or tertiary amine. Quaternary amine salts can be prepared, such as those derived from methylamine, dimethylamine, trimethylamine,triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N- methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N- dibenzylphenethylamine, 1 -ephenamine and N,N'-dibenzyl ethylenediamine, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, and the like.

[0076] Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.Methods

[0077] Provided herein are methods for specifically and selectively killing, promoting cell death, or inhibiting cell cycle progression or proliferation of a cell expressing a mutant splicing factor. The methods and compounds disclosed herein affect those cells specifically and selectively expressing the mutant splicing factor at a statistical significance from wild-type or cells which do not express the mutant splicing factor.

[0078] The mutant splicing factor may include Splicing Factor 3b Subunit 1 (SF3B1) mutant, U2 Small Nuclear RNA Auxiliary Factor 1 (U2AF1) mutant, Serine And Arginine Rich Splicing Factor 2 (SRSF2) mutant, or combinations thereof. In some embodiments, the mutant splicing factor is K700E SF3B1, S34F U2AF1, P95H SRSF2, or a combination thereof.

[0079] In some embodiments, the methods comprise contacting the cell with a compound as listed in any of Tables 2-6. In some embodiments, the methods comprise contacting the cell with one or more compounds selected from:

[0080] In some embodiments, the methods comprise contacting the cell with a compound of formula (I),pharmaceutically acceptable salt thereof, wherein,R1is a 5-membered heteroaryl;R2is a 5-membered heteroaryl;R3is hydrogen or OH; andR4is a 5 or 6 membered cycloalkyl, cycloalkylene, heterocyclyl, aryl or heteroaryl, optionally substituted with one or more R5; wherein each R5is independently halogen, C1-6haloalkyl, or cyano.

[0081] In some embodiments, R1and R2are each independently selected fromiments, each of R1and R2areIn some embodiments, each ofsome embodiments,

[0082] In some embodiments, R4is a 5-membered cycloalkyl.

[0083] In some embodiments, R4is a 5-membered heteroaryl, optionally substituted with one or more R5; wherein each R5is independently halogen, C1-6haloalkyl, or cyano. In some embodimentswherein X is O or S, n is 0, 1 , or 2 and each R5is independently halogen, C1-6haloalkyl, or cyano.

[0084] In some embodiments, n is 0. In some embodiments, n is 1.

[0086] In some embodiments, R5is halogen. In some embodiments, R5is chloro, fluoro, or bromo.

[0087] In some embodiments, R4is a 6-membered aryl or cycloalkylene, optionally substituted with one or more R5; wherein each R5is independently halogen, Ci-ehaloalkyl, or cyano.

[0088] In some embodiments, R4 iswherein m is 0, 1 , or 2 and each R5is independently halogen, Ci-ehaloalkyl, or cyano.wherein each R5is independently halogen, Ci-ehaloalkyl, or cyano. In some embodiments, each R5is independently selected from chloro, fluoro, and bromo.

[0091] In some embodiments, the mutant splicing factor is a U2AF1 mutant, and the compound is one or more of those listed in Tables 2 and 5, or a compound of formula (I) as described above. In some embodiments, the mutant splicing factor is a U2AF1 mutant and thesplicing factor is a U2AF 1 mutant and the compound is one or more of:embodiments, the mutant splicing factor is a U2AF1 mutant, and the compound is

[0092] In some embodiments, the mutant splicing factor is an SF3B1 mutant and the compound is one or more of those listed in Tables 3 and 6. In some embodiments, the mutantsplicing factor is an SF3B1 mutant and the compound is one or more of:

[0093] In some embodiments, the mutant splicing factor is a SRSF2 mutant, and the compound is one or more of those listed in Table 4. In some embodiments, the mutant splicing factor is a SRSF2 mutant and the compound is one or more of:

[0094] In some embodiments, the methods promote cell death by increasing DNA damage, inhibiting DNA repair mechanisms, and / or increasing cell cycle arrest. In some embodiments, the compound(s) interacts with to effect, positively or negatively, DNA damage, DNA repair, and cell cycle proteins and process. For example, the compound(s) may inhibit DNA repair mechanisms such as base excision repair, nucleotide excision repair, mismatch repair, homologous recombination, and non-homologous end joining, by interacting with proteins and enzymes which identify or correct DNA damage,

[0095] The methods described herein may be applied to cell populations in vivo or ex vivo. “Ex vivo” means outside of a living individual. Examples of ex vivo cell populations include in vitro cell cultures and biological samples including fluid or tissue samples obtained from individuals. Such samples may be obtained by methods well known in the art. “In vivo” meanswithin a living subject. In this context, the methods described herein may be used therapeutically in an individual. In this context, the methods described herein may be used for a variety of purposes, including therapeutic and experimental purposes. For example, the methods may be used ex vivo to determine the optimal schedule and / or dosing of administration for a given indication, cell type, individual, and other parameters. Information gleaned from such use may be used for experimental purposes or in the clinic to set protocols for in vivo treatment. In some embodiments, the cell is in vitro or ex vivo.

[0096] In some embodiments, the cell is in a subject. Thus, in some embodiments, the method comprises administering to the subject the compound or composition thereof.

[0097] In some embodiments, the subject has or is suspected of having a disease or disorder characterized by mutant splicing factor. In some embodiments, the disease or disorder is characterized by the mutant splicing factors described herein.

[0098] Accordingly, further provided herein are methods of treating or preventing a disease or disorder in a subject, comprising administering to the subject a compound as described above, for example, a compound as in Tables 2-6, a compound of formula (I), as described above, or a pharmaceutically acceptable salt thereof or pharmaceutical composition comprising the compound.

[0099] In some embodiments, the subject has or is suspected of having disease cells expressing a mutant splicing factor. Prior to treatment, subjects to be treated can be identified by determining characteristics that indicate the suitability of the treatment for that subject. For example, the disclosed compounds and methods are particularly useful for subjects having cancer where cells of the cancer express a mutant splicing factor. In some embodiments, the methods comprise determining if the subject disease or disorder comprises diseased cells expressing a mutant splicing factor, such as for example, those described elsewhere herein. In some embodiments, diagnostic methods, such as biopsies, sequencing, and ELISA methods are common methods that can be used to determine if the subject expresses a mutant splicing factor.

[0100] In some embodiments, the subject has or is suspected of having a proliferative disease or disorder, e.g., a disease or disorder that occurs due to abnormal growth or extension by the multiplication or replication of cells. Proliferative diseases or disorders may include benign, premalignant, and malignant cell proliferation.

[0101] In some embodiments, the proliferative disease is cancer. The term cancer refers to a class of diseases characterized by the development of abnormal cells that proliferate uncontrollably and have the ability to infiltrate and destroy normal body tissues. In some embodiments, the cancer comprises a solid tumor. In some embodiments, the cancer is metastatic cancer. In some embodiments, the disclosed methods result in suppression of elimination of metastasis. In some embodiments, the disclosed methods result in decreased tumor growth. In some embodiments, the disclosed methods prevent tumor recurrence. The cancer may be a primary or secondary cancer in that it can be located where it originated or originate from cancer in other organs (e.g., metastatic cancers), respectively.

[0102] In some embodiments, the cancer is characterized by increased DNA damage and / or DNA double strand breaks. Such cancers include, but are not limited to those cancers with mutations of BRCA1 and BRCA2 genes, cancer with homologous recombination deficiency (e.g., BRCAness phenotype), chromosomal instability (CIN), and microsatellite instability (MSI).

[0103] The disclosed methods may be useful to treat a wide variety of cancers including carcinoma, sarcoma, lymphoma, leukemia, melanoma, mesothelioma, multiple myeloma, or seminoma. Exemplary cancers include, but are not limited to, adrenocortical carcinoma, anal cancer, appendix cancer, basal cell carcinoma, cholangiocarcinoma, bladder cancer, bone cancer, osteosarcoma or malignant fibrous histiocytoma, brain cancer (e.g., brain stem glioma, astrocytoma (e.g., cerebellar, cerebral, etc.), atypical teratoid / rhabdoid tumor, central nervous system embryonal tumors, malignant glioma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and / or pineoblastoma, visual pathway and / or hypothalamic glioma, brain and spinal cord tumors, etc.), breast cancer, bronchial tumors, carcinoid tumor (e.g., gastrointestinal, etc.), carcinoma of unknown primary, cervical cancer, chordoma, chronic myeloproliferative disorders, colon cancer, colorectal cancer, embryonal tumors, cancers of the central nervous system, endometrial cancer, ependymoma, esophageal cancer, Ewing family of tumors, eye cancer (e.g., intraocular melanoma, retinoblastoma, etc.), gallbladder cancer, gastric cancer, gastrointestinal tumor (e.g., carcinoid tumor, stromal tumor (gist), stromal cell tumor, etc.), germ cell tumor (e.g., extracranial, extragonadal, ovarian, etc.), gestational trophoblastic tumor, head and neck cancer,hepatocellular cancer, hypopharyngeal cancer, hypothalamic and visual pathway glioma, intraocular melanoma, islet cell tumors, Kaposi sarcoma, kidney cancer, large cell tumors, laryngeal cancer (e.g., acute lymphoblastic, acute myeloid, etc.), leukemia (e.g., myeloid, acute myeloid, acute lymphoblastic, chronic lymphocytic, chronic myelogenous, multiple myelogenous, hairy cell, etc.), lip and / or oral cavity cancer, liver cancer, lung cancer (e.g., nonsmall cell, small cell, etc.), lymphoma (e.g., AIDS-related, Burkitt, cutaneous Tcell, Hodgkin, non-Hodgkin, primary central nervous system, cutaneous T-cell, Waldenstrom macroglobulinemia, etc.), malignant fibrous histiocytoma of bone and / or osteosarcoma, medulloblastoma, medulloepithelioma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic / myeloproliferative diseases (e.g., myeloproliferative disorders, chronic, etc.), nasal cavity and / or paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oral cancer; oral cavity cancer, oropharyngeal cancer; osteosarcoma and / or malignant fibrous histiocytoma of bone: ovarian cancer (e.g., ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, etc.), pancreatic cancer (e.g., islet cell tumors, etc.), papillomatosis, paranasal sinus and / or nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastema, prostate cancer, rectal cancer, renal cell cancer, transitional ceil cancer, respiratory tract carcinoma involving the nut gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma (e.g., Ewing family of tumors, Kaposi, soft tissue, uterine, etc.), Sezary syndrome, skin cancer (e.g., non-melanoma, melanoma, merkel cell, etc.), small intestine cancer, squamous cell carcinoma, squamous neck cancer with occult primary, metastatic, stomach cancer, supratentorial primitive neuroectodermal tumors, testicular cancer, throat cancer, thymoma and / or thymic carcinoma, thyroid cancer, transitional cell cancer of the renal, pelvis and / or ureter (e.g., trophoblastic tumor, unknown primary site carcinoma, urethral cancer, uterine cancer, endometrial, uterine sarcoma, etc.), vaginal cancer, visual pathway and / or hypothalamic glioma, vulvar cancer, Wilms tumor, and the like. In some embodiments, the cancer is any cancer vulnerable to membrane permeabilization or lysosome related tumorigenicity.

[0104] In select embodiments, the cancer is a hematologic cancer. In some embodiments, the cancer is selected from the group consisting of acute myeloid leukemia (AML, acute myelogenous leukemia), acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and acute monocytic leukemia.

[0105] The term “myeloid leukemia” as used herein refers to leukemia characterized by proliferation of myeloid tissue and an abnormal increase in the number of granulocytes, myelocytes and myeloblasts in the circulating blood. This term is synonymous with the terms myelocytic leukemia, myelogenic leukemia, myelogenous leukemia, and granulocytic leukemia. Myeloid leukemia encompasses acute and chronic myeloid leukemias (AML and CML), acute promyelocytic leukemia (APL), chronic myelomonocytic leukemia (CMML), myelodysplastic syndrome and juvenile myelomonocytic leukemia which involve the myeloid elements of the bone marrow (e.g., white cells, red cells, and megakaryocytes) and includes all subtypes which are defined by morphological, histochemical and immunological techniques that are well known by those skilled in the art.

[0106] In some embodiments, the subject has or is suspected of having acute myeloid leukemia. Acute myeloid leukemia is characterized by an uncontrolled proliferation of progenitor cells of myeloid origin including, but not limited to, myeloid progenitor cells, myelomonocytic progenitor cells, immature megakaryoblasts.

[0107] In some embodiments, AML is AML with at least one genetic abnormality, AML with multilineage dysplasia, therapy-related AML, undifferentiated AML, AML with minimal maturation, AML with maturation, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroid leukemia, acute megakaryoblastic leukemia, acute basophilic leukemia, acute panmyelosis with fibrosis or myeloid sarcoma.

[0108] In some embodiments, AML is AML with at least one genetic abnormality. Somatic mutations in various genes have been identified as being relevant to AML pathogenesis. These include mutations in fins-related tyrosine kinase 3 (FLT3), nucleophosmin (NPM1), isocitrate dehydrogenase 1(IDH1), isocitrate dehydrogenase 2 (IDH2), DNA (cytosine-5)- methyltransferase 3 (DNMT3A), CCAAT / enhancer binding protein alpha (CEBPA), U2 small nuclear RNA auxiliary factor 1 (U2AF1), enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), structural maintenance of chromosomes 1A (SMC1A) and structuralmaintenance of chromosomes 3 (SMC3) (The Cancer Genome Atlas Research Network; N Engl J Med 368:2059-74, 2013).

[0109] In some embodiments, the cancer to be treated is a cancer having substantial potential to metastasize to the bone marrow, including for example, prostate cancer, breast cancer, lung cancer and melanoma, all of which show high rates of metastasis to the bone and can home into the niche occupied by hematopoietic stem cells.

[0110] Examples of noncancerous cellular proliferative disorders include, but are not limited to, fibroadenoma, adenoma, intraductal papilloma, nipple adenoma, adenosis, fibrocystic disease or changes of breast, plasma cell proliferative disorder (PCPD), restenosis, atherosclerosis, rheumatoid arthritis, myofibromatosis, fibrous hamartoma, granular lymphocyte proliferative disorders, benign hyperplasia of prostate, heavy chain diseases (HCDs), lymphoproliferative disorders, psoriasis, idiopathic pulmonary fibrosis, scleroderma, cirrhosis of the liver, TgA nephropathy, mesangial proliferative glomerulonephritis, membranoproliferative glomerulonephritis, hemangiomas, vascular and non-vascular intraocular proliferative disorders, and the like.

[0111] In some embodiments, the subject has or is suspected of having a hematopoietic stem cell disorder. Hematopoietic stem cell disorders are characterized by one or more of the following: ineffective blood cell production, progressive cytopenias, risk of progression to acute leukemia or cellular marrow with impaired morphology and maturation (dysmyelopoiesis).

[0112] In certain embodiments, the hematopoietic stem cell disorder is myelodysplastic syndrome (MDS, myelodysplasia). Myelodysplastic syndromes are a group of disorders caused by blood cells that are poorly formed or don't work properly, myelodysplastic syndromes can be divided into subtypes based on the type of blood cells, e.g., red cells, white cells and platelets, and are often diagnosed based on certain changes in the blood cells and bone marrow, e.g., refractory anemia, refractory anemia with ring sideroblasts, refractory anemia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, unclassifiable myelodysplastic syndrome, myelodysplastic syndrome associated with an isolated del(5q) chromosome abnormality, chronic myelomonocytic leukemia (CMML).

[0113] In some embodiments, the methods may further comprise administration with one or more additional therapies to treat the disease or disorder, or one or more symptoms of the disease or disorder. The additional therapy may include administration of an additional therapeutic agentor a therapy not connected to the administration of another agent including surgery, radiotherapy, bone marrow / stem cell transplantation, transfusion therapy (e.g., Red blood cell transfusions and platelet transfusions), physical therapy, and the like.

[0114] The additional therapy may be administered at the same time as the initial therapy. For example, either in the same composition or in a separate composition administered at substantially the same time as the first composition. In some embodiments, the additional therapy may precede or follow the treatment of the initial therapy by time intervals ranging from hours to months.

[0115] In some embodiments, the additional therapy includes administration of an additional therapeutic agent. The additional therapeutic agent may include an immune modulator, a chemotherapeutic agent, a steroid, an analgesic, an immunotherapy, iron chelation, hematopoietic growth factors, or a combination thereof.

[0116] Exemplary immune modulators include: indoleamine 2,3-dioxygenase (IDO) inhibitors and analogs thereof, such as, epacadostat, BMS-986205, indoximod, PF-06840003, and analogs thereof; signal transducer and activator of transcription 3 (Stat3) inhibitors and analogs thereof, such as, SM-36 and its analogs; toll-like receptor (TLR) agonists and analogs thereof, such as, imiquimod, resiquimod, selgantolimod, gardiquimod, SM-360320, TMX-101, TMX-202, TMX-302, TMX-306, GSK2245035, CL097, 852A, AZD-8848, DSP-3025, GS- 9620, R07020531, RO6871765, ANA773, DSP-0509, NJH395, BNT411, TQ-A3334, JNJ-4964, LHC165, CV8102, VTX-1463, VTX-2337, IMO-8400, IMO-3100, IRS-954, and analogs thereof; and statins or other lipid-lowering medications and analogs thereof, such as, atorvastatin, pravastatin, fluvastatin, simvastatin, lovastatin, mevastatin, pitavastatin, rosuvastatin, and analogs thereof.

[0117] In some embodiments, the additional therapeutic agent comprises at least one chemotherapeutic agent. As used herein, the term “chemotherapeutic” or “anti-cancer drug” includes any small molecule or other drug used in cancer treatment or prevention. Chemotherapeutics include, but are not limited to, azacitidine, decitabine, cytarabine, cyclophosphamide, methotrexate, 5-fluorouracil, doxorubicin, docetaxel, daunorubicin, bleomycin, vinblastine, dacarbazine, cisplatin, paclitaxel, raloxifene hydrochloride, tamoxifen citrate, abemacicilib, afinitor (Everolimus), alpelisib, anastrozole, pamidronate, anastrozole, exemestane, capecitabine, epirubicin hydrochloride, eribulin mesylate, toremifene, fulvestrant,letrozole, gemcitabine, goserelin, ixabepilone, emtansine, lapatinib, olaparib, megestrol, neratinib, palbociclib, ribociclib, talazoparib, thiotepa, toremifene, methotrexate, and tucatinib. In select embodiments, the chemotherapeutic agent comprises paclitaxel.

[0118] In certain embodiments, treatment according to the present methods results in a reduction (e.g., about a 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, 97.5%, 99% or more reduction) or a complete elimination of the presence, or alternatively the accumulation, of one or more pathological, clinical, or biological markers that are associated with the particular disease or disorder

[0119] In some embodiments, treatment according to the present methods results in increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient. In some embodiments, treatment results in an increased life survival by more than about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more, as compared to an average survival time (e.g., life expectancy of one or more control individuals with a select disease without treatment). In some embodiments, treatment results in an increased life expectancy of a patient by more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or more, as compared to the average life expectancy of one or more control individuals without treatment. In some embodiments, treatment results in long term survival of a patient.

[0120] The term “improve,” “increase,” or “reduce,” as used herein, indicates values that are relative to a control. In some embodiments, a suitable control is a baseline measurement, such as a measurement in the same cell or same individual prior to initiation of the treatment described herein, or a measurement in a control cell(s) or individual(s) in the absence of the treatment described herein. For example, a “control individual” is an individual afflicted with a select disease, who is approximately the same age and / or gender as the individual being treated (toapproximate that the stages of the disease in the treated individual and the control individual(s) are comparable).Compositions

[0121] Any of the compounds disclosed herein may be delivered or administered as pharmaceutical compositions. Thus, further disclosed herein are pharmaceutical compositions comprising a compound as in Tables 2-6, a compound of formula (I) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier. In some embodiments, the pharmaceutical compositions comprise at least one additional therapeutic agent, as described above.

[0122] The phrase “pharmaceutically acceptable,” as used in connection with compositions and / or cells of the present disclosure, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a subject (e.g., a mammal, a human). Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. “Acceptable” means that the carrier is compatible with the active ingredient of the composition (e.g., the nucleic acids, vectors, cells, or therapeutic antibodies) and does not negatively affect the subject to which the composition(s) are administered. Any of the pharmaceutical compositions and / or cells to be used in the present methods can comprise pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formations or aqueous solutions.

[0123] Pharmaceutically acceptable carriers, including buffers, are well known in the art, and may comprise phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; amino acids; hydrophobic polymers; monosaccharides; disaccharides; and other carbohydrates; metal complexes; and / or non-ionic surfactants. See, e.g., Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. K. E. Hoover.Administration

[0124] In the methods disclosed herein, administration may be by any convenient route of administration, whether systemically / peripherally or at the site of desired action, including but not limited to, oral (e.g., by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g., by inhalation or insufflation therapy using, e.g., an aerosol, e.g., through mouth or nose); rectal; vaginal; parenteral (e.g., by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrastemal injection); or by implant of a depot, for example, subcutaneously or intramuscularly.

[0125] When utilized as a method of treatment, the effective amount and / or dosage may depend on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. In some embodiments, the effective amount alleviates, relieves, ameliorates, improves, reduces the symptoms, or delays the progression of any disease or disorder in the subject. In some embodiments, the subject is a human.

[0126] In the context of the present disclosure insofar as it relates to any of the disease conditions recited herein, the terms “treat,” “treatment,” and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition. Within the meaning of the present disclosure, the term “treat” also denotes to arrest, delay the onset (e.g., the period prior to clinical manifestation of a disease) and / or reduce the risk of developing or worsening a disease,

[0127] It will be appreciated that appropriate dosages can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present disclosure. The selected dosage level will depend on a variety of factors including, but not limited to, the relative activity of the selected compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and / or materials used in combination, and the age, sex, weight, condition, general health, and priormedical history of the patient. The amount and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side-effects.

[0128] Administration in vivo can be in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.

[0129] The compound or composition thereof may be administered once, on a continuous basis (e.g. by an intravenous drip), or on a periodic / intermittent basis, including about once per hour, about once per two hours, about once per four hours, about once per eight hours, about once per twelve hours, about once per day, about once per two days, about once per three days, about twice per week, about once per week, and about once per month. The compound or composition thereof may be administered until a desired reduction of symptoms is achieved.

[0130] Other therapies, as included in the above methods, may be used in combination with the compound or composition thereof. Administered “in combination,” as used herein, means that two (or more) different treatments are delivered to the subject during the course of the subject's affliction with the disorder, e.g., the two or more treatments are delivered after the subject has been diagnosed with the disorder and before the disorder has been cured or eliminated or treatment has ceased for other reasons. In some embodiments, the delivery of one treatment is still occurring when the delivery of the second begins, so that there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment ends before the delivery of the other treatment begins. In some embodiments of either case, the treatment is more effective because of combined administration. The effect of the two treatments can be partially additive, wholly additive, or greater than additive. The delivery can be such that an effect of the first treatment delivered is still detectable when the second is delivered.

[0131] The following examples further illustrate aspects of the disclosure, but should not be construed as in any way limiting its scope.EXAMPLES Example 1 Genetically engineered cell lines for phenotypic high-throughput screen (HTS)

[0132] Somatic mutations in splicing factors (SF), such as SF3B1, U2AF1, and SRSF2, are the most common mutations in clonal myeloid disorders, including MDS and AML, with an estimated prevalence of up to 60% in any given MDS patient cohort. Genetically engineered K562 leukemia cell lines harboring the 3 most common hotspot mutations in SF genes - (SF3BlK700E, U2AF1S34F, and SRSF2P95"' were created using a CRISPR-Cas9 knock-in technology. All K562 knock-in cell lines were generated using sgRNAs cloned into the pSpCas9(BB)-2A-GFP(PX458; Addgene) vector, and electroporated with ssODNs using the Neon Electroporation system (Invitrogen). After 48-72 h, cells were sorted for expression of GFP using the BD FACSAria cell sorter and plated into 96-well to generate single-cell clones.

[0133] SF3BlK700Eknock-in K562 cell lines and WT controls: The human SF3B1 CRISPR guide RNA was 5’-TGGATGAGCAGCAGAAAGTTcgg-3’ (SEQ ID NO: 1). The singlestranded oligodeoxynucleotides (ssODNs, Integrated DNA Technologies) for WT and K700E SF3B1 were 5’- AATGTTGGGGCATAGTTAAAACCTGTGTTTGGTTTTGTAGGTCTTGTGGATGAGCAG CAGAAAGTGCGCACCATCAGTGCTTTGGCCATTGCTGCCTTGGCTGAAGCAGCAACT CCTTATGGTATCGAAT-3’ (SEQ ID NO: 2) and 5’- AATGTTGGGGCATAGTTAAAACCTGTGTTTGGTTTTGTAGGTCTTGTGGATGAGCAG CAGGAAGTGCGCACCATCAGTGCTTTGGCCATTGCTGC CTTGGCTGAAGCAGCAACTCCTTATGGTATCGAAT-3’ (SEQ ID NO: 3), respectively. SF3B1 mutation knock-in was confirmed using PCR amplification of genomic DNA (forward primer:5’- GTTGATATATTGAGAGAATCTGGATG-3’ (SEQ ID NO: 4); and reverse primer: 5’-AAATCAAAAGGTAATTGGTGGA-3’ (SEQ ID NO: 5)) and DNA sequencing. The DNA chromatogram a representative K562 / SF3B1 mutant clone demonstrated the stable expression of K700E and two silent mutations in SF3B1 mRNA.

[0134] U2AF1S34Fknock-in K562 cell lines and WT controls: The human U2AF1 CRISPR guide RNA was 5’- AAAATTGGAGCATGTCGTCATGG-3 ’ (SEQ ID NO: 6) and the mutant ssODN was 5’-ttacagagtc aac tgt tea ttt tat ttc aaa att gga gca tgt cgt cat gga gac Cgg tgc tTt egg ttg cac aat aaac cgacgtttag ccaggtttgt tgcctttttttcatgtaaa ttataaaaac-3 ’ (SEQ ID NO: 7). U2AF1mutation knock-in was confirmed using PCR amplification of genomic DNA (forward primer: 5’- TGCTGCTGACATATTCCATGT-3’ (SEQ ID NO: 8); and reverse primer: 5’- AGTCGATCACCTGCCTCACT -3’ (SEQ ID NO: 9)) and DNA sequencing. The DNA chromatogram from a representative K562 / U2AF1 mutant clone showed the introduction of S34F and two silent mutations in the U2AF1 gene.

[0135] SRSF2P95Hknock-in K562 cell lines and WT controls: The human SRSF2 CR1SPR guide RNA (gRNA) (5'-GGCGCGCTACGGCCGCCCCCcgg-3' (SEQ ID NO: 10)), WT ssODN was 5'-ATGGACGGGGCCGTGCTGGACGGCCGCGAGCTGCGGGTGCAAATGGCGCGCTACGG CCGgCCCCCaGACTCACACCACAGCCGCCGGGGACCGCCACCCCGCAGGTACGGGGG CGGTGGCTAC-3' (SEQ ID NO: 11), and P95H mutant 5'- ATGGACGGGGCCGTGCTGGACGGCCGCGAGCTGCGGGTGCAAATGGCGCGCTACGG gCGCCaCCCaGACTCACACCACAGCCGCCGGGGACCGCCACCCCGCAGGTACGGGGG CGGTGGCTAC-3’ (SEQ ID NO: 12). SRSF2 mutation knock-in was confirmed using PCR amplification (forward primer: 5'-TCCCGCGGCTTCGCCTTCGTTC-3' (SEQ ID NO: 13); reverse primer: 5'-CCGCCTCCCGCGGTCCCCTCAG-3' (SEQ ID NO: 14)).

[0136] The DNA chromatogram from a representative P95H / SRSF2 mutant clone showed the introduction of P95H and two synonymous mutations in the SRSF2 gene.

[0137] A high-throughput viability screen of 50,000 investigational compounds from a manually curated chemical library in K562 leukemia cell lines harboring hotspot mutations in splicing factors (SF3BlK700E, U2AF1S34F’ and SRSF2P95H) and WT cells. The ratio between the cellular IC50 of the WT cells and SF-mutant cells was used to infer the specificity of the compounds. A schematic of the screening in K562 leukemia cells is shown in FIG. 1. The parameters of phenotypic HTS using the genetically engineered SF-mutant cell lines are shown in Table 1. Hit compounds for each of the SF-mutants are shown in Tables 2-6.Table 1

[0138] A high-throughput viability screen of 50,000 investigational compounds from a manually curated chemical library in K562 leukemia cell lines harboring hotspot mutations in splicing factors (SF3B1K7(I(IE, U2AF1S34F, and SRSF2P95H) and WT cells. The ratio between the cellular IC50 of the WT cells and SF-mutant cells was used to infer the specificity of the compounds. A schematic of the screening in K562 leukemia cells is shown in FIG. 1. The parameters of phenotypic HTS using the genetically engineered SF-mutant cell lines are shown in Table 1.

[0139] Compound hits based on the criteria described above for each of U2AF1S34F, SF3BlK700E, and .S' / ?.S'F2?95 / / SF-mutant cells are in each of Tables 2-4, respectively.Table 2Table 3Table 4

[0140] Analogs and variants of the compound hits described above for each of U2AF1S34F, SF3BlK700E, and .S' / ?.S'F2P95HSF-mutant cells were also subjected to dose-response curve validation assays and pharmacokinetic and specificity index readouts. Tables 5 and 6 show the analogs of compounds identified above which show activity in specifically killing U2AF1S34Fand SFTS7^700£SF-mutant cells, respectively.Table 5Table 6Example 2Small molecule binder of Ku70 induces selective lethality of U2A / / -mutant leukemia cells

[0141] Compound 1, F6181-0028 shown in Table 2, specifically reduces the viability of U2AF1 -mutant cells but spares WT cells at lOuM (FIGS. 6A and 6B). The IC50 for U2AF1WTwas 26.61 pM, whereas the IC50 for U2AF1S34Fwas 9.74 pM, resulting in a specificity ration of 2.73. Treatment of cells with compound 1 induced increased apoptosis, G2-phase arrest, and phosphorylated gamma-H2AX staining of U2AF1 -mutant cells, as measured by flow cytometry (FIGS. 7A-7D and 12A-12F).

[0142] Wild-type and mutant cells were stained with their respective dye for 45 min at 37C (FIG. 8A). Flow cytometry and fluorescence microscopy were used to confirm that -100% of the cells were stained. Cells were then mixed in a 1 : 1 ratio and then incubated with 1 OuM of compound 1 (FIG. 8A, right). FIG. 8B shows a reduction of the percentage of mutant cells upon exposure to compound 1 while the percentage of WT cells increased. FIGS. 8C and 8D show western blot detection of apoptosis and DNA damage markers in WT and mutant cells. Increased expression of PARP, cleaved-PARP (c-PARP), and cleaved-caspase 3 (c-casp3) was seen in mutant cells upon treatment with compound 1. Cleavage of PARP and caspase 3 are key markers of apoptosis (programmed cell death) that are specifically increased in mutant cells.Additionally, the western blots show increased expression of phosphorylated gamma-H2AX on Serine 139 (gH2AX) which is a marker of DNA double-strand breaks.

[0143] Pre -treatment with compound 1 followed by treatment with ionizing radiation increased phosphorylation of Chk2 in mutant cells compared to wild type (FIG. 13). Phosphorylation of Chk2 is a marker of G2 / M cell cycle arrest and activation of the G2 / M phaseDNA damage cell cycle checkpoint, suggesting mutant cells are more sensitive to the combined effects of phosphorylation of Chk2 and radiation treatment. Comparison is shown to pretreatment with the DNA-PK inhibitor NU7441 (Di).

[0144] Without being bound by theory, compound 1 may specifically kills U2AF lS34F+ / ~ cells through increased DNA damage. Compound 1 induced selective lethality of U2AF1 -mutant cells by increasing DNA double-strand breaks, which could lead to the observed activation of the G2 / M DNA damage checkpoint, G2 / M phase cell cycle arrest, and subsequent apoptosis. Since U2AF 1 -mutant cells have increased DNA double-strand breaks due to inherent DNA damage, these cells are likely more sensitive to compound 1. Compound 1 could be used as a synthetic lethal drug for any cancer with increased DNA damage and / or DNA double strand breaks such as those with mutations of BRCA1 and BRCA2 genes, cancer with homologous recombination deficiency (e.g., BRCAness phenotype), chromosomal instability (ON), and microsatellite instability (MSI), for example.

[0145] To identify the cellular target of compound 1, a drug affinity responsive target stability (DARTS) assay was used and identified Ku70 / XRCC6 to be protected from pronase digestion by incubation with compound 1 in vitro using mass spectrometry (FIGS. 9A-9C). Compound 1 protects Ku70 from heat denaturation of live cells treated with the drug through the cellular thermal shift assay (CETSA) coupled with immunoblotting (FIGS. 10A-10C). These target engagement assays collectively show that compound 1 binds to Ku70 in vitro and in vivo. Target deconvolution chemoproteomic methods based on drug-induced protein stability indicated that Compound 1 targets to Ku70 / Ku80 heterodimer in vivo (FIG. 10D).

[0146] Ku70 forms a heterodimer with its interacting partner Ku80 and, together, these proteins act in non-homolog ous end-joining (NHEJ) by recognizing DNA double-strand breaks and recruiting the NHEJ machinery to those sites for DNA repair. Given that compound 1 induces selective lethality of U2AF1 -mutant cells and targets the NHEJ protein Ku70, Ku70 inhibition could be a genetic vulnerability of U2AF1 -mutant cells. To explore this, U2AF1- mutant cells and WT controls were electroporated with siRNAs targeting Ku70 (Sigma), and Ku70 knockdown (FIG. 11 A) led to increased apoptosis of U2AF1 -mutant cells, partly phenocopying the effects of compound 1 (FIGS. 1 IB-1 ID). Moreover, a missplicing event of the translesion DNA polymerase POLK specific to U2AF1S34Fcells that leads to the downregulationof this protein was also identified and could potentially be lethal with compound 1 -mediated NHEJ inhibition.

[0147] The results collectively show that compound 1 is a cell-permeable Ku70 binder that selectively kills U2AF1 -mutant K562 leukemia cells and NHEJ inhibition may be a genetic vulnerability of U2AF1S34Fmutant cells.

[0148] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0149] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0150] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

CLAIMS1. A method for specifically and selectively killing, promoting cell death, or inhibiting cell cycle progression or proliferation of a cell expressing a mutant splicing factor, comprising contacting the cell with one or more compounds selected from:

2. A method for specifically and selectively killing, promoting cell death, or inhibiting cell cycle progression or proliferation of a cell expressing a mutant splicing factor, comprising contacting the cell with a compound of formula (I),or a pharmaceutically acceptable salt thereof, wherein,R1is a 5-membered heteroaryl;R2is a 5-membered heteroaryl;R3is hydrogen or hydroxy; andR4is a 5 or 6 membered cycloalkyl, cycloalkylene, heterocyclyl, aryl, or heteroaryl, optionally substituted with one or more R5, wherein each R5is independently halogen, Ci-6 haloalkyl, or cyano.

3. The method of claim 2, wherein each of R1and R2areeach of R1and R2are4. The method of claim 2 or 3, wherein R4is: a 5-membered heteroaryl, optionally substituted with one or more R5, wherein each R5is independently halogen, Ci-6 haloalkyl, or cyano;each R5is independently halogen, Ci-6 haloalkyl, or cyano, preferably wherein n is 0 or 1;wherein R5is halogen, wherein R5is preferably chloro, fluoro, or bromo; a 6-membered aryl or cycloalkylene, optionally substituted with one or more R5, wherein each R5is independently halogen, Ci-6 haloalkyl, or cyano;cyano; and / or selected fromwherein each R5is independently halogen, Ci-6 haloalkyl, or cyano, wherein each R5is preferably independently selected from chloro, fluoro, and bromo.

5. The method of any of claims 2-4, wherein the compound of formula (I) is selected from:

6. The method of any of claims 1-5, wherein the mutant splicing factor is Splicing Factor 3b Subunit 1 (SF3B1) mutant, U2 Small Nuclear RNA Auxiliary Factor 1 (U2AF1) mutant, Serine And Arginine Rich Splicing Factor 2 (SRSF2) mutant, or a combination thereof.

7. The method of any of claims 1-6, wherein the mutant splicing factor is K700E SF3B1, S34F U2AF1, P95H SRSF2, or a combination thereof.

8. The method of any of claims 1-7, wherein the mutant splicing factor is a U2AF1 mutant andwherein the mutant splicing factor is an SF3B1 mutant andsplicing factor is a SRSF2 mutant and the compound is one or more of:

9. The method of any of claims 1-8, wherein the method promotes cell death by increasing DNA damage, inhibiting DNA repair mechanisms, and / or increasing cell cycle arrest.

10. The method of any of claims 1-9, wherein the cell is in vitro, ex vivo, or in a subject.

11. A method of treating a disease or disorder in a subject comprising administering to the subject an effective amount of a compound selected from:or a pharmaceutically acceptable salt thereof, wherein,R1is a 5-membered heteroaryl;R2is a 5-membered heteroaryl;R3is hydrogen or hydroxy; andR4is a 5 or 6 membered cycloalkyl, cycloalkylene, heterocyclyl, aryl or heteroaryl, optionally substituted with one or more R5; wherein each R5is independently halogen, Ci-6 haloalkyl, or cyano, or a pharmaceutical composition thereof.

12. The method of claim 11, wherein each of R1and R2are, each of R1and R2are13. The method of claim 11 or 12, wherein R4is: a 5-membered heteroaryl, optionally substituted with one or more R5, wherein each R5is independently halogen, C1-6haloalkyl, or cyano;C1-6haloalkyl, or cyano, preferably wherein n is 0 or 1; selected fromwherein R5is halogen, wherein R5is preferably chloro, fluoro, or bromo; a 6-membered aryl or cycloalkylene, optionally substituted with one or more R5, wherein each R5is independently halogen, C1-6haloalkyl, or cyano;m is 0, 1, or 2, and each R5is independently halogen, C1-6haloalkyl, or cyano; and / orwherein each R5is independently halogen, Ci-6 haloalkyl, or cyano, wherein each R5is preferably independently selected from chloro, fluoro, and bromo.

14. The method of any of claims 11-13, wherein the compound of formula (I) is selected from:

15. The method of any of claims 11-14, wherein the subject is characterized by one or more of the following: has or is suspected of disease cells expressing a mutant splicing factor wherein the mutant splicing factor is a SF3B1 mutant, a U2AF1 mutant, a SRSF2 mutant, or a combination thereof, preferably wherein the mutant splicing factor is K700E SF3B1, S34F U2AF1, P95H SRSF2, or a combination thereof, has cancer; has a myelodysplastic syndrome; and has acute myeloid leukemia (AML).

Citation Information

Patent Citations

  • Ceramide analog saclac modulates sphingolipid levels and MCL-1 splicing to induce apoptosis in acute myeloid leukemia

    US20220387358A1

  • Targeting essential genes in acute myeloid leukemia (AML)

    WO2019023189A1