Methods and materials for treating cancer

Diterpenoid epoxide compounds like triptolide sensitize cancer cells to DNMT inhibitors by inhibiting DCTPP1, addressing resistance and enhancing treatment efficacy for various cancer types.

WO2025175023A1PCT designated stage Publication Date: 2025-08-21JOHNS HOPKINS UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/015817
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-13
Filing Date
2025-02-13
Publication Date
2025-08-21

AI Technical Summary

Technical Problem

Current nucleoside analog DNA methyltransferase (DNMT) inhibitors (DNMTi) are ineffective as single agents for most cancer types due to poor bioavailability, instability in blood, substantial toxicity, and primary resistance mechanisms, despite their potential in treating myelodysplastic syndrome and certain leukemias.

Method used

Administering diterpenoid epoxide compounds, such as triptolide and its analogs, to sensitize cancer cells to DNMT inhibitors by inhibiting deoxycytidine triphosphate pyrophosphatase 1 (DCTPP1)-mediated pyrophosphate cleavage, thereby enhancing the effectiveness of DNMT inhibitors like decitabine.

Benefits of technology

This approach overcomes cell-intrinsic resistance to single-agent DNMTi treatment, improving treatment outcomes by sensitizing cancer cells to DNMT inhibitors, allowing for more accurate cancer treatment assessment and minimizing ineffective treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000033_0001
    Figure IMGF000033_0001
  • Figure IMGF000035_0001
    Figure IMGF000035_0001
  • Figure IMGF000035_0002
    Figure IMGF000035_0002
Patent Text Reader

Abstract

This document describes methods and materials for treating cancer. In some cases, one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer to treat that mammal. For example, one or more diterpenoid epoxide compounds and one or more inhibitors (e.g., nucleoside-analog inhibitors) of a nucleoside DNA methyltransferase (DNMT) polypeptide can be administered to a mammal (e.g., a human) having cancer to treat that mammal.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No.44807-0477WO1 / C18163_P18163-01 METHODS AND MATERIALS FOR TREATING CANCER CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Patent Application Serial No. 63 / 552,888, filed on February 13, 2024. The disclosure of the prior application is considered part of, and is incorporated by reference in, the disclosure of this application. STATEMENT REGARDING FEDERAL FUNDING This invention was made with government support under CA058236 awarded by the National Institutes of Health. The government has certain rights in the invention. SEQUENCE LISTING This application contains a Sequence Listing that has been submitted electronically as an XML file named “44807-0477WO1_SL.xml.” The XML file, created on December 31, 2024, is 2,778 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety. TECHNICAL FIELD This document relates to methods and materials for treating cancer. In some cases, one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer to treat that mammal. For example, one or more diterpenoid epoxide compounds and one or more inhibitors (e.g., nucleoside-analog inhibitors) of a nucleoside DNA methyltransferase (DNMT) polypeptide can be administered to a mammal (e.g., a human) having cancer to treat that mammal. BACKGROUND Therapeutic reversal of epigenetic gene silencing, with nucleoside analog DNA methyltransferase (DNMT) inhibitors (DNMTi) have been developed as rational anti- cancer treatment strategies. The mechanism of action of these drugs involves metabolic conversion to 5-aza-2’-deoxycytidine triphosphate(5-aza-dCTP), incorporation into genomic DNA, trapping of DNMT enzymes and their subsequent proteolytic degradation, and ultimately DNA demethylation through passive loss of 5-methylcytosine (Ghoshal et al., Mol. Cell. Biol., 25:4727-4741 (2005); Patel et al., Nucl. Acids Res., 38:4313-4324 (2010); and Yang et al., Trends Pharm. Sci., 31:536-546 (2010)). Thus far, DNMTi have Attorney Docket No.44807-0477WO1 / C18163_P18163-01 shown promise when used for myelodysplastic syndrome (MDS), for certain acute myeloid leukemias (AMLs), and a limited number of other cancers (Blum et al., J. Clin. Oncol., 25:3884-3891 (2007); Cashen et al., J. Clin. Oncol., 28:556-561 (2010); Issa et al., Blood, 103:1635-1640 (2004); Kantarjian et al., Cancer, 106:1794-1803 (2006); and Silverman et al., (2005) Nat. Clin. Practice Oncol., 2(Suppl 1):S12-23). However, DNMTi have not been effective as single agents for the majority of cancer types despite the nearly universal prevalence of DNA hypermethylation alterations across cancer types (Cheishvili et al., Br. J. Pharmacol., 172:2705-2715 (2015); and Jones et al., Nat. Rev. Gen., 3:415-428 (2002)). Additionally, the clinical use of nucleoside analog DNMTi has been generally limited by poor bioavailability, instability in blood, and substantial toxicity when administered at high doses (Karpf et al., Mol. Pharm., 59:751-757 (2001); and Palii et al., Mol. Cell. Biol., 28:752-771 (2008)). SUMMARY This document provides methods and materials for treating cancer. For example, one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer to treat that mammal. For example, one or more diterpenoid epoxide compounds and one or more inhibitors of a DNMT polypeptide can be administered to a mammal (e.g., a human) having cancer to treat that mammal. As demonstrated herein, diterpenoid epoxide compounds (e.g., triptolide and its analogs) can be used to sensitize a cell (e.g., a cancer cell) to one or more inhibitors of a DNMT polypeptide. For example, diterpenoid epoxide compounds can be used to inhibit deoxycytidine triphosphate (dCTP) pyrophosphatase 1 (DCTPP1)-mediated pyrophosphate cleavage from 5-aza-deoxycytidine triphosphate, thereby sensitizing cells to one or more inhibitors of a DNMT polypeptide. Also as demonstrated herein, administering one or more inhibitors of a DCTPP1 polypeptide can further enhance the ability of diterpenoid epoxide compounds to sensitize a cell (e.g., a cancer cell) to one or more inhibitors of a DNMT polypeptide. Having the ability to treat a mammal (e.g., a human) having cancer as described herein (e.g., by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide), provides opportunities for clinicians to assess and treat cancer patients in a more accurate manner than current protocols. For example, the ability to treat a cancer as described herein (e.g., Attorney Docket No.44807-0477WO1 / C18163_P18163-01 by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide) allows clinicians to overcoming cell-intrinsic primary resistance mechanisms to single-agent treatment with DNMTi, thereby improving treatment outcomes. In addition, the ability to identify a cancer as being likely to respond to a cancer treatment that includes administering one or more diterpenoid epoxide compounds (and, optionally, administering one or more inhibitors of a DNMT polypeptide) can minimize subjecting patients to ineffective treatments. In general, one aspect of this document features methods for sensitizing a cancer cell within a mammal having cancer to an inhibitor of a DNMT polypeptide. The methods can include, or consist essentially of, administering a diterpenoid epoxide compound to a mammal having cancer. The mammal can be a human. The cancer can be a lung cancer, a breast cancer, a melanoma, a prostate cancer, an ovarian cancer, or a leukemia. The inhibitor of the DNMT polypeptide can be decitabine, azacitidine, guadecitabine, cedazuridine, ASTX 727, 5-fluoro-cytosine, 5-fluoro-deoxycytidine, or zebularine. The diterpenoid epoxide can be triptolide, TPL-2004, TPL-2005, TPL-2015, TPL-2021, TPL- 2024, glutriptolide, triptonide, or tripterygium glycosides. The diterpenoid epoxide compound can have a structure set forth in any one of compounds 1-18. The diterpenoid epoxide compound can inhibit a DCTPP1 polypeptide and / or an XPB polypeptide. The inhibitor of the DNMT polypeptide can be decitabine and the diterpenoid epoxide compound can be triptolide. The cancer cell can have an elevated level of a DCTPP1 polypeptide. The method also can include administering an inhibitor of the DCTPP1 polypeptide to the mammal. In another aspect, this document features methods for treating a mammal having cancer. The methods can include, or consist essentially of, administering, to a mammal having cancer: (a) an inhibitor of a nucleoside DNA methyltransferase (DNMT) polypeptide; and (b) a diterpenoid epoxide compound. The mammal can be a human. The cancer can be a lung cancer, a breast cancer, a melanoma, a prostate cancer, an ovarian cancer, or a leukemia. The inhibitor of the DNMT polypeptide can be decitabine, azacitidine, guadecitabine, cedazuridine, ASTX 727, 5-fluoro-cytosine, 5-fluoro- deoxycytidine, or zebularine. The diterpenoid epoxide compound can be triptolide, TPL- 2004, TPL-2005, TPL-2015, TPL-2021, TPL-2024, glutriptolide, triptonide, or tripterygium glycosides. The diterpenoid epoxide compound can have a structure set forth Attorney Docket No.44807-0477WO1 / C18163_P18163-01 in any one of compounds 1-18. The diterpenoid epoxide compound can inhibit a DCTPP1 polypeptide and / or an XPB polypeptide. The inhibitor of the DNMT polypeptide can be decitabine and the diterpenoid epoxide compound can be triptolide. In another aspect, this document features methods for treating a mammal having a cancer identified as having at least one cancer cell having an elevated level of a DCTPP1 polypeptide. The methods can include, or consist essentially of, administering to a mammal having a cancer identified as having at least one cancer cell having an elevated level of a DCTPP1 polypeptide:(a) an inhibitor of a nucleoside DNA methyltransferase (DNMT) polypeptide; and (b) a diterpenoid epoxide compound. The method also can include administering an inhibitor of the DCTPP1 polypeptide to the mammal. The mammal can be a human. The cancer can be a lung cancer, a breast cancer, a melanoma, a prostate cancer, an ovarian cancer, or a leukemia. The inhibitor of the DNMT polypeptide can be decitabine, azacitidine, guadecitabine, cedazuridine, ASTX 727, 5-fluoro-cytosine, 5-fluoro-deoxycytidine, or zebularine. The diterpenoid epoxide compound can be triptolide, TPL-2004, TPL-2005, TPL-2015, TPL-2021, TPL-2024, glutriptolide, triptonide, or tripterygium glycosides. The diterpenoid epoxide compound can have a structure set forth in any one of compounds 1-18. The diterpenoid epoxide compound can inhibit a DCTPP1 polypeptide and / or an XPB polypeptide. The inhibitor of the DNMT polypeptide can be decitabine and the diterpenoid epoxide compound can be triptolide. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 DESCRIPTIONS OF THE DRAWINGS Figures 1A-1B. Identification of compounds demonstrating synergy with decitabine for cancer cell growth inhibition. Figure 1A) Schematic outline of the screening method. DU145 cells were treated with 100nM decitabine or vehicle control for 3 days and then seeded into 96 well-plates for overnight attachment followed by exposure to JHDL compounds (5 µM) for 72 hours. The degree of 3H-thymidine incorporation (added at day 6 for 18 hours) was measured to evaluate the degree of growth inhibition. 131 compounds showed more than 50% growth inhibition, when given alone or in combination with decitabine, of which 66 compounds were selected for a wide dose- response titration for synergy analysis. Among these, 24 compounds showed synergy with decitabine in inhibiting DU145 cell growth. Figure 1B) Scatter plot of 24 synergistic compounds with decitabine, ranked by Combination Index (CI) at a decitabine concentration of 100 nM (circles) or 250 nM (diamonds). Figures 2A-2D. Triptolide and decitabine synergistically and selectively inhibited cancer cell growth, viability, and survival. Figure 2A) Inhibition of growth and viability of human prostate cancer cell lines DU145 (left) and LNCaP (right) treated with decitabine and triptolide. Growth curves were measured as the percent of total confluence in each well over time. The mean percent confluence ± SEM for 16 fields in each condition are shown, with measurements taken every 6 hours throughout the course of the growth curve. Viability measurements of cells treated with decitabine and triptolide alone and in combinations across a dose series as indicated are represented in a heatmap scaled as shown in the legend, with each measurement representing the percent viability with respect to the control treatment. The degree of synergy of combinations of decitabine and triptolide was calculated as the Bliss synergy score across the full dose ranges (values >0 indicate greater than additive effect). For both cell lines, multiple dose combinations exhibited greater than additive effects. Figure 2B) Percent viability with respect to the control treatment for human leukemia cell lines treated with decitabine and triptolide in a dose series. Shown are the decitabine alone dose response curve along with the decitabine plus triptolide dose response curves at the two triptolide doses exhibiting the greatest synergy as measured by the Bliss synergy score. Each value represents the mean ± SEM of duplicate treatments. Figure 2C) Clonogenic survival analysis of human prostate cancer cell lines DU145 (left panel) and PC3 (right panel) treated with vehicle control, decitabine and triptolide alone, and in combination. Quantitation of colonies were Attorney Docket No.44807-0477WO1 / C18163_P18163-01 normalized to the vehicle treatment and presented as the mean of duplicate wells ± SEM. Figure 2D) Growth curve analysis as in Figure 2A for non-malignant RWPE-1 prostate epithelial cells (left) and normal hepatocytes in primary culture (right). At doses that showed synergistic growth inhibition of cancer cell lines in Figure 2A, decitabine, triptolide, and their combination showed minimal growth inhibition of these non- malignant cells. Figures 3A-3G. Combination of triptolide and decitabine showed favorable efficacy and safety in vivo. Figure 3A) Xenograft study design: NOD / SCID mice bearing DU145 human prostate cancer cell xenografts were divided randomly into 4 groups and then treated with normal saline (Control, Arm1), 1 mg / kg decitabine (Arm 2, three 1 mg / kg doses given i.p. on week 1 of two 3-week cycles), 0.2 mg / kg triptolide (Arm 3, five 0.2 mg / kg doses given i.p. each week of two 3-week cycles), or in combination (Arm 4) upon xenograft tumors reaching an average size of 200 mm3. Figure 3B) DU145 xenograft tumor growth curve. The tumor volumes were measured every week. The tumor volume in each animal was estimated according to the formula: tumor volume (mm3) = 1 / 2×Length× Width2. Combination treatment (Arm 4) significantly inhibited the growth of DU145 xenografts when compared to single treatment (Arm 2 and Arm 3) and vehicle control (Arm 1). Shown are the mean ± SEM of all xenografted tumors. Figure 3C) Kaplan-Meier survival curves of DU145 xenograft mice. Combination of decitabine and triptolide significantly improved progression free survival (time to >5X growth of DU145 xenograft in nude mice) compared to vehicle control (p=0.003), decitabine alone (p=0.003), or triptolide alone (p=0.035). Figure 3D) Mouse body weight curve. Mean mouse body weight ± SEM from these experiments are shown. Figures 3E, 3F, and 3G) Changes of hematological parameters (RBC and WBC counting, hemoglobin; Figure 3E) and biochemical parameters for liver (Total protein, AST and ALT; Figure 3F) and kidney (glucose, BUN, and creatinine; Figure 3G) toxicity monitoring. Each value represents the mean ± SEM of three mice from each treatment arm during treatment (at week 0, 2 and 6). Dashed lines indicate upper limit of the normal range. Figures 4A-4F. Triptolide analogs with stronger potency for inhibition of DCTPP1 relative to XPB showed greater synergy with decitabine. Figure 4A) Correlation between potency (log10[IC50]) of inhibition of DU145 cell growth (measured by growth curve analysis as in Fig.2A) and potency (log10[IC50]) of inhibition of XPB (left panel) and DCTPP1 (right panel) activity in vitro for a series of triptolide analogs. The Attorney Docket No.44807-0477WO1 / C18163_P18163-01 correlation of potency for growth inhibition with inhibition of XPB suggested that triptolide and its analogs mediate single agent growth inhibition via targeting of XPB rather than DCTPP1. Figure 4B) Correlation between the log-ratio of [potency of inhibition of DU145 cell growth of each triptolide analog with and without 50 nM decitabine] and the log-ratio of [potency of inhibition of DCTPP1 activity to that of XPB activity]. The correlation showed that triptolide analogs with stronger DCTPP1 potency relative to XPB potency exhibited greater enhanced growth inhibition in combination with decitabine. Figure 4C) Potency of inhibition of DCTPP1 (left) and XPB (right) in vitro activity by the triptolide analogs TPL-2004 and TPL-2015. Both compounds had comparable potency of inhibition of XPB, but TPL-2004 exhibited significantly greater potency of inhibition of DCTPP1 than TPL-2015. Shown are the mean ± SEM of triplicate in vitro assays. Figure 4D) DU145 growth curve analysis as in Fig.2A with vehicle control, decitabine alone, TPL-2004 or TPL-2015 alone, or each in combination with 50 nM decitabine. Left, TPL-2004; Right, TPL-2015. Figure 4E) (Left) The triptolide and nucleotide binding pockets of DCTPP1 overlap. The structure of DCTPP1(21-130) is shown in curled ribbons by monomer subunit. Triptolide is illustrated as indicated sticks, with the dCTP binding pocket as defined from mouse DCTPP1 (PDB#6SQZ) outlined open circle and a magnesium ion represented as a sphere inside the binding pocket. (Center) The triptolide binding pocket is predominantly formed by a hydrophobic sandwich of tryptophan residues W73 and W47, with H51 forming hydrogen bonding contacts with the lactone carbonyl of triptolide. (Right) Triptolide derivatives TPL-2004 and TPL-2015, as indicated with arrow, manually overlayed onto the structure of DCTPP1 bound to triptolide. The hydroxyl modification on TPL-2015 (solid circle) appears to create a steric clash with W73 on DCTPP1 (dotted circle). In contrast, the modifcation on TPL-2004 does not interfere sterically and appears to close off the triptolide binding pocket. *-dCTP, modified or unmodified dCTP. Figure 4F) Clonogenic survival and quantification in DU145 (left panel) and PC3 (right panel) cells treated with vehicle control, decitabine alone, TPL-2004 or TPL-2015 alone, and each in combination with decitabine. Quantitation of colonies were normalized to vehicle control and presented as mean of duplicate wells ± SEM. Figures 5A-5E. The synergy of triptolide and decitabine was dependent on DCTPP1. Figure 5A) Cellular sensitivity to decitabine was dependent on DCTPP1 levels. Human prostate cancer cell lines PC3 and DU145 were transduced with CRISPR-Cas9 Attorney Docket No.44807-0477WO1 / C18163_P18163-01 system with DCTPP1 guide-RNA to knockout DCTPP1 (KO-DCTPP1), or non-targeting guide-RNA (KO-Control), or DCTPP1 overexpression lentivirus (OE-DCTPP1), or empty lentivirus (OE-Control). Knockout and overexpression of DCTPP1 was confirmed by immunoblotting (right panels). Potency of inhibition of growth and viability of the transduced isogenic cell lines was measured across a dose range of decitabine. Overexpressing DCTPP1 significantly desensitized the cells to decitabine (significant right shift of log10[IC50]); while knocking out DCTPP1 significantly sensitized the cells to decitabine (significant left shift of log10[IC50]). Figures 5B, 5C, 5D, and 5E) The synergy between decitabine and triptolide was dependent on DCTPP1 expression levels in isogenic DU145 and PC3 cells. Viability measurements of DU145 and PC3 cells treated with decitabine and triptolide alone and in combinations across the indicated dose series are represented in heatmaps scaled as shown in the legend, with each measurement representing the percent viability with respect to the control treatment. The degree of synergy of combinations of decitabine and triptolide was calculated as the Bliss synergy score across the indicated dose range. Knocking out DCTPP1 in DU145 (Figure 5B) and PC3 (Figure 5D) cells showed no overall synergy across serial dose combinations of decitabine and triptolide (Bliss values <0 indicate less than additive effect). Both DU145 (Figure 5C) and PC3 (Figure 5E) cells with DCTPP1 overexpression retained better overall synergy across serial dose combinations of decitabine and triptolide (Bliss values >0 indicate greater than additive effect). Figures 6A-6F. DCTPP1 inhibition by triptolide enhances the action of nucleoside analog DNMT inhibitors. Figures 6A and 6B).5-aza-dC incorporation into genomic DNA, determined by LC-MS / MS, in DU-145 (Figure 6A) and PC3 (Figure 6B) cells treated with vehicle control, triptolide or decitabine alone or in combination. The mean of the amount of 5-aza-dC per 10002-dC in genomic DNA ± SEM of duplicate treatments is shown. Triptolide treatment significantly enhanced the decitabine incorporation into genomic DNA in DU145 and PC3 cells. Figure 6C). The combination treatment of triptolide and decitabine enhanced DNMT loss. Western Blot of DNMT1, DNMT3A, DNMT3B in DU145 cells treated with vehicle control, decitabine (250 nM) or triptolide (1 nM) alone or in combination for 24 hours. β-actin blotting is shown as protein loading control. Figure 6D) Genomic 5-methyl-deoxycytidine content by LC-MS / MS in DU145 cells treated in vitro with vehicle control, decitabine or triptolide or both at indicated doses. Each value represents the mean ± SEM of 5-methyl-deoxycytidine content from Attorney Docket No.44807-0477WO1 / C18163_P18163-01 triplicate measurements at 5 days from the start of treatment. The combination treatment of triptolide and all tested doses of decitabine significantly lowered the levels of 5- methyl-deoxycytidine content in genomic DNA compared to each dose of decitabine alone. Figure 6E) Genomic 5-methyl-deoxycytidine content by LC-MS / MS in DU145 xenograft tumors treated in vivo with vehicle control, decitabine or triptolide or both. Each value represents the mean ± SEM of 5-methyl-deoxycytidine content from two xenografted tumors as a percent of that measured in xenografted tumors from vehicle control treated animals. Figure 6F) Genomic 5-methyl-deoxycytidine content by LC- MS / MS in DU145 cells treated in vitro with vehicle control, triptolide analogs (TPL-2004 or TPL-2015), decitabine or triptolide or both. Each value represents the mean ± SEM of 5-methyl-deoxycytidine content from triplicate measurements at 5 days from treatment starting. Figures 7A-7F. The combination treatment of triptolide and decitabine enhances the epigenetic effects of decitabine. Figure 7A). Decitabine induced gene sets (n = 704, DAC / DAC+TPL vs Control,log2 Fold of Change >0, P < 0.001) are further upregulated by treatment with the combination of triptolide and decitabine. Upper panel) Heatmap representing day-20 gene expression profiles of triplicate samples of DU145 cells treated with vehicle control (Control), 2nM triptolide alone (TPL), 33nM decitabine alone (DAC), or in combination (DAC+TPL). Lower panel) Distribution of decitabine induced genes across the whole transcriptome in combination treatment of triptolide and decitabine. Each vertical line represents a decitabine upregulated gene (n=704, DAC+TPL vs DAC, p<0.001, Wilcoxon rank sum test), ranked by log2 fold of change of combination treatment of decitabine and triptolide over decitabine alone (horizontal line, P < 0.001, Wilcoxon rank sum test). Red vertical line represents the median for decitabine induced genes; Blue vertical line represents median of whole transcriptome.525 of 704 decitabine induced genes were further upregulated by triptolide and decitabine combination treatment. Figure 7B). The long noncoding RNA H19, is one of the top decitabine induced genes and also upregulated in decitabine and triptolide combination treatment. qRT-PCR validated there were significantly higher mRNA expression of H19 compare to decitabine alone, triptolide alone or vehicle control.(**: p<.001). Figure 7C). Bisulfite sequencing analysis of H19 imprint control region in the representative samples at day-20 after the indicated treatment. The combination of decitabine and triptolide led to a greater fraction of completely demethylated alleles compared to decitabine alone (**: Attorney Docket No.44807-0477WO1 / C18163_P18163-01 p<.001, Binomial test). Data shown are the numbers and patterns of methylated and unmethylated clones and their percentages. Color scale shows methylation fraction at each CpG sites. Figures 7D and 7E). DU145 cells treated with decitabine alone (Figure 7D) are enriched for increased expression of interferon-γ response genes (upper panel, p < 0.005, GSEA) and interferon-γ response genes (lower panel, p < 0.05, GSEA). The combination treatment of triptolide and decitabine (Figure 7E) further enhanced induction of these genes compared to decitabine alone. Figure 7F). qRT-PCR validation of endogenous retrovirus gene HERV-FC1 (upper panel) and interferon response genes IFI27 (lower panel). Data shown are represented as mean ± SEM of three biological replicates at day-15 after indicated treatment, y axis is represented as fold change over vehicle control treatment. **: p<0.001. Figures 8A-8G. DCTPP1 expression leads to reduced 5-aza-dC incorporation and decitabine potency. Figure 8A). A schematic representation of the enzymes (with HUGO gene symbols of encoding genes in parentheses) curated in the “pyrimidine metabolism” KEGG pathway that are directly involved in decitabine uptake, metabolism and incorporation. A proposed model of synergy between decitabine and triptolide is shown with bolded arrows: by inhibiting DCTPP1 (shown in bolded red arrow), triptolide prevents pyrophosphate cleavage of 5-aza-deoxycytidine triphosphate (5-aza-dCTP), resulting in greater incorporation of 5-aza-dC into genomic DNA. This would trigger increased DNMT trapping / degradation, greater hypomethylation, and synergistic cytotoxicity in vitro and in vivo (shown in bolded black arrow).5-aza-dC, 5-aza-2’- deoxycytidine; 5-aza-dU, 5-aza-2’-deoxyuridine; 5-aza-dCMP, 5-aza-2’-deoxycytidine monophosphate; 5-aza-dUMP, 5-aza-2’deoxyuridine monophosphate; 5-aza-dCDP, 5- aza-2’deoxycytodine diphosphate; 5-azadCTP, 5-aza-2’-deoxycytidine triphosphate; DNMTs, DNA methyltransferases. Figure 8B). A plot of the correlation coefficient versus the [–log10(p-value)] for the correlation between 5-aza-dC incorporation into genomic DNA and the level of expression for each gene from the Kyoto Encyclopedia of Genes and Genomes (KEGG) “pyrimidine metabolism” pathway that would be directly involved in decitabine uptake, metabolism / activation, and DNA incorporation. The Human Genome Organization (HUGO) gene symbols for the top-ranked genes (with p < 0.1) are indicated. Among these genes, only DCTPP1 showed a significant (p<0.01) correlation with the level of incorporation of 5-aza-dC into genomic DNA. Figure 8C). The level of incorporation of 5-aza-dC into genomic DNA after two days of exposure to 250 nM Attorney Docket No.44807-0477WO1 / C18163_P18163-01 decitabine is significantly inversely correlated with the level of expression of DCTPP1 in the panel of 16 cancer cell lines. The cells selected for genetic manipulation are indicated with arrows. Figure 8D). Decitabine potency (log10(IC50)) is significantly correlated with the level of DCTPP1 expression in a panel of 18 cancer cell lines (4 lung cancer, 4 breast cancer, 4 melanoma, 3 leukemia, 2 prostate cancer and 1 ovarian cancer). Figures 8E and 8F). Genetic disruption of DCTPP1 significantly sensitized A549 and MCF7cells to decitabine (Figure 8E), while overexpressing DCTPP1 in MDA-MB-231 cells conferred significant resistance to decitabine (Figure 8F). Data represent log10 [IC50, DAC (nM)] and 95% confidence intervals. Figure 8G). DCTPP1 expression levels in acute myeloid leukemia are significantly lower than those in most solid tumors. The DCTPP1 mRNA expression levels among the major cancer types in The Cancer Genome Atlas (TCGA, www.cbioportal.org / ) were plotted and each cancer type was ranked by its median DCTPP1 expression level. The box of the box-and-whisker plots showed the median and interquartile range, and the whiskers represent the minimum and maximum log2(RPKM) value (reads per kilobase per million). DCTPP1 mRNA expression levels in acute myeloid leukemia (blue) were significantly lower than those in most solid tumor samples (red), including liver, lung, testis, prostate, brain glioblastoma, head and neck, bladder, breast, ovarian, cervical and colorectal cancers (**, p<0.001). There is no significant difference in DCTPP1 mRNA expression between AML and the remaining four cancer types (yellow). CCRCC, clear cell renal cell carcinoma; PRCC, papillary renal cell carcinoma. Figure 9. Scatter plot of 24 synergistic compounds with decitabine ranked by sum of excess over Bliss independence as the synergy score. Values greater than zero indicate increasing levels of synergy. Figure 10. Triptolide synergistically sensitized cancer cells to nucleoside analog DNMT inhibitors in vitro. Inhibition of growth of human prostate cancer cell lines C4- 2B, CWR22Rv1, LAPC4 and PC3 treated with vehicle control, 50 nM decitabine, or 1 nM triptolide alone or in combination. Growth curves were measured as the percent of total confluence in each well over time. The mean percent confluence ± SEM for 16 fields in each condition are shown. Measurements were taken every 6 hours throughout the course of the growth curve. Figures 11A-11B. Inhibition of DCTPP1 activity by triptolide analogs and relationship to synergy with decitabine. Figure 11A) Thin layer chromatography DCTPP1 Attorney Docket No.44807-0477WO1 / C18163_P18163-01 pyrophosphatase activity assay using 1 μCi [α -32P]dCTP, with a dose response of triptolide and its analogs. The percent of dCTP hydrolysis to dCMP was quantified using PhosphorImager. Shown are typical images of duplicate reactions. Figure 11B) Correlation between synergy of decitabine and triptolide analogs (measured as average of Bliss synergy across all doses) in inhibiting DU145 cell growth (measured by growth curve analysis as in Fig.4D) and the potency of inhibiting DCTPP1 (left panel) or XPB (right panel) activity in vitro for a series of triptolide analogs. The synergy between decitabine and triptolide analogs was more correlated with the potency of triptolide analogs in inhibiting DCTPP1 activity than in inhibiting XPB. Figures 12A-12C. Superposition of DCTPP1 binding with triptolide and Me- dCPNPP. Figure 12A) Structural alignment of the structure of triptolide bound to human DCTPP1(21-130) (dark gray ribbon) and mouse DCTPP1 bound to Me-dCPNPP (light gray ribbon – PDB# 6SQZ). Triptolide and Me-dCPNPP are illustrated as solid and dotted arrows, respectively. Figure 12B) Electron density for a 2Fo-Fc simulated annealing omit map contoured at 1σ for triptolide bound to DCTPP1. Figure 12C) Space filling representation of the hydrophobic binding pocket shared by Me-dCTP and triptolide. Me-dCTP is illustrated by a dotted arrow with phosphorous and oxygen atoms are indicated with a dotted circle, respectively. Triptolide is illustrated by a solid arrow as in (Figure 9A). Figures 13A-13D. The synergy of triptolide and decitabine was dependent on DCTPP1. Human prostate cancer cell lines DU145 (Figure 13A) and PC3 (Figure 13B) were transduced with CRISPR-Cas9 with non-targeting controls (KO-Control), or DCTPP1 guide-RNA to knockout DCTPP1 (KO-DCTPP1) or XPB guide-RNA to knockout XPB (KO-XPB) confirmed by immunoblotting. Inhibition of cell viability and the degree of synergy of combinations of decitabine and triptolide in indicated dose series of the transduced isogenic cell lines were developed as in Figure 7. Knocking out XPB in DU145 and PC3 cells had no significant change of overall synergy between triptolide and decitabine (histograms, right panel) compared to isogenic control cells. Knocking out DCTPP1 in both DU145 and PC3 cells completely abolished overall synergy (Bliss sum < 0). Figures 13C and 13D). Data represent log10 [IC50, DAC (nM)] and 95% confidence intervals of the XPB knockout or overexpression cell lines. NS, non- significant. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Figures 14A-14C. dCTP and 5-aza-dCTP are optimal substrates in in vitro DCTPP1 assay. Figure 14A) Hill plot of DCTPP1 enzymatic pyrophosphatase activity on a range of dCTP and 5-aza-dCTP substrate concentrations. Each value represents the mean ± SEM of triplicate measurements of the initial velocity of DCTPP1 pyrophosphatase activity for each substrate. Figure 14B) Triptolide inhibited DCTPP1 pyrophosphatase activity, measured via a coupled luminescence assay on dCTP and 5- aza-dCTP across a dose response. Shown are the mean ± SEM of triplicate measurements. Figure 14C) Decitabine failed to inhibit DCTPP1 across a wide dose range as indicated. Triptolide served as a positive control for inhibition of DCTPP1 activity. Each value represents the mean ± SEM of triplicate treatments. Figures 15A-15B. The incorporation of decitabine into genomic DNA is strongly influenced by modulating DCTPP1 levels. Figure 15A) Overexpression of DCTPP1 in DU145 cells reduced decitabine incorporation into genomic DNA.5-aza-2’- dC incorporation into genomic DNA, determined by LC-MS / MS, in DU145-OE-Control or DU145-OE-DCTPP1 cells treated with vehicle control or 1250nM decitabine for 2 days. The 5-aza-2’-dC content per 10002’-dC in DU145-OE-DCTPP1 cells was normalized to that of DU145-OE-Control cells. Figure 15B) Knockout DCTPP1 in DU145 cells enhanced decitabine incorporation into genomic DNA.5-aza-2’-dC incorporation into genomic DNA, determined by LC-MS / MS, in DU145-KO-Control or DU145-KO- DCTPP1 cells treated with vehicle control or 1250nM decitabine for 2 days. The 5-aza- 2’-dC content per 10002’-dC in DU145-KO-DCTPP1 cells was normalized to that of DU145-KOControl cells. Shown in (A and B) are the mean ± SEM of triplicate treatments. Figures 16A-16B. Triptolide treatment enhanced the decitabine induced DNMTs protein loss. Figure 16A) Quantitation of immunoblots from Figure 6C of DNMT1, DNMT3a and DNMT3B levels in human prostate cancer DU145 cells treated with vehicle control, decitabine (250 nM) or triptolide (1 nM) alone or in combination for 24 hours. Densitometry was measured with Image-J software. Figure 16B) Western Blot of DNMT1 levels in human prostate cancer DU145 cells treated with a 2-dose response of each drug: vehicle control, decitabine (25 nM or 100 nM) or triptolide (0.5 nM or 1 nM) alone or in combination for 24 hours. β-actin blotting is shown as protein loading control, and densitometry was measured as in Figure 13A. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Figures 17A-17B. Genome-wide methylation analyses in DU145 cells after treatment with triptolide and decitabine. Distribution plots of global DNA demethylation (delta beta values) across all CpG probes in Infinium platform in DU145 cells treated with vehicle control, 33 nM decitabine (DAC) alone or 2 nM triptolide (TPL) alone or in combination (DAC+TPL) for 5 days (Figure 17A) or 20 days (Figure 17B). The y-axis represents the difference in beta values at each probe between the two conditions indicated. Negative values indicate greater extent of demethylation in the first condition compared to the second. At both timepoints, the combination of decitabine and triptolide led to greater demethylation compared to decitabine alone (P < 10-16, Wilcoxon signed rank test). Figure 18. The combination treatment of triptolide and decitabine changed gene expression profiles in DU145 cells. Heatmap of DU145 expression profile change in RNA-seq with vehicle control (Ctrl), 2nM Triptolide (TPL), 33nM Decitabine (DAC), or the combination (DAC+TPL). Shown are differentially expressed genes across conditions (n=3 each) at 20 days after treatment. Genes showing specific patterns of alteration across the conditions are clustered together and indicated. Figures 19A-19B. DCTPP1 but not XPB expression levels were inversely correlated with 5-aza-dC incorporation. Figure 19A) Correlation between levels of DCTPP1 mRNA expression and decitabine incorporation after normalization with cell proliferation activity among 16 cancer cell lines. Tritiated thymidine incorporation assays were carried out in parallel experiments with decitabine incorporation assays to normalize for differences in DNA replication rates among the different cell lines. The significant inverse correlation between decitabine incorporation rate and DCTPP1 mRNA expression level was preserved after normalization to tritiated thymidine incorporation. Figure 19B) There was no correlation between XPB mRNA expression levels with decitabine incorporation levels among 16 cancer cell lines. Figures 20A-20C. The endogenous DCTPP1 expression level varied among cell lines. Figure 20A) Immunoblotting detection of endogenous expression level of DCTPP1 among a series of cancer cell lines. β-Actin was included as a loading control. Figure 20B) Immunoblotting confirmation of lentiviral overexpression of DCTPP1 in MDA- MB-231 cells. β-Actin was included as a loading control. Figure 20C) Immunoblotting confirmation of CRISPR-Cas9 knockout of DCTPP1 in A549 and MCF7 cells. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Figures 21A-21B. DCTPP1 expression levels in hematological tissues were significantly lower than those in most normal human tissues. Figure 21A) DCTPP1 expression levels in bone marrow were relatively low among most normal human tissues. Human Protein Atlas (HPA) RNA-seq data were downloaded from ncbi.nlm.nih.gov / gene / , project: PRJEB4337. Each value represents the mean ± SEM of RNA-seq of multiple human normal tissue samples. Figure 21B) DCTPP1 protein expression levels in normal tissues were largely consistent with RNA expression data. DCTPP1 protein expression levels in normal tissues were developed with HPA002832 antibody and were downloaded from proteinatlas.org. Protein expression in bone marrow was not detected. Figures 22A-22B. Combination treatment of azacitidine and triptolide or its DCTPP1 active derivative (TPL-2004) enhanced 5-aza-2’-dC incorporation into genomic DNA. Figure 22A) The potency for 5-aza-2’-dC incorporation into genomic DNA between decitabine versus azacitidine was highly correlated. Human prostate cancer DU145 cells were treated with dose series of decitabine or azacytidine for 48 hours, and the 5-aza-2’-dC content in genomic DNA was analyzed with LCMS / MS. The potency of 5-aza-2’-dC incorporation into genomic DNA across the tested doses of decitabine and azacitidine was highly correlated (R2=0.968), with a ~3-fold greater potency, on average, for decitabine compared to azacitidine. Each point on the graph represents the mean ± SEM of the triplicate measurements for 5-aza-2’-dC content in genomic DNA. Figure 22B) 5-aza-2’-dC incorporation into genomic DNA, determined by LC-MS / MS, in DU- 145 cells treated with vehicle control, triptolide or its DCTPP1 targeting derivative (TPL- 2004), azacitidine alone, or in combination for 2 days. The mean of the amount of 5-aza- 2’-dC per 10002’-dC in genomic DNA ± SEM of triplicate treatments are shown. Both triptolide and TPL-2004 treatment significantly enhanced the azacitidine incorporation into genomic DNA in DU145 cells. Figures 23A-23B. Triptolide synergistically sensitized cancer cells to nucleoside analog DNMT inhibitor azacitidine in vitro. Figure 23A) The potency for growth inhibition between decitabine (DAC) and azacytidine (AZA) was highly correlated. For a panel of 15 cancer cell lines representing multiple cancer types, the potency of decitabine and azacitidine for inducing growth inhibition was measured by tritiated thymidine incorporation assay across a broad dose range. The potency of decitabine for growth inhibition (represented as log10 of the IC50 concentration in nM) on the panel of cancer Attorney Docket No.44807-0477WO1 / C18163_P18163-01 cell lines was highly correlated (R2=0.7835, p <0.01) with the potency of azacitidine, with a ~10-fold greater potency, on average, for decitabine compared to azacitidine. Each point on the graph represents the IC50 for decitabine versus azacitidine for a single cell line. Figure 23B) Synergy of azacitidine and triptolide in DU145 cells. Viability measurements of cells treated with vehicle control, 1 μM azacitidine or triptolide (1 nM or 2.5 nM) alone, or in combinations, with each measurement representing the percent viability with respect to the vehicle control treatment. Each value represents the mean ± SEM of triplicate treatments. Figures 24A-24C. Triptolide did not synergistically inhibit cancer cell growth with gemcitabine and cytarabine. Figures 24A and 24B) Bliss synergy analysis of triptolide and gemcitabine (Figure 24A) or cytarabine (Figure 24B) in different cancer cell lines. Cell viability measurements of human prostate cancer DU145 cells (left panel), human leukemia K562 cells (middle panel) and CCRFCEM cells (right panel) treated with gemcitabine or cytarabine or triptolide alone and in combinations across a dose series were developed by Alamar Blue Assay. The degree of synergy of combinations of triptolide and gemcitabine (Figure 24A) or cytarabine (Figure 24B) was calculated as the Bliss synergy score across the full dose ranges as represented in a heatmap scaled as shown in the legend. For all 3 cell lines, there was no overall synergy (sum of bliss synergy score < 0) for the triptolide combined with gemcitabine or cytarabine. Figure 24C) In contrast, there was overall synergy (sum of bliss synergy score > 0) between triptolide and decitabine in DU145 cells (left panel), K562 cells (middle panel), and CCRFCEM cells (right panel). Conventions for display are the same as in panels (Figure 24A) and (Figure 24B). DETAILED DESCRIPTION This document provides methods and materials for treating cancer. In some cases, one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer to treat that mammal. For example, one or more diterpenoid epoxide compounds and one or more inhibitors of a DNMT polypeptide can be administered to a mammal (e.g., a human) having cancer to treat that mammal. In some cases, one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer to sensitize that cancer to one or more inhibitors of a DNMT polypeptide. For example, one or more diterpenoid epoxide compounds can be Attorney Docket No.44807-0477WO1 / C18163_P18163-01 administered to a mammal (e.g., a human) having cancer to sensitize that that cancer to one or more inhibitors of a DNMT polypeptide and the mammal can be administered one or more inhibitors of a DNMT polypeptide. When treating a mammal (e.g., a human) having cancer as described herein, the mammal can have any type of cancer. In some cases, a cancer that can be treated as described herein can include one or more solid tumors. In some cases, a cancer that can be treated as described herein can be a blood cancer. In some cases, a cancer that can be treated as described herein can be a primary cancer. In some cases, a cancer that can be treated as described herein can be a metastatic cancer. In some cases, a cancer that can be treated as described herein can be a refractory cancer. For example, a cancer that can be treated as described herein can be resistant to DNMT inhibitors. In some cases, a cancer that can be treated as described herein can be a relapsed cancer. Examples of cancers that can be treated as described herein include, without limitation, lung cancers, breast cancers, melanomas, prostate cancers, ovarian cancers, and leukemias. In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having cancer. Any appropriate method can be used to identify a mammal having cancer. For example, imaging techniques, biopsy techniques, and molecular techniques can be used to identify mammals (e.g., humans) as having cancer. In some cases, a cancer that can be treated as described herein can be identified as having an elevated level of a DCTPP1 polypeptide. For example, the presence or absence of an elevated level of a DCTPP1 polypeptide in a sample (e.g., a sample including one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be used to determine whether that cancer is likely to respond to a cancer treatment described herein (e.g., by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide). In some cases, a mammal having a cancer having an elevated level of a DCTPP1 polypeptide can be identified as being likely to respond to a cancer treatment that includes administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide. In some cases, a mammal having a cancer that lacks an elevated level of a DCTPP1 polypeptide can be identified as not being likely to respond to a cancer treatment that includes administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 The term “elevated level” as used herein with respect to a level of a DCTPP1 polypeptide refers to any level that is greater than a reference level of the DCTPP1 polypeptide. The term “reference level” as used herein with respect to a DCTPP1 polypeptide refers to the level of the DCTPP1 polypeptide typically observed in a sample (e.g., a control sample) from one or more mammals (e.g., humans) without cancer. Control samples can include, without limitation, samples from normal (e.g., healthy) mammals and non-cancerous cells (e.g., non-cancerous primary cells and non-cancerous cells lines). In some cases, an elevated level of a DCTPP1 polypeptide can be a level that is at least 2 (e.g., at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold greater relative to a reference level of the DCTPP1 polypeptide. In some cases, an elevated level of a DCTPP1 polypeptide can be a level that is at least 1 (e.g., at least 1.5, at least 2, at least 2.5, at least 3, at least 3.5, or at least 4) standard deviation in excess of a reference level of the DCTPP1 polypeptide. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an elevated level. Any appropriate sample can be assessed to determine if a mammal (e.g., a human) has an elevated level of a DCTPP1 polypeptide. In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more biological molecules (e.g., nucleic acids such as DNA and RNA, polypeptides, carbohydrates, lipids, hormones, and / or metabolites). For example, biological samples such as fluid (e.g., whole blood, peripheral blood, serum, plasma, urine, cerebrospinal fluid, and sputum) samples and tissue (e.g., tumor tissue) samples can be obtained from a mammal and assessed for the presence of an elevated level of DCTPP1 polypeptides. A sample can be a fresh sample or a fixed sample (e.g., a formaldehyde-fixed sample or a formalin-fixed sample). In some cases, a sample can be a processed sample (e.g., an embedded sample such as a paraffin or OCT embedded sample). In some cases, one or more biological molecules can be isolated from a sample. For example, nucleic acid (e.g., RNA such as messenger RNA (mRNA)) can be isolated from a sample and can be assessed as described herein. For example, one or more polypeptides can be isolated from a sample and can be assessed as described herein. A sample (e.g., a blood sample) obtained from a mammal (e.g., a human) having cancer can be assessed for any appropriate DCTPP1 polypeptide. Examples of DCTPP1 polypeptides that can be detected in a sample obtained from a mammal having cancer Attorney Docket No.44807-0477WO1 / C18163_P18163-01 include, without limitation, those set forth in the National Center for Biotechnology Information (NCBI) databases at, for example, accession no. NP_077001 (e.g., version NP_077001.1). Any appropriate method can be used to detect the presence or absence of an elevated level of a DCTPP1 polypeptide within a sample obtained from a mammal (e.g., a human). In some cases, a level of polypeptide expression within a sample can be determined by detecting the presence, absence, or level of the polypeptide in the sample. For example, immunoassays (e.g., immunohistochemistry (IHC) techniques and western blotting techniques), mass spectrometry techniques (e.g., proteomics-based mass spectrometry assays or targeted quantification-based mass spectrometry assays), enzyme- linked immunosorbent assays (ELISAs), and radio-immunoassays, can be used to determine the presence, absence, or level of a polypeptide in a sample. For example, one or more anti-DCTPP1 antibodies (e.g., Abcam ab224051) can be used detect changes in polypeptide levels. In some cases, a level of polypeptide expression within a sample can be determined by detecting the presence, absence, or level of mRNA encoding the polypeptide in the sample. For example, polymerase chain reaction (PCR)-based techniques such as quantitative RT-PCR techniques, gene expression panel (e.g., next generation sequencing (NGS) such as RNA-seq), in situ hybridization, northern blotting techniques, and microarrays can be used to determine the presence, absence, or level of mRNA encoding the polypeptide in the sample. In some cases, the presence or absence of an elevated level of a DCTPP1 polypeptide within a sample from a mammal having cancer can be determined as described in Example 1. Any type of mammal having cancer can be treated as described herein (e.g., by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide). Examples of mammals that can have cancer and can be treated with one or more diterpenoid epoxide compounds (and, optionally, with one or more inhibitors of a DNMT polypeptide) as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, rabbits, mice, and rats. A mammal having cancer can be administered or instructed to self-administer one or more (e.g., one, two, three, four, or more) diterpenoid epoxide compounds described herein. A diterpenoid epoxide compound can be any type of diterpenoid epoxide compound. A diterpenoid epoxide compound can be a naturally derived diterpenoid Attorney Docket No.44807-0477WO1 / C18163_P18163-01 epoxide compound or a synthetic diterpenoid epoxide compound. In some cases, a diterpenoid epoxide compound can be derived from a plant such as a Thunder God Vine (Tripterygium wilfordii). Examples of diterpenoid epoxide compounds that can be used to treat a mammal (e.g., a human) having cancer as described herein include, without limitation, triptolide, TPL-2004, TPL-2005, TPL-2015, TPL-2021, TPL-2024, glutriptolide, triptonide, and tripterygium glycosides. In some cases, a diterpenoid epoxide compound can be in the form of a conjugate (e.g., can be conjugated to one or more additional molecules). In some cases, a diterpenoid epoxide compound can be conjugated to one or more targeting molecules. For example, a diterpenoid epoxide compound can be in the form of an antibody-drug conjugate. In some cases, a diterpenoid epoxide compound can be conjugated to one or more molecules that can enhance a desired outcome such as enhanced cellular uptake. For example, a diterpenoid epoxide compound can be in the form of a sugar conjugate (e.g., a glucose-triptolide conjugate). an antibody-drug conjugate. In some cases, a diterpenoid epoxide compound can have one of the structures can be shown in Table 1.

[0002] Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Table 1. Structures of exemplary diterpenoid epoxide compounds. Attorney Docket No.44807-0477WO1 / C18163_P18163-01

[0003] Attorney Docket No.44807-0477WO1 / C18163_P18163-01 In some cases, a diterpenoid epoxide compound can target (e.g., target and inhibit) a DCTPP1 polypeptide. In some cases, a diterpenoid epoxide compound can target (e.g., target and inhibit) an XPB polypeptide. In some cases, an agent other than a diterpenoid epoxide compound that can target (e.g., target and inhibit) a DCTPP1 polypeptide can be used in the methods described herein in addition to or in place of a diterpenoid epoxide. An inhibitor of a DCTPP1 polypeptide can be an inhibitor of DCTPP1 polypeptide activity (e.g., anti-DCTPP1 antibodies such as neutralizing anti-DCTPP1 antibodies and small molecules that target an DCTPP1 polypeptide) or an inhibitor of DCTPP1 polypeptide expression (e.g., nucleic acid molecules designed to induce RNA interference (RNAi) of DCTPP1 polypeptide expression such as antisense oligonucleotides (ASOs), siRNA molecules, and shRNA molecules). Examples of inhibitors of a DCTPP1 polypeptide that can be used in addition to or in place of a diterpenoid epoxide as described herein (e.g., by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide) can be as shown in Table 2. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Table 2. Inhibitors of DCTPP1 polypeptides. In some cases, one or more diterpenoid epoxide compounds can be as described elsewhere (see, e.g., He et al., Angew. Chem. Int. Ed., 55:12035 –12039 (2016); Datan et al., iScience 23:101536 (2020); Llona-Minguez et al., Bioorg. Med. Chem. Lett., 27(15):3219-3225 (2017); U.S. Patent No.10,695,319; and Canadian Patent No.3169 315)). Any appropriate amount (e.g., any appropriate dose) of one or more diterpenoid epoxide compounds can be administered to a mammal (e.g., a human) having cancer. An effective amount (e.g., a therapeutically effective amount) of a composition containing one or diterpenoid epoxide compounds described herein can be any amount that can treat a mammal having cancer as described herein without producing significant toxicity to the mammal. In some cases, an effective amount of one or more diterpenoid epoxide compounds can be less than about 1 microgram (µg) per kilogram body weight (µg / kg) to about 100 milligrams (mg) / kg. For example, an effective amount of triptolide can be from about 1 µg / kg to about 100 µg / kg (e.g., from about 1 to about 100, from about 1 to about 90, from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 1 to about 40, from about 1 to about 30, from about 1 to about 20, from about 1 to about 10, from about 10 to about 100, from about 20 to about 100, from about 30 to about 100, from about 40 to about 100, from about 50 to about 100, from about 60 to about 100, from about 70 to about 100, from about 80 to about 100, from about 90 to about 100, from about 10 to about 90, from about 20 to about 80, from about 30 to about 70, from about 40 to about 60, from about 20 to about 40, from about 30 to about 50, from about 40 to about 60, from about 50 to about 70, from about 60 to about 80 or from about 70 to about 90 µg / kg). For example, an effective amount of tripterygium glycosides can be from about 1 mg / kg to about 100 mg / kg (e.g., from about 1 to about 100, from about 1 to about 90, from about 1 to about 80, from about 1 to about 70, from about 1 to about 60, from about 1 to about 50, from about 1 to about 40, from about 1 to about 30, from about 1 to about 20, from about 1 to about 10, Attorney Docket No.44807-0477WO1 / C18163_P18163-01 from about 10 to about 100, from about 20 to about 100, from about 30 to about 100, from about 40 to about 100, from about 50 to about 100, from about 60 to about 100, from about 70 to about 100, from about 80 to about 100, from about 90 to about 100, from about 10 to about 90, from about 20 to about 80, from about 30 to about 70, from about 40 to about 60, from about 20 to about 40, from about 30 to about 50, from about 40 to about 60, from about 50 to about 70, from about 60 to about 80 or from about 70 to about 90 mg / kg). In some cases, one or more diterpenoid epoxide compounds described herein can be administered to a mammal (e.g., a human) having cancer together with one or more (e.g., one, two, three, four, or more) inhibitors of a DNMT polypeptide. An inhibitor of an DNMT polypeptide can be an inhibitor of DNMT polypeptide activity (e.g., anti-DNMT antibodies such as neutralizing anti-DNMT antibodies and small molecules that target an DNMT polypeptide) or an inhibitor of DNMT polypeptide expression (e.g., nucleic acid molecules designed to induce RNAi of DNMT polypeptide expression such as ASOs, siRNA molecules, and shRNA molecules). In some cases, an inhibitor of a DNMT polypeptide can be a nucleoside analog (e.g., cytidine analog). Examples of inhibitors of an DNMT polypeptide that can be used as described herein (e.g., by administering one or more diterpenoid epoxide compounds and, optionally, administering one or more inhibitors of a DNMT polypeptide) include, without limitation, decitabine (e.g., DACOGEN®), azacytidine (e.g., VIDAZA®and ONUREG®), guadecitabine, cedazuridine, ASTX 727 (e.g., INQOVI®), 5-fluoro-cytosine, 5-fluoro-deoxycytidine, and zebularine. Any appropriate amount (e.g., any appropriate dose) of one or more inhibitors of a DNMT polypeptide can be administered to a mammal (e.g., a human) having cancer. An effective amount (e.g., a therapeutically effective amount) of a composition containing one or inhibitors of a DNMT polypeptide described herein can be any amount that can treat a mammal having cancer as described herein without producing significant toxicity to the mammal. In some cases, an effective amount of one or more inhibitors of a DNMT polypeptide can be less than about 0.1 milligrams per meter squared of body surface area (mg / m2) to about 75 mg / m2. For example, an effective amount of decitabine can be from about 0.1 mg / m2to about 20 mg / m2(e.g., from about 0.1 to about 17, from about 0.1 to about 15, from about 0.1 to about 12, from about 0.1 to about 10, from about 0.1 to about 8, from about 0.1 to about 5, from about 0.1 to about 2, from about 3 to about 20, from Attorney Docket No.44807-0477WO1 / C18163_P18163-01 about 5 to about 20, from about 8 to about 20, from about 10 to about 20, from about 13 to about 20, from about 15 to about 20, from about 18 to about 20, from about 2 to about 17, from about 5 to about 15, from about 8 to about 12, from about 2 to about 5, from about 5 to about 8, from about 8 to about 10, from about 10 to about 12, from about 12 to about 15, or from about 15 to about 18 mg / m2). For example, an effective amount of azacitidine can be from about 1 mg / m2to about 75 mg / m2(e.g., from about 1 to about 50, from about 1 to about 35, from about 1 to about 25, from about 1 to about 10, from about 10 to about 75, from about 25 to about 75, from about 35 to about 75, from about 50 to about 75, from about 10 to about 50, from about 25 to about 35, from about 10 to about 25, from about 25 to about 35, from about 35 to about 50, or from about 50 to about 60 mg / m2). For example, an effective amount of guadecitabine can be from about 1 mg / m2to about 60 mg / m2(e.g., from about 1 to about 40, from about 1 to about 20, from about 1 to about 10, from about 10 to about 60, from about 20 to about 60, from about 40 to about 60, from about 50 to about 60, from about 10 to about 50, from about 20 to about 40, from about 20 to about 30, from about 30 to about 40, or from about 40 to about 50 mg / m2). In some cases, an effective amount of one or more inhibitors of a DNMT polypeptide can be less than about 35 mg to about 100 mg. For example, an effective amount of ASTX 727 can include about 35 mg decitabine and about 100 mg cedazuridine. In some cases, one or more inhibitors of a DNMT polypeptide can be as described elsewhere (see, e.g., Kim et al., Clin. Cancer Res., 28(16):3411-3416 (2022); Kaminskas et al., Oncologist, 10(3):176-82 (2005); Kaminskas et al., Clin. Cancer Res., 11(10):3604- 8 (2005); Steensma, Blood Cancer J., 8(5):47 (2018)). One or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be formulated into a composition (e.g., a pharmaceutically acceptable composition) for administration to a mammal having cancer. For example, a therapeutically effective amount of one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be formulated together with one or more pharmaceutically acceptable carriers (additives) and / or diluents. A pharmaceutical composition can be formulated for administration in solid or liquid form including, without limitation, sterile solutions, suspensions, sustained-release formulations, tablets, capsules, pills, powders, and granules. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 A composition (e.g., a pharmaceutically acceptable composition) including one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be administered locally or systemically. A composition containing one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be designed for oral, parenteral (including subcutaneous, intramuscular, intravenous, and intradermal), or inhaled administration. For example, a composition containing one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be administered systemically by an oral administration to or inhalation by a mammal (e.g., a human). When being administered orally, a composition containing one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be in the form of a pill, tablet, or capsule. In some cases, one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having cancer) to reduce the size of the cancer present within a mammal. For example, the materials and methods described herein can be used to reduce the number of cancer cells present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the materials and methods described herein can be used to reduce the size (e.g., volume) of one or more tumors present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be administered to a mammal (e.g., a human) in need thereof (e.g., a human having cancer) to improve survival of the mammal. For example, disease-free survival (e.g., relapse-free survival) can be improved using the materials and methods described herein. For example, progression-free survival can be improved using the materials and methods described herein. In some cases, the materials and methods described herein can be used to improve the survival of a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be used Attorney Docket No.44807-0477WO1 / C18163_P18163-01 as the sole active agent(s) to treat a mammal (e.g., a human) having cancer. For example, a composition including one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can include the one or more diterpenoid epoxide compounds (and, optionally, the one or more inhibitors of a DNMT polypeptide described herein) as the sole active agent(s) to treat a mammal (e.g., a human) having cancer. In some cases, one or more diterpenoid epoxide compounds described herein (and, optionally, one or more inhibitors of a DNMT polypeptide described herein) can be administered to a mammal (e.g., a human) having cancer together with one or more (e.g., one, two, three, four, or more) additional agents / therapies used to treat cancer. In some cases, an anti-cancer agent can be a targeted anti-cancer agent. In some cases, an anti- cancer agent can be a chemotherapeutic agent. In some cases, an anti-cancer agent can be an immunotherapeutic agent. Examples of anti-cancer agents include, without limitation, pembrolizumab, nivolumab, venetoclax, and any combinations thereof. In cases where one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide) are used with one or more additional agents treat a cancer, the one or more additional agents can be administered at the same time (e.g., in a single composition) or independently. In some cases, one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide) can be administered first, and the one or more additional agents administered second, or vice versa. Examples of therapies that can be used to treat cancer include, without limitation, surgery, radiation therapy, carbon ion therapy, and proton therapy. In cases where one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide) are used in combination with one or more additional therapies used to treat cancer, the one or more additional therapies can be performed at the same time or independently of the administration of one or more diterpenoid epoxide compounds (and, optionally, the one or more inhibitors of a DNMT polypeptide). For example, the one or more diterpenoid epoxide compounds (and, optionally, one or more inhibitors of a DNMT polypeptide) can be administered before, during, and / or after the one or more additional therapies are performed. In certain instances, a cancer within a mammal can be monitored to evaluate the effectiveness of the cancer treatment. Any appropriate method can be used to determine Attorney Docket No.44807-0477WO1 / C18163_P18163-01 whether or not a mammal having cancer is treated. For example, imaging techniques or laboratory assays can be used to assess the number of cancer cells and / or the size of a tumor present within a mammal. For example, imaging techniques or laboratory assays can be used to assess the location of cancer cells and / or a tumor present within a mammal. The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES Example 1: Triptolide sensitizes cancer cells to nucleoside DNA methyltransferase inhibitors through inhibition of DCTPP1-mediated cell-intrinsic resistance This Example describes the discovery that one or more diterpenoid epoxide compounds (e.g., triptolide (TPL) and its analogs) can sensitive cancer cells to one or more inhibitors of a DNMT polypeptide. This Example also describes how one or more diterpenoid epoxide compounds, and optionally, one or more inhibitors of a DNMT polypeptide can be used to treat cancer. RESULTS A chemical library screen for synergistic combinations with decitabine The Johns Hopkins Drug Library, comprised of 3,800 of the estimated 10,000 drugs used in medical practice was screened. Agents were identified that showed >50% growth inhibition (measured by tritiated thymidine incorporation of the prostate cancer cell line DU145 either alone (5 µM of each drug) or in combination with a low dose of decitabine (100 nM) that is well below circulating concentrations of decitabine achieved by clinically used doses (Figure 1A). This narrowed the initial set of compounds to 131 compounds that could have any potential for interaction with decitabine to inhibit DU145 cell growth. After filtering out those compounds that are used only topically, 66 of the remaining compounds were selected to represent a diverse array of compound classes for further analysis in combination studies across a wide dose range of each hit and of decitabine (0 nM to 10 µM each drug). Among these 66 compounds, 24 compounds showed formal synergy with decitabine for DU145 growth inhibition (Chou-Talalay combination index (CI) < 1 at a minimum of 2 decitabine doses and sum of Bliss Attorney Docket No.44807-0477WO1 / C18163_P18163-01 independence index across the full dose response > 0) (Figure 1B; Figure 9). Among these 24 synergistic hits, there were 6 anti-neoplastic drugs, 6 protein kinase inhibitors, 3 cardiotonic agents, 3 anti-rheumatics and immunosuppressants, 2 antibiotics, 2 mitotic poisons and 2 nucleoside analogs. Two of the top 10 synergistic compounds, triptolide and triptonide, are diterpene triepoxides derived from the Thunder God Vine (Tripterygium wilfordii) (Figure 1B). Triptolide is reported to be the principal active ingredient from extracts of T. wilfordii (Titov et al., Nat. Chem. Biol., 7:182-188 (2011); and Zhou et al., Nat. Prod. Rep., 29:457-475 (2012)), and has been tested in multiple pre- clinical and clinical settings including as an anti-inflammatory, immunosuppressive, anti- fertility, and anticancer agent (Chugh et al., Sci. Trans. Med., 4:156ra139 (2012); and Zhou et al., Nat. Prod. Rep., 29:457-475 (2012)). This study also investigated the role of triptolide in sensitization to DNMT inhibitors (DNMTi). Triptolide synergistically sensitizes cancer cells to nucleoside analog DNMTi in vitro Whether the synergy between triptolide and decitabine was more generalizable was examined. When tested alone and in combination using a broad dose response of each agent, triptolide and decitabine exhibited marked synergistic interaction in inhibiting cancer cell growth and / or viability on multiple cancer cell lines including 6 prostate cancer cell lines (DU145, LNCaP, C4-2B, LAPC4, CWR22Rv1, and PC3) and 3 leukemia cell lines (K562, CCRF-CEM, and MOLT4) (Figures 2A-2B, and Figure 10). The combination of triptolide and decitabine also significantly reduced clonogenic survival compared to either drug alone in multiple cancer cell models (Figure 2C). Non- malignant RWPE1 prostate epithelial cells and normal hepatocytes in primary culture were largely resistant to the growth inhibitory effects of triptolide and decitabine, both alone and in combination (Figure 2D). This suggested that the combination of triptolide and decitabine exhibited a favorable therapeutic index. Combination of triptolide and decitabine showed enhanced efficacy at well-tolerated doses in vivo To further explore the efficacy and safety of the combination of triptolide and decitabine, each drug was tested alone and in combination in a DU145 prostate cancer xenograft model in athymic nude mice. The combination of decitabine (1 mg / kg doses given i.p. on week 1 on days 1 / 3 / 5) and triptolide (0.2 mg / kg doses given each week on days 1-5, 8-12, and 15-19) for two 3- week cycles significantly diminished xenograft Attorney Docket No.44807-0477WO1 / C18163_P18163-01 growth and improved survival compared to triptolide alone, decitabine alone or vehicle control (Figure 3A-C). At these doses, in which the combination of triptolide and decitabine showed significantly enhanced efficacy in reducing xenograft growth, increased systemic toxicity was not observed as measured throughout the treatment course by mouse body weight loss, hematological parameters (WBC, RBC, hemoglobin), liver function (AST, ALT, total protein), and renal function (BUN, creatinine) (Figure 3D-G). Taken together, these data suggested that the combination of triptolide and decitabine exhibited favorable efficacy and safety in vivo. The synergistic interaction of triptolide and decitabine is mediated through inhibition of DCTPP1 It was next sought to understand the mechanistic basis for the observed synergy between triptolide and the nucleoside analog DNMTi. To date, a number of direct cellular binding targets for triptolide have been reported, including Xeroderma Pigmentosum B (XPB) / ERCC3 subunit of general transcription factor TFIIH, the dCTP pyrophosphatase DCTPP1, the calcium channel polycystin-2, the membrane protease ADAM10, and the kinase TAK1 partner protein TAB1. XPB mediates the antiproliferative activity of triptolide (He et al, Angewandte Chemie (International ed in English), 54:1859-1863 (2015); and Smurnyy et al., Nat. Chem. Biol., 10:623-625 (2014)), and DCTPP1 hydrolyzes nucleotide triphosphate in addition to dCTP (Corson et al., Chembiochem, 12:1767-1773 (2011); Requena et al., Biochem. J., 459:171-180 (2014); and Song et al., Oncogenesis, 4:e159 (2015)). To understand which of these two direct targets (XPB and DCTPP1) were most responsible for the observed synergy between triptolide and decitabine, a chemical biology approach was used with a series of 6 triptolide analogs that exhibited different potencies for inhibiting DCTPP1 and XPB in vitro (Table 3; Figure 11A). For each triptolide analog, the IC50 for DU145 cancer cell growth inhibition (defined as the dose of the compound needed to reduce cell growth at 150 hours to 50% of vehicle control) was determined with and without combined exposure to decitabine (50 nM). The growth inhibitory potency of each compound alone was significantly correlated to its potency in inhibiting the target XPB (R2=0.882, P=0.006), but not to its potency for DCTPP1 inhibition (R2=0.463, P=0.137; Figure 4A). In a multivariate analysis, the correlation with XPB was preserved (coefficient = 1.11, p = 0.04), while the low trend of correlation with DCTPP1 potency was largely eliminated (coefficient = 0.12, p = 0.76); Attorney Docket No.44807-0477WO1 / C18163_P18163-01 this suggested that single agent growth inhibition of the triptolide analogs was attributable to XPB targeting, and not DCTPP1 targeting. Table 3. Bioactivities of triptolide (TPL) and its analogs. The log ratio of the growth inhibitory IC50for each compound with decitabine to that without decitabine was significantly correlated to the log ratio of IC50 for inhibition of DCTPP1 activity vs. XPB activity (R2=0.901, P=0.004; Figure 4B). Thus, the extent to which each compound enhanced growth inhibition with decitabine co-treatment could be attributed to its relative potency for DCTPP1 with respect to XPB. In support of this notion, the degree of synergy between triptolide analogs and decitabine in inhibiting cell growth (measured by the average Bliss synergy score) was correlated with the potency of triptolide analogs in inhibiting DCTPP1 activity more so than that for XPB (Figure 11B). To explore this further, the behavior of two triptolide analogs, TPL-2004 and TPL-2015, was examined (Table 3; Figure 4C). Each of these compounds had Attorney Docket No.44807-0477WO1 / C18163_P18163-01 comparable IC50for inhibition of XPB in activity assays. However, while TPL-2004 had strong potency for inhibition of DCTPP1 activity, comparable to that of the parent compound triptolide, TPL-2015 did not effectively inhibit DCTPP1 (Figure 4C). Likewise, while both TPL-2004 and TPL-2015 showed similar single agent potency for inhibition of DU145 cell growth (6.05 nM and 8.71 nM IC50respectively; Table 3), likely attributable to their comparable potency of inhibiting XPB (Figure 4C), only TPL-2004 and not TPL-2015 showed significantly enhanced growth inhibition with decitabine (Figure 4D). This selective enhancement of growth inhibition by the combination of TPL- 2004 with decitabine compared to the combination of TPL-2015 with decitabine was further confirmed by clonogenic survival assays in both DU145 and PC3 cells (Figure 4F). To define the structural basis for the inhibition of DCTPP1 by triptolide and to understand the differences between triptolide and its analogs, the structure of the catalytic core of human DCTPP1 (residues 21-130) bound to triptolide was determined using X- ray crystallography (Table 4). A structure of mouse DCTPP1 was solved in the presence of non-hydrolyzable 5-methyl dCTP (indicated as *-dCTP or Me-dCPNPP in Figure 4E and Figure 12 respectively) (Wu et al., J. Mol. Biol., 367:1405-1412 (2007)), as well as several structures bound to dCTP analogs (Scaletti et al., J. Mol. Biol., 432:1126-1142 (2020)). The dCTP binding pocket comprised a hydrophobic pyrimidine-binding site and a triphosphate-binding locus lined with charged residues capable of coordinating a catalytic magnesium ion. The pyrimidine-binding pocket was composed of Trp47, Phe50 and Trp73 from an adjacent monomer (human DCTPP1 numbering). The human protein was highly similar structurally to its mouse homolog (C^ rmsd = 0.242Å) (Figure 12A), given the sequence similarity between the two proteins (88% identity, 93% similarity for the catalytic core regions). Inspection of the human DCTPP1•triptolide complex revealed that the inhibitor bound in part to the pyrimidine-binding locus (Figure 4E, and Figure 12C). Trp47 and Trp73 sandwiched the lactone ring and a portion of the diterpine ring of triptolide, while the lactone carbonyl of the compound formed hydrogen bonds to His51, a residue also seen to engage the 4-amino group of dCTP. Phe50 also made close contact to the diterpene ring of triptolide, while residues Tyr102 and Tyr129 formed an additional adjacent monomer to further define the hydrophobic binding pocket. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Table 4. Data collection and model refinement statistics. Numbers in parentheses refer to values in the highest resolution shell. Triptolide contains three epoxides. The inhibition of XPB by triptolide has been attributed to covalent adduct formation between a cysteine in the protein and one of the Attorney Docket No.44807-0477WO1 / C18163_P18163-01 three epoxides (Titov et al., Nat. Chem. Biol., 7:182-188 (2011)). In the DCTPP1•triptolide complex, the binding pocket contained no cysteines or serines and no covalent adduct were observed (Figure 4E, and Figure 12B). The structure of the complex also explained the disparate activities of analogs TPL-2004 and TPL-2015. The hydroxyl substitution of TPL-2015 likely disrupted the hydrophobic sandwich formed by W47 and W73, accounting for the >100-fold difference in IC50 of this derivative for DCTPP1 compared to triptolide (Figure 4E). By comparison, TPL-2004 was functionalized with an imidazole group linked through a thio-enol ester to a hydroxyl group on triptolide distal to its lactone ring. This imidazole substituent likely closed off the hydrophobic binding pocket exploited by triptolide (Figure 4E), accounting for its observed ~3-fold improvement in IC50(Table 3). The mechanistic studies of synergy between decitabine and triptolide were supplemented with additional genetic experiments. CRISPR / CAS9 mediated genetic disruption of DCTPP1 led to sensitization of DU145 and PC3 cells to single agent decitabine (Figure 5A), and greatly abolished the synergy between decitabine and triptolide (P<0.001, Figures 5B and 5D). However knocking out XPB in DU145 and PC3 did not significantly impact the sensitivity to decitabine or the synergy between decitabine and triptolide (Figures 13A-13C). On the other hand, forced expression of DCTPP1 in DU145 and PC3 cells led to significant desensitization to single agent decitabine (Figure 5A), and enhanced the synergy between decitabine and triptolide in inhibiting cancer cell proliferation across a dose response matrix (Figures 5C and 5E). In contrast, forced expression of XPB in DU145 and PC3 cells had little impact on sensitivity to single agent decitabine (Figure 13D). Taken together, these findings suggest that inhibition of cell growth by single agent triptolide and its analogs is likely due to their ability to inhibit the target XPB, while the observed synergy between triptolide and its analogs with decitabine for inhibition of cancer cell growth and survival is attributable to inhibition of DCTPP1. Defining the mechanism of synergy of DNMT and DCTPP1 inhibition Since DCTPP1 was the major target for triptolide and its analogs for synergy with decitabine in inhibiting cancer cell growth and survival, the underlying mechanisms were next explored. DCTPP1 encodes a deoxycytidine triphosphate pyrophosphatase, which is involved in balancing levels of deoxycytidine triphosphate (dCTP) and deoxycytidine monophosphate (dCMP) in cells. DCTPP1 has also been shown to hydrolyze Attorney Docket No.44807-0477WO1 / C18163_P18163-01 pyrophosphate from non-natural and modified dCTP, including 5-halogenated, 5-formyl, 5-methyl, 5-hydroxymethyl, more so than dCTP itself, potentially acting to more selectively prevent the incorporation of these modified dCTP nucleotides into genomic DNA. The convergent mechanism of action of the nucleoside analog DNMTi, including decitabine, azacitidine, and guadecitabine, involves cellular conversion to 5-aza-2’- deoxycytidine triphosphate (5-aza-dCTP) and incorporation into the genome during DNA synthesis, triggering trapping and degradation of the DNA methyltransferase enzymes and passive loss of methylation across DNA replication. It was examined whether DCTPP1 may have pyrophosphatase activity on 5-aza-dCTP, thereby preventing its incorporation into genomic DNA, presenting a cell-intrinsic resistance mechanism to nucleoside analog DNMTi. The enzymatic activity of DCTPP1 for hydrolysis of pyrophosphate from 5-aza- dCTP and dCTP was examined. These analyses revealed that DCTPP1 had slightly increased catalytic efficiency (Kcat / Km) for 5-aza-dCTP compared to dCTP (Figure 14A). It was observed that triptolide can inhibit DCTPP1 pyrophosphatase activity for 5- aza-dCTP with an IC50 similar to that for dCTP (14.7 µM and 8.49 µM, respectively) (Figure 14B). Additionally, it was shown that decitabine did not inhibit DCTPP1 pyrophosphatase activity (Figure 14C). These data suggested that DCTPP1 can reduce 5- aza-dCTP availability for incorporation into genomic DNA, and that triptolide can increase the availability of 5-aza-dCTP incorporation by inhibiting DCTPP1 pyrophosphatase activity. Consistent with this notion, co-treatment with decitabine and triptolide led to enhanced 5-aza-dC incorporation into genomic DNA compared to treatment with decitabine alone as measured by liquid chromatography / tandem mass spectrometry assay (Figures 6A-6B). Similarly, compared to that in control DU145 cells, the level of 5-aza- dC incorporation into genomic DNA after decitabine treatment was significantly reduced in DCTPP1-overexpressing cells (Figure 15A), and was significantly increased in DCTPP1-knockout cells (Figure 15B). Intriguingly, this enhanced genomic incorporation of 5-aza-dC by combination decitabine and triptolide treatment translated to significantly enhanced trapping and degradation of all three DNA methyltransferases (DNMT1, DNMT3A, and DNMT3B) in the cells (Figure 6C, and Figures 16A-16B) as well as a greater degree of global DNA demethylation (Figures 6D-6E), compared to decitabine Attorney Docket No.44807-0477WO1 / C18163_P18163-01 alone, which could only lead to reduction of DNMT1 levels. This enhanced demethylation was also observed when decitabine was combined with the DCTPP1- inhibiting triptolide analog TPL-2004, but not with TPL-2015 (Figure 6F). It was examined whether the combination of triptolide (or its DCTPP1-inhibiting analogs) with decitabine could allow significant cancer cell cytotoxicity, while also mediating DNA demethylation and epigenetic reprogramming in any surviving cells. To test this, DU145 cells were exposed to vehicle controls, triptolide (0.5 nM) or decitabine (33 nM) alone at low doses, or the combination, for 3 days, replaced with drug free media, and the surviving cells were assessed for genome-wide DNA methylation (using the Infinium EPIC microarray platform) and gene expression (using RNA-seq) patterns over a time course at 5 days and 20 days post initial exposure. The combination of triptolide and decitabine showed significant inhibition of growth / survival at 5 days while each drug alone had minimal effect. Low dose decitabine alone, but not triptolide alone, led to marked genome-wide DNA demethylation across all interrogated CpGs (Figure 17A). The combination of low dose triptolide and decitabine also showed marked genome-wide DNA demethylation, and, if anything, enhanced the degree of DNA demethylation compared to low-dose decitabine alone. Moreover, this pattern of genome- wide DNA demethylation was retained in the surviving cells even at 20 days post- exposure (Figure 17B). Consistent with these in vitro findings, in the long-term in vivo experiment, mice treated with the combination of decitabine and triptolide showed significantly greater loss of 5-methyl-deoxycytidine (5mdC) in the residual tumor genomic DNA compared to that in mice treated with decitabine alone (Figure 6E). Remarkably, in terms of gene expression, it was observed that the genes significantly induced by decitabine alone (Benjamini-Hochberg adjusted p (padj) < 0.001, log2(fold change) > 0.5), across the board, were subtly but consistently further upregulated by the combination of decitabine and triptolide (p <0.001; Figure 7A and Figure 18). As an example, the long noncoding RNA H19, which is known to exhibit loss of imprinting and DNA methylation mediated silencing in DU145 cells, was highly induced by decitabine alone, and was further upregulated by the combination of triptolide and decitabine, which was confirmed by qRT-PCR (Figure 7B). Deep bisulfite sequencing of the previously characterized imprint control region of H19 (Barletta et al., Can. Res., 57:48-50 (1997); and Ito et al., Nucl. Acids Res., 41:5290-5302 (2013)) showed that the combination of decitabine and triptolide led to a greater fraction of Attorney Docket No.44807-0477WO1 / C18163_P18163-01 completely demethylated alleles compared to decitabine alone (Figure 7C). Decitabine strongly induced expression of endogenous retroviruses, cancer testis antigens, and interferon response genes (Figures 7D-7F). The combination of triptolide and decitabine further enhanced induction of these genes compared to decitabine alone (Figures 7D-7F). Thus, compared to decitabine alone, the combination of triptolide and low dose decitabine captures the most desired effects of both low-dose and high-dose nucleoside DNMTi, in that it leads to both selective cancer cell cytotoxicity while also mediating, and even enhancing, the long-lived epigenetic effects of DNA demethylation and gene re- expression. DCTPP1 inhibition by triptolide overcomes a cell intrinsic resistance mechanism to nucleoside analog DNMTi These data implicated DCTPP1 as a cell-intrinsic factor in mediating primary resistance to nucleoside analog DNMTi by preventing their incorporation into genomic DNA. To further investigate this notion, it was assessed whether the degree of incorporation of decitabine into genomic DNA in a panel of 16 human cancer cell lines (5 lung cancer, 4 breast cancer, 4 melanoma, 2 prostate cancer, and 1 ovarian cancer) was associated with the level of expression of DCTPP1 or with any other genes from the “pyrimidine metabolism” pathway curated in the Kyoto Encyclopedia of Genes and Genomes (KEGG; Figure 8A). There was a significant inverse correlation with 5-aza-dC incorporation and DCTPP1 expression levels (R2=0.493, p=0.003, Figures 8A-8C), and this correlation was preserved even after normalizing to differences in the rate of proliferation between cell lines as measured by tritiated thymidine incorporation (Figure 19A). This correlation with DCTPP1 expression was the top-ranked correlation among all genes in the “pyrimidine metabolism” KEGG pathway, including those that are known to be directly involved in the cellular uptake and metabolism of decitabine (Figures 8A-8B). Conversely, there was no significant correlation between 5-aza-dC incorporation and the level of expression of XPB, the other known major direct target of triptolide (Figure 19B). Furthermore, the growth inhibitory potencies of decitabine were also significantly correlated with the DCTPP1 expression levels among a panel of 18 cancer cell lines (R2=0.238, p=0.0399, Figure 8D). In cell lines with intermediate to high DCTPP1 expression (DU145, PC3, A549 and MCF7), CRISPR / CAS mediated disruption of DCTPP1 significantly sensitized (reduced IC50) the cells to single agent decitabine compared to those of the isogenic control cells (Figures 5A, 8E, 20A, and 20C). On the other hand, in Attorney Docket No.44807-0477WO1 / C18163_P18163-01 cell lines having low to intermediate DCTPP1 expression (MDA-MB-231, DU145 and PC3), overexpressing DCTPP1 conferred resistance (increased IC50) to single agent decitabine compared isogenic control cells (Figures 5A, 8F, 20A, and 20B). An analysis of DCTPP1 mRNA expression levels in multiple cancer types from the TCGA showed that the level of DCTPP1 expression in AML (n = 175) was significantly lower than those in the majority of major solid organ cancers (Figure 8G). Furthermore, normal bone marrow and liver tissues had relatively low DCTPP1 expression (Figure 21), suggesting that there may not be an enhanced hematopoietic or liver toxicity of combination DNMT and DCTPP1 inhibition compared to DNMT inhibition alone. It was further tested whether inhibition of DCTPP1 by triptolide may have more broad implications for sensitization to several classes of cytidine nucleoside analog drugs whose mechanism of action involves incorporation into DNA. The other FDA approved nucleoside DNMTi azacitidine can be metabolized and incorporated into both RNA (~80- 90%) and DNA (~10-20%). However, the major mechanism of action in MDS / AML and other cancers is thought to arise from the conversion (through ribonucleotide reductase and other enzymes) to 5-aza-dCTP and incorporation into DNA, thereby exerting both epigenetic demethylation and DNA damage responses (Baylin, Nat. Clin. Practice Oncol., 2(Suppl 1):S4-11 (2005); Kiziltepe et al., Mol. Can. Ther., 6:1718-1727 (2007); and Palii et al., Mol. Cell. Biol., 28:752-771 (2008)). It was found that, similar to decitabine, co-treatment of DU145 cells with azacitidine and triptolide or its DCTPP1- inhibiting analog TPL-2004 showed synergistic cytotoxicity, enhanced 5-aza-dC incorporation into genomic DNA and global demethylation compared to treatment with azacitidine alone (Figures 22A-22B, and Figures 23A-23B). Since DCTPP1 does not have enzymatic activity on ribonucleosides, these data further confirmed that the major mechanism of action of azacitidine is through incorporation in DNA and not RNA. In further support of this notion, it was found that across a panel of 15 cell lines, the degree of 5-aza-2’dC incorporation into genomic DNA and the potency of decitabine in inhibiting cancer cell growth was highly correlated to those of azacitidine (Figures 22A and 23A). Since decitabine cannot be incorporated into RNA, this high correlation provided further support that azacitidine exerted growth inhibition through the fraction that gets incorporated into DNA. In contrast to 5-aza-2’dCTP, gemcitabine or cytarabine triphosphate are not substrates for DCTPP1. Consistent with this substrate selectivity, Attorney Docket No.44807-0477WO1 / C18163_P18163-01 there was no appreciable synergy for the combination of triptolide and gemcitabine or cytarabine in multiple cell lines (Figures 24A-24C). EXPERIMENTAL PROCEDURES Materials and cell culture All the cell lines, unless otherwise stated, were obtained from American Type Culture Collection (ATCC) and grew in the recommended medium. Human prostate epithelial cell line RWPE1 was purchased from Lonza (Basel, Switzerland) and was cultured in PrEGM medium (Lonza). All cell lines were maintained in a humidified incubator with 5% CO2 at 37°C. All chemicals, unless otherwise stated, were purchased from Sigma Aldrich (St. Louis, MO) and had purity greater than 98%. [α -32P]-dCTP was purchased from Perkin Elmer (Waltham,MS); 5-methyl-2'-deoxycytidine (5mC), 5- azacitidine-15N4(5AC-15N4), 2'-deoxycytidine-13C15N2(2dC-13C15N2), and 5-methyl-2'- deoxycytidine-d3 (5mC-d3) were purchased from Toronto Research Chemical (Toronto, ON). Clinical drug library screen 3800 clinical compounds were included in Johns Hopkins Drug Library (JHDL) (Chong et al., Nat. Chem. Biol., 2:415-416 (2006); Kamiyama et al., Clin. Can. Res., 19:1139-1146 (2013); and Platz et al., Can. Discov., 1:68-77 (2011)). Human prostate cancer DU145 cells were treated with 100 nM Decitabine (DAC) or DMSO for 4 days in T75 flasks. Cells were then split and seeded into 96-well plates at 5,000 cells / well in complete media and allowed to adhere overnight. On day 5, JHDL drugs were added to the plates in duplicate wells at a final concentration of 5 µM for a total of 72 hours, with 16 wells left untreated as no-drug controls. After the first 48 hours in JHDL compounds, 1 µCi [3H]-thymidine was added, and incubated for an additional 24 hours (in both drug and [3H]-thymidine). Cells were then trypsinized and transferred onto FilterMat-A glass fiber filters (Wallac, Turku, Finland) using the Harvester-96 cell harvester (Tomtec, Hamden, CT). After washing with distilled water five times to remove free [3H]- thymidine, the incorporated [3H]-thymidine was read on a MicroBeta plate reader (Perkin Elmer, MA, USA), and the mean percentage of inhibition was calculated relative to no- drug control wells. In each group (DAC or DMSO pretreated cells), JHDL compounds demonstrating greater than 50% inhibition of [3H]-thymidine incorporation considered Attorney Docket No.44807-0477WO1 / C18163_P18163-01 primary hits. After filtering out those compounds that are used only topically, 66 compounds representing a diverse array of classes were selected for combination titration studies across a wide dose range of each hit and of decitabine (0 nM to 10 µM each drug). For synthetic lethality and synergy analysis, the Combination Index (CI) was calculated with CompuSyn software using Chou-Talalay method (CI < 1 represents synergy) and sum of Bliss independence index was calculated with Graphpad Prism 5 (Bliss independence index > 0 represents synergy). In vitro DCTPP1 pyrophosphatase activity assays. [α -32P]-dCTP was used to detect dCTP hydrolysis by DCTPP1 with a thin layer chromatography assay. Briefly, a 20 μL reaction mixture contained 50 mM HEPES (pH=8.0), 100 mM NaCl, 5 mM MgCl2, 1 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), indicated concentration of triptolide analogs, 10 μM dCTP, 1 μCi [α -32P]dCTP, 100 μg / mL BSA, 10nM His-DCTPP1. The reactions were started by addition of DCTPP1 for 5 minutes and were stopped by addition of 5 μL of 0.5 M EDTA and dilution up to 100 μL with TE buffer. An aliquot of 1 μL reaction mixture was spotted on PEI-cellulose and the chromatogram was developed with 0.9 M guanidine hydrochloride (PH=6.0). The percent of dCTP hydrolysis to dCMP was quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). To enable measurement of DCTPP1 pyrophosphatase activity on multiple deoxycytidine triphosphate analog substrates, the rate of DCTPP1 pyrophosphate production was measured through a coupled ATP regeneration reaction followed by detection of luciferase-mediated luminescence. Briefly, the pyrophosphate generated by DCTPP1 after hydrolysis of dCTP or 5-aza-dCTP was converted by ATP sulfurylase to ATP, which was in turn used to produce luminescence by a luciferase assay. A 45 μL reaction mixture contained 50 mM HEPES (pH=8.0), 100 mM NaCl, 5 mM MgCl2, 1 mM TCEP, various concentrations of triptolide, 100 μg / mL BSA, 0.015U ATP sulfurylase, 10 nM His-DCTPP1. The reactions were started by addition of various concentrations of 5-Aza-dCTP or dCTP and incubated at room temperature at the indicated times followed by quenching via addition of 5 μL of 0.1 M EDTA. The luminescence produced by addition of 50 μL Buffer A (50mM HEPES(PH=8.0), 15 mM MgCl2, 5 μM Adenosine 5’-phosphosulfate (APS), 0.015 U luciferase, and 100 µg / mL D- luciferin, using injector mode of Microbeta 1450-023(Perkins Elmer). The amount of DCTPP1 mediated production of pyrophosphate from 5-aza-dCTP or dCTP was Attorney Docket No.44807-0477WO1 / C18163_P18163-01 quantified comparing to a pyrophosphate standard curve. The Kcat and Km for each substrate was calculated by Prism Graphpad 5.0. In vitro XPB activity assays The TFIIH complex containing XPB was purified and a DNA-dependent ATPase assay was performed. Briefly, a 10-μL reaction mixture contained 20 mM Tris (pH 7.9), 4 mM MgCl2, 1 μM of ATP, 1 μCi [γ-32P]ATP (3000 Ci / mmol), 100 μg / mL BSA, 100 nM AdMLP, 5 nM TFIIH and indicated concentrations of triptolide or its analogs. The reactions were started by either addition of TFIIH for 2 hours and stopped by addition of 2 μL of 0.5 M EDTA and dilution up to 100 μL with TE buffer. An aliquot of 1 μL reaction mixture was spotted on PEI-cellulose and the chromatogram was developed with 0.5 M LiCl and 1 M HCOOH. The percent of ATP hydrolysis was quantified using a PhosphorImager. Quantitation of genomic 5-aza-dC and 5-methyl-dC content by high-pressure liquid chromatography-tandem mass spectrometry (LC-MS / MS). The 5-aza-deoxycytidine (5-aza-dC) and 5-methyl-deoxycytidine (5-methyl-dC) content in genomic DNA was determined by a high-pressure liquid chromatography / tandem mass spectrometry (LC-MS / MS) procedure. Briefly, ~2 to 5 μg genomic DNA in 50 μL of HPLC grade water was digested with 4 Units of Nuclease P1 (Sigma) at 65°C for 10 minutes in a digestion buffer containing 0.04 mM desferrioxamine mesylate (DFAM), 3.25 mM ammonium acetate pH 5.0, 0.5 mM zinc chloride in a final volume of 100 μL. Subsequently, 20 μL of 100 mM Trizma base, pH 8.5 was added and this reaction was treated with 4 Units of alkaline phosphatase (Roche Life Science) at 37°C for 1 hour. Following incubation, 20 μL of 300 mM ammonium acetate, pH 5.0 and 6 μL of 0.25 mM DFAM in 50nM EDTA was added to stop digestion. Standards and quality control (QCs) samples were prepared by adding known concentrations of decitabine, 2′-deoxycytidine (2dC), and 5-methyl-2′-deoxycytidine (5mC) into blank digest matrix (all solvents used during DNA digest except for the enzymes). All samples, standards and QCs were prepared for analysis by adding 20 µL internal standard (5- azacitidine (5AC)-15N42dC-13C15N2, and 5mC-d3 in water) to 100 µL of sample and vortex-mix briefly. The samples were injected onto a LC-MS / MS system consisting of a Waters Acquity UPLC (Milford, MA) interfaced with an AB Sciex 5500 triple quadruple mass spectrometer (Foster City, CA). Chromatographic separation was achieved using Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Thermo Hypercarb porous graphite analytical column (100 x 2.1 mm, 5 µm, Waltham, MA) running isocratic elution with a mobile phase consisting of 10 mM ammonium acetate:acetonitrile with 0.1% formic acid (70:30, v / v) at a flow rate of 0.3 mL / minute. The mass spectrometer was run in positive electrospray ionization mode monitoring for the following MRM transitions: 5-aza-dC (DAC): ^ 113.0, 2dC: 228.0 ^112.0, 5- 15 methyl-dC: 242.0^126.0, 5AC- N4 (internal : 249.0 ^ 117.0, 2dC-13C15N2(internal standard): 230.8 ^ 115.0, and 5mC-d3 (internal standard): 245.8 ^129.0. The calibration was 2 – 400 ng / mL for 5-aza-dC, 5-1000 ng / mL for 5-methyl-dC, and 50-10,000 ng / mL for 2dC. All analytes used quadratic regression with 1 / x2weighing. Results were reported as 5-aza-dC (DAC) and 5mC content per thousand 2dC. Western blot detection of DNMT, DCTPP1and XPB proteins. Cells were collected by trypsinization, washed with PBS, and lysed in RIPA buffer (ThermoFisher) supplemented with protease and proteosomal inhibitors. Lysates were denatured in NuPage LDS Sample buffer 4X (Invitrogen, US) at 100°C and 15 µg of protein were separated with 4–12% Bis-Tris gels (Invitrogen, US) and transferred to polyvinylidene fluoride (PVDF) membrane using NUPAGE transfer buffer (Invitrogen, US). Membranes were incubated with Odyssey blocking buffer (Li-Cor, Lincoln, NE) prior to incubation with appropriate antibodies (anti-DNMT-1,-3A,-3B antibody, 1:1000, Sigma; anti-DCTPP1 antibody, 1:500, Cell Signaling; anti-XPB antibody, 1:500, Abcam; anti-β-actin antibody, 1:5000 Cell Signaling) overnight at 4°C. After three 5-minute washes with PBS-Tween20 (0.05%), goat anti-rabbit or goat anti-mouse secondary antibody (1:5000, LI-COR) was applied for 1 hour at room temperature, followed by three washing with PBS-Tween20 (0.05%). Visualization and quantification was carried out with the LI-COR Odyssey scanner and software (Li-Cor, Lincoln, NE). Clonogenic survival assay Clonogenic assays were performed to assess long-term cell survival. Human prostate cancer cell lines, DU145 and PC3 cells were plated in duplicates in a density of 2,000 cells / well in 6-well plates for adhering overnight. Decitabine was freshly dissolved in DMSO and diluted with PBS to indicated concentration and added to culture plates within 15 minutes. Cells were cultured for 10-14 days to allow formation of colonies. After 30 minutes fixation with 20% methanol, the clones were stained with crystal violet Attorney Docket No.44807-0477WO1 / C18163_P18163-01 (Sigma, US) and the colony areas were calculated with ImageJ. All dishes from one cell line were stained at the same time point. The average colony area for each condition was normalized to that in DMSO-treated controls for each cell line and each separate experiment. Statistical significance of differences was assessed by Student's t-tests. Alamar Blue cell viability assay Cells were seeded into 96 well plates one day before compound treatments. After incubating with appropriate drugs for 96 hours, 20 µL Alamar Blue reagent (Thermo Fisher, USA) was added into each well and incubated for 2 hours. The fluorescence intensity was read on a microplate reader at 590 nm wavelength. Growth curve assay 500 cancer cells were seeded per well in 48 well plates one day before compound treatments. Decitabine, triptolide and other drugs were freshly prepared and added to culture plates at indicated concentrations. For growth curve experiments, growth data were determined by imaging cell confluence at 6-hour intervals at each of 16 fields per well using the IncuCyte™ ZOOM System (Essen Bioscience, MA) in the Johns Hopkins SKCCC Imaging Core Facility. The percent confluence was calculated with Incucyte built-in software. Growth curves were analyzed and constructed with Graphpad Prism software 5.0 (La Jolla, CA). Growth inhibition of subcutaneous xenografted tumors. Human prostate cancer DU145 xenografts were generated by subcutaneous injection of 2×106cells into 8-10 week old athymic nude mice (Harlan, Indianapolis, IN). Tumor volumes (calculated as length x (width)2 / 2) were measured every week. When the tumors reached approximately 200 mm3in size, 10 mice were randomly divided into each treatment arm and received intraperitoneal injection of 100 µL of appropriate drug as outlined in Figure 3A: control (normal saline, Arm 1), decitabine (three 1 mg / kg doses given i.p. every other day on week 1 of two 3-week cycles, Arm 2), triptolide (0.2 mg / kg doses given each day for 5 days with two days’ rest each week for two 3-week cycles, Arm 3) or both (Arm 4). For analysis of systemic toxicity, mouse body weight was measured every week; whole blood samples were collected from three randomly selected mice in each group at baseline, at week 2, and at completion of treatment (week6) by submandibular bleeding. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Mouse blood samples were processed within four hours for measurement of complete blood count / hematology and clinical chemistry parameters. Lentiviral-mediated stable gene knockout pLenti-CRISPR.V2 plasmids containing DCTPP1 CRISPR guide RNA GCTTACATGTCCTCGAGCG; SEQ ID NO:1), or XPB CRISPR guide RNA (AAACGGGCGTGCACGTTCGG; SEQ ID NO:2), or non-targeting control were obtained from Genscript (Piscataway, NJ). Packaged viral particles were used to infect selected cancer cell lines using polybrene media (at a final concentration of 8 μg / mL). Transduced cells were selected by puromycin (1-2.5 μg / mL) (Sigma). Knockdown efficacy was determined by western blotting and cells were used for further studies as described. Lentiviral-mediated stable gene overexpression pLenti-6 containing DCTPP1 or XPB ORF were obtained. Packaged viral particles were used to infect selected cancer cell lines using polybrene media (at a final concentration of 8 μg / mL). Transduced cells were selected by blasticidin (5-10 μg / mL) (Sigma). Expression efficacy was determined by western blotting and cells were used for further studies as described. X-ray Crystallography Constructs and Cloning - The gene for full length human DCTPP1 was codon optimized for bacterial expression and synthesized by Twist bioscience. A slightly truncated crystallization construct comprising residues 21-130 (DCTPP1(21-130)) was designed using sequence alignments with existing crystal structures of mouse DCTPP1 (2A3Q, 2OIG). DCTPP1(21-130)was generated by PCR and subcloned into a modified pET vector containing an N-terminal hexahistadine SUMO tag using ligation independent cloning (LIC). Expression and Purification - Expression of DCTPP1(21-130)was conducted in BL21[DE]-RIL E. coli. Cells were grown in 2XTY at 37°C to OD600 of 0.5 before lowering the temperature to 18°C for 30 minutes, followed by induction with 300 μM IPTG. Cells were harvested after 16 hours at 18°C and resuspended in Buffer A (50 mM Tris-HCl (pH 7.8); 800 mM NaCl; 10% glycerol; 10 mM imidazole; 0.5 mM TCEP-HCl; 1 mM PMSF; 1 μg / mL Leupeptin; 1 μg / mL Pepstatin). Cells were lysed by sonication Attorney Docket No.44807-0477WO1 / C18163_P18163-01 and clarified by centrifugation before passing the lysate over a 5 mL HisTrap-HP column. The column was washed with 200 mL of Buffer A and eluted with 30 mL Buffer B (50 mM Tris-HCl (pH 7.8); 800 mM NaCl; 10% glycerol; 500 mM imidazole; 0.5 mM TCEP-HCl; 1 mM PMSF; 1 μg / mL Leupeptin; 1 μg / mL Pepstatin). SUMO-tagged DCTPP1(21-130)was cleaved with SENP protease and dialyzed overnight against Buffer A. Cleaved DCTPP1(21-130)was again applied to a 5 mL HisTrap-HP column and flow- through containing protein was collected and concentrated for application onto a size exclusion column. Concentrated protein was applied to a Sephacryl S-300 column pre- equilibrated in Buffer C (50 mM Tris 7.8; 500 mM NaCl; 10% glycerol; 0.5 mM TCEP). Peak fractions were pooled and concentrated to 20 mg / mL. Final glycerol concentration was brought to 30% for flash freezing and storage at -80°C. Crystallization, Data Collection and Model Building - For crystallization, DCTPP1(21-130)was dialyzed overnight against Buffer D (20 mM Tris 7.8; 500 mM NaCl; 0.5M TCEP). After dialysis, 96 μL of DCTPP1 (10mg / mL) was complexed with 4 μL triptolide (50mM in 100% DMSO) to a final concentration of 2 mM Triptolide. The DCTPP1(21-130)•triptolide complex was crystallized by hanging drop vapor diffusion. Protein and compound was mixed in a 1:1 ratio with crystallization buffer containing 100 mM Tris-HCl (pH 7.5), 8% PEG3350, and 300 mM proline and allowed to equilibrate by vapor diffusion at 20°C. Crystals were cryoprotected in crystallization buffer supplemented with 25% glycerol and 2 mM triptolide before plunge freezing in liquid nitrogen. Diffraction data were collected at NSLS-II beamline 17-ID-1 (AMX) and auto- processed using FASTDP. A molecular replacement solution was obtained by using 2OIG as a search model, stripped of ligands and waters using PHASER in the PHENIX software suite. Model building was conducted using COOT. Refinement was carried out in PHENIX and figures were generated using PYMOL. Coordinates have been deposited in the PDB (accession number 7MU5). RNAseq DU145 cells were exposed to either 2 nM triptolide alone, 33 nM decitabine alone, or both 2 nM triptolide and 3 nM decitabine once daily for 3 days, followed by 17 more days of treatment-free growth. Following this 20-day period, RNA was extracted and purified for RNA-seq using Qiagen Allprep method (Germantown, MD). Complementary DNA libraries were prepared with Illumina’s TruSeq Stranded Total RNA Sample prep and were sequenced on and Illumina HiSeq System. Reads were Attorney Docket No.44807-0477WO1 / C18163_P18163-01 aligned to the transcriptome using STAR, quantified using a gene transfer format (GTF) file containing gene models, with each model representing the structure of transcripts produced by a given gene, and normalized to transcripts per million (TPM). The significance and magnitude of differential expression between treatment groups was determined using the R package DEseq2. Heatmaps were generated using the CRAN package gplots. The Wilcoxon rank sum test was performed on the log2 fold change (DAC+TPL versus DAC) to assess whether genes upregulated by decitabine alone were enriched for further upregulation by combination treatment of decitabine and triptolide. Gene set enrichment for increased expression with treatment of DAC+TPL versus DAC was performed with GSEA against HALLMARK gene sets containing between 15 and 500 genes. HALLMARK gene sets were downloaded from gseaftp.broadinstitute.org / . The RNA-seq data are accessible at the Gene Expression Omnibus (GEO) with accession number GSE185651. Global Genomic DNA methylation assays Cells were treated with vehicle control, decitabine, triptolide or in combination for 5 days. Genomic DNA was extracted with DNeasy kit (Qiangen, Germantown, MD) according to the manufacturer’s protocol. The global DNA methylation were analyzed by direct Pyrosequencing after bisulfite conversion of DNA in EpigenDX (Hopkinton, MA). Global gene expression and methylation analysis Gene expression profiles for queried cells were analyzed using Agilent Human 44K expression arrays (Agilent Technologies, Santa Clara, CA). Data was loess- normalized to correct for dye and ratio bias at different signal intensities. Global methylation analysis was performed using the Illumina Infinium Human Methylation27 BeadChip (Illumina, Inc. San Diego, CA). Data quality was verified using in vitro methylated DNA (IVD) and DNMT1 and 3b double knock-out HCT-116 cells (DKO), which is completely depleted of methylation. Data from the above two platforms were analyzed with R and BioConductor. The Infinium EPIC DNA methylation microarray data are accessible at the Gene Expression Omnibus (GEO) with accession number GSE185651. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 Statistics Statistical analyses were performed using Prism GraphPad v 5.0 software (San Diego, CA), unless described separately above. The a priori level of significance was set at 0.05. Example 2: Sensitizing a Cancer to One or More Inhibitors of a DNMT Polypeptide A human identified as having cancer (e.g., a cancer including at least one cancer cell having an elevated level of a DCTPP1 polypeptide) is administered one or more diterpenoid epoxide compounds (e.g., triptolide). The administered one or more diterpenoid epoxide compounds can sensitize the cancer to treatment with one or more inhibitors of a DNMT polypeptide (e.g., decitabine). Example 3: Sensitizing a Cancer to One or More Inhibitors of a DNMT Polypeptide A human identified as having cancer (e.g., a cancer including at least one cancer cell having an elevated level of a DCTPP1 polypeptide) is administered one or more diterpenoid epoxide compounds (e.g., triptolide) together with one or more inhibitors of a DCTPP1 polypeptide. The administered one or more diterpenoid epoxide compounds and one or more inhibitors of a DCTPP1 polypeptide can sensitize the cancer to treatment with one or more inhibitors of a DNMT polypeptide (e.g., decitabine). Example 4: Treating Cancer A human identified as having cancer (e.g., a cancer including at least one cancer cell having an elevated level of a DCTPP1 polypeptide) is administered one or more diterpenoid epoxide compounds (e.g., triptolide). The administered one or more diterpenoid epoxide compounds can reduce the number of cancer cells present in the human. Example 5: Treating Cancer A human identified as having cancer (e.g., a cancer including at least one cancer cell having an elevated level of a DCTPP1 polypeptide) is administered one or more diterpenoid epoxide compounds (e.g., triptolide) together with one or more inhibitors of a DNMT polypeptide (e.g., decitabine). The administered one or more diterpenoid epoxide compounds and one or more inhibitors of a DNMT polypeptide can reduce the number of cancer cells present in the human. Attorney Docket No.44807-0477WO1 / C18163_P18163-01 OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.44807-0477WO1 / C18163_P18163-01 WHAT IS CLAIMED IS:

1. A method for sensitizing a cancer cell within a mammal having cancer to an inhibitor of a nucleoside DNA methyltransferase (DNMT) polypeptide, wherein said method comprises administering a diterpenoid epoxide compound to said mammal.

2. The method of claim 1, wherein said mammal is a human.

3. The method of any one of claims 1-2, wherein said cancer is selected from the group consisting of a lung cancer, a breast cancer, a melanoma, a prostate cancer, an ovarian cancer, and a leukemia.

4. The method of any one of claims 1-3, wherein said inhibitor of said DNMT polypeptide is selected from the group consisting of decitabine, azacitidine, guadecitabine, cedazuridine, ASTX 727, 5-fluoro-cytosine, 5-fluoro-deoxycytidine, and zebularine.

5. The method of any one of claims 1-3, wherein said diterpenoid epoxide compound is selected from the group consisting of triptolide, TPL-2004, TPL-2005, TPL-2015, TPL-2021, TPL-2024, glutriptolide, triptonide, and tripterygium glycosides.

6. The method of any one of claims 1-3, wherein said diterpenoid epoxide compound has a structure set forth in any one of compounds 1-18.

7. The method of any one of claims 1-3, wherein said diterpenoid epoxide compound inhibits a deoxycytidine triphosphate (dCTP) pyrophosphatase 1 (DCTPP1) polypeptide and / or an XPB polypeptide.

8. The method of any one of claims 1-3, wherein said inhibitor of said DNMT polypeptide is decitabine and said diterpenoid epoxide compound is triptolide.Attorney Docket No.44807-0477WO1 / C18163_P18163-01 9. The method of any one of claims 1-8, wherein said cancer cell comprises an elevated level of a deoxycytidine triphosphate (dCTP) pyrophosphatase 1 (DCTPP1) polypeptide.

10. The method of claim 8 or claim 9, wherein said method further comprises administering an inhibitor of said DCTPP1 polypeptide to said mammal.

11. A method for treating a mammal having cancer, wherein said method comprises administering, to said mammal: (a) an inhibitor of a nucleoside DNA methyltransferase (DNMT) polypeptide; and (b) a diterpenoid epoxide compound.

12. A method for treating a mammal having a cancer identified as having at least one cancer cell comprising an elevated level of a DCTPP1 polypeptide, wherein said method comprises administering to said mammal: (a) an inhibitor of a nucleoside DNA methyltransferase (DNMT) polypeptide; and (b) a diterpenoid epoxide compound.

13. The method of claim 12, wherein said method further comprises administering an inhibitor of said DCTPP1 polypeptide to said mammal.

14. The method of any one of claims 11-13, wherein said mammal is a human.

15. The method of any one of claims 11-14, wherein said cancer is selected from the group consisting of a lung cancer, a breast cancer, a melanoma, a prostate cancer, an ovarian cancer, and a leukemia.

16. The method of any one of claims 11-15, wherein said inhibitor of said DNMT polypeptide is selected from the group consisting of decitabine, azacitidine, guadecitabine, cedazuridine, ASTX 727, 5-fluoro-cytosine, 5-fluoro-deoxycytidine, and zebularine.Attorney Docket No.44807-0477WO1 / C18163_P18163-01 17. The method of any one of claims 11-15, wherein said diterpenoid epoxide compound is selected from the group consisting of triptolide, TPL-2004, TPL-2005, TPL-2015, TPL- 2021, TPL-2024, glutriptolide, triptonide, and tripterygium glycosides.

18. The method of any one of claims 11-15, wherein said diterpenoid epoxide compound has a structure set forth in any one of compounds 1-18.

19. The method of any one of claims 11-15, wherein said diterpenoid epoxide compound inhibits a DCTPP1 polypeptide and / or an XPB polypeptide.

20. The method of any one of claims 11-15, wherein said inhibitor of said DNMT polypeptide is decitabine and said diterpenoid epoxide compound is triptolide.

Citation Information

Patent Citations

  • Antioxidant, Anti-inflammatory and anticancer derivatives of triptolide and nanospheres thereof

    US20160115192A1

  • Heterocyclic compounds as dctpp1 modulators

    US20170305893A1