Functional composition, beverage concentrate, functional beverage, dietary supplement, pharmaceutical composition comprising thereof and uses thereof to support and improve the functioning of the nervous system and the brain, and as an energy drink
A synergistic blend of beta-alanine, acetyl-L-carnitine, carnosine, and B vitamins addresses the limitations of energy drinks, enhancing nervous system function and energy levels without side effects, serving as a safe and effective energy source.
Patent Information
- Application Number
- PCT/PL2025/050010
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-13
- Filing Date
- 2025-02-10
- Publication Date
- 2025-08-21
AI Technical Summary
Existing energy drinks based on caffeine and taurine cause temporary stimulation followed by undesirable physiological symptoms and contribute to lifestyle diseases, while existing supplements with beta-alanine, acetyl-L-carnitine, and carnosine lack synergy for long-term nervous system support.
A functional composition combining beta-alanine, acetyl-L-carnitine, carnosine, and B group vitamins (B1, B3, B6, B12) in specific doses, providing a synergistic effect that supports and stabilizes the nervous system without side effects.
The composition enhances energy and vitality, improves concentration, and regenerates the nervous system, offering a safe alternative to energy drinks with no short-term or long-term adverse effects.
Smart Images

Figure IMGF000011_0001 
Figure IMGF000011_0002 
Figure IMGF000013_0001
Abstract
Description
[0001] Functional composition, beverage concentrate, functional beverage, dietary supplement, pharmaceutical composition comprising thereof and uses thereof to support and improve the functioning of the nervous system and the brain, and as an energy drink
[0002] TECHNICAL FIELD
[0003] The object of the invention is a functional composition acting as an energy drink, supporting at the same time the functioning of the nervous system, which enables the production of functional beverages based on a common "core", i.e. a basic formulation consisting of non-protein amino acids and B group vitamins, which can be produced in a dry form and as a concentrated beverage, a beverage, a functional beverage, a dietary supplement, a functional food, as well as a pharmaceutical composition, which are produced based on this basic formulation and their use as a healthy energy drink to improve the vitality and increase the energy of the body and to support, aid and stabilize the functioning of the nervous system, which enables their use in the functional composition as a safe formula replacing an energy drink, preferably for administration in the form of a functional beverage, as well as their use for the treatment and prevention of the indicated disease states.
[0004] STATE OF ART
[0005] Commercially available beverages and dietary supplements with stimulating and energizing effects are based on the activity of two main active ingredients: caffeine and taurine. The combination of these two active substances, combined with a whole range of additional ingredients, including a large amount of sugars, has an energizing effect - in the short term it causes stimulation, accelerates the heart rate and increases blood pressure. Such beverages work by quickly increasing the activity of the body, including the nervous system, and increasing the ability to concentrate. However, this is only a temporary effect that occurs at the expense of incurring an energy debt in the body, leading, depending on the circumstances of consumption, to a "comedown" effect, that is a sudden drop in mood, accompanied by undesirable physiological symptoms, including drowsiness, in the perspective of even few dozen minutes.
[0006] Long-term use of energy drinks, especially those supplemented with a large amount of simple sugars, leads to adverse physical and mental symptoms, energy drinks stimulate the development of lifestyle diseases, damage the liver and pancreas, lead to obesity, increase blood pressure in previously healthy people, increase the risk of heart disorders, and in the mental sphere, their long-term use leads to a decrease in serotonin levels and an increase in noradrenaline in the brain, increased stress, anxiety, mood swings and depression.
[0007] From the publication US20230310461A1 a composition containing beta-alanine, acetyl-L-carnitine, carnosine or carnitine is known, but these compounds are in combination with other antioxidants, and the composition is intended for use in the prevention and treatment of prediabetes, and not for use as a safe energy source by supporting, supporting and stabilizing the functioning of the nervous system.
[0008] From the publication W02020237340A1 a liquid high-energy dietary supplement based on invert sugars derived mainly from sugar cane is known, which may contain carnitine, alanine and vitamins as additives. The document does not describe the use of acetyl-L-carnitine, nor the use of beta-alanine, carnosine, carnitine as the main active ingredients, as a safe functional beverage replacing an energy drink.
[0009] From the publication WO2009147229A1 a composition is known, being a dietary supplement containing Russian tarragon in combination with carnitine, which is used to enhance the cellular uptake of carnitine. The document discloses the possibility of adding carnosine and beta-alanine to the composition, but as lactic acid buffering agents.
[0010] DISCLOSURE OF THE INVENTION
[0011] In the light of the described state of the art, the aim of the present invention is to overcome the indicated inconveniences resulting from the use of the caffeine and taurine system in energy drinks and to provide a solution using substances available on the market and permitted for sale in combination and proportions giving additional functional effects, the sum of which is not the sum of the functionality of each of the individual substances, but the effect of their synergy.
[0012] The aim of the invention is therefore to provide a functional composition containing a basic formulation and products based thereon, particularly in liquid form, based on the main active ingredients which are betaalanine, carnosine, acetyl-L-carnitine supplemented with selected B group vitamins, i.e. B1 , B3, B6 and B12 in doses effective to obtain a functional composition, particularly a safe functional beverage replacing an energy drink, in particular for its use to support and improve the functioning of the nervous system and the brain.
[0013] The aim of the present invention is also to break the paradigm of the previously known energy drink based on the combination of two functional ingredients: taurine and caffeine, optionally supplemented with sugar, and to prepare a beverage with a direct energizing effect and a long-term effect that promotes regeneration and improves the functioning of the nervous system, without causing side effects known for currently available and used energy drinks.
[0014] The inventors unexpectedly found that the combination of active ingredients beta-alanine, acetyl-L-carnitine and carnosine providing non-protein amino acids in combination with B group vitamins, i.e. B1 , B3, B6 in appropriate amounts, the functional composition obtained using such a combination has unique and unknown functional features, having a beneficial effect on the functioning, hygiene and regeneration of the nervous system, and at the same time acting as a completely safe energy drink without any side effects known for energy drinks currently available on the market.
[0015] The essence of the invention is therefore a functional composition for administration to an individual comprising a basic formulation constituting a single dose of a functional composition with beta-alanine in an amount of 0.01 g to 2.0 g, acetyl-L-carnitine in an amount of 0.01 g to 2.0 g, carnosine in an amount of 0.01 g to 2.0 g, vitamin B1 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B3 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B6 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B12 in a dose of 10-500% of the recommended daily intake (RDI); wherein the composition is intended to increase the energy and vitality of the body and to support, aid and stabilize the functioning of the nervous system of the individual; wherein preferably the individual is a human.
[0016] In a preferred functional composition, the base formulation consists of a single dose of a functional composition of beta-alanine in an amount of 0.5±10%g, acetyl-L-carnitine in an amount of 0.6±10%g, carnosine in an amount of 0.5±10%g, vitamin B1 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B3 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B6 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B12 in a dose of 50%±10% ofthe recommended daily intake (RDI).
[0017] In a preferred functional composition, the base formulation comprises a single dose of a functional composition of beta-alanine in an amount of 0.5 g, acetyl-L-carnitine in an amount of 0.6 g, carnosine in an amount of 0.5 g, vitamin B1 in a dose of 50% of the recommended daily intake (RDI), vitamin B3 in a dose of 50% of the recommended daily intake (RDI), vitamin B6 in a dose of 50% of the recommended daily intake (RDI), vitamin B12 in a dose of 50% of the recommended daily intake (RDI).
[0018] The functional composition preferably further comprises L-glutamine in an amount of 0.02-2 g, more preferably in an amount of 0.2±10% g; more preferably also comprises sodium chloride in an amount of 0.1-1 g, more preferably in an amount of 0.375±10% g.
[0019] The functional composition preferably further comprises at least one additional active ingredient, preferably selected from glutamic acid, glutamate, L-glutamine, glycine, choline, L-theanine and folic acid.
[0020] In a preferred functional composition, vitamin B1 is in the form of thiamine mononitrate; vitamin B3 is in the form of niacin, nicotinamide PP or a mixture thereof; vitamin B6 is in the form of pyridoxine hydrochloride; vitamin B12 is in the form of cobalamin, cyanocobalamin, methylcobalamin, adenosylcobalamin or hydroxocobalamin or a mixture thereof.
[0021] The functional composition is preferably intended to enhance concentration, sharpen the senses and improve thinking in an individual.
[0022] The functional composition is preferably in a dry, loose form, preferably in the form of a powder, granules, granulate, powder for preparing a solution or a mixture thereof.
[0023] The functional composition is preferably in the form of a tablet, dragee, hard or elastic capsule, soluble tablet, effervescent tablet, coated tablet, sugar-coated tablet, solution, oral suspension.
[0024] The functional composition is preferably in liquid form.
[0025] The functional composition further preferably comprises at least one of the following additives: a flavor additive, an adjuvant, a stabilizer, a preservative, an acidity regulator, a juice concentrate, a coloring agent, an aroma, a sweetener.
[0026] In a preferred functional composition, at least one of the flavor additive, adjuvant, stabilizer, preservative, acidity regulator, juice concentrate, colorant, aroma, sweetener is selected from: i) a flavor additive selected from: a flavor, preferably selected from natural fruit flavors, watermelon flavor, pitaya flavor, mango flavor, pomegranate flavor, elderflower flavor; fruit juice concentrate; fruit juice, preferably selected from apple juice, blackcurrant juice, raspberry juice, blueberry juice, elderberry juice, cranberry juice, peach juice, mango juice, pineapple juice, orange juice, tangerine juice, plum juice, mirabelle plum juice, pear juice, blueberry juice, chokeberry juice; or mixtures thereof; ii) an adjuvant, preferably in the form of an additive ensuring the appropriate isotonicity of the functional composition, preferably selected from sodium chloride, potassium chloride, or a mixture thereof; iii) a stabilizer selected from glycerol, xanthan gum, or a mixture thereof; iv) a preservative selected from benzoic acid, sodium benzoate, potassium sorbate, or a mixture thereof v) an acidity regulator, preferably selected from ascorbic acid, citric acid, malic acid, or a mixture thereof; vi) a dye selected from curcumin, riboflavin, carotenes, lycopene, lutein; vii) sweetener selected from sucrose, glucose, xylitol, steviol glycosides, erythritol, aspartame.
[0027] The functional composition is preferably in the form of a beverage, a dietary supplement, a pharmaceutical composition, a medical agent, a drug for treating and / or preventing disease states, including diseases and conditions in which the functional composition acts as an agent with antioxidant activity on the nervous system, an antidepressant, an agent increasing the vitality of the body of the individual, an agent increasing the energy of the body of the individual, an agent increasing the efficiency of the body of the individual, an agent increasing the concentration of the body of the individual, an agent increasing the sharpness of the senses of the individual, an agent increasing the thinking abilities of the body of the individual.
[0028] The functional composition is preferably intended for administration at least once a day, preferably twice a day, preferably three times a day.
[0029] The invention also relates to a beverage concentrate containing the functional composition according to the invention.
[0030] The invention also relates to a functional beverage containing the functional composition according to the invention, preferably based on fruit juice, water, milk, a plant beverage, a plant beverage replacing milk.
[0031] The invention also relates to a dietary supplement containing the functional composition according to the invention.
[0032] The invention also relates to a pharmaceutical composition comprising the functional composition according to the invention for use in treating, supporting, supporting and stabilizing the functioning of the nervous system of an individual.
[0033] The invention also relates to a pharmaceutical composition comprising a functional composition according to the invention for use in treating or preventing a disease state with reduced concentration of an individual.
[0034] The invention also relates to a pharmaceutical composition comprising the functional composition according to the invention for use in treating and preventing conditions with reduced sensory perception of an individual.
[0035] The invention also relates to a pharmaceutical composition comprising the functional composition according to the invention for use in treating and preventing disease states with reduced thinking and analysis abilities of an individual.
[0036] The invention also relates to a pharmaceutical composition comprising the functional composition according to the invention for use in treating and preventing disease states with reduced vital energy of an individual. The invention also relates to a pharmaceutical composition comprising the functional composition according to the invention for use in treating and preventing conditions with reduced sleep quality of an individual.
[0037] The invention also relates to the use of the functional composition according to the invention for the production of a functional beverage, a functional food, a dietary supplement.
[0038] The functional compositions produced use active ingredients of substances that affect the body's energy balance and the functioning of the nervous system, such as:
[0039] Amino acids
[0040] Non-protein amino acids, although they are not a building block of proteins, play an extremely important role as neurotransmitters, in regulating our metabolism and key life processes. Their deficiencies and disorders in their metabolism can cause neurodegenerative changes leading to a decrease in physical and intellectual efficiency.
[0041] The substances constituting the active ingredients in the functional compositions according to the invention, i.e. beta-alanine, acetyl-L-carnitine and carnosine play an important role in the regeneration of the nervous system and inhibition of oxidative processes. Carnosine has anti-neurotoxic properties - it protects the cells of the nervous system from the effects of toxins. Beta-alanine is a raw material for the synthesis of carnosine, at the same time it affects the delay of aging processes, and acetyl-L-carnitine supports the learning processes and regeneration of nerve cells. p-alanine (p-Ala) is an endogenous amino acid produced in the liver and used primarily as a substrate in the synthesis of carnosine, a dipeptide responsible for, among other things, buffering the level of H+ions, p-alanine supplementation translates into increased endurance and energy efficiency of muscle tissue, as well as faster regeneration and reduced fatigue even after very intensive training, p-alanine is of great importance for increasing the efficiency and endurance of muscle work. In the functional composition according to the invention, p-alanine is also a reservoir of an easily accessible substrate for carnosine synthesis.
[0042] Carnosine is a dipeptide consisting of p-alanine and L-histidine. Carnosine is an endogenous dipeptide found abundantly in skeletal muscle and brain, mainly in neuroglial cells. It has many beneficial effects, such as antioxidant and chelating effects. Carnosine has important functions in the brain, such as protecting cells from oxidative stress, modulating neurotransmitter activity, and influencing cognitive functions. Oxidative stress may be one of the factors contributing to brain aging and the development of neurodegenerative diseases. Carnosine, as an antioxidant, neutralizes the effects of free radicals, protects neurons from damage and prevents their degeneration. A high concentration of carnosine in the body is particularly beneficial for athletes. During exercise, lactic acid is produced in muscle tissue and the level of H+ions increases. In muscles, carnosine acts as a buffer that ensures an optimal pH level by lowering the H+level. As a result, it also prevents muscle fiber losses and allows for faster regeneration. People who supplement carnosine are therefore able to perform more intense and longer training.
[0043] Acetyl-L-carnitine is an acetyl ester of the dipeptide L-carnitine synthesized from lysine and methionine. Acetyl-L-carnitine is produced in mitochondria by the enzyme carnitine acetyltransferase. It takes part in many metabolic cycles, e.g. in p-oxidation of fatty acids and energy production. It can be a reservoir of acetyl groups in the reaction of producing acetyl-coenzyme A (acetyl-CoA). It was found that in comparison with "regular" L-carnitine, its acetyl derivative has a much stronger effect on the central nervous system. Acetyl-L-carnitine has a beneficial effect on the efficiency of muscle cells, especially the heart muscle.
[0044] B group vitamins (i.e. B1 , B3, B6, B12), included in the functional composition according to the invention, are closely related to the functioning of the nervous system. Vitamin B1 plays a key role in cellular respiration processes, its deficiencies can result in a number of neurological disorders, including concentration and memory disorders and depression; vitamin B3 is involved in key metabolic processes, its deficiency, common e.g. in people abusing alcohol, leads to a number of disorders including serious neurological disorders, vitamin B6 as an element of prosthetic enzyme groups, is involved, among others, in the synthesis processes of key neurotransmitters, vitamin B12 participates in the synthesis process of the myelin sheath protecting neurons and neurotransmitters, its deficiency causes mental balance disorders and negatively affects learning processes and concentration.
[0045] Vitamin B1 can be administered, for example, in the form of thiamine mononitrate; B3 can be, for example, in the form of niacin, nicotinamide; B6 can be, for example, in the form of pyridoxine hydrochloride; B12 can be, for example, in the form of cobalamin, cyanocobalamin, methylcobalamin, adenosylcobalamin or hydroxocobalamin.
[0046] During the studies conducted on volunteers, it was unexpectedly found that the administration of the functional composition according to the invention with a simple composition gives a synergy effect and has a positive effect on the nervous system and the energy balance of the body, and the combined administration of the active ingredients beta-alanine, acetyl-L-carnitine and carnosine providing non-protein amino acids in combination with B group vitamins, i.e. B1 , B3, B6, enhances the well-being and efficiency of the body, which enables the use of the functional composition according to the invention as a safe functional beverage replacing an energy drink, which does not cause side effects like an energy drink, and on the contrary also shows health-promoting functions.
[0047] Beta-alanine, acetyl-L-carnitine and carnosine play an important role in the regeneration of the nervous system and inhibition of oxidative processes. Carnosine has anti-neurotoxic properties - it protects the cells of the nervous system from the effects of toxins. Beta-alanine is a raw material for the synthesis of carnosine, at the same time it affects the delay of aging processes, and acetyl-L-carnitine supports the learning processes and regeneration of nerve cells. Unexpectedly, it was found that their combined administration in the form of a functional composition according to the invention gives a synergistic effect on the nervous system, enhances the well-being and efficiency of the body, and therefore such a composition has unique and previously unknown functional features that have a beneficial effect on the functioning, hygiene and regeneration of the nervous system and the entire body, thanks to which the functional composition according to the invention can be used as a safe functional beverage replacing an energy drink, without the side effects observed when using energy drinks, and on the contrary also showing health-promoting functions.
[0048] During the studies, it was shown that the functional composition according to the invention, administered even once a day, has a stimulating effect, supports physical activity, improves concentration and sharpens the senses, supports the functioning of the nervous system, improves thought processes, increases vitality, while not showing any side effects, especially observed when using known energy drinks based on caffeine and taurine. The functional composition may be prepared in a dry form, a thickened liquid form for measuring and dilution by the end user, a thickened liquid form for dilution at the stage of industrial production, a ready-to-beverage form in a measured volume to obtain a unit dose for administration, or a ready-to-beverage beverage form in a unit dose for administration.
[0049] None of the tested compositions (see Examples 1 -3) showed the side effects known for currently available energy drinks based on caffeine and taurine and sugar, and therefore, surprisingly, the invention provides a functional composition intended for people who want to achieve a stable increase in the body's mobilization without side effects and support the functioning of the nervous system, especially by regenerating the nervous system and inhibiting oxidative processes.
[0050] The functional composition may contain additional ingredients:
[0051] Additional ingredients constituting flavor additives providing the appropriate taste may be: flavor aromas, natural fruit aromas, e.g. watermelon aroma, pitaya aroma, mango aroma, pomegranate aroma, elderflower aroma, fruit juice concentrate; fruit juice, preferably selected from apple juice, currant juice, blackcurrant juice, raspberry juice, blueberry juice, elderberry juice, cranberry juice, peach juice, mango juice, pineapple juice, orange juice, tangerine juice, plum juice, mirabelle juice, pear juice, blueberry juice, chokeberry juice.
[0052] Additional active ingredients may preferably be selected from glutamic acid, glutamate, L-glutamine, glycine, choline, L-theanine, folic acid.
[0053] Additional supporting substances are, for example, ingredients ensuring the appropriate isotonicity of the functional composition, for example selected from sodium chloride, potassium chloride or a mixture thereof.
[0054] Additional stabilizing ingredients of the functional composition such as stabilizers are preferably selected from glycerol, xanthan gum.
[0055] Additional preservative components of the functional composition, such as preservatives, are preferably selected from benzoic acid, sodium benzoate, potassium sorbate, or a mixture thereof.
[0056] Additional ingredients ensuring the proper acidity of the functional composition such as acidity regulators, preferably selected from ascorbic acid, citric acid, malic acid.
[0057] Additional ingredients providing the appropriate color of the functional composition such as colorants, preferably selected from curcumin, riboflavin, carotenes, quinoline yellow, carmine acid, cochineal red, patent blue, azorubine, brilliant blue, green S, brilliant black BN, brown HT, lycopene, lutein.
[0058] Additional ingredients ensuring the appropriate sweetness of the functional composition such as sweeteners, preferably selected from sucrose, glucose, xylitol, steviol glycosides, erythritol, aspartame.
[0059] The "recommended daily intake" (RDI), also known as the "recommended dietary allowance" (RDA) for a given vitamin or an additional ingredient, should be understood as the amount recommended for daily consumption for an individual as indicated in the document ..Resolution of the Team for Dietary Supplements operating at the Sanitary and Epidemiological Council No. 6 / 2021 " issued in accordance with Regulation (EC) No. 1925 / 2006 of the European Parliament and of the Council of 20 December 2006 on the addition of vitamins and minerals and certain other substances to food (OJ EU L 404 of 30.12.2006, p. 26, as amended) and the definition of food (foodstuff) as set out in art. 2 of Regulation (EC) No. 178 / 2002 of the European Parliament and of the Council of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety Authority and laying down procedures in matters of food safety (EU OJ L 31 of 1 February 2002, p. 1 , as amended) i.e. available at https: / / www.gov.pl / web / gis / zespol-do-spraw-suplementow-diety.
[0060] During the studies, it was shown that the functional composition according to the invention, administered even once a day, unexpectedly has a stimulating, energizing effect, supports physical activity, improves concentration and sharpens the senses, supports the functioning of the nervous system, improves thought processes, increases vitality, while at the same time showing no side effects, especially the side effects observed when using known energy drinks based on caffeine and taurine.
[0061] BRIEF DESCRIPTION OF THE DRAWINGS
[0062] Exemplary embodiments of the invention are presented in the figures, in which:
[0063] Fig.1 Presents the age profile of the study participants with a percentage breakdown for each age group;
[0064] Fig. 2 Presents the average score of individual parameters and the average overall score taking into account the importance criteria of the individual parameters.
[0065] Fig. 3 Presents the percentage of positive ratings for individual parameters (a rating of >4 is considered a positive rating).
[0066] Fig. 4. Presents the results of the determination of BDNF expression changes (after normalization to the GAPDH transcript level, control level = 1) in nerve cell lines cultured with individual active ingredients of the functional composition and their mixture (mix). A- cell line A-172, B- cell line SH-N-AS, C- cell line SH-SY5Y.
[0067] Fig. 5. Presents the percentage change in the distance covered in the Cooper Test. Active - the administered preparation of the functional composition according to the invention (Active (-CI)) with an indication of the number of days of administration. Studies after 28 days for 0-28 days, after 56 days for 0-56 days of administration of a given preparation.
[0068] Fig. 6. Presents graphs illustrating the comparison of the effect on sleep quality of the placebo and the tested functional composition. A- Sleep quality expressed in percentage scale, where 100% is the maximum value. B- Average number of awakenings in the study participants.
[0069] Fig. 7. Presents a comparison of the effect of placebo and the tested functional composition on sleep. A- shows the trend line of sleep quality improvement - sleep quality expressed on a percentage scale, where 100% is the maximum value (linear regression); B- shows the trend line of the decrease in the number of awakenings during sleep (linear regression).
[0070] The publications cited in the description and the references given therein are hereby included in their entirety as references.
[0071] EMBODIMENTS OF THE INVENTION
[0072] The following examples were presented merely to illustrate the invention and to clarify its various aspects, but are not intended to be limitative, and should not be equated with all its scope, which is defined in the appended claims. EXAMPLES
[0073] The following examples present functional compositions supporting the work of the nervous system based on a basic formulation (the composition forming the core) and functional compositions supplemented with additional additives, for example, aimed at the needs of a given group of recipients or made in a specific form of its production. Functional compositions can be prepared in the form of weighed active ingredients in dry, concentrated, liquid or ready-to-consume form, preferably in the form of a beverage.
[0074] Functional compositions may be supplemented with flavor additives, supporting substances, stabilizers, preservatives, acidity regulators, juice concentrates, juices, colorants, flavors and sweeteners in doses and proportions permitted by food law, depending on the needs and preferences. Preferred additives are mixtures of fruit juices, preferably natural juices, preferably without added sweeteners.
[0075] The dry form of the functional composition used, for example, to produce a beverage, a concentrated form of a beverage or a beverage produced therefrom, particularly for the purpose of diversifying taste and aroma experiences, may be supplemented with flavor and aroma additives, preferably in the form of a mixture of fruit juices, preferably natural juices, preferably without the addition of sweeteners.
[0076] The examples given below provide the composition of the active ingredients used in experiments on healthy human volunteers, calculated per single dose, included in the tested functional composition.
[0077] In the following examples, unless otherwise indicated, standard materials and methods in the art were used or the manufacturer's recommendations for specific materials and methods were followed.
[0078] Example 1. Preparation of a basic formulation (core) of a functional composition supporting the functioning of the nervous system and having an energizing effect
[0079] Based on the experiments conducted on a group of volunteers and the biochemical and physicochemical properties of various mixtures of active substances obtained from many tests, a mixture of the basic formulation (core formulation) was developed, containing the active substances necessary to obtain a functional composition supporting the work of the nervous system and having an energizing effect, and therefore providing an effect that stimulates the body, supports and stabilizes the work of the nervous system.
[0080] A_- active ingredient ranges in the formulation blends of the basic functional composition
[0081] The produced mixtures of the basic functional composition formulation, for which the effect supporting the functioning of the nervous system was observed, contained per single dose: beta-alanine in the amount of 0.01 g to 2.0 g; acetyl-L-carnitine in the amount of 0.01 g to 2.0 g, carnosine in the amount of 0.01 g to 2.0 g and vitamins B1 , B3, B6 and B12 in a dose of 10-500% of the recommended daily intake (RDI) each, when administered once a day.
[0082] B_- base functional composition formulation mixture for further human studies
[0083] For further preclinical studies in humans, healthy adult volunteers were prepared with a basic formulation mixture containing the active ingredients for a single dose: beta alanine 0.5 g; acetyl-L-carnitine 0.6 g; carnosine 0.5 g, and vitamins B1 , B3, B6 and B12, each at 50% of the recommended daily intake (RDI). To prepare a single dose of the beverage, the base formula mixture was dissolved in 250 ml of water, preparing an energizing beverage that supports the nervous system.
[0084] The functional composition prepared in this way in the form of a beverage was tested on a group of 15 individuals, administered once a day, and the impact of the functional composition on the nervous system was assessed through changes in the ability to concentrate, sharpen the senses, and think more clearly. The study participants received 1 portion of the beverage (250 ml) to consume, and then assessed its effect 30 minutes after consuming the full portion, marking the appropriate fields in the functional composition assessment scale table.
[0085] The evaluation of the effect was carried out based on the changes observed by those consuming the composition, which were assessed on a 5-point scale for 4 parameters on a point scale from 1 to 5 in accordance with the assessment scale presented in Table 1.
[0086] Table 1. The scale of evaluation of the tested parameters after consumption of the functional composition based on the basic formulation.
[0087] The following results were obtained in the tests conducted over two consecutive weeks, presented in Table 2.
[0088] Table 2. Summary of the evaluation of individual parameters for the functional composition based on the basic formulation.
[0089] The functional composition produced in the form of a beverage from the base formulation can also be used to obtain a beverage, preferably a single dose of the beverage, for example after dissolving in a volume of 10-1000 ml of water, or water containing any combination of ingredients such as: flavor additives, adjuvants, stabilizers, preservatives, acidity regulators, juice concentrates, colorants, aromas and sweeteners in doses and proportions permitted by food law.
[0090] The tested functional composition did not cause any side effects known for energy drinks based on caffeine or taurine.
[0091] Example 3. Preparation of a functional composition with an energizing effect, supporting the functioning of the nervous system and enhancing physical performance - the "active" type
[0092] In order to conduct further preclinical studies on humans, who were healthy adult volunteers, a functional composition with an energizing effect, supporting the functioning of the nervous system and enhancing physical performance was produced, which was obtained as in Example 2B and with the addition of a single dose of sodium chloride in the amount of 0.375 g
[0093] L-glutamine in the amount of 0.2 g.
[0094] To prepare a single dose of the functional composition of the "active" type in the form of a beverage, the mixture was dissolved in water and supplemented with flavor additives to improve it: currant flavor additive with berry flavor additive in a ratio of 3:1 and watermelon aroma, then supplemented with water to the final volume up to 250 ml.
[0095] The functional composition of the "active" type, in its assumption is intended for physically active people who, through its consumption, in addition to supporting the nervous system and obtaining an energizing effect, also want to obtain the effect of improving the physical efficiency of the body. It is therefore dedicated to physically active people as well as those who want to improve their sports results and the overall efficiency of the body.
[0096] To prepare a functional composition of the "active" type, the basic formulation was supplemented with an active ingredient, which was L-glutamine regulating the conduction of nerve signals and neuronal activity, and with sodium chloride (NaCI) recommended for supplementation during increased physical activity, i.e. obtaining a beverage with isotonic properties. The addition of NaCI is optional and can also be replaced with KCI.
[0097] The functional composition prepared in this way in the form of an "active" beverage was tested on a group of 15 individuals, administered once a day, and the impact on the nervous system was assessed through changes in the ability to concentrate, sharpen the senses and think more clearly, and the taste, color and smell of the functional composition administered were also assessed.
[0098] The study participants included 7 women and 8 men with the age profile shown in Fig. 1.
[0099] The study participants received 1 portion of the beverage (250 ml) for consumption, and then assessed its effect 30 minutes after consuming the full portion, marking the appropriate fields in the functional composition assessment scale table. The assessment of the effect was carried out based on the changes observed by the participants consuming the composition, which were assessed on a 5-point scale for 7 parameters on a point scale from 1 to 5 in accordance with the assessment scale presented in Table 3. Table 3. Scale of evaluation of the tested parameters after consumption of the functional composition of the "active" type.
[0100] The mean score and standard deviation forthe individual parameters studied were calculated. The following results were obtained in the studies conducted over two consecutive weeks, summarized in Table 4.
[0101] Table 4. Summary of the evaluation of individual parameters of the "active" functional composition.
[0102] The total score was calculated using the Ak*Wkformula, taking into account the importance coefficients (Wk) for the individual assessed parameters and the number of points obtained for them (Ak) and is presented in Fig. 2. The percentage of positive scores for the individual assessed parameters was calculated, considering only the score with the value >4 as positive. The obtained results are presented in Fig. 3.
[0103] As the study showed, the average rating of the functional composition of the "active" type in the form of a beverage was 4.4 / 5.0, with a standard deviation of 0.52.
[0104] There were no extremely negative responses among the ratings given. Apart from smell, all parameters (both organoleptic and functional) were rated very positively (score equal to or higher than 4). The highest overall score given was 4.9 (2 people).
[0105] The tested compositions did not cause any side effects known for energy drinks based on caffeine, taurine and possibly sugar. The functional composition produced in the form of a beverage from the basic formulation and additives required to obtain an "active" type composition can also be used to obtain a beverage, preferably a single dose of the beverage, for example after dissolving in a volume of 10-1000 ml of water, or water containing any combination of ingredients such as: flavor additives, supporting substances, stabilizers, preservatives, acidity regulators, juice concentrates, colorants, flavors and sweeteners in doses and proportions permitted by food law.
[0106] To diversify the taste and smell experience, the beverage may be supplemented with a flavor base in the form of a mixture of fruit juices, preferably natural juices, preferably without added sweeteners.
[0107] The conducted studies have shown that the basic formulation and the functional compositions produced on its basis according to the invention, administered in one dose per day, fulfill the function of an energy drink, increasing vitality and causing an energy surge in individuals consuming it, but at the same time support the functioning of the nervous system, providing clearer thinking, increased concentration and sharpening of the senses in people consuming it. The functional composition according to the invention, by influencing the well-being and stabilization of the nervous system, also ensures regeneration and increases the neuropathy of the nervous system with its longer consumption.
[0108] The basic formulation allows for the production of functional compositions according to the invention, adjusted in terms of taste and smell to the needs of the recipient, and through the addition of other active ingredients it can also be aimed at obtaining additional physiological effects.
[0109] Such functional compositions supplemented with additional active ingredients can be tailored to the needs of individual recipients, e.g. to simultaneously strengthen the physical capacity of the body, it has been shown that it is possible to prepare a functional composition based on the basic formulation, addressed to a group of physically active people - the "active" type.
[0110] Example 4. Study of the effect of a functional composition substance on the level of BDNF gene expression in the cultures of selected cell lines of the nervous system.
[0111] The following experiments were performed to molecularly confirm the effect of individual active ingredients of the functional composition according to the invention and their mixtures on the nervous system. For this purpose, cell lines of nervous system cells capable of expressing and secreting BDNF, i.e. brain-derived neurotrophic factor (BDNF), were used. It is a small protein (the molecular weight of the functional homodimer is approximately 27 kDa) secreted by neurons, belonging to the family of nerve growth factors, responsible, among others, for the regulation of processes related to brain morphogenesis, neuroplasticity, learning and memory processes, neuronal cell growth, neurogenesis and energy metabolism.
[0112] Therefore, the demonstration of the effect of individual active ingredients of the functional composition according to the invention and their mixtures on BDNF in cell lines originating from the nervous system reflects, at the level of the applied cellular model, the actual effect on the functioning of the brain at the molecular and real level.
[0113] The study used three cell lines from the nervous system obtained from the ATCC cell bank:
[0114] A-172 Glioblastoma, (ATCC-CRL-1620: a cell line isolated from brain tissue used in neurological research. SH-SY5Y Neuroblastoma (ATCC-CRL-2266); neuroblast line used in immunological, neurological and toxicological studies.
[0115] SK-N-AS Neuroblastoma ATCC-CRL-2137 neuroblast line isolated from the brain, used in neurological and immunology research.
[0116] Cell cultures
[0117] Cells of individual lines A-172, SH-SY5Y and SK-N-AS were cultured in DMEM medium (Merck: D6429, 12133C, P4323) supplemented with 10% FCS and antibiotics and a complex of B group vitamins (Vitamin B1 (thiamine mononitrate) - Vitamin B3 (niacin) - Vitamin B6 (pyridoxine) - Vitamin B12 (cobalamin) each added at a concentration proportional to the concentration of beta-alanine in the formulation, on standard 24-well cell culture plates. After reaching 70% confluence, active ingredients were added to the medium in concentrations selected based on literature data, at the same time reflecting the proportions of individual active ingredients in the functional composition according to the invention: beta-alanine - 10 mM (146064 Merck);
[0118] L-glutamine - 4 mM (41-218-25 Biological Industries);
[0119] L-carnosine - 20 mM (C9625 Merck); acetyl-L-carnitine (ALC) -10 mM (A6706 Merck)
[0120] In the cultures, a mixture (so-called MIX) of the above-mentioned active ingredients was also used, i.e. in the experiment taking into account the mixture of active compounds, their total concentration was 44 mM (beta-alanine - 10 mM, L-glutamine - 4 mM, L-carnosine - 20 mM), acetyl-L-carnitine - 10 mM), excluding B group vitamins, which were also present in them.
[0121] The cell lines were cultured at 37°C in a 5% CO2 atmosphere. The cells were incubated for 6 hours with the tested compounds. The control culture was a pure medium without the addition of active substances. Each culture, for each cell line, was performed in 3 independent replicates.
[0122] BDNF expression determination
[0123] After the incubation period, RNA was isolated from cells using the GeneMAGNET RNA Purification Kit (EURx cat. no. E3401). RNA concentration was measured with a spectrophotometer (Cole-Parmer SP- 350-NANO Genova Nano).
[0124] In order to determine the level of the BDNF gene mRNA transcript, the RT-qPCR reaction was performed to detect the expression level of BDNAF and the expression level of the gene encoding glyceraldehyde-3- phosphate dehydrogenase GAPDH, which, as the so-called housekeeping gene, i.e. a gene of basic metabolism with a constant expression level, was used as an internal standard for normalization.
[0125] For RT-qPCR reactions, 400ng RNA was taken. The reactions were carried out in a StepOne Thermofisher thermal cycler. The reactions were performed using the quantitative PCR kit with reverse transcription from EURx Probe OneStep RT-qPCR kit, plus ROX solution, cat. no. E0813 in the presence of primers and probes specific for BDNF mRNA (250 nM) and GAPDH (50 nM).
[0126] Sequences of primers and probes used in the reaction:
[0127] GAPDH primer F: GATTCCACCCATGGCAAATTC (SEQ ID NO: 1); GAPDH primer R: GGGATTTCCATTGATGACAAGC (SEQ ID NO: 2);
[0128] GAPDH probe: CACCGTCAAGGCTGAGAACGGGA (SEQ ID NO: 3);
[0129] BDNF primer F: TGGCCTACCCAGGTGTGCGGA (SEQ ID NO: 4);
[0130] BDNF primer R: CCCATTCACGCTCTCCAGAG (SEQ ID NO: 5);
[0131] BDNF probe: TGGCCTACCCAGGTGTGCGGA (SEQ ID NO: 6).
[0132] The Ct values obtained in the reaction, indicating the amplification efficiency proportional to the amount of mRNA tested, were converted into relative amounts of BDNF mRNA in the mRNA preparations.
[0133] The obtained results are presented as a graph of the mean and SD of 3 replicates recalculated so that the mean for control cultures was equal to 1 ; the results after normalization to the GAPDH transcript level, control level = 1 are presented in Table 5 and Fig. 4a-c, respectively.
[0134] Tab. 5. Average BDNF expression levels after normalization to GAPDH.
[0135] The results were statistically analyzed using the ANOVA test. For the SH-N-AS and SH-SY5Y cell lines, the statistical significance of the synergistic effect of the complete amino acid formulation was confirmed in terms of the increase in the amount of the mRNA transcript of the BDNF protein coding sequence. An increase in the BDNF level of about 50% was observed. For the A172 line, a similar increase was observed for the full combination of the functional composition components (MIX). In the studies conducted on cells of the nervous system it was shown that the active ingredients of the functional composition synergistically stimulate the expression of the gene encoding BDNF, increasing the transcript level in a statistically significant way more than each of the components separately.
[0136] Thus, the actual influence of the functional composition according to the invention on supporting, supporting and stabilizing the functioning of the nervous system of an individual, in particular on the functioning of the brain at the molecular level, was demonstrated in the cellular model by demonstrating the impact on the used cell lines of the nervous system.
[0137] Example 5. Evaluation of long-term supplementation with the functional composition according to the invention
[0138] In order to demonstrate the effect of the functional composition during long-term administration to humans on their physical condition and selected cognitive abilities, sleep rhythm, physical performance, level of molecular markers used in diagnostics, and condition of the nervous system, studies were conducted in the conditions of a 10-week research experiment involving 30 people.
[0139] During the study, the effect of regular and long-term supplementation with a functional composition of the "Active (-CI)" type (hereinafter also referred to as the tested preparation) with the content of active ingredients as indicated in Table 6, which was produced as in Example 3 (but without the addition of HCI or KCI, without supplementation of chlorides), with a mixture of amino acids (beta-alanine, carnosine, acetyl-L-carnitine, L-glutamine) and B group vitamins was tested.
[0140] Tab. 6 Qualitative and quantitative composition of active substances in the tested functional composition - "Active (-CI)" type beverage
[0141] The research experiment was conducted for 74 days from January 8 to March 22, 2024, in Poland.
[0142] In the experiment carried out in two centers at the Polish Mother's Health Centre in Lodz and the Zamkowa Medical Centre in Pabianice, 30 people representing the age range of 22-63 years took part, with an average age of 40 years and a median of 42 years, while maintaining the gender ratio of 16:14 (women:men). The endpoints of the study that were important from the point of view of the functionality of the preparation were to determine the effect of the tested beverage on:
[0143] - blood parameters (morphology) - expected result: no changes or improvement in a statistically significant range;
[0144] - blood parameters (liver markers) - expected result: no changes or improvement in a statistically significant range;
[0145] - fitness and physical activity - expected result: improvement of performance in a statistically significant range
[0146] - cognitive abilities - expected result: improvement in at least 2 of 3 parameters (memory, reaction time, association) in a statistically significant range;
[0147] - sleep rhythm and quality - expected result: improvement of parameters (extended share of REM phase in sleep rhythm and / or extension of individual REM phase periods) in a statistically significant range.
[0148] An analogous flavor mixture without active substances was used as a placebo in the study (see Example 3).
[0149] I. TEST PROCEDURE
[0150] The study included 3 research STAGES. During the study, participants were required to wear measuring equipment in the form of a smartwatch (Garmin, Forerunner 265S), with a function of measuring heart rate and activity. Data was regularly sent to the server via the LABFRONT application (www.labfront.com) and processed to analyze the actigraphy profile.
[0151] During the experiment, participants were required to report any possible adverse events, technical problems, or deviations from the experimental rigor (cessation of measurements, failure to consume the preparation) to the study coordinator or the attending physician.
[0152] STAGE 1 - implementation (wash-out)
[0153] After successfully completing the qualification procedure, participants began a 14-day wash-out period, during which they were introduced to the experimental rigor and accustomed to using measuring devices 24 / 7.
[0154] During the wash-out period, participants received and consumed 1 beverage per day. During the wash-out period, participants received a placebo beverage labeled A or B, randomly assigned to the participant. Participants received a daily reminder to consume the beverage and were required to confirm that they had consumed it.
[0155] After a 14-day period, all participants underwent a protocol-based follow-up examination, including a doctor's visit and a brief medical interview, the Cooper Test and CANTAB tests, and blood sampling. After completing Stage 1 , participants were enrolled in Stage 2.
[0156] STAGE 2 - the first phase of the research phase
[0157] During the 28-day first phase of the research phase, participants received and consumed 1 serving of the beverage per day. Participants received a placebo beverage labeled C or the test preparation (functional composition according to the invention) labeled D, randomly assigned to the participant. Participants received a daily reminder to consume the beverage and had to confirm its consumption.
[0158] After a period of 28 days, all participants underwent a follow-up examination according to the protocol, including a medical visit and a short medical interview, conducting the Cooper Test and CANTAB tests, and a blood sample.
[0159] After completing the Stage 2 procedure, participants were included in Stage 3.
[0160] Stage 3 - the second phase of the research phase
[0161] During the 28-day second phase of the research phase, participants received and consumed 1 serving of the beverage daily. In this phase, participants were not given a placebo, but the functional composition according to the invention (labeled E or F, randomly assigned to the participant). Participants received a daily reminder to consume the beverage and had to confirm that they had consumed it.
[0162] After a period of 28 days, all participants underwent a final follow-up examination according to the protocol, including a medical visit and a short medical interview, the Cooper Test and CANTAB tests, and a blood sample.
[0163] During the experiment, no adverse effects or side effects of consuming the tested preparation or placebo were reported or recorded.
[0164] II. RESULTS OF THE STUDY
[0165] II. 1. SAFETY OF TAKING THE FUNCTIONAL COMPOSITION
[0166] The tested functional composition in the form of a beverage met the legal requirements regarding the content of active substances, and all substances used in it were approved for use in supplements.
[0167] In order to assess safety, two independent mechanisms were adopted in the study.
[0168] The objective mechanism for assessing the safety of the functional composition was control tests, including blood analyses.
[0169] Blood analyses included:
[0170] - classical morphology, allowing for the assessment of the general health status of the participants and the possible detection of any abnormalities related to erythropoiesis and blood clotting disorders;
[0171] - lipid profile - allowing for the assessment of the general state of the body's lipid metabolism, including metabolic disorders;
[0172] - iron and ferritin level test allowing to assess the impact of taking the preparation on iron metabolism in the body;
[0173] - liver markers, allowing for the assessment of the condition and burden of the liver. The panel included markers such as: alanine aminotransferase - ALT; aspartate aminotransferase - AST; alkaline phosphatase - ALP; bilirubin; gamma-glutamyl transpeptidase GGTP.
[0174] In all study participants, the results of blood parameter tests remained within the normal range throughout the study, which clearly indicates that regular, daily and long-term (4 or 8 weeks) consumption of the functional composition preparation according to the invention does not burden the body and does not cause any adverse effects at the level of the basic parameters for which the above-mentioned blood analyses were performed.
[0175] In addition, participants made a subjective assessment of the comfort of consuming the beverage, conveying their feelings related to consuming the preparation and reporting any adverse effects to the study coordinator or the attending physician during follow-up visits. The conveyed feelings were very positive.
[0176] During the experiment, over a period of 10 weeks, none of the participants reported any adverse symptoms or any form of discomfort associated with taking the preparation.
[0177] Based on the results obtained in a pilot study on a group of 30 participants, it was clearly confirmed that in healthy people, regular, daily consumption of the preparation - functional composition according to the invention, for a period of 4 or 8 weeks does not cause any adverse effects and does not negatively affect the basic blood parameters.
[0178] II. 2. ASSESSMENT OF COGNITIVE ABILITIES
[0179] The Cambridge Neuropsychological Test Automated Battery (CANTAB) was originally developed at the University of Cambridge in the 1980s but is now commercially available from Cambridge Cognition. It is a computer-based cognitive assessment system consisting of a battery of neuropsychological tests administered to patients via a touchscreen tablet. The 25 tests in CANTAB examine different areas of cognitive function, such as:
[0180] - general memory and learning,
[0181] - working memory and executive functions,
[0182] - visual memory,
[0183] - attention and reaction time (RT),
[0184] - semantic / verbal memory,
[0185] - decision-making and response control.
[0186] The key element of the research experiment was the study of cognitive abilities (cognitive tests). The aim of the tests was to show the effect of regular consumption of the functional composition according to the invention on selected cognitive abilities. The tests were performed individually, respectively on the 14th, 42nd and 70th day of the experiment. The results obtained during the first control visit (after 14 days of wash-out) were treated as a reference level. The subsequent results indicate the effect of the tested preparation on the change in cognitive abilities.
[0187] The analysis showed statistically significant differences between the study group and the placebo group.
[0188] During the conducted studies on the effect of long-term consumption of the functional composition according to the invention on cognitive abilities, it was shown that the functional composition according to the invention administered to the persons participating in the experiment improved:
[0189] - executive functions (reducing the length of time needed to process contradictory information - resistance to interference),
[0190] - improvement of visual-spatial working memory (more frequent use of strategies and effective use of clues,
[0191] - reduction of stereotyped reactions and increases perception (greater alertness, better efficiency in detecting objects). In addition, the conducted studies show that longer intake of the functional composition according to the invention significantly improves the ability to learn and remember visually associated material, by reducing errors. Unlike the research group, no reduction in errors was observed in the placebo group between visits.
[0192] In the studies conducted to assess changes in cognitive abilities in the research groups taking the functional composition according to the invention and not placebo, an improvement in perceptiveness, executive functions and visual-spatial working memory was observed.
[0193] In addition, it was shown that regular and long-term consumption of the functional composition according to the invention improved the memory abilities of the individuals tested.
[0194] 11.3. PHYSICAL CAPACITY
[0195] The physical capacity of the study participants was measured using the Cooper test. This is an endurance test, consisting of a 12-minute continuous run. Currently, the Cooper test is widely used to test the endurance of athletes - among the study participants there were no people who regularly practiced running sports or athletics.
[0196] Study participants underwent the Cooper test on day 14. of the study (after wash-out) but before starting to take the functional composition preparation, then after 4 weeks of taking the functional composition / placebo preparation and after another 4 weeks of taking the functional composition preparation.
[0197] The study was conducted on a group of 27 participants. During the experiment, three participants suffered from an injury that prevented an objective assessment of physical fitness. Three test measurements were performed for each participant.
[0198] For the group of 23 participants taking the tested functional composition preparation for a period of 4 weeks (28 days), an average improvement of the distance covered in 12 minutes by 9.63% was observed (on average, the distance covered was 130 + / - 18 m longer, which translates into an increase in the average running speed by 0.19 m / s) compared to the group taking placebo, for which the average distance covered in 12 minutes improved by only 1 .78%. The obtained results are illustrated in Fig. 5.
[0199] For the group of 14 participants taking the tested functional composition preparation for a period of 8 weeks (56 days), an average improvement of the distance covered in 12 minutes by 16.39% was observed (on average, the distance covered was 220 + / - 132 m longer, which translates into an increase in the average running speed by 0.30 m / s).
[0200] It has been shown that taking the functional composition preparation according to the invention promotes an increase in physical capacity in both women and men.
[0201] The observed increase in the distance covered (running pace) clearly indicates an improvement in the physical condition of the study participants taking the tested preparation of the functional composition according to the invention. The slight increase in the distance covered, and therefore the running pace, in the people taking the placebo can be interpreted as an effect of inclusion in the study - the study participants, knowing that one of the measured parameters is physical efficiency, increased their physical activity. An objective comparison of the results for the group taking the preparation of the functional composition according to the invention vs. the placebo group, shows that the preparation of the functional composition according to the invention significantly contributes to increasing the physical capabilities of the body.
[0202] 11.4. SLEEP RHYTHM AND QUALITY
[0203] The measuring device in the form of a smartwatch enabled actigraphic analysis of the sleep rhythm and quality of the study participants. Over the 10-week period of the experiment, sleep quality was analyzed - measured as a resultant of three parameters: the percentage of deep sleep in the length of the sleep cycle, the number and total time of short (not exceeding 120 seconds) awakenings during sleep, without taking up physical activity, and the shortening of the length of sleep necessary for the regeneration of the body.
[0204] With a total number of 30 participants, with an equal division into the placebo group and people taking the tested preparation of the functional composition according to the invention, taking into account the above factors, it was not possible to analyze the division into gender and age groups, and the obtained results were developed as a trend for the entire cohort.
[0205] The trend analysis was performed using the linear regression method (GraphPad Prism) and clearly indicates a positive trend in the improvement of sleep quality expressed as a significant increase in the length of the deep and REM sleep phases, in relation to the length of sleep, a reduction in the number of awakenings and a prediction of a shorter length of sleep necessary for full regeneration of the body in the study participants taking the preparation for 4 weeks. At the same time, in the group taking the preparation for 8 weeks, a flattening of the curve and a plateau effect were observed, indicating that after approximately 4-6 weeks of taking the preparation at the intended dose, the optimal effect of improving the quality of sleep is achieved.
[0206] The result from Fig. 6A shows a decreasing trend in the average number of sleep arousals. And the values presented in Fig. 6B show the number of sleep arousals in the longest sleep phase, averaged for the entire cohort.
[0207] The graph showing the trend line of sleep quality improvement -from Fig. 7A shows sleep quality expressed on a percentage scale, where 100% is the maximum value (linear regression) and was calculated with the assumptions summarized in Table 6’.
[0208] Tab. 6’. Comparison of the effect of placebo and the tested functional composition of Active (-CI) type on sleep
[0209] The trend line graph of the decreasing number of arousals during sleep from Fig. 7B was calculated with the assumptions summarized in Table 7.
[0210] Tab. 7. Comparison of the effect of placebo and the tested functional composition of Active (-CI) type on sleep
[0211] It has therefore been shown that regular consumption of the functional composition according to the invention for a period of 4-8 weeks helps to improve the quality of sleep by increasing the share of deep and REM sleep and reducing the number of short awakenings.
[0212] III. SUMMARY OF THE STUDY Based on the results of a research experiment using the functional composition according to the invention against placebo conducted on humans, it was shown that
[0213] - the use of the functional composition according to the invention improves perception, executive functions and visual-spatial working memory;
[0214] - the use of the functional composition according to the invention improves the quality of sleep and accelerates the regeneration of the body;
[0215] - the use of the functional composition according to the invention improves physical performance and increases the body's capabilities;
[0216] - the use of the functional composition according to the invention does not negatively affect the nervous system and liver function.
[0217] These effects are particularly advantageous when the use is long-term, preferably for at least 7, more preferably 14, 21 , 28, 35, 42, 49, 58 or more consecutive days, preferably when the functional composition is taken at least once a day, more preferably two or three times a day.
[0218] LITERATURE:
[0219] 1. Jay R Hoffman, Alyssa Varanoske, Jeffrey R Stout. Effects of 0-Alanine Supplementation on Carnosine Elevation and Physiological Performance. Adv Food Nutr Res. 2018;84:183-206. https: / / doi.Org / 10.1016 / bs.afnr.2017.12.003
[0220] 2. Mia Ericson, Rhona B C Clarke, PeiPei Chau, Louise Adermark, Bo Soderpalm. beta-Alanine elevates dopamine levels in the rat nucleus accumbens: antagonism by strychnin^. Amino Acids. 2010 Apr;38(4):1051 -5. https: / / doi.Org / 10.1007 / S00726-009-0313-0
[0221] 3. Ishay Ostfeld, Jay R Hoffman. The Effect of 0-Alanine Supplementation on Performance, Cognitive Function and Resiliency in Soldiers. Nutrients. 2023 Feb 19;15(4):1039. https: / / doi.org / 10.3390 / nu15041039
[0222] 4. Patrick Z. Liu and Robin Nusslock. Exercise-Mediated Neurogenesis in the Hippocampus via BDNF. Front Neurosci. 2018; 12: 52. https: / / doi.org / 10.3389 / fnins.2018.00052
[0223] 5. Rocio Beatriz Foltran, Silvina Laura Diaz. BDNF isoforms: a round trip ticket between neurogenesis and serotonin? Journal of Neurochemistry. 2016 https: / / doi.org / 10.1111 / jnc.13658
[0224] 6. K E Tiedje, K Stevens, S Barnes, D F Weaver. Beta-alanine as a small molecule neurotransmitter. Neurochem Int. 2010 Oct;57(3):177-88. https: / / doi.Org / 10.1016 / j.neuint.2010.06.001
[0225] 7. M S Homing, L J Blakemore, P Q Trombley. Endogenous mechanisms of neuroprotection: role of zinc, copper, and carnosine. Brain Res. 2000 Jan 3;852(1):56-61 . https: / / d0i.0rg / l 0.1016 / s0006-8993(99)02215-5
[0226] 8. Rong-Xia Xie, Da-Wei Li, Xi-Chang Liu, Ming-Feng Yang, Jie Fang, Bao-Liang Sun, Zong-Yong Zhang 2, Xiao-Yi Yang. Carnosine Attenuates Brain Oxidative Stress and Apoptosis After Intracerebral Hemorrhage in Rats. Neurochem Res. 2017 Feb;42(2):541-551 . https: / / doi.org / 10.1007 / s11064-016-2104-9
[0227] 9. Aloisi A, Barca A, Romano A, Guerrieri S, Storelli C, Rinaldi R, Verri T (2013) Anti-aggregating effect of the naturally occurring dipeptide carnosine on a beta 1 -42 fibril formation. Pios One 8:e68519. https: / / d0i.0rg / l 0.1371 / journal. pone.0068159
[0228] 10. L Bonfanti, P Peretto, S De Marchis, A Fasolo. Carnosine-related dipeptides in the mammalian brain. Prog Neurobiol. 1999 Nov;59(4):333-53. https: / / doi.org / 10.1016 / s0301 -0082(99)00010-6
[0229] 11. M S Homing, L J Blakemore, P Q Trombley. Endogenous mechanisms of neuroprotection: role of zinc, copper, and czamosine. Brain Res. 2000 Jan 3;852(1):56-61 . https: / / d0i.0rg / l 0.1016 / s0006-8993(99)02215-5
[0230] 12. L Bonfanti, P Peretto, S De Marchis, A Fasolo. Carnosine-related dipeptides in the mammalian brain. Prog Neurobiol. 1999 Nov;59(4):333-53. https: / / doi.org / 10.1016 / s0301 -0082(99)00010-6 13. Bellia F, Vecchio G, Cuzzocrea S, Calabrese V, Rizzare 11 i E. Neuroprotective features of carnosine in oxidative driven diseases. Mol Aspects Med. 201 1 . 32:258-266. https: / / doi.Org / 10.1016 / j.mam.201 1 .10.009
[0231] 14. Berezhnoy DS, Fedorova TN, Stvolinskii SL, Inozemtsev AN (2016) Carnosine modulates oxidative homeostasis and levels of neurotransmitters in the brain in models of learning with positive and negative reinforcement. Neurochem J 10:273-279. https: / / doi.Org / 10.1 134 / S1819712416040048
[0232] 15. Tatsuhiro Hisatsune, Jun Kaneko, Hiroki Kurashige, Yuan Cao, Hideo Satsu, Mamoru Totsuka, Yoshinori Katakura, Etsuko Imabayashi, Hiroshi Matsuda. Effect of Anserine / Carnosine Supplementation on Verbal Episodic Memory in Elderly People. J Alzheimers Dis. 2016;50(1):149-59. https: / / doi.org / 10.3233 / JAD-150767
[0233] 16. Sergey Stvolinsky, Maxim Antipin, Kanji Meguro, Tatsunori Sato, Hiroki Abe, and Alexander Boldyrev. Effect of Carnosine and Its Trolox-Modified Derivatives on Life Span of Drosophila melanogaster. Rejuvenation Research. Vol. 13, No. 4
[0234] 17. Masahiro Kawahara, Ken-ichiro Tanaka, and Midori Kato-Negishi. Zinc, Carnosine, and Neurodegenerative Diseases. Nutrients. 2018 Feb; 10(2): 147. https: / / doi.org / 10.3390 / nu10020147
[0235] 18. A Carta, M Calvani. Acetyl-L-carnitine: a drug able to slow the progress of Alzheimer's disease? Ann N YAcad Sci. 1991 ;640:228-32. https: / / doi.Org / 10.1 1 11 / j.1749-6632.1991 ,tb00223.x
[0236] 19. Triantafyllos Didangelos, Eleni Karlafti, Evangelia Kotzakioulafi, Zisis Kontoninas, Charalampos Margaritidis, Parthena Giannoulaki, Konstantinos Kantartzis. Efficacy and Safety of the Combination of Superoxide Dismutase, Alpha Lipoic Acid, Vitamin B12, and Carnitine for 12 Months in Patients with Diabetic Neuropathy. Nutrients. 2020 Oct 23; 12(1 1 ):3254. https: / / doi.Org / 10.3390 / nu121 13254
[0237] 20. G Sergi, S Pizzato, F Piovesan, C Trevisan, N Veronese, E Manzato. Effects of acetyl-L-carnitine in diabetic neuropathy and other geriatric disorders. Aging Clin Exp Res. 2018 Feb;30(2):133-138. https: / / doi.org / 10.1007 / s40520- 017-0770-3
[0238] 21 . Gustavo C Ferreira, Mary C McKenna. L-Carnitine and Acetyl-L-carnitine Roles and Neuroprotection in Developing Brain. Neurochem Res. 2017 Jun;42(6):1661 -1675. https: / / doi.org / 10.1007 / s1 1064-017-2288-7
[0239] 22. G Rai, G Wright, L Scott, B Beston, J Rest, A N Exton-Smith. Double-blind, placebo controlled study of acetyl- l-carnitine in patients with Alzheimer's dementia. Curr Med Res Opin. 1990;1 1 (10):638-47. https: / / doi.Org / 10.1 185 / 030079990091 12690
[0240] 23. Xiang Wang, Liang-Ping Wang, Hui Tang, Wan-Ying Shan, Xiong Wang, Dan Liu, Yuan-Yuan Wu, Qing Tian, Jian-Zhi Wang, Ling-Qiang Zhu. Acetyl-L-carnitine rescues scopolamine-induced memory deficits by restoring insulinlike growth factor II via decreasing p53 oxidation. Neuropharmacology. 2014 Jan;76 Pt A:80-7. https: / / doi.Org / 10.1016 / j.neuropharm.2013.08.022
[0241] 24. M A Virmani, R Biselli, A Spadoni, S Rossi, N Corsico, M Calvani, A Fattorossi, C De Simone, E Arrigoni- Martell i . Protective actions of L-carnitine and acetyl-L-carnitine on the neurotoxicity evoked by mitochondrial uncoupling or inhibitors. Protective actions of L-carnitine and acetyl-L-carnitine on the neurotoxicity evoked by mitochondrial uncoupling or inhibitors. Pharmacol Res. 1995 Dec;32(6):383-9. https: / / doi.org / 10.1016 / s1043-6618(05)80044-1
[0242] 25. S Hudson, N Tabet. Acetyl-L-carnitine for dementia. Cochrane Database Syst Rev. 2003; 2003(2):CD003158. https: / / doi.Org / 10.1002 / 14651858.CD003158
[0243] 26. Jay W Pettegrew, Richard J McClure. Acetyl-l-carnitine as a possible therapy for Alzheimer's disease. Expert Rev Neurother. 2002 Sep;2(5):647-54. https: / / doi.Org / 10.1586 / 14737175.2.5.647
[0244] 27. Mike Youle. Acetyl-L-carnitine in HIV-associated antiretroviral toxic neuropathy. CNS Drugs. 2007;21 Suppl 1 :25-30; discussion 45-6. https: / / doi.org / 10.2165 / 00023210-200721001 -00004
[0245] Nisha Verma, Jeetendra Kumar Gupta, Krishna Kumar Varshney, Rajnish Srivastava. Ameliorative Effect of Acetyl L- carnitine in Alzheimer's Disease via Down regulating of Homocysteine Levels in Hyperhomocysteinemia Induced Cognitive Deficit in Mouse Model. Drug Metab Lett. 2021 ;14(3):219-231 . https: / / doi.Org / 10.2174 / 187231281466621 1209102136
Claims
CLAIMS1. A functional composition for administration to an individual, comprising a basic formulation constituting a single dose of a functional composition with beta-alanine in an amount of 0.01 g to 2.0 g, acetyl-L-carnitine in an amount of 0.01 g to 2.0 g, carnosine in an amount of 0.01 g to 2.0 g, vitamin B1 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B3 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B6 in a dose of 10-500% of the recommended daily intake (RDI), vitamin B12 in a dose of 10-500% of the recommended daily intake (RDI); wherein the composition is intended to increase the energy and vitality of the body and to support, assist and stabilize the functioning of the nervous system of the individual; wherein preferably the individual is a human.
2. The functional composition according to claim 1 , characterized in that the base formulation consists of a single dose of a functional composition of beta-alanine in an amount of 0.5±10%g, acetyl-L-carnitine in an amount of 0.6±10%g, carnosine in an amount of 0.5±10%g, vitamin B1 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B3 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B6 in a dose of 50%±10% of the recommended daily intake (RDI), vitamin B12 in a dose of 50%±10% of the recommended daily intake (RDI).
3. The functional composition according to claims 1 -2, characterized in that the base formulation comprises a single dose of a functional composition of beta-alanine in an amount of 0.5 g, acetyl-L-carnitine in an amount of 0.6 g, carnosine in an amount of 0.5 g, vitamin B1 in a dose of 50% of the recommended daily intake (RDI), vitamin B3 in a dose of 50% of the recommended daily intake (RDI), vitamin B6 in a dose of 50% of the recommended daily intake (RDI), vitamin B12 in a dose of 50% of the recommended daily intake (RDI).
4. The functional composition according to claims 1-3, characterized in that it further comprisesL-glutamine in an amount of 0.02-2 g, more preferably in an amount of 0.2±10% g; more preferably also comprises sodium chloride in an amount of 0.1 -1 g, more preferably in an amount of 0.375±10% g.
5. The functional composition according to claims 1 -4, characterized in that it further comprises at least one additional active ingredient, preferably selected from glutamic acid, glutamate, L-glutamine, glycine, choline, L-theanine and folic acid.
6. The functional composition according to claims 1 -5, characterized in that vitamin B1 is in the form of thiamine mononitrate; vitamin B3 is in the form of niacin, nicotinamide PP or a mixture thereof; vitamin B6 is in the form of pyridoxine hydrochloride; vitamin B12 is in the form of cobalamin, cyanocobalamin, methylcobalamin, adenosylcobalamin or hydroxocobalamin or a mixture thereof.
7. The functional composition according to claims 1 -6, characterized in that is intended to enhance concentration, sharpen the senses and improve thinking in an individual.
8. The functional composition according to claims 1 -7, characterized in that is in a dry, loose form, preferably in the form of a powder, granules, granulate, powder for preparing a solution or a mixture thereof.
9. The functional composition according to claims 1 -8, characterized in that is in the form of a tablet, dragee, hard or elastic capsule, soluble tablet, effervescent tablet, coated tablet, sugar-coated tablet, solution, oral suspension.
10. The functional composition according to claims 1 -9, characterized in that is in liquid form.
11. The functional composition according to claims 1 -10, characterized in that further comprises at least one of the following additives: a flavor additive, an adjuvant, a stabilizer, a preservative, an acidity regulator, a juice concentrate, a coloring agent, an aroma, a sweetener.
12. The functional composition according to claim 1 1 , characterized in that at least one of the flavor additive, adjuvant, stabilizer, preservative, acidity regulator, juice concentrate, colorant, aroma, sweetener is selected from: i) a flavor additive selected from: a flavor aroma, preferably selected from natural fruit flavors, watermelon flavor, pitaya flavor, mango flavor, pomegranate flavor, elderflower flavor; fruit juice concentrate; fruit juice, preferably selected from apple juice, blackcurrantjuice, raspberryjuice, blueberry juice, elderberry juice, cranberry juice, peach juice, mango juice, pineapple juice, orange juice, tangerine juice, plum juice, mirabelle plum juice, pear juice, blueberry juice, chokeberry juice; or mixtures thereof; ii) an adjuvant, preferably in the form of an additive ensuring the appropriate isotonicity of the functional composition, preferably selected from sodium chloride, potassium chloride, or a mixture thereof;iii) a stabilizer selected from glycerol, xanthan gum, or a mixture thereof; iv) a preservative selected from benzoic acid, sodium benzoate, potassium sorbate, or a mixture thereof; v) an acidity regulator, preferably selected from ascorbic acid, citric acid, malic acid, or a mixture thereof; vi) a dye selected from curcumin, riboflavin, carotenes, lycopene, lutein; vii) sweetener selected from sucrose, glucose, xylitol, steviol glycosides, erythritol, aspartame.
13. The functional composition according to claims 1-12, characterized in that composition is in the form of a beverage, a dietary supplement, a pharmaceutical composition, a medical agent, a drug for treating and / or preventing disease states, including diseases and conditions in which the functional composition acts as an agent with antioxidant activity on the nervous system, an antidepressant, an agent increasing the vitality of the body of the individual, an agent increasing the energy of the body of the individual, an agent increasing the efficiency of the body of the individual, an agent increasing the concentration of the body of the individual, an agent increasing the sharpness of the senses of the individual, an agent increasing the thinking abilities of the body of the individual.
14. The functional composition according to claims 1-13, characterized in that is intended for administration at least once a day, preferably twice a day, preferably three times a day.
15. A beverage concentrate characterized in that it contains a functional composition as defined in claims 1-14.
16. A functional beverage characterized in that it contains a functional composition as defined in claims 1-14.
17. The functional beverage according to claim 16, characterized in that it is based on fruit juice, water, milk, a plant beverage, a plant beverage replacing milk.
18. A dietary supplement characterized in that it comprises the functional composition as defined in claims 1-14.
19. A pharmaceutical composition comprising the functional composition as defined in claim 1-14 for use in treating, supporting, assisting and stabilizing the functioning of the nervous system of an individual.
20. The pharmaceutical composition comprising the functional composition as defined in claim 1 -14 for use in treating or preventing a disease state with reduced concentration of an individual.
21. The pharmaceutical composition comprising the functional composition as defined in claim 1 -14 for use in treating and preventing conditions with reduced sensory perception of an individual.
22. The pharmaceutical composition comprising the functional composition as defined in claim 1 -14 for use in treating and preventing disease states with reduced thinking and analysis abilities of an individual.
23. The pharmaceutical composition comprising the functional composition as defined in claim 1 -14 for use in treating and preventing disease states with reduced vital energy of an individual.T124. The pharmaceutical composition comprising the functional composition as defined in claim 1 -14 for use in treating and preventing conditions with reduced sleep quality of an individual.
25. The pharmaceutical composition comprising the functional composition as defined in claim 1-14 for the production of a functional beverage, a functional food, a dietary supplement.
Citation Information
Patent Citations
Food with antioxidants to support immunity
CZ36012U1
Anti-dementia regimen
US8349376B1
Pharmaceutical composition
WO2023182529A1