Microorganism having capability of controlling plant diseases
Bacillus sp. strain 201106_1 and its mutants provide a biological solution for controlling plant diseases and nematodes by leveraging both microbial cells and culture supernatants, addressing the limitations of chemical pesticides and enhancing control efficacy.
Patent Information
- Application Number
- PCT/JP2025/004054
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-15
- Filing Date
- 2025-02-07
- Publication Date
- 2025-08-21
AI Technical Summary
Existing synthetic chemical pesticides face issues such as resistance development in plant pathogens, phytotoxicity, and use restrictions, necessitating the development of biological alternatives that can effectively utilize both microbial cells and culture supernatants for plant disease control.
The use of Bacillus sp. strain 201106_1 (NITE BP-03884) or its mutant strains, which exhibit high control abilities against various plant diseases and nematodes, along with their culture supernatants, providing a composition for plant disease and nematode control.
The Bacillus sp. strain 201106_1 and its mutants effectively control a wide range of plant diseases and nematodes with low environmental impact, utilizing both microbial cells and culture supernatants for enhanced efficacy.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Microorganisms capable of controlling plant diseases
[0001] The present invention relates to a microorganism capable of controlling plant diseases. This application claims priority to Japanese Patent Application No. 2024-021425, filed February 15, 2024, the contents of which are incorporated herein by reference.
[0002] Many synthetic chemical pesticides are used as a primary method for controlling plant diseases. However, synthetic chemical pesticides have a limited number of sites of action, and repeated application of these pesticides has recently become a problem, leading to the development of resistance in plant pathogens. Furthermore, synthetic chemical pesticides are prone to causing phytotoxicity in agricultural and horticultural crops, and some have restrictions on the timing or crops on which they can be used.
[0003] On the other hand, interest in biological pesticides has been growing as a means to replace or be used in combination with conventional chemical synthetic pesticides.Biological pesticides are known to have advantages such as lower environmental impact, looser use restrictions to avoid crop residues, and a lower risk of developing resistant bacteria compared to conventional chemical synthetic pesticides.Biological pesticides have been used to control plant diseases of agricultural and horticultural crops, particularly gray mold, and include, for example, microorganisms belonging to the genera Trichoderma, Gliocladium, Pseudomonas, and Bacillus, and agricultural and horticultural fungicide compositions containing these microorganisms have also been researched and developed.
[0004] Known examples of Bacillus microorganisms that can be used to control plant diseases in agricultural and horticultural crops include Bacillus subtilis strain 4-5-1-1 No. 30 (Patent Document 1), Bacillus sp. strain 4-5-21 0306 (Patent Document 1), Bacillus sp. strain AT-332 (Patent Document 2), and Bacillus sp. strain AT-79 (Patent Document 2). Furthermore, as pesticides containing microorganisms of the genus Bacillus that can be used to control plant diseases, for example, "Agrocare Wettable Powder" (Non-Patent Document 1), which contains viable spores of the Bacillus subtilis HAI-0404 strain as an active ingredient, "Serenade ASO", which contains viable spores of the Bacillus subtilis QST-713 strain as an active ingredient, "Eco Shot", which contains viable spores of the Bacillus subtilis D747 strain as an active ingredient, and "Impression Clear", which contains viable spores of the Bacillus amyloliquefaciens AT-332 strain as an active ingredient, are on the market.
[0005] Patent No. 4695070 Patent No. 5198690
[0006] Pesticide Era No. 192, p. 49 (2010)
[0007] All four of these pesticides contain viable spores (i.e., bacterial cells) of Bacillus microorganisms as active ingredients. However, the culture supernatant obtained during microbial cultivation generally contains metabolic products of the microorganisms, and these metabolic products may contain abundant substances that have antagonistic effects against plant diseases. Therefore, from the perspective of pesticide production efficiency, it is preferable to not only utilize the microbial cells themselves, but also to effectively utilize the culture supernatant or its components obtained as a by-product for plant disease control. Furthermore, because the culture supernatant can be obtained as a liquid component, different formulation designs and utilization methods may be developed compared to bacterial cells, which are solid components. Therefore, it is desirable to obtain microorganisms that can effectively utilize not only the bacterial cells contained in the microbial culture but also the culture supernatant for plant disease control.
[0008] The present invention has been made in view of the above circumstances. That is, an object of the present invention is to provide a microorganism that has a low environmental impact, has excellent control ability against various plant diseases, and allows not only the microbial cells but also the culture supernatant contained in the culture of the microorganism to be effectively used for controlling plant diseases.
[0009] To solve the above problems, the present inventors collected, cultured, and isolated microorganisms from various plants to search for microorganisms with strong activity. As a result, they discovered microorganisms that exhibit high control abilities against a variety of plant diseases. Furthermore, it was shown that not only the microorganisms themselves but also the culture supernatants contained in their cultures can be effectively used to control plant diseases. Furthermore, the nucleotide sequence of the genes of the microorganisms and their mycological properties strongly suggested that the microorganisms may be novel strains belonging to Bacillus amyloliquefaciens or Bacillus berezensis.
[0010] That is, the present invention is as specified by the following features. [1] Bacillus sp. strain 201106_1 (NITE BP-03884 strain). [2] A mutant strain of Bacillus sp. strain 201106_1 (NITE BP-03884 strain), which mutant strain has the ability to control plant diseases or nematodes. [3] A culture of the strain described in [1] or [2] above. [4] A processed product of the culture described in [3] above. [5] The processed product of [4] above, which is a culture supernatant. [6] A composition containing the strain described in [1] or [2] above, a culture of the strain, or a processed product of the culture. [7] The composition described in [6] above, which is a culture supernatant. [8] The composition described in [6] or [7] above, which is a plant disease control composition. [9] The composition according to [8] above, which is a plant disease control composition for post-harvest plants.
[10] The composition according to [8] or [9] above, wherein the plant disease is a bacterial disease or a fungal disease.
[11] The composition according to [6] above, which is a nematode control composition.
[12] A method for controlling plant diseases, comprising treating a plant and / or the soil in which the plant is grown with the strain according to [1] or [2] above, a culture of the strain (i.e., the culture according to [3] above), a treated product of the culture (i.e., the treated product according to [4] or [5] above), or a composition containing any of them (i.e., the composition according to any of [6] to
[10] above).
[13] A method for controlling plant diseases in post-harvest plants, comprising treating the post-harvest plants with the strain described in [1] or [2] above, a culture of the strain (i.e., the culture described in [3] above), a processed product of the culture (i.e., the processed product of [4] or [5] above), or a composition containing any of them (i.e., the composition described in any of [6] to
[10] above).
[14] A method for controlling nematodes, comprising treating the plants and / or the soil in which the plants are grown with the strain described in [1] or [2] above, a culture of the strain (i.e., the culture described in [3] above), a processed product of the culture (i.e., the processed product of [4] or [5] above), or a composition containing any of them (i.e., the composition described in any of [6] to [7] and
[11] above).
[15] A method for producing a plant, comprising treating a plant and / or the soil in which the plant is grown with the strain described in [1] or [2] above, a culture of the strain (i.e., the culture described in [3] above), a processed product of the culture (i.e., the processed product described in [4] or [5] above), or a composition containing any of them (i.e., the composition described in any of [6] to
[11] above).
[0011] Other aspects of the present invention include the following.
[16] Use of the strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above for controlling plant diseases.
[17] Use of the strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above for controlling plant diseases in harvested plants.
[18] Use of the strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above for controlling nematodes.
[19] Use of the strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in any of [6] to
[11] above for plant production.
[20] Use of the strain described in [1] or [2] above, the culture described in [3] above, or the treated product described in [4] or [5] above in the production of an agent for controlling plant diseases.
[21] Use of the strain described in [1] or [2] above, the culture described in [3] above, or the treated product described in [4] or [5] above in the production of an agent for controlling plant diseases for harvested plants.
[22] Use of the strain described in [1] or [2] above, the culture described in [3] above, or the treated product described in [4] or [5] above in the production of an agent for controlling nematodes.
[23] Use of the strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above for controlling plant diseases.
[24] The strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above, for controlling plant diseases in post-harvest plants.
[25] The strain described in [1] or [2] above, the culture described in [3] above, the treated product described in [4] or [5] above, or the composition described in [6] or [7] above, for controlling nematodes.
[26] For the production of a plant, the strain described in [1] or [2] above, the culture described in [3] above, the processed product described in [4] or [5] above, or the composition described in any of [6] to
[11] above.
[0012] The microorganism of the present invention has a low environmental impact and excellent control ability against various plant diseases or nematodes, and not only the microbial cells but also the culture supernatant contained in the culture thereof can be effectively used to control plant diseases or nematodes. Furthermore, the microorganism of the present invention can be used to provide a plant disease control agent composition, a plant disease control method, etc. that have a low environmental impact and are highly effective.
[0013] <1> Microorganism of the Present Invention The microorganism of the present invention is Bacillus sp. 201106_1 strain (i.e., the strain with accession number NITE BP-03884) or a mutant thereof. The microorganism of the present invention has the ability to control plant diseases or nematodes. The mutant of the present invention is a mutant of Bacillus sp. 201106_1 strain and has the ability to control plant diseases or nematodes. The mutant of the present invention includes a mutant obtained from Bacillus sp. 201106_1 strain by natural mutation without artificial manipulation, or a mutant obtained from the above strain by artificial mutagenesis manipulation and has the ability to control plant diseases or nematodes. The mutant strain of the present invention may have bacteriological properties similar to those of the Bacillus sp. 201106_1 strain described below, and preferably has the same bacteriological properties as those of the Bacillus sp. 201106_1 strain. As the microorganism of the present invention, either the Bacillus sp. 201106_1 strain (NITE BP-03884 strain) or a mutant thereof, or both, may be used, but it is preferable to use the Bacillus sp. 201106_1 strain (NITE BP-03884 strain).
[0014] The mutant strain of the present invention may have, for example, the following nucleotide sequence i), ii), and / or iii). That is, it may have one or more of the nucleotide sequences selected from the group consisting of the following i), ii), and iii). It is also preferable that the mutant strain has all of the following nucleotide sequences i), ii), and iii). i) a nucleotide sequence having 99% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, 99.95% or more, or 100% identity to the nucleotide sequence of the 16S rRNA (16S ribosomal RNA) gene shown in SEQ ID NO: 3; ii) a nucleotide sequence having 99% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, 99.95% or more, or 100% identity to the nucleotide sequence of the phoR (phosphate regulon sensorkinase) gene shown in SEQ ID NO: 6; iii) a nucleotide sequence having 99% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, 99.95% or more, or 100% identity to the nucleotide sequence of the dam (DNA adenine) gene shown in SEQ ID NO: 9. a nucleotide sequence having 98% or more, 99% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, 99.95% or more, or 100% identity to the nucleotide sequence of a DNA adenine methylase (DNA adenine methylase) gene. The mutant strain of the present invention may also have a mutation at a site other than SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9.
[0015] The mutant strain of the present invention may have, for example, the following nucleotide sequences: i) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 98% or more identity to the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0016] The mutant strain of the present invention may also have, for example, the following nucleotide sequences: i) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0017] The mutant strain of the present invention may also have, for example, the following nucleotide sequences: i) a nucleotide sequence having 99.8% or more identity to the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 99.8% or more identity to the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 99% or more identity to the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0018] The mutant strain of the present invention may also have, for example, the following nucleotide sequences: i) a nucleotide sequence having 100% identity with the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 100% identity with the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 98% or more identity with the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0019] The mutant strain of the present invention may also have, for example, the following nucleotide sequences: i) a nucleotide sequence having 100% identity with the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 100% identity with the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 99% or more identity with the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0020] The mutant strain of the present invention may also have, for example, the following nucleotide sequences: i) a nucleotide sequence having 100% identity with the nucleotide sequence of the 16S rRNA gene shown in SEQ ID NO:3; ii) a nucleotide sequence having 100% identity with the nucleotide sequence of the phoR gene shown in SEQ ID NO:6; and iii) a nucleotide sequence having 100% identity with the nucleotide sequence of the dam gene shown in SEQ ID NO:9.
[0021] As used herein, "having the ability to control plant diseases or nematodes" means having an antagonistic effect against the pathogenic bacteria or nematodes of any plant disease. The microorganism of the present invention exerts an antagonistic effect against the pathogenic bacteria or nematodes of plant diseases, thereby preventing or curing plant diseases or damage caused by the pathogenic bacteria or nematodes, and is particularly effective in preventing plant diseases. As used herein, "preventing plant diseases caused by pathogenic bacteria" means that when plants or their cultivation soil that are not infected with pathogenic bacteria of plant diseases or that do not show disease symptoms are treated with the microorganism of the present invention, the degree of disease in plants treated with the microorganism of the present invention is lower than that in plants not treated with the microorganism of the present invention, when the plants are grown under the same favorable conditions except for treating the plants or their cultivation soil that are not infected with pathogenic bacteria of plant diseases or that do not show disease symptoms with the microorganism of the present invention. As used herein, "curing plant disease caused by pathogens" means that when plants infected with a pathogen of a plant disease and showing symptoms are grown under the same favorable conditions except for treating them with the microorganism of the present invention, the severity of the disease is lower in plants treated with the microorganism of the present invention than in plants not treated with the microorganism of the present invention. As used herein, "preventing plant damage caused by nematodes" means that when plants not infected with or showing nematode damage or their cultivation soil are grown under the same favorable conditions except for treating them with the microorganism of the present invention, the severity of the damage is lower in plants treated with the microorganism of the present invention than in plants not treated with the microorganism of the present invention. As used herein, "curing plant damage caused by nematodes" means that when plants infected with and showing nematode damage are grown under the same favorable conditions except for treating them with the microorganism of the present invention, the severity of the damage is lower in plants treated with the microorganism of the present invention than in plants not treated with the microorganism of the present invention. In this specification, "damage" is not particularly limited, and may be, for example, one or more selected from the group consisting of nematode invasion and parasitism; feeding damage by nematodes, tissue destruction, root gall formation, and water or nutrient absorption; and plant wilting, growth inhibition, and poor appearance. In this specification, "low degree of disease damage" or "low degree of damage" may mean, for example, that the disease index, disease severity, or disease incidence rate is low, or that the control value is greater than 0.A larger control value is preferable, with a value of 30 or higher being excellent, a value of 50 or higher being even better, and a value of 60 or higher, 70 or higher, 80 or higher, 90 or higher, or even 100 being particularly excellent. Furthermore, for example, if nematodes exhibit abnormal behavior (e.g., symptoms of paralysis) as a result of treatment with the microorganism of the present invention, the degree of damage is thought to be reduced because the nematodes are unable to invade or feed on plants due to paralysis.
[0022] The Bacillus sp. 201106_1 strain was internationally deposited on April 18, 2023, at the National Institute of Technology and Evaluation (NPMD) Patent Microorganisms Depositary (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) under the international deposit number NITE BP-03884. The bacteriological properties of the Bacillus sp. 201106_1 strain are as follows: it is a gram-positive rod-shaped bacterium that produces acid aerobically and exhibits bacillus-type spore formation. Based on its colony morphology, the Bacillus sp. 201106_1 strain is presumed to be a bacterium of the genus Bacillus. Furthermore, based on the results of genetic analysis, the strain is presumed to be a novel strain belonging to Bacillus amyloliquefaciens or Bacillus velezensis. The microorganism of the present invention can be isolated using the above-mentioned bacteriological properties, the nucleotide sequence of the 16S rRNA gene (SEQ ID NO: 3), the nucleotide sequence of the phoR gene (SEQ ID NO: 6), and / or the nucleotide sequence of the dam gene (SEQ ID NO: 9) as indicators, and then cultured to obtain the microorganism. The microorganism of the present invention may be in any form (e.g., spores) exhibited by viable bacteria, including vegetative cells. The methods for confirming and measuring the above-mentioned items are not particularly limited, and commonly known methods can be used.
[0023] (Culturing Method) The method for culturing the microorganism of the present invention is not particularly limited, and the microorganism may be grown by known means. The substrate (culture medium, etc.) used during culturing may be liquid or solid. The method for culturing the microorganism of the present invention may be, for example, a method of culturing the microorganism at 20 to 50°C using a substrate containing one or more selected from the group consisting of processed rice products, processed wheat products, processed corn products, processed potato products, processed soybean products, processed yeast products, processed meat products, processed seafood products, sugars, oils and fats, organic acids and salts thereof, inorganic acids and salts thereof, amino acids and salts thereof, and nucleic acids and salts thereof. A culture of the microorganism of the present invention can be obtained by such a method. Alternatively, a culture of the microorganism of the present invention can be obtained, for example, by any of the methods described below in Examples 2 to 4, or methods similar thereto.
[0024] (Culture and Processed Products Thereof) The term "culture" of the present invention refers to a product obtained by culturing the microorganism of the present invention, and includes the cells of the microorganism of the present invention and / or its metabolic products (products). The "culture" of the present invention may be used as is after culturing the microorganism of the present invention, or may be used as a processed product after undergoing some processing as necessary. The "processed culture" of the present invention is not particularly limited in terms of the method or type of processing, and may be, for example, a processed product obtained by subjecting the culture to one or more processing steps selected from the group consisting of separation, filtration, disruption, extraction, purification, dilution, suspension, concentration, drying, freeze-drying, and spray-drying (i.e., one or more processing steps selected from the group consisting of an isolated product, a filtered product, an extract, a purified product, a diluted product, a suspended product, a concentrated product, a dried product, a freeze-dried product, and a spray-dried product). Specifically, the processed culture product is preferably a precipitate or a culture supernatant of the culture. These can be obtained by subjecting the culture to processing such as centrifugation or filtration. The precipitate of the culture mainly contains the cells of the microorganism of the present invention, and the cells may contain their metabolic products. The culture supernatant may contain metabolic products released by the microorganism of the present invention. Furthermore, the metabolic products may include antibacterial or antinematic substances. However, the culture supernatant does not need to be completely free of bacterial cells or their debris, and may contain solid components. Any liquid phase containing metabolic products of the microorganism of the present invention may be considered a culture supernatant. Similarly, the culture precipitate does not need to be completely free of liquid components, and may be mainly a solid phase containing bacterial cells of the microorganism of the present invention. Furthermore, the culture precipitate or culture supernatant, or the bacterial cells or metabolic products contained therein, may be further processed (e.g., one or more processes selected from the group consisting of separation, filtration, disruption, extraction, purification, dilution, suspension, concentration, drying, freeze-drying, and spray-drying) and used as a processed product. For example, the bacterial cell disruptant, cell fraction, or metabolic product obtained by such a process may be used as a specific component (e.g., an antibacterial or antinematic substance). To obtain a specific component at a high concentration, for example, an extraction process may be performed. The "extraction" may be carried out using a known solvent and a known method.The solvent is not particularly limited, and may be, for example, an inorganic solvent or an organic solvent, more specifically, one or more selected from the group consisting of water, methanol, isopropanol, ethyl acetate, hexane, and mixtures thereof. The culture of the present invention and a processed product thereof have the ability to control plant diseases or nematodes, and therefore can be effectively used for controlling plant diseases or nematodes.
[0025] (Plant Diseases) The plant diseases (pathogenic fungi) to which the microorganism of the present invention is applied are not particularly limited, as long as the microorganism of the present invention can exert its control ability. The microorganism of the present invention may be used, for example, to control bacterial diseases or fungal diseases, or may be used for both. The microorganism of the present invention may also be used, for example, to control one or more plant diseases selected from the group consisting of plant diseases caused by bacteria belonging to obligate aerobic bacteria, microaerobic bacteria, and facultative anaerobic bacteria. The microorganism of the present invention may also be used to control one or more plant diseases selected from the group consisting of plant diseases caused by filamentous fungi belonging to the phylum Oomycetes, Ascomycetes, Deuteromycetes, Basidiomycetes, and Zygomycetes. The bacterial disease may be, for example, one or more selected from the group consisting of soft rot, rot, bacterial spot, bacterial leaf spot, canker, bacterial perforation, bacterial black spot, bacterial brown spot, bacterial stem necrosis, bacterial grain rot, bacterial seedling blight, bacterial wilt, bacterial leaf blight, black rot, and fire blight.The fungal disease may be, for example, one or more filamentous fungal diseases selected from the group consisting of gray mold, brown rot, sclerotinia rot, brown spot, black spot, leaf spot, black spot, summer blight, ring spot, downy mildew, leaf mold, soybean scab, anthracnose, powdery mildew, rust, black spot, late blight, downy mildew, ring spot, blue mold, and green mold. The microorganism of the present invention can be preferably used to control, for example, one or more diseases selected from the group consisting of gray mold, sclerotinia rot, powdery mildew, downy mildew, brown rot, anthracnose, ring spot, blue mold, green mold, soft rot, and canker. Furthermore, the microorganism of the present invention can be particularly preferably used to control one or more diseases selected from the group consisting of gray mold, powdery mildew, downy mildew, brown rot, green mold, and soft rot.
[0026] Examples of plant diseases (pathogens) to be controlled are shown below. In the present invention, the plant diseases (pathogens) may be one or more selected from these groups. Sugar beet: Cercospora beticola, Aphanomyces cochlioides, Root rot (Thanatephorus cucumeris), Leaf rot (Thananatephorus cucumeris), Rust (Uromyces betae), Powdery mildew (Oidium sp.), Spot disease (Ramularia beticola), Seedling damping off (Aphanomyces cochlioides, Pythium ultimum), etc. Peanuts: Mycosphaerella arachidis, Ascochyta sp., Puccinia arachidis, Pythium debaryanum, Alternaria alternata, Sclerotium rolfsii, Mycosphaerella berkeleyi), black root rot (Calonectria ilicicola), etc. Cucumber: Powdery mildew (Sphaerotheca fuliginea), downy mildew (Pseudoperonospora cubensis), vine blight (Mycosphaerella melonis), vine splitting (Fusarium oxysporum), sclerotinia sclerotiorum, gray mold (Botrytis cinerea), anthracnose (Colletotrichum orbiculare), black spot (Cladosporium cucumerinum), brown spot (Corynespora cassiicola), seedling damping-off (Pythium ultimum, Pythium debaryanum, Rhizoctonia solani Kuhn), Phomopsis root rot (Phomopsis sp.), bacterial spot (Pseudomonas syringae pv. Lachrymans), etc. Tomato: Gray mold (Botrytis cinerea), leaf mold (Cladosporium fulvum), late blight (PhytophthoraPotato: late blight (Phytophthora infestans), Verticillium wilt (Verticillium albo-atrum, Verticillium dahliae), powdery mildew (Oidium neolycopersici), early blight (Alternaria solani), Pseudocercospora leaf spot (Pseudocercospora fuligena), bacterial wilt (Ralstonia solanacearum), Sclerotinia rot (Sclerotinia sclerotiorum), etc. Eggplant: gray mold (Botrytis cinerea), black blight (Corynespora melongenae), powdery mildew (Erysiphe cichoracearum), Pseudocercospora leaf spot (Mycovellosiella nattrassii), Sclerotinia rot (Sclerotinia sclerotiorum), Verticillium wilt (Verticillium dahliae), Phomopsis blight (Phomopsis vexans), etc. Pepper: Phytophthora blight (Phytophthora capsici), gray mold (Botrytis cinerea), Sclerotinia rot (Sclerotinia sclerotiorum), anthracnose (Colletotrichum aenigma, Colletotrichum capsici, Colletotrichum fructicola, Colletotrichum jiangxiense), powdery mildew (Leveillula taurica), etc. Strawberry: gray mold (Botrytis cinerea), powdery mildew (Sphaerotheca humuli), anthracnose (Colletotrichum acutatum, Colletotrichum fragariae), Phytophthora blight (Phytophthora cactorum), soft rot (Rhizopus stolonifer), Fusarium wilt (Fusarium oxysporum), Verticillium wilt (Verticillium dahliae), Sclerotinia rot (Sclerotinias clerotiorum), etc. Onion: gray rot (Botrytis allii), gray mold (Botrytis cinerea), Botrytis leaf blight (Botrytis squamosa), downy mildew (Peronospora destructor), white blight (PhytophthoraLeek: Downy mildew (Peronospora destructor), white rot (Sclerotium cepivorum), rust (Puccinia allii), sclerotinia rot (Botrytis squamosa), dry rot (Fusarium oxysporum), red root rot (Pyrenochaeta terrestris), black sclerotinia rot (Sclerotium cepivorum), bacterial leaf spot (Pseudomonas syringae pv. maculicola, P. s. pv. alisalensis), powdery mildew (Peronospora parasitica), sclerotinia rot (Sclerotinia sclerotiorum), black leaf spot (Alternaria brassicicola), gray mold (Botrytis cinerea), root rot (Phoma lingam), Pythium rot (Pythium aphanidermatum, Pythium ultimum), white rust (Albugo macrospora), etc. Onion: Downy mildew (Peronospora destructor), white rot (Sclerotium cepivorum), rust (Puccinia allii), sclerotinia rot (Botrytis squamosa), dry rot (Fusarium oxysporum), red root rot (Pyrenochaeta terrestris), black sclerotinia rot (Sclerotium cepivorum), bacterial leaf spot (Pseudomonas syringae pv. maculicola, P. s. pv. alisalensis), powdery mildew (Peronospora parasitica), sclerotinia rot (Sclerotinia sclerotiorum), black leaf spot (Alternaria brassicicola), gray mold (Botrytis cinerea), root rot (Phoma lingam), Pythium rot (Pythium aphanidermatum, Pythium ultimum), white rust (Albugo macrospora), etc. Cabbage: Clubroot (Plasmodiophora brassicae), soft rot (Erwinia carotovora), black rot (Xanthomonas campesrtis pv. campestris), black spot bacteria (Pseudomonas syringae pv. maculicola, P. s. pv. alisalensis), downy mildew (Peronospora parasitica), sclerotinia rot (Sclerotinia sclerotiorum), black leaf mold (Alternaria brassicicola), gray mold (Botrytis cinerea), root rot (Phoma lingam), Pythium rot (Pythium aphanidermatum, Pythium ultimum), white rust (Albugo macrospora), etc. Lettuce: Rot (Pseudomonas cichorii, Pseudomonas marginalis), soft rot (Pectobacterium carotovorum), downy mildew (Bremia lactucae), gray mold (Botrytis cinerea), sclerotinia rot (Sclerotinia sclerotiorum), Mirafiori lettuce big-vein ophiovirus, root rot (Fusariumoxysporum), bottom rot (Rhizoctonia solani), powdery mildew (Golovinomyces orontii), etc. Green beans: Sclerotinia sclerotiorum, gray mold (Botrytis cinerea), anthracnose (Colletotrichum lindemuthianum), angular spot (Phaeoisariopsis griseola), etc. Peas: Brown spot (Mycosphaerella pinodes), gray mold (Botrytis cinerea), Sclerotinia sclerotiorum, powdery mildew (Erysiphe pisi), etc.
[0027] Apple: Powdery mildew (Podosphaera leucotricha), black spot (Venturia inaequalis), monilinia (Monilinia mali), black spot (Mycosphaerella pomi), canker (Valsa mali), leaf spot (Alternaria mali), red spot (Gymnosporangium yamadae), ring spot (Botryosphaeria berengeriana), anthracnose (Glomerella cingulata, Colletotrichum acutatum), brown spot (Diplocarpon mali), sooty spot (Zygophiala jamaicensis), sooty spot (Gloeodes pomigena), purple root rot (Helicobasidium mompa), white root rot (Rosellinia necatrix), gray mold (Botrytis cinerea), fire blight (Erwinia amylovora), silver leaf (Chondrostereum) purpureum), crown gall (Rhizobium radiobacter, Rhizobium rhizogenes), etc. Plum: black spot (Cladosporium carpophilum), gray mold (Botrytis cinerea), brown rot (Monilinia mumecola), sooty spot (Peltaster sp.), fruit blister (Taphrina pruni), brown hole (Phloeosporella padi), etc. Persimmon: powdery mildew (Phyllactinia kakicola), anthracnose (Gloeosporium kaki), angular leaf spot (Cercospora kaki), circular leaf spot (Mycosphaerella nawae), gray mold (Botrytis cinerea), sooty spot (Zygophiala jamaicensis), etc. Peach: brown rot (Monilinia fructicola, Monilinia fructigena), black spot (Cladosporium carpophilum), Homopsis sp., Boring bacterial disease (Xanthomonas campestris pv.Plum: leaf curl (Taphrina pruni), leaf blister (Taphrina deformans), anthracnose (Colletotrichum gloeosporioides), brown spot (Phloeosporella padi), white rot (Coriolus versicolor), etc. Almond: gray mold (Monilinia laxa), leaf blotch (Stigmina carpophila), scab (Cladosporium carpophilum), leaf swelling disease (Polystigma rubrum), leaf spot and defoliation disease (Alternaria alternata), anthracnose (Colletotrichum gloeosporioides), etc. Peach: gray mold (Monilinia fructicola), anthracnose (Colletotrichum acutatum), black spot (Alternaria sp.), Young fruit sclerotinia (Monilinia kusanoi), Brown hole (Mycosphaerella cerasella), Powdery mildew (Podosphaera tridactyla), etc. Grapes: Gray mold (Botrytis cinerea), Powdery mildew (Uncinula necator), Late rot (Glomerella cingulata, Colletotrichum acutatum), Downy mildew (Plasmopara viticola), Black rot (Elsinoe ampelina), Brown spot (Pseudocercospora vitis), Black rot (Guignardia bidwellii), White rot (Coniella castaneicola), Rust (Phakopsora ampelopsidis), White cotton snow (causative agent unidentified), Crown gall (Rhizobium radiobacter, Rhizobium vitis), etc. Pears: Black spot (Venturia nashicola), Red spot (Gymnosporangium asiaticum), black spot (Alternaria kikuchiana), ring spot (Botryosphaeria berengeriana), powdery mildew (Phyllactinia mali), canker (Phomopsis fukushii), brown spot (Stempphylium vesicarium), anthracnose (Glomerella cingulata), etc. Tea: ring spot (Pestalotiopsis longiseta, P. theae), anthracnose (Colletotrichum theae-sinensis), net blight (Exobasidium reticulatum), red burn (Pseudomonas syringae), blight (Exobasidium vexans), etc. Citrus: scab (Elsinoe fawcettii), blue mold (Penicillium italicum), green mold (Penicillium digitatum), gray mold (Botrytis cinerea), black spot (Diaporthe citri), canker (Xanthomonas campestris pv. Citri), powdery mildew (Oidium sp.), late blight (Phytophthora citrophthora), anthracnose (Colletotrichum fioriniae), etc. Kiwifruit: blossom rot (Pseudomonas marginalis, Pseudomonas syringae, Pseudomonas viridiflava), canker (Pseudomonas syringae), gray mold (Botrytis cinerea), fruit soft rot (Botryosphaeria dothidea, Diaporthe sp., Lasiodiplodia theobromae), sooty spot (Pseudocercospora actinidiae), etc. Olive: anthracnose (Colletotrichum acutatum, Colletotrichum gloeosporioides), peacock spot (Spilocaea oleaginea), etc. Chestnut: anthracnose (Colletotrichum gloeosporioides), etc.
[0028] Wheat: powdery mildew (Blumeria graminis f.sp. tritici), scab (Gibberella zeae, Fusarium avenaceum, Fusarium culmorum, Fusarium crookwellense, Microdochium nivale), brown rust (Puccinia recondita), yellow rust (Puccinia striiformis), brown snow blight (Pythium iwayamai), red snow blight (Monographella nivalis), eyespot (Pseudocercosporella herpotrichoides), leaf blotch (Septoria tritici), glume blotch (Leptosphaeria nodorum), pink snow mold (Typhula incarnata), gray snow mold (Myriosclerotinia borealis), take-all (Gaeumannomyces graminis), ergot (Claviceps purpurea), common bunt (Tilletia caries), loose smut (Ustilago nuda), blast (Pyricularia grisea), damping off (Pythium spp., Fusarium spp., Rhizoctonia spp.), seedling blight (Pythium spp., Fusarium spp., Rhizoctonia spp.), etc. Barley: leaf stripe (Pyrenophora graminea), net blotch (Pyrenophora teres), scald (Rhynchosporium secalis), loose smut (Ustilago tritici, U. nuda), damping off (Pythium spp., Fusarium spp., Rhizoctonia spp.), seedling blight (Pythium spp., Fusarium spp., Rhizoctonia spp.), etc. Rice: blast (Pyricularia oryzae), sheath blight (Rhizoctonia solani), bakanae disease (Gibberella fujikuroi), sesame leaf blight (Cochliobolusmiyabeanus), seedling damping-off (Pythium graminicola), white leaf blight (Xanthomonas oryzae), bacterial seedling damping-off (Burkholderia plantarii), brown stripe (Acidovorax avenae), bacterial grain rot (Burkholderia glumae), streak leaf blight (Cercospora oryzae), rice smut (Ustilaginoidea virens), brown rice (Alternaria alternata, Curvularia intermedia), black-bellied rice (Alternaria padwickii), pink rice (Epicoccum purpurascens), etc. Tobacco: Sclerotinia sclerotiorum, powdery mildew (Erysiphe cichoracearum), late blight (Phytophthora nicotianae), etc. Tulip: Gray mold (Botrytis cinerea), brown spot (Botrytis tulipae), leaf rot (Rhizoctonia solani), bulb rot (Fusarium oxysporum), skin rot (Rhizoctonia solani), etc. Roses: black spot (Diplocarpon rosae), powdery mildew (Erysiphe simulans, Podosphaera pannosa), gray mold (Botrytis cinerea), etc. Chrysanthemums: gray mold (Botrytis cinerea), white rust (Puccinia horiana), downy mildew (Paraperonospora minor, Peronospora danica), Pythium damping-off (Pythium aphanidermatum, Pythium dissotocum, Pythium helicoides, Pythium oedochilum, Pythium sylvaticum), damping-off (Rhizoctonia solani), Fusarium damping-off (Fusarium solani), etc. Gerberas: gray mold (Botrytis cinerea), powdery mildew (Podosphaera xanthii), etc. Lilies: leaf blight (Botrytis elliptica, Pestalotiopsissp.), Gray mold (Botrytis cinerea), etc. Sunflower: Downy mildew (Plasmopara halstedii), Sclerotinia sclerotiorum, Gray mold (Botrytis cinerea), etc. Bentgrass: Snow mold (Sclerotinia borealis), Large patch (Rhizoctonia solani), Brown patch (Rhizoctonia solani), Dollar spot (Sclerotinia homoeocarpa), Blast (Pyricularia sp.), Red burn (Pythium aphanidermatum), Anthracnose (Colletotrichum graminicola), etc. Orchardgrass: Powdery mildew (Erysiphe graminis), etc. Soybean: Purple spot (Cercospora kikuchii), Downy mildew (Peronospora manshurica), Stem rot (Phytophthora sojae), Rust (Phakopsora pachyrhizi), Sclerotinia sclerotiorum, Anthracnose (Colletotrichum truncatum), Gray mold (Botrytis cinerea), Black rot (Elsinoe glycines), Black spot (Diaporthe phaseolorum var. sojae), Damping off (Pythium spp., Fusarium spp., Rhizoctonia spp.), Seedling blight (Pythium spp., Fusarium spp., Rhizoctonia spp.), etc. Potato: Late blight (Phytophthora infestans), Summer blight (Alternaria solani), Black spot (Thanatephorus cucumeris), Verticillium wilt (Verticillium albo-atrum, V. dahliae, V. nigrescens), Black leg (Pectobacterium atrosepticum), soft rot (Pectobacterium carotovorum), gray mold (Botrytis cinerea), common scab (Streptomycesspp.), Sclerotinia sclerotiorum, etc. Yam: Leaf blight (Cylindrosporium dioscoreae), Anthracnose (Colletotrichum gloeosporioides), Blue mold (Penicillium sclerotigenum), etc. Sweet potato: Purple root rot (Helicobasidium mompa), Fusarium oxysporum, Base rot (Diaporthe destruens), etc. Taro: Late blight (Phytophthora colocasiae), Stem rot (Rhizoctonia solani), etc. Ginger: Rhizome rot (Pythium ultimum, Pythium myriotylum), White spot (Phyllosticta zingiberis), etc. Banana: Panama disease (Fusarium oxysporum), Sigatoka disease (Mycosphaerella fijiensis, M. musicola), etc. Mango: Anthracnose (Colletotrichum aenigma), canker (Xanthomonas campestris), stem rot (Diaporthe pseudophoenicicola, Lasiodiplodia theobromae, Lasiodiplodia spp., Neofusicoccum parvum, Neofusicoccum sp.), gray mold (Botrytis cinerea), etc. Rapeseed: Sclerotinia sclerotiorum, root rot (Phoma lingam), black spot (Alternaria brassicae), powdery mildew (Erysiphe cruciferarum, Erysiphe cichoracearum, Oidium matthiolae), downy mildew (Peronospora parasitica), etc. Coffee: Rust (Hemileia vastatrix), anthracnose (Colletotrichum coffeanum), brown eye (Cercospora coffeicola), etc. Sugarcane: Brown rust (Puccinia melanocephala), etc. Corn: Hail blight (Gloeocercosporasorghi), rust (Puccinia sorghi), southern rust (Puccinia polysora), ear smut (Ustilago maydis), southern leaf blight (Cochliobolus heterostrophus), sooty blight (Setosphaeria turcica), damping off (Pythium spp., Fusarium spp., Rhizoctonia spp.), seedling blight (Pythium spp., Fusarium spp., Rhizoctonia spp.), etc. Cotton: damping off (Pythium sp.), rust (Phakopsora gossypii), white mold (Mycosphaerella areola), anthracnose (Glomerella gossypii), etc. Hops: downy mildew (Pseudoperonospora humuli), powdery mildew (Oidium sp., Podosphaera macularis), gray mold (Botrytis cinerea), etc.
[0029] (Nematodes) The nematodes to which the microorganism of the present invention is applied are not particularly limited, as long as the microorganism of the present invention can exert its control ability. The microorganism of the present invention may be used, for example, to control nematodes that infest the above-ground parts (stems, leaves, buds, etc.) or underground parts (roots, tubers, etc.) of plants, and is preferably used to control nematodes that infest the underground parts. The nematodes that infest the underground parts may be, for example, one or more selected from the group consisting of root-knot nematodes (Meloidogyne spp.), root-lesion nematodes (Pratylenchus spp.), and cyst nematodes (Globodera spp. and Heterodera spp.), and preferably root-knot nematodes.
[0030] Examples of nematodes to be controlled are shown below: In the present invention, the nematode may be one or more selected from these groups. (1) Tylenchida (a) Anguinidae, for example, Anguina spp., Anguina funesta, wheat nematode (Anguina tritici); Ditylenchus spp., Ditylenchus destructor, Ditylenchus dipsaci, mushroom nematode (Ditylenchus myceliophagus); (b) Aphelenchoididae, for example, Aphelenchoides spp., Aphelenchoides besseyi, strawberry nematode (Aphelenchoides (c) from the family Belonolaimidae, for example, from the genus Belonolaimus, Belonolaimus longicaudatus; (d) from the genus Tylenchorhynchus, for example, from the genus Tylenchorhynchus, Belonolaimus longicaudatus; (e) from the family Bursaphelenchus, for example, from the genus Bursaphelenchus, Belonolaimus longicaudatus; (f) from the family Tylenchorhynchus, for example, from the genus Tylenchorhynchus, Belonolaimus longicaudatus; (g) from the family Bursaphelenchus, for example, from the genus Bursaphelenchus, Belonolaimus longicaudatus; (h) from the family Tylenchorhynchus, for example, from the genus Tylenchorhynchus, Belonolaimus longicaudatus;(d) from the family Criconematidae, for example, Criconema mutabile; (e) from the family Dolichodoridae, for example, Dolichodorus mediterraneus; (f) from the family Ecphyadophoridae, for example, Ecphyadophora tenuissima (g) from the family Hemicycliophoridae, for example, Loofia thienemanni (h) from the family Hemicycliophoridae, for example, Loofia thienemanni (i) from the family Hemicycliophoridae, for example, ... (h) Heteroderidae, for example, Globodera spp., such as potato cyst nematode (Globodera rostochiensis), potato white cyst nematode (Globodera pallida), tobacco cyst nematode (Globodera tabacum); Heterodera spp., such as wheat cyst nematode (Heterodera avenae), Heterodea cruciferae, soybean cyst nematode (Heterodera glycines), sugar beet cyst nematode (Heterodera schachtii), clover cyst nematode (Heterodera trifolii); (i) Hoplolaimidae, for example, Helicotylenchus spp.), Helicotylenchus dihystera, Helicotylenchus multicinctus; Hoplolaimus spp.(j) from the family Meloidogynidae, for example, Meloidogyne spp., Meloidogyne arenaria, Meloidogyne chitwoodi, Meloidogyne hapla, Meloidogyne incognita, Meloidogyne javanica, Meloidogyne thamesi; (k) Nothotylenchidae, for example, strawberry nematode (Nothotylenchus acris); (l) Paratylenchidae, for example, Paratylenchus spp., Chapin nematode (Paratylenchus curvitatus), Himepin nematode (Paratylenchus elachistus); (m) Pratylenchidae, for example, Pratylenchus spp.) species, such as Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus curvitatus, Pratylenchus fallax, Pratylenchus goodeyi, Pratylencus neglectus, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus vulnus, and Pratylenchus zeae; others, such as Nacobbus aberrans and Radopholus similis), Tylenchulus semipenetrans, and Radopholus citrophilus.
[0031] (2) Dorylaimida (a) of the family Longidoridae, for example, Longidorus spp., Longidorus elongates; of the genus Xiphinema, Xiphinema americanum, Xiphinema brevicolle, Xiphinema index, Xiphinema diversicaudatum.
[0032] (3) Triplonchida (a) Trichodoridae, for example, Trichodorus primitivus, Paratrichodorus minor.
[0033] (Applicable Plants) The plants to which the microorganism of the present invention is applied are not particularly limited, as long as they are plants on which the microorganism of the present invention can exert its control activity. The microorganism of the present invention may be used on one or more plants selected from the group consisting of, for example, cereals; vegetables; root vegetables; potatoes; fruit trees, trees such as tea, coffee, and cacao; pasture grasses; turf; and cotton. In the present invention, the plant may be, for example, one or more plants selected from the group consisting of plants belonging to the Brassicaceae, Solanaceae, Cucurbitaceae, Liliaceae, Fabaceae, Asteraceae, Chenopodiaceae, Poaceae, Rosaceae, Caryophyllaceae, Primulaceae, Rutaceae, Vitaceae, Actinidiaceae, Ebaceae, Apiaceae, Convolvulaceae, and Araceae families. In particular, the plant in the present invention is preferably one or more selected from the group consisting of plants belonging to the Brassicaceae family, such as Chinese cabbage, plants belonging to the Asteraceae family, such as lettuce, plants belonging to the Solanaceae family, such as potato, plants belonging to the Rutaceae family, such as lemon and navel orange, and plants belonging to the Rosaceae family, such as pear.
[0034] The microorganism of the present invention may be applied to any part of a plant, for example, one or more parts selected from the group consisting of leaves, stems, stalks, flowers, buds, fruits, seeds, sprouts, roots, tubers, tuberous roots, shoots, and cuttings. The microorganism of the present invention may also be applied to improved varieties and cultivars, as well as mutants, hybrids, or genetically modified organisms (GMOs) of the above-mentioned plants.
[0035] (Application Method) The microorganism of the present invention may be used in various treatments or applications for controlling various diseases that occur in agricultural and horticultural crops, including ornamental plants, turf, and pasture grass. For example, the microorganism may be used in one or more methods selected from the group consisting of seed treatment, seed tuber treatment, foliar application, soil application, water application, and harvest treatment. The microorganism of the present invention may also be used as a seed treatment agent, and any form of seed treatment known to those skilled in the art may be used, such as soaking, submerging, or coating seeds with a composition containing the microorganism of the present invention. The seed treatment is carried out before sowing the seeds. The harvest treatment may be treatment of plants before and / or after harvest, but is preferably treatment of plants after harvest (post-harvest treatment). The post-harvest treatment of plants is not particularly limited, and may be, for example, treatment for plant disease control (e.g., anti-rot treatment) of one or more plants selected from the group consisting of during storage, transportation, and sale. Pre-harvest and / or post-harvest plants can include, for example, one or more agricultural products selected from the group consisting of fruits, vegetables, grains, and flowers, with fruits or vegetables being preferred.
[0036] (Non-agricultural Uses) As described above, the microorganism of the present invention can be used mainly for agricultural purposes, but it may also be used for purposes other than agriculture. The non-agricultural uses are not particularly limited, and may be, for example, one or more selected from the group consisting of a mildewproofing agent for walls of bathrooms, living rooms, etc.; a water quality improving agent for reservoirs, swimming pools, cooling towers, etc.; an agent for treating organic waste; and an agent for treating sludge, etc.
[0037] <2> Composition of the Present Invention The composition of the present invention is a composition containing the microorganism of the present invention, a culture thereof, or a processed product of the culture. That is, the composition of the present invention contains one or more selected from the group consisting of the following (1) to (4). Furthermore, the composition of the present invention is not particularly limited as long as it contains the microorganism of the present invention, a culture thereof, or a processed product of the culture. (1) Bacillus sp. 201106_1 strain. (2) A mutant strain of the above (1) that has the ability to control plant diseases or nematodes. (3) A culture of the strain of the above (1) or (2). (4) A processed product of the culture of the above (3).
[0038] The composition of the present invention is not particularly limited in its use and may be used as a plant disease control agent, a nematode control agent, a plant growth regulator, or the like. However, it is preferably used as a plant disease control composition or a nematode control composition, and particularly preferably as a plant disease control composition. The plant disease control composition may also be used as a plant disease control composition for post-harvest plants. That is, the composition of the present invention may contain the microorganism of the present invention, a culture thereof, or a processed product of the culture as an active ingredient for those uses (plant disease control, post-harvest plant disease control, nematode control, plant growth regulation, etc.). As used herein, "as an active ingredient" means containing an effective amount. An effective amount means an amount sufficient to exert the desired effect. As used herein, "as an active ingredient" also means that other ingredients may be included as long as they do not impair the effects of the present invention. The effective amount may vary depending on the target of application, the purpose of application, the time of application, etc.
[0039] (Prevention, cure) The microorganism of the present invention, a culture thereof, or a processed product of the culture contained in the composition of the present invention exerts an antagonistic effect against pathogenic bacteria or nematodes that cause plant diseases, and the composition of the present invention can prevent or cure plant diseases or damage caused by the pathogenic bacteria or nematodes.
[0040] (Form) The composition of the present invention contains the microorganism of the present invention, a culture thereof, or a processed product of the culture, but the form thereof is not particularly limited. For example, the composition of the present invention may contain the bacterial cells of the microorganism of the present invention itself, or the culture thereof itself, or may contain a processed product obtained by subjecting these to some treatment as necessary, as described above. The processed product is not particularly limited, but a culture supernatant is preferred. Furthermore, the microorganism of the present invention, a culture thereof, or a processed product of the culture thereof may be contained in the composition of the present invention in any form, such as a solid (solid phase), a liquid (liquid phase), or a mixture thereof.
[0041] (Concentration) The concentration of the microorganism of the present invention, its culture, or a processed product of the culture contained in the composition of the present invention is not particularly limited as long as it does not impair the effects of the present invention. For example, the concentration of the microorganism of the present invention may be 1 x 10 in terms of the bacterial cell concentration at the time of use of the composition. 2 ~1 x 10 11 cfu / mL, preferably 1 x 10 4 ~1 x 10 9 The concentration of the microorganism of the present invention, its culture, or a processed product of the culture, contained in the bulk or undiluted solution, may be set appropriately depending on the dilution ratio at the time of use.
[0042] (Content) The content of the microorganism of the present invention, a culture thereof, or a processed product of the culture thereof is not particularly limited, and may be, for example, 0.001 to 99 parts by mass, preferably 0.01 to 80 parts by mass, more preferably 0.1 to 70 parts by mass, and even more preferably 1 to 50 parts by mass, relative to 100 parts by mass of the composition of the present invention.
[0043] (Additives) The composition of the present invention may contain optional components other than the microorganism of the present invention, its culture, or a processed product of the culture, as long as the effects of the present invention are not impaired. The optional components are not particularly limited as long as the effects of the present invention are not impaired, and may be, for example, one or more selected from the group consisting of carriers, diluents, surfactants, dispersants, and adjuvants. If necessary, one or more selected from the group consisting of antioxidants, colorants, lubricants, UV absorbers, antistatic agents, and preservatives may also be added. Furthermore, the composition of the present invention may be mixed with a chemical pesticide to an extent that does not affect the microorganism of the present invention, its culture, or a processed product of the culture. The chemical pesticide may be, for example, one or more selected from the group consisting of fungicides, insecticides, herbicides, and plant growth regulators. Even if the chemical pesticide affects the microorganism of the present invention, such as a fungicide, insecticide, herbicide, or plant growth regulator, it may be used with an interval of several days between spraying.
[0044] (Additive: Carrier) The carrier is not particularly limited as long as it can be used in ordinary agricultural and horticultural formulations, and may be one or more selected from the group consisting of inorganic salts such as calcium carbonate, potassium chloride, sodium sulfate, calcium sulfate, ammonium sulfate, etc.; organic acids and salts thereof such as citric acid, malic acid, stearic acid, etc.; sugars such as glucose, lactose, sucrose, maltose, trehalose, etc.; and solid carriers such as alumina powder, silica gel, zeolite, hydroxyapatite, zirconium phosphate, titanium phosphate, titanium oxide, zinc oxide, hydrotalcite, kaolinite, montmorillonite, talc, clay, diatomaceous earth, bentonite, white carbon, kaolin, vermiculite, etc. The content of the carrier is not particularly limited, and may be, for example, 0.01 to 30 parts by mass, preferably 0.1 to 20 parts by mass, more preferably 0.3 to 10 parts by mass, per part by mass of the microorganism of the present invention, a culture thereof, or a treated product of the culture thereof.
[0045] (Additive: Diluent) The diluent is not particularly limited as long as it is usable in ordinary agricultural and horticultural formulations, and may be, for example, one or more selected from the group consisting of water, alcohol, acetone, ketone, pyrrolidone, sulfoxide, amide, glycol, nitrile, aromatic hydrocarbon, mineral oil, and vegetable oil. The content of the diluent is not particularly limited, and for example, the blending ratio of the diluent per 1 part by mass of the microorganism of the present invention, its culture, or a processed product of the culture may be 0.1 to 100,000 parts by mass, preferably 1 to 50,000 parts by mass, more preferably 5 to 10,000 parts by mass, and even more preferably 10 to 5,000 parts by mass.
[0046] (Additive: Surfactant or Dispersant) The surfactant (which can also be used as a dispersant) is not particularly limited as long as it is one that can be used in ordinary agricultural and horticultural formulations, and specifically, for example, it may be one or more selected from the group consisting of the following nonionic surfactants, anionic surfactants, cationic surfactants, and amphoteric surfactants. Examples of nonionic surfactants include sugar ester surfactants such as sorbitan fatty acid esters (C12-18), POE sorbitan fatty acid esters (C12-18), and sucrose fatty acid esters; fatty acid ester surfactants such as POE fatty acid esters (C12-18), POE resin acid esters, and POE fatty acid diesters (C12-18); alcohol surfactants such as POE alkyl ethers (C12-18); alkylphenol surfactants such as POE alkyl (C8-12) phenyl ether, POE dialkyl (C8-12) phenyl ether, and POE alkyl (C8-12) phenyl ether formalin condensates; polyoxyethylene-polyoxypropylene block polymers, alkyl (C12-18) The surfactant may be one or more selected from the group consisting of polyoxyethylene-polyoxypropylene block polymer surfactants such as polyoxyethylene-polyoxypropylene block polymer ether; alkylamine surfactants such as POE alkylamine (C12-18) and POE fatty acid amide (C12-18); bisphenol surfactants such as POE fatty acid bisphenyl ether; polyaromatic ring surfactants such as POA benzylphenyl (or phenylphenyl) ether and POA styrylphenyl (or phenylphenyl) ether; silicone and fluorine-based surfactants such as POE ether and ester-type silicone and fluorine-based surfactants; and vegetable oil surfactants such as POE castor oil and POE hydrogenated castor oil.
[0047] Examples of anionic surfactants include alkyl sulfates (C12-18, Na, NH 4 , alkanolamine), POE alkyl ether sulfate (C12-18, Na, NH 4 , alkanolamine), POE alkyl phenyl ether sulfate (C12-18, NH 4, alkanolamine), POE benzyl (or styryl) phenyl (or phenylphenyl) ether sulfate (Na, NH 4 , alkanolamine), polyoxyethylene, polyoxypropylene block polymer sulfate (Na, NH 4 , alkanolamine); paraffin (alkane) sulfonate (C12-22, Na, Ca, alkanolamine), AOS (C14-16, Na, alkanolamine), dialkyl sulfosuccinate (C8-12, Na, Ca, Mg), alkyl benzene sulfonate (C12, Na, Ca, Mg, NH 4 , alkylamines, alkanols, amines, cyclohexylamine), mono- or di-alkyl (C3-6) naphthalene sulfonates (Na, NH 4 , alkanolamine, Ca, Mg), naphthalenesulfonate-formalin condensate (Na, NH 4 ), alkyl (C8-12) diphenyl ether disulfonate (Na, NH 4 ), lignin sulfonate (Na, Ca), POE alkyl (C8-12) phenyl ether sulfonate (Na), POE alkyl (C12-18) ether sulfosuccinic acid half ester (Na); and sulfonate surfactants such as carboxylic acid fatty acid salts (C12-18, Na, K, NH 4 , alkanolamine), N-methyl-fatty acid sarcosinate (C12-18, Na), resinate (Na, K) and other POE alkyl (C12-18) ether phosphate (Na, alkanolamine), POE mono- or dialkyl (C8-12) phenyl ether phosphate (Na, alkanolamine), POE benzyl (or styryl) phenyl (or phenylphenyl) ether phosphate (Na, alkanolamine), polyoxyethylene-polyoxypropylene block polymer (Na, alkanolamine), phosphatidylcholine-phosphatidylethanolimine (lecithin), phosphate-type surfactants such as alkyl (C8-12) phosphate.
[0048] The cationic surfactant may be one or more selected from the group consisting of ammonium surfactants such as alkyltrimethylammonium chloride (C12-18), methyl polyoxyethylene alkylammonium chloride (C12-18), alkyl N-methylpyridium bromide (C12-18), mono- or dialkyl (C12-18) methylated ammonium chloride, and alkyl (C12-18) pentamethylpropylenediamine dichloride; and benzalkonium surfactants such as alkyldimethylbenzalkonium chloride (C12-18) and benzethonium chloride (octylphenoxyethoxyethyldimethylbenzylammonium chloride).
[0049] The amphoteric surfactant may be one or more selected from the group consisting of betaine surfactants such as dialkyl (C8-12) diaminoethyl betaine and alkyl (C12-18) dimethyl benzyl betaine; and glycine surfactants such as dialkyl (C8-12) diaminoethyl glycine and alkyl (C12-18) dimethyl benzyl glycine.
[0050] The surfactant and / or dispersant may be used alone or in combination of two or more. The content of the surfactant and / or dispersant is not particularly limited, but may be, for example, 0.01 to 30 parts by mass, preferably 0.1 to 20 parts by mass, and more preferably 0.3 to 10 parts by mass, of the surfactant per 1 part by mass of the microorganism of the present invention, a culture thereof, or a processed product of the culture.
[0051] (Additives: Adjuvants) The adjuvants are not particularly limited as long as they are usable in ordinary agricultural and horticultural formulations, and may be, for example, one or more selected from the group consisting of carboxymethyl cellulose, hydroxypropyl cellulose, polyethylene glycol, gum arabic, polyvinylpyrrolidone, and starch.
[0052] (Formulation) The formulation form of the composition of the present invention is not particularly limited and may be any form that is commonly used for agricultural and horticultural chemicals, such as dust (DP, Dustable Powder), wettable powder (WP, Wattable Powder), emulsifiable concentrate (EC, Emulsifiable Concentrate), flowable (FL, Flowable), suspension concentrate (SC, Suspension Concentrate), water-soluble powder (SP, Water-soluble Powder), water-dispersible granule (WG, Water-dispersible Granule), tablet, granule (GR, Granule), SE (Suspo Emulsion), OD (Oil Dispersion), EW (Emulsion oil in water), etc. The preparation method for the formulation is not particularly limited, and known preparation methods can be used depending on the dosage form. An example of a formulation is shown below. Note that "parts" means "parts by mass."
[0053] (Formulation 1: wettable powder) 40 parts of the microorganism of the present invention, a culture thereof, or a processed product of the culture thereof, 53 parts of diatomaceous earth, 4 parts of a higher alcohol sulfate, and 3 parts of an alkylnaphthalene sulfonate are uniformly mixed and finely pulverized to obtain a wettable powder containing 40% of the active ingredient.
[0054] (Preparation 2: Emulsion) 30 parts of the microorganism of the present invention, its culture, or a processed culture thereof, 33 parts of xylene, 30 parts of dimethylformamide, and 7 parts of polyoxyethylene alkyl allyl ether are mixed and dissolved to obtain an emulsion containing 30% of the active ingredient.
[0055] (Formulation 3: Granules) 5 parts of the microorganism of the present invention, its culture, or a processed product of the culture, 40 parts of talc, 38 parts of clay, 10 parts of bentonite, and 7 parts of sodium alkyl sulfate are uniformly mixed and finely pulverized, and then granulated into granules with a diameter of 0.5 to 1.0 mm to obtain a granule containing 5% of the active ingredient.
[0056] (Formulation 4: Granules) 5 parts of the microorganism of the present invention, its culture, or a processed product of the culture, 73 parts of clay, 20 parts of bentonite, 1 part of dioctyl sulfosuccinate sodium salt, and 1 part of potassium phosphate are thoroughly ground and mixed, water is added, and the mixture is thoroughly kneaded, then granulated and dried to obtain granules containing 5% of the active ingredient.
[0057] (Formulation 5: Suspension) 10 parts of the microorganism of the present invention, a culture thereof, or a processed culture thereof, 4 parts of polyoxyethylene alkyl allyl ether, 2 parts of sodium polycarboxylate, 10 parts of glycerin, 0.2 parts of xanthan gum, and 73.8 parts of water are mixed and wet-pulverized until the particle size becomes 50 microns or less, to obtain a suspension containing 10% of the active ingredient.
[0058] (Plant diseases and nematodes to which the composition of the present invention is applied, applicable plants, application methods, and non-agricultural uses) The plant diseases and nematodes to which the composition of the present invention is applied, applicable plants, application methods, and non-agricultural uses are the same as the plant diseases and nematodes to which the microorganism of the present invention is applied, applicable plants, application methods, and non-agricultural uses described above.
[0059] <3> Methods of the Present Invention The first method of the present invention is a method for controlling plant diseases, comprising treating plants and / or plant cultivation soil with a composition containing the microorganism of the present invention, a culture thereof, a processed product of the culture, or any of them (i.e., one or more selected from the group consisting of the microorganism of the present invention, a culture thereof, and a processed product of the culture). The second method of the present invention is a method for controlling plant diseases in post-harvest plants, comprising treating post-harvest plants with a composition containing the microorganism of the present invention, a culture thereof, a processed product of the culture, or any of them (i.e., one or more selected from the group consisting of the microorganism of the present invention, a culture thereof, and a processed product of the culture). The third method of the present invention is a method for controlling nematodes, comprising treating plants and / or plant cultivation soil with a composition containing the microorganism of the present invention, a culture thereof, a processed product of the culture, or any of them (i.e., one or more selected from the group consisting of the microorganism of the present invention, a culture thereof, and a processed product of the culture). The fourth method of the present invention is a method for producing a plant, comprising treating the plant and / or the soil in which the plant is grown with a composition containing the microorganism of the present invention, a culture thereof, a processed product of the culture, or any of them (i.e., one or more selected from the group consisting of the microorganism of the present invention, a culture thereof, and a processed product of the culture). (The first method of the present invention, the second method of the present invention, the third method of the present invention, and the fourth method of the present invention are sometimes collectively referred to as the "methods of the present invention.")
[0060] That is, the method of the present invention involves treating a plant and / or plant cultivation soil with one or more selected from the group consisting of (1) to (5) below. In particular, a second method of the present invention involves treating a harvested plant with one or more selected from the group consisting of (1) to (5) below: (1) Bacillus sp. 201106_1 strain; (2) A mutant strain of (1) above that has the ability to control plant diseases or nematodes; (3) A culture of the strain of (1) or (2) above; (4) A processed product of the culture of (3) above; or (5) A composition containing one or more selected from the group consisting of (1) to (4) above. Note that, as used herein, "plants and / or plant cultivation soil" encompasses the meanings of "plants and plant cultivation soil" and "plants or plant cultivation soil." In other words, it means either or both of plants and plant cultivation soil.
[0061] Furthermore, the first method of the present invention, the third method of the present invention, and the fourth method of the present invention are not particularly limited, as long as they involve treating plants and / or plant cultivation soil with the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them. Furthermore, the second method of the present invention is not particularly limited, as long as it involves treating post-harvest plants with the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them. That is, as with the use of conventional chemical pesticides or microbial pesticides, the treatment method may be appropriately selected depending on the type of plant disease or nematode, the type of plant to be treated, etc.
[0062] (Treatment Method) The microorganism of the present invention, its culture, a processed product of the culture, or a composition containing any of them may be used without any particular limitation on the treatment method. For example, plants may be treated by directly applying or spraying the microorganism to the plant, or the soil in which the plant is grown (plant cultivation soil) may be treated by mixing, spraying, or irrigating the soil. When treating the soil in which the plant is grown, the soil may be treated before planting the plant, or the soil may be treated after planting the plant. Furthermore, as described in JP 2001-302407 A, the microorganism of the present invention, its culture, a processed product of the culture, or a composition containing any of them may be placed near the air outlet of an air blower that blows air into a facility, and sprayed together with the air blown out from the air outlet. Furthermore, plant seeds, tubers, etc. may be coated, dusted, immersed, etc. with the microorganism of the present invention, its culture, a processed product of the culture, or a composition containing any of them, or the roots of plant seedlings may be treated by immersing them. Alternatively, the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them may be diluted in water and sprayed, or the solid agent may be sprayed directly onto the soil, or the solid agent may be placed in water and slowly released to exert its effect.
[0063] (Number of treatments) The number of treatments with the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them may be selected appropriately depending on the type of plant disease or nematode, the type of plant to be applied, the severity of the disease, etc.
[0064] (Treatment Concentration) When treating plants and / or plant cultivation soil with the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them, the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them may be used as is, or may be diluted with an appropriate amount of water, etc. The treatment concentration of the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them cannot be generally defined because it varies depending on the type of plant disease or nematode, the type of plant to be applied, etc., but when sprayed onto soil, it is usually 1 x 10 in terms of the bacterial cell concentration of the microorganism of the present invention. 2 ~1 x 10 11 cfu / mL, preferably 1 x 10 4 ~1 x 10 9 cfu / mL.
[0065] (Amount of spray water) When the microorganism of the present invention, a culture thereof, or a treated product of the culture, or a composition containing any of them is diluted with water and used, the dilution ratio and amount of spray water are not particularly limited and may be adjusted appropriately depending on the content of the microorganism or its culture, etc. For example, when the culture of the microorganism of the present invention is diluted 1000 to 20,000 times with water and used, the amount of spray water is usually 1 to 100,000 L / ha, preferably 10 to 10,000 L / ha, more preferably 100 to 7,000 L / ha. Also, for example, when the culture of the microorganism of the present invention is diluted 10,000 to 20,000 times with water and used, the amount of spray water may be, for example, 1,000 to 10,000 L / ha, but for example, when the culture of the microorganism of the present invention is diluted 1,000 to 2,000 times with water and used, the amount of spray water can be a small amount (for example, 100 to 1,000 L / ha) and still be effective.
[0066] (Mixture or Combined Use) The microorganism of the present invention, its culture, a processed product of the culture, or a composition containing any of them may be mixed or combined with other components. The other components may be, for example, one or more selected from the group consisting of fungicides, insecticides, miticides, nematicides, soil pesticides, anthelmintics, plant growth regulators, synergists, fertilizers, soil conditioners, and animal feed. Mixing or combining such other components may produce a synergistic effect.
[0067] Specific examples of fungicides that may be mixed or used in combination with the microorganism of the present invention, its culture, a treated product of the culture, or a composition containing any of them are shown below. (1) Nucleic acid biosynthesis inhibitors: (a) RNA polymerase I inhibitors: benalaxyl, benalaxyl-M, furalaxyl, metalaxyl, metalaxyl-M, oxadixyl, clozylacon, ofurace; (b) adenosine deaminase inhibitors: bupirimate, dimethirimol, ethirimol; (c) DNA / RNA synthesis inhibitors: hymexazol, octhilinone; (d) DNA topoisomerase II inhibitors: oxolinic acid.
[0068] (2) Mitotic inhibitors and cell division inhibitors: (a) β-tubulin polymerization inhibitors: benomyl, carbendazim, chlorfenazole, fuberidazole, thiabendazole, thiophanate, thiophanate-methyl, diethofencarb, zoxamide, ethaboxam; (b) cell division inhibitors: pencycuron; (c) spectrin-like protein delocalization inhibitors: fluopicolide.
[0069] (3) Respiratory inhibitors: (a) Complex I NADH oxidoreductase inhibitors: diflumetorim, tolfenpyrad; (b) Complex II succinate dehydrogenase inhibitors: benodanil, flutolanil, mepronil, isofetamide, fluopyram, fenfuram, furmecyclox, carboxin, oxycarboxin, thifluzamide, benzovindiflupyr, bixafen, fluxapyroxad, furametpyr, isopyrazam, penflufen, penthiopyrad, sedaxan, boscalid, pyraziflumid;(c) Complex III ubiquinol oxidase Qo inhibitors: Azoxystrobin, coumoxystrobin, coumethoxystrobin, enoxastrobin, flufenoxystrobin, picoxystrobin, pyraoxystrobin, pyraclostrobin, pyrametostrobin, triclopyricarb, kresoxim-methyl, trifloxystrobin, dimoxystrobin, fenaminstrobin, metominostrobin, orysastrobin, famoxadone, fluoxastrobin, fenamidone, pyribencarb, mandestrobin; (d) Complex III ubiquinol reductase Qi inhibitors: cyazofamid, amisulbrom; (e) oxidative phosphorylation uncouplers: binapacryl, meptyldinocap, dinocap, fluazinam, ferimzone; (f) oxidative phosphorylation inhibitors (ATP synthase inhibitors): fentin acetate, fentin chloride, fentin hydroxide; (g) ATP production inhibitors: silthiofam; (h) Complex III: Qx (unknown) inhibitors of cytochrome bc1 (ubiquinone reductase): ametoctradin;
[0070] (4) Amino acid and protein synthesis inhibitors (a) methionine biosynthesis inhibitors: andoprim, cyprodinil, mepanipyrim, pyrimethanil; (b) protein synthesis inhibitors: blasticidin-S, kasugamycin, kasugamycin hydrochloride, streptomycin, oxytetracycline.
[0071] (5) Signal transduction inhibitors: (a) Signal transduction inhibitors: quinoxyfen, proquinazid; (b) MAP / histidine kinase inhibitors in osmotic signal transduction: fenpiclonil, fludioxonil, chlozolinate, iprodione, procymidone, vinclozolin.
[0072] (6) Lipid and cell membrane synthesis inhibitors: (a) phospholipid biosynthesis and methyltransferase inhibitors: edifenphos, iprobenfos, pyrazophos, isoprothiolane; (b) lipid peroxidants: biphenyl, chloroneb, dichloran, quintozene, tecnazene, tolclofos-methyl, etridiazole; (c) agents acting on cell membranes: iodocarb, propamocarb, propamocarb-hydrochloride, propamocarb-fosetylate, prothiocarb; (d) microorganisms that disrupt pathogenic cell membranes: Bacillus (e) a cell membrane disrupting agent: Melaleuca altemifolia (tea tree) extract.
[0073] (7) Sterol biosynthesis inhibitors in cell membranes: (a) Demethylation inhibitors at C14 position in sterol biosynthesis: triforine, pyrifenox, pyrisoxazole, fenarimol, flurprimidol, nuarimol, imazalil, imazalil sulfate, oxpoconazole fumaratefumarate, pefurazoate, prochloraz, triflumizole, viniconazole, azaconazole, bitertanol, bromuconazole, cyproconazole, diclobutrazol, difenoconazole, diniconazole, diniconazole-M, epoxyconazole, etaconazole, fenbuconazole, fluquinconazole, flusilazole, flutriafol, fluconazole zole, fluconazole-cis, hexaconazole, imibenconazole, ipconazole, metconazole, myclobutanil, penconazole, propiconazole, fluquinconazole, simeconazole, tebuconazole, tetraconazole, triadimefon, triadimenol, triticonazole, prothioconazole, voriconazole, mefentrifluconazole; (b) Inhibitors of Δ14 reductase and Δ8→Δ7-isomerase in sterol biosynthesis: aldimorph, dodemorph, dodemorph acetateacetate), fenpropimorph, tridemorph, fenpropidine, piperalin, spiroxamine; (c) 3-ketoreductase inhibitors in the C4 demethylation of the sterol biosynthetic pathway: fenhexamid, fenpyrazamine; (d) squalene epoxidase inhibitors in the sterol biosynthetic pathway: pyributicarb, naftifin, terbinafine.
[0074] (8) Cell wall synthesis inhibitors: (a) trehalase inhibitors: validamycin; (b) chitin synthase inhibitors: polyoxins, polyoxorim; (c) cellulose synthase inhibitors: dimethomorph, flumorph, pyrimorph, benthiavalicarb-isopropyl, iprovalicarb, tolprocarb, valifenalate, mandipropamid.
[0075] (9) Melanin biosynthesis inhibitors (a) Reductase inhibitors of melanin biosynthesis: fthalide, pyroquilon, tricyclazole; (b) Dehydratase inhibitors of melanin biosynthesis: carpropamid, diclocymet, fenoxanil.
[0076] (10) Resistance inducers in host plants: (a) Agents acting on the salicylic acid synthesis pathway: acibenzolar-S-methyl; (b) Others: probenazole, tiadinil, isotianil, laminarin, reynoutriasachalinensis extract.
[0077] (11) Agents of unknown action: cymoxanil, fosetyl-aluminium, phosphoric acid (phosphate), tecloftalam, triazoxide, flusulfamide, diclomezine, methasulfocarb, cyflufenamid, metrafenone, pyriophenone, dodine, dodine free base, flutianil.
[0078] (12) Agents with multiple action points: copper (copper salt), Bordeaux mixture, copper hydroxide, copper naphthalate, copper oxide, copper oxychloride, copper sulfate, sulfur, sulfur products, calcium polysulfide polysulfide), ferbam, mancozeb, maneb, mancopper, metiram, polycarbamate, propineb, thiram, zineb, ziram, captan, captafol, folpet, chlorothalonil, dichlofluanid, tolylfluanid, guazatine, iminoctadine triacetate, iminoctadine trialbesilate, anilazine, dithianon, quinomethionate, fluoroimide.
[0079] (13) Other agents: DBEDC, fluorofolpet, guazatin acetate, bis(8-quinolinolato)copper(II) copper(II)), propamidine, chloropicrin, cyprofuram, Agrobacterium, bethoxazin, diphenylamine, methylisothiocyanate (MITC), mildew-mycin, capsaicin, cufraneb, cyprosulfamide, dazomet, debacarb, dichlorophen, flumetover, fosetyl calcium, fosetyl sodium, irumamycin, natamycin, nitrothal isopropyl isopropyl), oxamocarb, pyrrolnitrin, tebufloquin, tolnifanide, zarilamide, algophase, amicarthiazol, oxathiapiprolin, metiram zinczinc), benthiazole, trichlamide, uniconazole, mildew-mycin, oxyfenthiin, picarbutrazox, fenpicoxamid, dichlobentiazox, quinofumelin, thiuram, ambam, Agrobacterium radiobacter, Coniothyrium minitans, Pseudomonas fluorescens, Pseudomonas rhodesiae, Talaromyces flavus, Trichoderma atroviride atroviride), non-pathogenic Erwinia carotovora subsp. carotovora, Bacillus simplex, variovoraxparadoxus, and Lactobacillus plantarum.
[0080] Specific examples of insecticides, acaricides, nematicides, soil pesticides, anthelmintics, etc. that may be mixed or used in combination with the microorganism of the present invention, a culture thereof, a treated product of the culture, or a composition containing any of them are shown below.
[0081] (1) Acetylcholinesterase inhibitors: (a) Carbamates: alanycarb, aldicarb, bendiocarb, benfuracarb, butocarboxim, butoxycarboxim, carbaryl, carbofuran, carbosulfan, ethiofencarb, fenobucarb, formetanate, furathiocarb, isoprocarb, methiocarb, methomyl, oxaminium oxamyl, pirimicarb, propoxur, thiodicarb, thiofanox, triazamate, trimethacarb, XMC, xylycarb, fenothiocarb, MIPC, MPMC, MTMC, aldoxycarb, aliyxycarb, aminocarb, bufencarb, cloethocarb, metam-sodium, promecarb;
[0082] (b) Organophosphates: acephate, azamethiphos, azinphos-ethyl, azinphos-methyl, cadusafos, chlorethoxyfos, chlorfenvinphos, chlormephos, chlorpyrifos, chlorpyrifos-methyl, coumaphos umaphos), cyanophos (cyanophos), demeton-S-methyl (demeton-S-methyl), diazinon (diazinon), dichlorvos (dichlorvos) / DDVP, dicrotophos (dicrotophos), dimethoate (dimethoate), dimethylvinphos (dimethylvinphos), disulfoton (disulfoton), EPN, ethion (ethion), ethoprophos (ethoprophos), famphur (famphur), fenamiphos (fenam iphos), fenitrothion (fenitrothion), fenthion (fenthion), fosthiazate (fosthiazate), heptenophos (heptenophos), imicyaphos (imicyafos), isofenphos (isofenphos), isocarbophos (isocarbophos), isoxathion (isoxathion), malathion (malathion), mecarbam (mecarbam), methamidophos (methamidophos), methidathion (methidathion), Mevinphos (mevinphos), monocrotophos (monocrotophos), naled (naled), omethoate (omethoate), oxydemeton-methyl (oxydemeton-methyl), parathion (parathion), parathion-methyl (parathion-methyl), phenthoate (phenthoate), phorate (phorate), phosalone (phosalone), phosmet (phosmet), phosphamidon (phosphamidon), phoxim (phoxim),Pirimiphos-methyl, profenofos, propetamphos, prothiofos, pyraclofos, pyridaphenthion, quinalphos, sulfotep, tebupirimfos, temephos, terbufos, tetrachlorvinphos, thiometon, triazophos, trichlorfon, vamidothion, bromophos-ethyl, BRP, carbophenothion, cyanofenphos anofenphos), CYAP, demeton-S-methylsulfone, dialifos, diclofenthion, dioxabenzofos, etrimfos, fensulfothion, flupyrazofos, fonofos, formothion, fosmethilan, isazofos, iodofenphos, methacrifos, pirimiphos-ethyl, phosphocarb, propaphos, prothoate, sulprofos.
[0083] (2) GABA-gated chloride channel antagonists: acetoprole, chlordane, endosulfan, ethiprole, fipronil, pyrafluprole, pyriprole, camphechlor, heptachlor, dienochlor. (3) Sodium channel modulators: acrinathrin, d-cis-trans allethrin, d-trans allethrin, bifenthrin, bioallethrin, bioallethrin s-cyclopentyl isomer. isomer), bioresmethrin, cycloprothrin, cyfluthrin, beta-cyfluthrin, cyhalothrin, lambda-cyhalothrin, gamma-cyhalothrin, cypermethrin, alpha-cypermethrin, beta-cypermethrin, theta-cypermethrin, zeta-cypermethrin, cyphenothrin [(1R)-trans isomer]isomer], deltamethrin, empenthrin [(EZ)-(1R)-isomer], esfenvalerate, etofenprox, fenpropathrin, fenvalerate, flucythrinate, flumethrin, tau-fluvalinate, halfenprox, imiprothrin, kadethrin, permethrin, phenothrin [(1R)-trans isomer] isomer]), prallethrin, pyrethrum, resmethrin, silafluofen, tefluthrin, tetramethrin[(1R)-isomer], tralomethrin, transfluthrin, allethrin, pyrethrins, pyrethrin I, pyrethrin II II), profluthrin, dimefluthrin, bioethanomethrin, biopermethrin, transpermethrin, fenfluthrin, fenpirithrin, flubrocythrinate, flufenprox, metofluthrin, protrifenbute, pyresmethrin, and terallethrin.
[0084] (4) Nicotinic acetylcholine receptor agonists: acetamiprid, clothianidin, dinotefuran, imidacloprid, nitenpyram, nithiazine, thiacloprid, thiamethoxam, sulfoxaflor, nicotine, flupyradifurone. (5) Nicotinic acetylcholine receptor allosteric modulators: spinetoram, spinosad. (6) Chloride channel activators: abamectin, emamectin benzoate, lepimectin, milbemectin, ivermectin, selamectin, doramectin, eprinomectin, moxidectin, milbemycin, milbemycin oxime, nemadectin. (7) Juvenile hormone-like substances: hydroprene, kinoprene, methoprene, fenoxycarb, pyriproxyfen, diofenolan, epofenonane, triprene. (8) Other non-specific inhibitors: methyl bromide, chloropicrin, sulfuryl fluoride, borax, tartar emetic. (9) Homoptera selective feeding inhibitors: flonicamid, pymetrozine, pyrifluquinazon.
[0085] (10) Mite growth inhibitors: clofentezine, diflovidazin, hexythiazox, etoxazole. (11) Microbial-derived insect midgut membrane disrupting agents: Bacillus thuringiensis subsp. israelensi, Bacillus sphaericus, Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. kurstaki, Bacillus thuringiensis subsp. tenebrionis, Bt crop proteins: Cry1Ab, Cry1Ac, Cry1Fa, Cry1A.105, Cry2Ab, Vip3A, mCry3A, Cry3Ab, Cry3Bb, Cry34Ab1 / Cry35Ab1. (12) Mitochondrial ATP biosynthesis enzyme inhibitors: diafenthiuron, azocyclotin, cyhexatin, fenbutatin oxide, propargite, tetradifon. (13) Oxidative phosphorylation uncouplers: chlorfenapyr, sulfuramid, DNOC, binapacryl, dinobuton, dinocap. (14) Nicotinic acetylcholine receptor channel blockers: bensultap, cartap hydrochloride, nereistozin, thiosultap-sodium, thiocyclam.(15) Chitin synthesis inhibitors: bistrifluron, chlorfluazuron, diflubenzuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron, noviflumuron, teflubenzuron, triflumuron, buprofezin, fluazuron. (16) Diptera molting disruptors: cyromazine. (17) Molting hormone receptor agonists: chromafenozide, halofenozide, methoxyfenozide, tebufenozide. (18) Octopamine receptor agonists: amitraz, demiditraz, chlordimeform. (19) Mitochondrial electron transport chain complex III inhibitors: acequinocyl, fluacrypyrim, hydramethylnon. (20) Mitochondrial electron transport chain complex I inhibitors: fenazaquin, fenpyroximate, pyrimidifen, pyridaben, tebufenpyrad, tolfenpyrad, rotenone.
[0086] (21) Voltage-dependent sodium channel blockers: indoxacarb, metaflumizone. (22) Acetyl-CoA carboxylase inhibitors: spirodiclofen, spiromesifen, spirotetramat. (23) Mitochondrial electron transport chain complex IV inhibitors: aluminum phosphide, calcium phosphide, phosphine, zinc phosphide, cyanide. (24) Mitochondrial electron transport chain complex II inhibitors: cyenopyrafen, cyflumetofen, pyflubumide. (25) Ryanodine receptor modulators: chlorantraniliprole, cyantraniliprole, flubendiamide, cyclaniliprole, tetraniliprole. (26) Mixed function oxidase inhibitor compounds: piperonyl butoxide. (27) Latrophilin receptor agonists: depsipeptide, cyclic depsipeptide, 24-membered cyclodepsipeptide, emodepside. (28) Other agents (mechanism of action unknown): azadirachtin, benzoximate, bifenazate, bromopropylate, quinomethionate, cryolite, dicofol, pyridalyl, benclothiaz, sulfur, amidoflumet, 1,3-Dichloropropene (1,3-dichloropropene), DCIP, phenisobromolate, benzomate, metaldehyde, chlorobenzilate, clothiazoben, dicyclanil, fenoxacrim, fentrifanil, flubenzimine, fluphenazine, gossyplure, japonilure, metoxadiazone, petroleum oil, potassium oleate oleate), tetrasul, triarathene, afidopyropen, flometoquin, flufiprol, fluensulfone, meperfluthrin, tetramethylfluthrin, tralopyril, dimefluthrin, methylneodecaneamide mide), fluralaner, afoxolaner, fluxametamide, 5-[5-(3,5-dichlorophenyl)-5-trifluoromethyl-4,5-dihydroisoxazole-3-yl]-2-(1H-1,2,4-triazol-1-yl)benzonitrile (CAS: 943137-49-3)4-triazole-1-yl)benzonitrile (CAS: 943137-49-3), broflanilide, other metadiamides, Steinernema carpocapsae, Steinernema glacerii, Pasteuria penetrans, Paecilomyces tenuipes, Paecilomyces fumosoroseus, Beauveria bassiana, Beauveria brongniartii, Metarhizium anisopliae, and Verticillium lecanii.
[0087] (29) Anthelmintics: (a) benzimidazoles: fenbendazole, albendazole, triclabendazole, oxibendazole, mebendazole, oxfendazole, parbendazole, flubendazole, febantel, netobimin, thiophanate, thiabendazole, cambendazole; (b) salicylanilides: closantel, oxyclozanide, rafoxanide, niclosamide; (c) substituted phenols: nitroxinil, nitroscanate; (d) pyrimidines: (e) Imidazothiazoles: levamisole, tetramisole; (f) Tetrahydropyrimidines: praziquantel, epsiprantel; (g) Other anthelmintics: cyclodiene, ryania, clorsulon, metronidazole, demiditraz, piperazine, diethylcarbamazine, dichlorophen, monepantel, tribendimidine, amidantel, thiacetalsamide, melarsomine, arsenamide.
[0088] Specific examples of plant growth regulators that may be mixed or used in combination with the microorganism of the present invention, a culture thereof, a processed product of the culture, or a composition containing any of them are shown below. Abscisic acid, kinetin, benzylaminopurine, 1,3-diphenylurea, forchlorfenuron, thidiazuron, chlorfenuron, dihydrozeatin, gibberellin A, gibberellin A4, gibberellin A7, gibberellin A3, 1-methylcyclopropane, N-acetylaminoethoxyvinylglycine (aviglycine), aminooxyacetate, silver nitrate, cobalt chloride chloride), IAA, 4-CPA, cloprop, 2,4-D, MCPB, indole-3-butyrate, dichlorprop, phenothiol, 1-naphthyl acetamide, ethychlozate, cloxyfonac, maleic acid hydrazide, 2,3,5-triiodobenzoic acid5-triiodobenzoic acid, salicylic acid, methyl salicylate, (-)-jasmonic acid, methyl jasmonate, (+)-strigol, (+)-deoxystrigol, (+)-orobanchol, (+)-sorgolactone, 4-oxo-4-(2-phenylethyl)aminobutyric acid, ethephon, chlormequat, mepiquat chloride, benzyladenine, 5-aminolevulinic acid acid), daminozide.
[0089] Specific examples of fertilizers that may be mixed or used in combination with the microorganism of the present invention, its culture, a processed product of the culture, or a composition containing any of them are listed below. The fertilizers may be inorganic or organic. Ammonium salts (ammonium sulfate, ammonium phosphate, ammonium nitrate, calcium ammonium nitrate, ammonium sulfate nitrate, ammonium sulfate, ammonium chloride, etc.); urea, nitrogen, phosphoric acid, potassium, iron, magnesia lime, slaked lime, phosphorous acid, acetic acid, boric acid, α-amino acids (glutamic acid, etc.), γ-amino acids (GABA, etc.), fulvic acid, and salts thereof; seaweed extract, chicken manure, cow manure, goat manure, horse manure, sheep manure, pig manure, rice straw, rice husks, rice bran, soybean meal, oil cake, bone meal, fish meal, compost, and bark compost.
[0090] The present invention will be explained in more detail below with reference to examples, but the technical scope of the present invention is not limited to these examples.
[0091] [Isolation and Identification of Bacteria] 1. Strain Selection Spore-forming bacteria isolated from plant surfaces throughout Japan were screened for strains antagonistic to Botrytis cinerea, and a strain isolated from dead grass in Fujieda City, Shizuoka Prefecture, was identified. This strain was designated strain 201106_1. Based on colony morphology, strain 201106_1 was presumed to be a bacterium of the genus Bacillus. It is a Gram-positive rod-shaped bacterium that produces acid aerobically and exhibits bacillus-type spore formation.
[0092] 2. Genetic Analysis (1) 16S rRNA Gene The nucleotide sequence of the 16S rRNA gene of the 201106_1 strain was analyzed. Specifically, genomic DNA was first isolated from the 201106_1 strain according to conventional methods. Using the obtained genomic DNA as a template, PCR amplification was performed according to conventional methods using the 9F primer (SEQ ID NO: 1) and 1500R primer (SEQ ID NO: 2) used to amplify the 16S rRNA gene. The obtained PCR product was sequenced using the 9F primer or 1500R primer to determine the partial nucleotide sequence of the 16S rRNA gene of the 201106_1 strain (SEQ ID NO: 3).
[0093] A BLAST homology search was performed on the partial nucleotide sequence of the 16S rRNA gene of strain 201106_1. The results confirmed that the sequence showed 100% identity with multiple strains belonging to Bacillus amyloliquefaciens or Bacillus velezensis, strongly suggesting that strain 201106_1 likely belongs to the genus Bacillus.
[0094] (2) phoR Gene The nucleotide sequence of the phoR gene of the 201106_1 strain was analyzed. Specifically, genomic DNA was first isolated from the 201106_1 strain according to standard methods. Using the resulting genomic DNA as a template, PCR amplification was performed according to standard methods using the phoR-F primer (SEQ ID NO: 4) and the phoR-R primer (SEQ ID NO: 5). The resulting PCR product was sequenced using the phoR-R primer, and the partial nucleotide sequence of the phoR gene of the 201106_1 strain was determined (SEQ ID NO: 6).
[0095] A homology search was performed using BLAST on the partial nucleotide sequence of the phoR gene of the 201106_1 strain, and the results confirmed that it exhibited high identity of 99% or more with multiple strains belonging to Bacillus amyloliquefaciens or Bacillus veresensis, and in particular, it was confirmed that it exhibited 100% identity with two strains belonging to Bacillus veresensis.
[0096] Commercially available pesticides containing Bacillus bacteria as an active ingredient include, for example, Agrocare Wettable Powder (Nissou Green Co., Ltd.), Serenade ASO (Bayer Crop Science Co., Ltd.), Botkiller Wettable Powder (SDS Biotech Co., Ltd.), Ecoshot (Kumiai Chemical Industry Co., Ltd.), and Impression Clear (SDS Biotech Co., Ltd.). The strains contained in these were isolated, and the partial nucleotide sequence of the phoR gene was determined using the same method as above and compared with the partial nucleotide sequence of the phoR gene of the 201106_1 strain. As a result, there were no strains whose partial nucleotide sequence of the phoR gene matched the 201106_1 strain, but among them, the Bacillus subtilis HAI-0404 strain, which is the active ingredient of Agrocare Wettable Powder, showed the highest identity (99.5%). Therefore, in each test of Examples 5 to 7 described below, the Bacillus subtilis strain HAI-0404 was used as a comparative example.
[0097] (3) dam gene The nucleotide sequence of the dam gene of the 201106_1 strain was analyzed. Specifically, genomic DNA was first isolated from the 201106_1 strain according to standard methods. Using the obtained genomic DNA as a template, PCR amplification was performed according to standard methods using the dam-F primer (SEQ ID NO: 7) and the dam-R primer (SEQ ID NO: 8). The presence or absence of a PCR product was confirmed by agarose gel electrophoresis, and the obtained PCR product was sequenced using the dam-F primer or the dam-R primer to determine the partial nucleotide sequence of the dam gene of the 201106_1 strain (SEQ ID NO: 9).
[0098] A homology search was performed using BLAST on the partial nucleotide sequence of the dam gene of strain 201106_1. The results showed high identity with multiple strains belonging to Bacillus amyloliquefaciens or Bacillus veresensis, but no strains with 98.0% or more identity were identified. Furthermore, when the complete genome sequences of two strains belonging to Bacillus veresensis that showed 100% identity in the partial nucleotide sequence of the phoR gene were examined, it was confirmed that neither of these two strains possessed a dam gene. These findings strongly suggest that strain 201106_1 may be a novel strain belonging to Bacillus amyloliquefaciens or Bacillus veresensis.
[0099] [Cultivation of 201106_1 strain (1)] 100 mL of standard liquid medium (0.25% (w / v) yeast extract, 0.5% (w / v) casein peptone, 0.1% (w / v) glucose, adjusted to pH 7.0 with sodium hydroxide) was placed in a 300 mL Erlenmeyer flask and sterilized by heating. 201106_1 strain was inoculated and cultured in a reciprocating shaker at 30°C and 100 rpm for 3 days to obtain a culture.
[0100] [Cultivation of 201106_1 strain (2)] Five liters of heat-sterilized Bacillus medium (corn steep liquor 5% (w / v), soybean peptone 3% (w / v), glucose 3% (w / v), sodium chloride 1% (w / v), potassium dihydrogen phosphate 0.1% (w / v), magnesium sulfate 0.05% (w / v), calcium chloride 0.05% (w / v), manganese chloride 0.025% (w / v), pH adjusted to 7.0 with sodium hydroxide) was placed in a 10-liter jar fermenter, inoculated with the 201106_1 strain, and cultured at 30°C, 350 rpm, and an aeration rate of 5 L / min for 4 days to obtain a culture.
[0101] [Cultivation of 201106_1 strain (3)] 100 g of heat-sterilized solid medium for Bacillus (20% (w / v) defatted soybeans, 80% (w / v) water) was placed in a tray, and the 201106_1 strain was inoculated and cultured at 25°C for 7 days to obtain a culture.
[0102] [Test on the effectiveness of 201106_1 strain cells in controlling grey mold disease in beans (laboratory test)] The culture of Example 2 was centrifuged at 10,000 × g for 5 minutes, and the supernatant was removed to obtain a culture precipitate mainly containing 201106_1 strain cells. The precipitate was adjusted to OD600 = 0.1 with ion-exchanged water, and green bean flower vases were immersed in the precipitate for 10 minutes. The green bean flower vases were then placed on a petri dish lined with filter paper and air-dried for approximately 2 hours. A conidial suspension (5.0 × 10 5The green bean flower vases were inoculated with 200 L / 10 a of the spores (spores / mL) sprayed using an airbrush. The green bean flower vases were then placed on the surface of cucumber cotyledons contained in a plastic container with a lid for moisture retention, and left to stand for 5 days at 20°C in the dark and under moist conditions. The reason for using green beans for the flower vases and cucumber for the cotyledons is to facilitate the test. As a comparative example, a test was conducted in the same manner except that the strain used was Bacillus subtilis HAI-0404. The diameter of the lesions formed on the cucumber cotyledons was measured. The control titer was calculated based on the following formula. The "average" is the average of four replicates. Control titer = {1 - (average lesion diameter in treated area / average lesion diameter in untreated area)} x 100 As a result, as shown in Table 1, the cells of the 201106_1 strain showed a higher control effect against gray mold of kidney beans than the cells of Bacillus subtilis HAI-0404 strain.
[0103]
[0104] [Test for measuring the minimum inhibitory concentration (MIC) of Botrytis cinerea spores using the culture supernatant of strain 201106_1 (laboratory test)] The culture of Example 2 was centrifuged at 10,000 × g for 5 minutes to obtain only the culture supernatant. The culture supernatant was filtered through a 0.2 μm filter to obtain a filtrate. The filtrate was then diluted with a suspension of Botrytis cinerea spores (5.0 × 10) prepared in a medium containing 200 ppm Tween 20 water, 2% glucose, and 1% yeast extract. 4 The filtrate was mixed with 100 ml of 201106_1 strain (spores / mL), poured into wells of a 96-well plate, and incubated at 20°C for 7 days. The degree of mycelial growth in the wells was visually examined. Similarly, tests were conducted on solutions diluted 2-fold, 4-fold, 8-fold, and 16-fold with sterile water, and the maximum dilution rate at which the minimum inhibitory concentration was achieved was calculated. As a comparative example, a test was conducted in the same manner except that the strain used was Bacillus subtilis HAI-0404. As a result, as shown in Table 2, the culture supernatant of the 201106_1 strain had a maximum dilution rate of 8 times the minimum inhibitory concentration against spores of Botrytis cinerea, which was superior to the 4-fold dilution rate of Bacillus subtilis HAI-0404 strain.
[0105] *The maximum dilution rate that resulted in the minimum inhibitory concentration is shown.
[0106] [Test on the Control Effect of Culture of 201106_1 Strain on Cucumber Powdery Mildew (Pot Test)] A culture of 201106_1 strain was diluted 10-fold with ion-exchanged water, and a sufficient amount was sprayed on the leaves of potted cucumber seedlings. The spray treatment was carried out three times at seven-day intervals. On the day of the first spray treatment, potted cucumber seedlings infected with cucumber powdery mildew (Sphaerotheca cucurbitae) were placed nearby. As a comparative example, a test was carried out in the same manner except that the strain used was Bacillus subtilis HAI-0404. Seven days after the third spray, the number of cucumber powdery mildew lesions was counted. The control titer was calculated according to the following formula. In the following formula, "average" refers to the average of three repetitions, with one test per pot being considered one repetition. Control titer = {1 - (average number of lesions in treated area / average number of lesions in untreated area)} x 100 As a result, as shown in Table 3, the culture of the 201106-1 strain showed a higher control effect against cucumber powdery mildew than the culture of Bacillus subtilis HAI-0404 strain.
[0107]
[0108] [Test on the effectiveness of a culture of the 201106_1 strain in controlling cucumber powdery mildew (field test)] (Test A) A culture of the 201106_1 strain was diluted 1500-fold with ion-exchanged water and sprayed at a rate of 300 L / ha on cucumbers grown in a greenhouse (201106_1 culture spray area A). Spraying was performed three times at 7-day intervals. Disease development was controlled by natural infection. As a comparative example, a similar test was performed, except that a wettable powder of Bacillus amyloliquefaciens D747 strain (Double Nickel 55, manufactured by CERTIS Biologicals) was diluted 100-fold and sprayed at a rate of 300 L / ha (Bacillus amyloliquefaciens D747 wettable powder spray area). Seven days after the third spray, the incidence of powdery mildew on cucumbers was investigated. The disease incidence index was calculated as follows: index 0: no disease observed; index 1: lesion area occupying less than 5% of the leaf area; index 2: lesion area occupying 5 to 25% of the leaf area; index 3: lesion area occupying 25 to 50% of the leaf area; index 4: lesion area occupying 50% or more of the leaf area. The disease incidence and control titer were calculated using the following formula. In the formula, "n1" to "n4" are the numbers of plants corresponding to the disease incidence indexes 1 to 4, respectively. The "average" is the average of three replicates. Disease severity = {(1 × n1 + 2 × n2 + 3 × n3 + 4 × n4) / (4 × total number of plants tested)} × 100 Control titer = {1 - (average disease severity in treated areas / average disease severity in untreated areas)} × 100 (Test B) A culture of 201106_1 strain was diluted 15,000 times with ion-exchanged water, and sprayed at a rate of 3,000 L / ha on greenhouse-grown cucumbers. Test was conducted in the same manner as in Test A (201106_1 culture spray area B). As a comparative example, chlorothalonil wettable powder (Daconil 1000, manufactured by SDS Biotech) was diluted 1,000 times and sprayed at a rate of 3,000 L / ha. Test was conducted in the same manner as in Test A (chlorothalonil wettable powder spray area).
[0109] As a result, as shown in Tables 4 and 5, the culture of the 201106-1 strain exhibited a higher control effect against cucumber powdery mildew than the Bacillus amyloliquefaciens D747 strain wettable powder, and also exhibited a control effect as high as that of chlorothalonil wettable powder.
[0110]
[0111]
[0112] [Broccoli downy mildew control efficacy test using 201106_1 strain culture (field test)] The 201106_1 strain culture was diluted 500-fold with ion-exchange water and sprayed in sufficient amounts on broccoli grown in a greenhouse (201106_1 strain culture spray area). Spraying was performed five times at approximately 7-day intervals. The day after the second spray, pots infected with broccoli downy mildew were planted at the base of the plants in the buffer area. As a comparative example, a test was performed in the same manner except that a chlorothalonil wettable powder (Daconil 1000, manufactured by SDS Biotech) was used at a 1000-fold dilution (chlorothalonil wettable powder spray area). Broccoli downy mildew incidence was investigated 8 days after the fifth spray. The disease index was assessed as follows: index 0: no disease observed, index 0.5: up to 2 lesions observed on leaves, index 1: 3 to 5 lesions observed on leaves, index 2: 6 to 10 lesions observed on leaves, index 3: 11 to 20 lesions observed on leaves, index 4: 21 or more lesions observed on leaves, and the disease severity and control titer were calculated based on the following formula. In the formula, "n0.5" to "n4" are the numbers of plants corresponding to disease indices 0.5 to 4, respectively. "Average" is the average of three replicates. Disease severity = {(0.5 × n0.5 + 1 × n1 + 2 × n2 + 3 × n3 + 4 × n4) / (4 × total number of plants surveyed)} × 100 Control titer = {1 - (average disease severity in treated areas / average disease severity in untreated areas)} × 100 As a result, as shown in Table 6, the culture of the 201106-1 strain showed a high level of control effect against broccoli downy mildew, similar to that of chlorothalonil wettable powder.
[0113]
[0114] [Test on the efficacy of cultures of strain 201106_1 in controlling Chinese cabbage soft rot (field test)] A culture of strain 201106_1 was diluted 100-fold with ion-exchanged water and sprayed in sufficient amounts on Chinese cabbage plants planted in the field (201106_1 culture spray area). Spraying was performed four times at 7-day intervals. On the day of the second spraying treatment, a suspension of Pectobacterium carotovorum in ion-exchanged water (OD600 = 0.1) was sprayed onto the base of the Chinese cabbage. As a comparative example, a test was conducted in the same manner except that a solution of a 2000-fold diluted copper wettable powder (Coside 3000, manufactured by DuPont Production Agriscience) diluted 100-fold with calcium carbonate (Clefnon, manufactured by Shiraishi Calcium Co., Ltd.) was sprayed (copper wettable powder spray area). The incidence of Chinese cabbage soft rot was investigated 14 days after the fourth application. The disease index was calculated as follows: index 0: no disease observed; index 1: disease observed on some outer leaves; index 2: disease observed on some outer leaves and head leaves; index 3: disease observed on most of head leaves. The disease severity and control titer were calculated based on the following formula. In the formula, "n1" to "n3" represent the number of plants corresponding to disease indices 1 to 3, respectively. "Average" refers to the average of three replicates. Disease severity = {(1 × n1 + 2 × n2 + 3 × n3) / (3 × total number of plants investigated)} × 100 Control titer = {1 - (average disease severity in treated areas / average disease severity in untreated areas)} × 100. As a result, as shown in Table 7, the culture of strain 201106-1 exhibited a high level of control effect against Chinese cabbage soft rot, comparable to that of a copper wettable powder.
[0115]
[0116] [Test on the effectiveness of a culture of strain 201106_1 in controlling brown rot of peach (postharvest treatment test)] A culture of strain 201106_1 was diluted 1500 times with ion-exchanged water, and a sufficient amount was sprayed onto peach fruit that had been harvested and previously injured with a pinprick. The day after spraying, a suspension of the peach brown rot fungus prepared to a spore concentration of 100,000 spores / mL was sprayed onto the peach fruit and stored at 25°C. Three days after inoculation, the diseased fruit rate and the rate of wounded diseased areas were tallied, and the control values for the fruit and wounded areas were calculated, respectively. The "average" refers to the average of two replicates. <Fruit> Diseased fruit incidence rate = number of diseased fruits / total number of fruits surveyed x 100 Control value = {1 - (average diseased fruit incidence rate in treated areas / average diseased fruit incidence rate in untreated areas)} x 100 <Damaged areas> Damaged diseased area incidence rate = number of damaged diseased areas / total number of damaged areas x 100 Control value = {1 - (average damaged diseased area rate in treated areas / average damaged diseased area rate in untreated areas)} x 100 As a result, as shown in Tables 8 and 9, the culture of the 201106_1 strain showed high control effect against peach brown rot in post-harvest treatment.
[0117]
[0118]
[0119] [Test on the effectiveness of citrus green mold disease control using a culture of the 201106_1 strain (postharvest treatment test)] A culture of the 201106_1 strain was diluted 5,000 times with ion-exchange water, and a sufficient amount was sprayed onto mandarin orange fruits that had been harvested and punctured with a pin. The day after spraying, a suspension of citrus green mold fungus adjusted to a spore concentration of 100,000 spores / mL was sprayed onto the mandarin orange fruits and stored at 25°C. Ten days after inoculation, the diseased fruit rate was tallied and the control titer was calculated. The "average" is the average of two replicates. Diseased fruit rate = number of diseased fruits / total number of fruits surveyed × 100 Control titer = {1 - (average diseased fruit rate in treated areas / average diseased fruit rate in untreated areas)} × 100 As a result, as shown in Table 10, the culture of the 201106_1 strain demonstrated high control efficacy against citrus green mold disease when treated postharvest.
[0120]
[0121] [Nematode Control Effect Test Using 201106_1 Strain Culture (Laboratory Test)] A 201106_1 strain culture was diluted 500-fold with ion-exchange water, and approximately 50 L2 larvae of Meloidogyne incognita were added to a 96-well plate at 200 μL per well. The 96-well plate was stored at 15°C. After two days, abnormal behavior was assessed and the rate of abnormally behaving individuals was calculated. As a comparative example, a test was conducted in the same manner except that the 201106_1 strain culture was not used. The test was conducted twice. As a result, when the 201106_1 strain culture was not used, the rate of abnormally behaving Meloidogyne incognita individuals was 0%, whereas when the 201106_1 strain culture was used, the rate of abnormally behaving Meloidogyne incognita individuals was 100%, specifically, all individuals exhibited symptoms of paralysis. Since paralysis prevents nematodes from invading or feeding on plants, it is thought that nematodes can be controlled by using a culture of the 201106_1 strain.
[0122] As described above, the microorganisms of the present invention, their cultures, or culture supernatants obtained by processing the cultures have been shown to have the ability to control at least Chinese cabbage soft rot, a bacterial disease, and at least the fungal diseases gray mold of beans, powdery mildew of cucumber, downy mildew of broccoli, brown rot of peach, and green mold of citrus, which are filamentous fungal diseases. Furthermore, comparisons with existing Bacillus bacteria or cultures thereof, which are active ingredients in commercially available microbial pesticides, or with commercially available chemical pesticides, have shown that the microorganisms of the present invention, their cultures, or processed cultures thereof have a high level of plant disease control ability. Therefore, the microorganisms of the present invention, their cultures, or processed cultures thereof can effectively control plant diseases. Furthermore, since the microorganisms of the present invention, cultures thereof, or processed products of the cultures have high control potency against a variety of plant diseases, they are expected to be effectively used not only to control the above-mentioned Chinese cabbage soft rot, kidney bean gray mold, cucumber powdery mildew, broccoli downy mildew, peach brown rot, and citrus green mold, but also to control other diseases of various plants, such as gray mold, sclerotinia rot, powdery mildew, anthracnose, ring spot, blue mold, green mold, soft rot, and scab. Furthermore, since the cultures of the microorganisms of the present invention have been shown to have control potency against peach brown rot and citrus green mold in post-harvest fruits, the microorganisms of the present invention, cultures thereof, or processed products of the cultures are expected to be effectively used to control a variety of plant diseases not only in pre-harvest plants and / or plant cultivation soil, but also in post-harvest plants. Furthermore, since the culture of the microorganism of the present invention caused symptoms of paralysis in nematodes, it is expected that the microorganism of the present invention, its culture, or a processed product of the culture can be effectively used not only to control plant diseases but also to control nematodes.
[0123] SEQ ID NO: 1: 9F primer GAGTTTGATCCTGGCTC
[0124] SEQ ID NO: 2: 1500R primer TACCTTGTTACGACTT
[0125]
[0126] SEQ ID NO: 4: phoR-F primer GTCCGTGTGCGTCTGTTCGC
[0127] SEQ ID NO: 5: phoR-R primer GCCGCTTCAGCGTCACG
[0128] SEQ ID NO: 6: Partial nucleotide sequence of the phoR gene of strain 201106_1 GAGACGAAAAAATGCCAGCTGCTCAGACTTCCCATCAACATTGAGCGGCGCTACTTTGAAGTTGACGGCGTTCCGATCATGGGCCCTGACGATGAATGGAAGGGCATCGTCCTCGTCTTTCACGATATGACGGAAATTAAAAAATTGGAGCAGATGAGAAAGGACTTCGTCGCCAATGTCTCCCATGAACTGAAAACACCGATCACCTCGATTAAAGGATTTACGGAAACACTGTTAGACGGGGCGATGAAAGACGAAAAGGCGCTTTCAGACTTTCTGTCTATTATTCTGAAAGAAAGTGAGCGGCTCCAATCTCTCGTGCAGGATTTACTGGATTTATCCAAGATGGAGCAGCAAAACTTTACGATGCGCGTAGAGTCCTTTGACGCCGCAA AAATTCTGCATGAAATTGAAGCGCTTTTGCGGCATAAGGCTGAGGAAAAAGGCATCAGCTTTCAGCTCGATCTCCCGGAAGAGCCGATTTTGTGACGGGTGATGCGCACAGGCTGAAGCAGGTGTTTTTGAATCTGGCGAACAATGCCCTGACCTACACGCCTGAAAAAAGGGACGGTGGGGATTTCGGTACATGTG AAAGAAACCGTTGTCGATATCAAAGTGTCCGATACGGGAATCGGCATTCAGAAGGAAGAGATCCCGCGGATATTTGAGAGATTCTACCGCGTGGATAAAGACAGAAGCCGCAACTCGGGAGGAACCGGGCTCGGCCTCGCCATCGTGAAGCACTTAATAGAAGCCCATGAAGGTAAAATCGAGGTCACAAGCGAGCCG
[0129] SEQ ID NO: 7: dam-F primer ATGGCACGCTCACCATTAATCTGG
[0130] SEQ ID NO: 8: dam-R primer TTCCCTCCTGATCAAATAAGCTGAGTTG
[0131] SEQ ID NO: 9: Partial nucleotide sequence of the dam gene of strain 201106_1 ATCATAAATAAAATGCCCGCCCATAAGGTGTACGTCGAGCCTTTCGGCGGCGCGGCTCATGTCATAGCGAATAAGCCGCAAATGGGACATGAAGTGTATAACGACATTGACGGCCATGTGGTGAATTTCTTGATGCAAGTTAGAAAGGATCCGAAGGCCATGCAGCAGGCCTGCGAGTCCATTCCGTACAGCCGGGCGCTCTATGAGAAATGGAAAACTGAAGATTACCCACAAGATGATTTTGACCGGGCTGTCAGGTGGTTTTATATGAATCGTTCCGGCATTAGTAAGGGGAACGCGGAGGAAGTACCGCAGACAGGCTGGAGGCATAGCACACAAAGCGGGCAGAACC CTGCTGGCGGATACATAAACGCCTGCGCTGCCTTCGAGTCTTTCGCCAACCGCATGAAGGGCGTCATGATCGAATGTAAGGATTTTCGCAACATCATTGAGAAATACGATAGCCCGGATACTCTGTTTTATGTGGATCCGCCATACGTTGGCCGAGAGCGGTTTTACGCTGGCGGC TTTACGGAAGAGGATCACCGGGAACTGGCCCGGCTGCTTAATCAGGTCAAAGGGAAAGTGGTTCTTTCTTATTACGATGATCCTTTGATACTCGAGATCTACCCGAACTGGGAGTCAGAAACCTTTTCCGCATACAAACAGGTTGTCGGCGGATCCGGAAAAAAGTCGCGGCGCTGAA
Claims
1. Bacillus sp. strain 201106_1 (NITE BP-03884 strain).
2. A mutant strain of Bacillus sp. 201106_1 (NITE BP-03884 strain), which has the ability to control plant diseases or nematodes.
3. A culture of the strain according to claim 1 or 2.
4. A processed product of the culture described in claim 3.
5. The processed product according to claim 4, which is a culture supernatant.
6. A composition comprising the strain according to claim 1 or 2, a culture of said strain, or a processed product of said culture.
7. The composition according to claim 6, wherein the processed material is a culture supernatant.
8. The composition according to claim 6, which is a plant disease control composition.
9. The composition according to claim 8, which is a plant disease control composition for post-harvest plants.
10. The composition according to claim 8, wherein the plant disease is a bacterial disease or a fungal disease.
11. The composition according to claim 6, which is a nematode control composition.
12. A method for controlling plant diseases, comprising treating a plant and / or the soil in which the plant is grown with the strain described in claim 1 or 2, a culture of said strain, a processed product of said culture, or a composition containing any of them.
13. A method for controlling plant diseases in post-harvest plants, comprising treating post-harvest plants with the strain described in claim 1 or 2, a culture of said strain, a processed product of said culture, or a composition containing any of them.
14. A method for controlling nematodes, comprising treating a plant and / or the soil in which the plant is grown with the strain described in claim 1 or 2, a culture of said strain, a processed product of said culture, or a composition containing any of them.
15. A method for producing a plant, comprising treating the plant and / or the soil in which the plant is grown with the strain described in claim 1 or 2, a culture of said strain, a processed product of said culture, or a composition containing any of them.
Citation Information
Patent Citations
Method for scattering agrochemical
JP2001302407A
Liquid level sensor, liquid storage device and medicine dispensing system
JP2024021425A
Plant disease control agent composition and microorganisms
JP4695070B2
Bacillus strains, microbial preparations, and methods for cultivating plants.
JP5198690B2
Novel bacillus velezensis CJBV and antimicrobial compositions comprising the same
JP2016000031A
Cited By
Bacillus for preventing and treating camellia oleifera anthracnose and application thereof
CN120775754A
Bacillus velezensis strain JZ01, microbial inoculum containing bacillus velezensis strain JZ01 and application of bacillus velezensis strain JZ01
CN120905095A