A system and method for cell-free unnatural amino acid incorporation

The Nicotiana tabacum-derived cell-free translation system addresses the limitations of existing systems by enabling high-yield, site-specific unnatural amino acid incorporation and posttranslational modifications, facilitating complex protein synthesis with enhanced functional properties.

WO2025176699A1PCT designated stage Publication Date: 2025-08-28LENIOBIO GMBH
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/054394
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-20
Filing Date
2025-02-19
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Existing eukaryotic cell-free systems lack the ability to incorporate unnatural amino acids while ensuring high-yield protein synthesis, particularly for complex proteins, and do not provide appropriate posttranslational modifications necessary for proper protein function.

Method used

A novel eukaryotic cell-free translation system derived from Nicotiana tabacum (BY-2 cell line) that incorporates unnatural amino acids into predetermined positions of proteins, enabling posttranslational modifications such as glycosylation and correct folding, using the amber suppression method with a suppressor tRNA and aminoacyl transferase.

Benefits of technology

The system achieves high-yield, site-specific incorporation of unnatural amino acids into proteins, allowing for complex protein synthesis with functional posttranslational modifications, enhancing protein properties for applications like targeted drug delivery and vaccine development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025054394_28082025_PF_FP_ABST
    Figure EP2025054394_28082025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of protein synthesis, e.g. of complex proteins and human proteins. It provides a new artificial eukaryotic cell-free translation system suitable for the incorporation of at least one or more unnatural amino acids (uaa) in predetermined positions of an artificial protein. A method for a cell-free manufacture of the artificial protein comprising one or more uaas in predetermined positions of the artificial protein is also provided. The system, a cell-free system, a kit and nucleic acid constructs are provided and are for use in said method. The advantage of the present invention is that the method allows manipulation of any desired protein by incorporation of one or more uaas. Further, the method and / or the achieved artificial protein is suitable to be combined with a linking reaction to link the artificial protein, e.g. to virus like particles or another molecule.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] A system and method for cell-free unnatural amino acid incorporation

[0002] The present invention relates to the technical field of protein synthesis, e.g. of complex proteins and human proteins. It provides a new artificial eukaryotic cell-free translation system suitable for the incorporation of at least one or more unnatural amino acids (uaa) in predetermined positions of an artificial protein. A method for a cell-free manufacture of the artificial protein comprising one or more uaas in predetermined positions of the artificial protein is also provided. The system, a cell-free system, a kit and nucleic acid constructs are provided and are for use in said method. The advantage of the present invention is that the method allows manipulation of any desired protein by incorporation of one or more uaas. Further, the method and / or the achieved artificial protein is suitable to be combined with a linking reaction to link the artificial protein, e.g. to virus like particles or another molecule.

[0003] Prior art

[0004] In the prior art different systems for incorporation of unnatural amino acids are disclosed. W02005003294A3 / US7888063B2 discloses methods for producing and compositions of orthogonal tRNAs, orthogonal synthetases (synonym aminoacyl-transferase) and pairs thereof, in eukaryotic cells, and discloses the use in eukaryotic protein biosynthetic machinery to incorporate an unnatural amino acid in a nascent polypeptide. A eukaryotic cell of US7888063B2 generally refers to mammalian cells, yeast cells, fungus cells, algae cells, plant cells, insect cells and the translation components can be derived from a variety of organisms, e.g., non-eukaryotic organisms. EP2796546B1 discloses E. coli cell extracts which is capable of site-specific incorporation of an unnatural amino acid into a protein produced in the cell extract. The cell extract comprises a transfer RNA that is specific for a non-sense codon, a mutant and selective aminoacyl-tRNA synthetase that is capable of amino-acylating the tRNA with the unnatural amino acid and a desired unnatural amino acid. The nonsense codon is a stop codon (TAG), or a four base codon, or an amber codon. As eukaryotic cell mammalian cells, yeast cells, fungus cells, algae cells, plant cells and insect cells are disclosed. Similar teaching is disclosed in EP2155890A1 . In all prior art documents, the plant cells are not further defined neither a suitable plant family nor a plant genus is indicated for a plant based translation system. No cell extract from a plant of the family Solanaceae, in particular the genus Nicotiana, are disclosed. In consequence no translation systems derived from a plant, in particular from the family Solanaceae or from the genus Nicotiana of the family Solanaceae neither indicated nor disclosed.

[0005] W02015006555A2 discloses the use of a cell free extract of E. coli for the synthesis of antibodies and incorporation of at least one unnatural amino acid. However, prokaryotic cell- free systems have the disadvantage that posttranslational modification, such as glycosylation is missing which is an important modification of complex proteins such as antigens to ensure the desired function. This problem is solved by the present invention wherein both, incorporation of at least one or more uaas into a nascent polypeptide and posttranslational modification of the artificial protein are ensured.

[0006] WO2010081 110A1 a wheat germ lysate which is further optimized by the addition of an energy generating system and then used for incorporating non-native amino acids into preselected positions of a protein using said cell-free synthesis system. Quast et al discloses eukaryotic cell-free systems based on wheat germ and Spodoptera frugiperda insect cells wherein an orthogonal amber suppressor tRNA-synthetase pair is used for protein synthesis with a site- specifically incorporated p-azido-l-phenylalanine residue in order to provide their chemo- selective fluorescence labeling with azide-reactive dyes by Staudinger ligation. However, in both there is no indication to an extract from a plant of the family Solanaceae, in particular of the genus Nicotiana, nor an indication of a standardized eukaryotic cell-free systems like the BY-2 cell-free lysate.

[0007] In summary, prior art describes the use of the E. coli tyrosyl transferase system to incorporate unnatural amino acids in living yeast cells and in wheat germ extracts as eukaryotic cell-free systems. However, there is no eukaryotic cell-free system that allows incorporation of uaa and at the same time allows high yield protein synthesis of any desired proteins, in particular of complex proteins. The invention provides tools and systems required for the unnatural amino acid incorporation into expressed proteins based on BY-2 cell-free lysate (ALiCE®, LenioBio GmbH, DE). The advantage at least is that already established plasmids are suitable for the expression of artificial proteins. For example the production of virus-like particle vaccines is rapidly adaptable to new pathogenic threats using a common particle and changing the antigen to be displayed, post translationally binding it to VLP via the unnatural amino acid. This approach has the added advantage that it imposes lower constraints to antigen design, as the virus-like particle is pre-assembled, thus allowing more complex antigens to be displayed, which in turn can generate vaccines with increased immunogenicity potential. Lastly, the production of ADCs in ALiCE® would also be permitted by the expression of the antibodies including the unnatural amino acid required for drug binding.

[0008] There is a need of eukaryotic cell-free systems for the expression of human proteins and complex proteins, respectively, with an appropriate posttranslational modification and / or with a correct folding and at the same time of a systems that allows incorporation of unnatural amino acids. Lack of the necessary posttranslational modifications might render a recombinant protein inactive, and thus, eukaryotic cell-free systems with the capability of performing posttranslational modifications are required for proper protein function alongside the incorporation of unnatural amino acids.

[0009] The introduction of non-canonical amino acids into proteins confers to proteins with additional properties (synonym “function” according to the present invention) that either enhance or modify their uses in pharmacological, structural and other applications. For instance, antibodies including unnatural amino acids can be used in targeted drug delivery against cancerous cells. Additionally, uaa-modified proteins (synonym “artificial protein” as defined herein) can be post-translationally modified (function), in order to specifically attach different active groups, such as phosphorylation, glycosylation and other proteins. The use of this technology in vaccinology would allow the use of a common virus-like particle scaffold to which antigens could be post translationally attached - via the linking reaction according to the present invention - with considerably lower size and shape limitations than when applying protein fusion.

[0010] The recombinant production of proteins combining natural / canonical and unnatural / non- canonical amino acids has opened a new scope of possibilities regarding protein use as pharmaceuticals and industrial processes. These recombinant proteins can be engineered to enhance or modify their functionality, thus providing even a further range of possible products. One of such engineering approaches involves the incorporation of unnatural / non-canonical amino acids. Non-canonical amino acids are synthetic structures that resemble amino acids, but that have been specifically modified in order to provide special functions to the recombinant protein in which they are incorporated. Such modifications include the addition of specific reactive handles, fluorescent dyes and stabilizing groups, between others. Uaa-modified proteins can be used to covalently attach other molecules to proteins, study protein-protein interactions and to provide enhanced stability or activity to specific enzymes. Therefore, providing a high-yielding and cost-effective path to drive the incorporation of unnatural amino acids into recombinant (artificial) proteins by ALiCE® would pose a great opportunity for the skilled person.

[0011] The inventive cell-free protein synthesis (CFPS) systems, preferably ALiCE® (LenioBio GmbH, DE) excel at the incorporation of unnatural amino acids into proteins of interest, given the lack of a cell-membrane and wall preventing the passage of the unnatural amino acid and other necessary components. There are different methods that can be used in order to drive unnatural amino acid incorporation CFPS systems: global suppression, amber suppression, sense codon reassignment, tetra-codons and the use of unnatural base pairs. From these approaches, the amber suppression is one of the most promising, as it allows the site-specific introduction of uaa into the protein. Additionally, the CFPS of the present invention presents higher yields and lower complexity than the other approaches of the prior art. The ambersuppression approach relies on the use of a protein coding sequence containing an amber stop codon (TAG), a suppressor tRNA that codes for that amber codon and an aminoacyl transferase capable of transferring the unnatural amino acid into the tRNA (Figure 1 , A). In ideal conditions, the aminoacyl transferase binds the unnatural amino acid to the tRNA, which can then be used in protein translation to incorporate the unnatural amino acid in the amber codon site. In this manner, the protein of interest is fully translated only if the unnatural amino acid is successfully incorporated (Figure 1 , B).

[0012] Thus, the object of the present invention is to overcome the limitation of the prior art cell-free systems described above and the limitation to provide artificial proteins of the desired amino acid sequence and with the desired function. It is further an object of the present invention to provide a novel and easy handling method as well as a system and kit for use in said method for the manufacture of artificial proteins. Another object is to provide a system that is suitable for the expression of the components that a part of the translations system for the manufacture of the artificial protein. To provide a flexible and modular system and method for the manufacture of an artificial protein and for the manufacture of the components used in the manufacture of an artificial protein is another object of the present invention. Another object is to overcome the limitation on other CFPS systems regarding the production of complex proteins comprising at least one uaa that require posttranslational modifications or complex folding and to overcome the limitation on other CFPS systems that require supplements to enable posttranslational modification and / or artificial components to enable complex folding. It is also an object of the present invention to provide those who are familiar with the cell-free lysate of BY-2 a novel expansion of uses of the cell-lysate.

[0013] The object of the present invention is solved by the inventive method as described in claim 1 and herein for a cell-free manufacture of an artificial protein suitable for incorporation of unnatural amino acid (uaa) in any desired protein, preferably into complex human proteins using the artificial eukaryotic cell-free translation system, preferably derived from N. tabacum. Embodiments of the invention are disclosed in detail in the dependent claims and in the description. The advantage of said system and method is that it allows posttranslational modification of the achieved protein, in particular of the achieved artificial protein. The invention is described in detail below. The first aspect of the present invention is a method for a cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein, preferably the method is performed by means of a cell-free lysate derived from a BY-2 cell line as defined herein, the method comprises: transcription, preferably by means of a suitable protein machinery, more preferably by means of a cell-free lysate of BY-2 comprising a suitable protein machinery, of a nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position, translation of a transcribed mRNA sequence into a nascent polypeptide, comprising i) incorporation of the at least one uaa into the nascent polypeptide at the predetermined position encoded by the at least one non-sense codon, most preferably by means of the E. coli tyrosyl transferase system, wherein

[0014] • a suppressor transfer RNA (tRNA) carrying the uaa specifically interacts with the at least one non-sense codon of the mRNA sequence, in particular the uaa is chemically linked to the suppressor tRNA, and

[0015] • a site-specific incorporation of the uaa into the nascent polypeptide at the position encoded by the at least one non-sense codon in the mRNA occurs, and achieving the artificial protein comprising the at least one uaa in the at least one predetermined position of the artificial protein.

[0016] The technical effect of the method, tools and system of the present invention is that the cell- free protein synthesis system excels at the incorporation of unnatural amino acids (uaas) into proteins of interest, given the lack of a cell-membrane and wall preventing the passage of the uaa and other necessary components. There are different methods that can be used in order to drive uaa incorporation CFPS systems: global suppression, amber suppression, sense codon reassignment, tetra-codons and the use of unnatural base pairs. All these approaches are feasible within the meaning of the present invention. The amber suppression is one of the most promising, as it allows the site-specific introduction of uaa into the nascent poly peptide and presents higher yields and lower complexity than the other approaches. Especially, in BY- 2 derived cell lysates, higher yields of artificial proteins, or complex artificial proteins is achieved. The amber-suppression approach relies on the use of a protein coding sequence containing an amber stop codon (TAG), a suppressor tRNA that codes for that amber codon and an aminoacyl transferase capable of transferring the uaa into the tRNA (Fig. 1 , A). In ideal conditions, the aminoacyl-transferase binds the uaa to the tRNA, which can then be used in protein translation to incorporate the uaa in the amber codon site. In this manner, the protein of interest is fully translated only if the uaa is successfully incorporated (Fig. 1 , B). That is achieved by the tools, system and method of the present invention. The technical effect of the present invention is the higher yield of desired artificial proteins, wherein those are posttranslational modified and if necessary, are folded in a correct manner. That is enabled by the tools, system and method of the present invention.

[0017] Different methods exist to bring together all the necessary components for uaa incorporation according to the present invention. For example, the synthetase could be co-expressed together with the artificial protein, or its expression could be induced prior to the production of the cell-free lysate. Other possibility entails the exogenous expression and purification of the synthetase, later to be introduced into the expression reaction. For the tRNA addition, an in vitro transcription and purification of the tRNA is usually performed, although direct production in the cell-free reaction is possible by using a DNA template, preferably a short PCR template, that is directly transcribed and turned into the tRNA in coupled cell-free reactions as described in more detail later.

[0018] The method of the present invention is an in-vitro method for a cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein. The same applies for all embodiment of the method.

[0019] The achieved artificial protein comprise at least two uaa, at least three uaa, at least four uaa, at least five or more uaas.

[0020] In another aspect of the method according to the present invention the at least one uaa is chemically linked to the suppressor tRNA. Preferably according to this embodiment the suppressor tRNA carrying the chemically linked uaa is added to the method of the present invention as a component to the reaction mixture.

[0021] Thus, the method may further comprise a step of providing a reaction mixture comprising

[0022] - at least a sufficient amount of a cell-free lysate comprising a suitable protein machinery.

[0023] - a sufficient amount of the suppressor tRNA carrying chemically linked uaa and

[0024] - a sufficient amount of the target - as defined herein -

[0025] A protein machinery is suitable within the meaning of the present invention to achieve the desired artificial protein. Where the desired artificial protein needs posttranslational modification, protein folding and / or membrane anchoring, a cell-free lysate comprising microsomes is provided, preferably derived from a plant, N. tabacum from the cell line BY-2. In another embodiment of the method of the present invention a step of ii) transferring the at least one uaa to the suppressor tRNA by means of an aminoacyl transferase or by a flexizyme is performed, more preferably it is a E. coli derived transferase, most preferably a E. coli tyrosyl transferase or a his-tagged E. coli tyrosyl transferase. Suitable flexizymes and the approach (see section 3.2.1 ) are disclosed in Cui et al 2020. It is preferred that this step is performed in a cell-free lysate derived from a plant, a plant of the genus Nicotiana of the family Solanaceae, preferably the plant is N. tabacum, most from a BY-2 cell line from N. tabacum, as defined herein. Preferably, the aminoacyl transferase specifically binds to the at least one uaa and transfers it to the suppressor tRNA and achieving a suppressor tRNA carrying the uaa. Thus, either suppressor tRNA carrying chemically linked uaa is provided (ready for use) or the suppressor tRNA and the desired uaa are provided as separate components. The aminoacyl transferase transfers the uaa to the suppressor tRNA. In this embodiment of the method a reaction mixture is provided comprising

[0026] - at least a sufficient amount of a cell-free lysate comprising a suitable protein machinery.

[0027] - a sufficient amount of the aminoacyl transferase

[0028] - a sufficient amount of the suppressor tRNA

[0029] - a sufficient amount of the desired uaa and

[0030] - a sufficient amount of the target - as defined herein -

[0031] In the method according to the represent invention, the aminoacyl transferase is derived from Escherichia coli, Methanosarcina mazei, Methanosarcina barkeri or Methanococcus jannaschii, is an isolated aminoacyl transferase and / or a genetically modified aminoacyl transferase derived from Escherichia coli, Methanosarcina mazei, Methanosarcina barkeri or Methanococcus jannaschii. Preferably, the aminoacyl transferase is derived from Methanosarcina mazei, Methanosarcina barkeri or Methanococcus jannaschii or Escherichia coli, which has been isolated and genetically modified. Suitable transferases are disclosed in US7888063B2 and those disclosed therein have been used according to the present invention. More preferably, a E. coli derived transferase, most preferably a E. coli tyrosyl transferase or a his-tagged E. coli tyrosyl transferase is used. In a preferred embodiment an E. coli tyrosyl transferase system is used comprising an E. coli tyrosyl transferase and thereto suited tRNA.

[0032] Another aspect of the present invention is a reaction mixture comprising at least a cell-free lysate comprising a suitable protein machinery, preferably a eukaryotic cell free lysate comprising a suitable protein machinery, at least a BY-2 lysate, an aminoacyl transferase suitable to transfer the desired uaa to the respective suppressor tRNA, preferably it is a E. coli tyrosyl transferase, more preferably a E. coli derived tyrosyl transferase, most preferably a his-tagged E. coli tyrosyl transferase, at least one suppressor tRNA specific for the respective desired uaa, and at least one desired uaa or more desired uaas.

[0033] In a further aspect of any embodiment of the method according to the present invention, the non-sense codon is a stop codon, a four base codon, a re-assigned sense codon, an unnatural base pair or an amber codon. Preferably, in the method the target template is a nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one or more amber codons in at least one or more predetermined position. Preferably, the amber codon is TAG or UAG.

[0034] In a preferred embodiment the method of the present invention the manufacture of the artificial protein is performed by means of a protein machinery derived from a eukaryotic species, preferably from a plant. More preferably, the cell-free manufacture is performed with a cell-free lysate comprising a protein machinery derived from a non-human eukaryotic species, preferably from a plant. More preferably, the -free manufacture method of the present is performed with a cell-free lysate comprising a protein machinery derived from a plant, preferably from a plant of the genus Nicotiana of the family Solanaceae, most preferably the plant is N. tabacum, most preferably a BY-2 cell line from N. tabacum. In particular the cell- free manufacture takes place in a cell-free lysate comprising a protein machinery derived from a non-human eukaryotic species, preferably from a plant, more preferably from a plant of the genus Nicotiana of the family Solanaceae, preferably the plant is N. tabacum, most preferably a BY-2 cell line from N. tabacum.

[0035] In a preferred embodiment of the method of the present invention, the cell-free manufacture of the artificial protein is performed by means of BY-2 cell line derived lysate and the step of translation is performed by means of a mixed eukaryotic cell-free translation system comprising the eukaryotic cell-free translation system for natural amino acid incorporation as part of the BY-2 lysate and the artificial translation system for incorporation of the unnatural amino acid as defined herein, preferably an E. coli tyrosyl transferase system. Any embodiments and aspects defined herein, are also applicable to the embodiment with an E. coli transferase system or E. coli tyrosyl transferase system.

[0036] It is a preferred embodiment of the present invention that the manufacture of the artificial protein is performed by means of a protein machinery derived from an eukaryotic species, preferably from a plant as disclosed in WO2018148530A1 that enables in vitro synthesis of an artificial protein, as defined herein, wherein the cell-free lysate mitochondria and / or chloroplasts, wherein creatine phosphate and creatine kinase are not added to the reaction to provide artificial energy regeneration. Thus, it is preferred that any aspect and any embodiment of the present invention is suitable to manufacture any desired artificial protein without the need of supplementation with artificial energy regeneration.

[0037] It is preferred that in the method according to the present invention a step of post-translational modification of the nascent polypeptide or / and of the achieved artificial protein is performed. Post-translational modification of the nascent polypeptide of the artificial protein occurs while it is translated and translocated into the ER / microsomes and / or after complete expression of the achieved artificial protein . Posttranslational modification within the meaning of the present invention comprises: glycosylation, phosphorylation (mostly at serine, tyrosine and / or threonine) hydroxylation, acetylation, acylation, adenylation, methylation, carboxylation, formation of disulfide bonds (Cys-Cys), formation of Lys-Cys bonds, ubiquitination, SUMOylation, neddylation, ISGylation, deamination, biotinylation, succinylation, sulfation and more and any combination thereof. More preferably, posttranslational modification comprises glycosylation, phosphorylation, hydroxylation, methylation, carboxylation or any combination thereof. Most preferably posttranslational modification at least comprises glycosylation.

[0038] For this embodiment, the cell-free lysate comprise microsomes, more preferably endogenous microsomes.

[0039] The method of the present invention is preferably performed by means of a cell-free lysate comprises endogenous mitochondria and / or microsomes. Alternatively, for the method any cell-free lysate comprising a protein machinery is supplemented with mitochondria and / or microsomes from a plant, preferably from a plant of the genus Nicotiana of the family Solanaceae, most preferably the plant is N. tabacum, most preferably a BY-2 cell line from N. tabacum. In a preferred embodiment of the method of the present invention, a step of coupled transcription and co-translational translocation of the nascent polypeptide into a microsome is performed. In one embodiment the polypeptide is a membrane protein comprising at least one transmembrane domain.

[0040] The method of the present invention for the manufacture of an artificial protein comprising at least one uaa, comprising the steps: providing a cell-free lysate suitable for protein synthesis, either comprising a translation system capable of incorporation of at least one uaa into a predetermined amino acid sequence of a protein or a translation system capable of incorporation of at least one uaa into a predetermined amino acid sequence of a protein is provided separately and added to the cell-free lysate suitable for protein synthesis, wherein the translation system comprises a suppressor transfer RNA (tRNA) that specifically recognizes a non-sense codon, at least one uaa either chemically linked to the suppressor tRNA or at least one uaa and an aminoacyl transferase capable of transferring the at least one uaa to the suppressor tRNA, preferably it is a E. coli tyrosyl transferase, more preferably a E. coli derived tyrosyl transferase, most preferably a his-tagged E. coli tyrosyl transferase, and providing at least one target template comprising a sequence encoding for at least one non-sense codon and encoding for a predetermined amino acid sequence of a protein.

[0041] The method of the present invention is suitable for co-transcription of different molecules within the same reaction mixture while the same reaction run. In an embodiment of the method of the present invention, co-transcription is performed a) of the nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position, b) of the nucleic acid sequence encoding for the aminoacyl transferase, preferably it is a

[0042] E. coli tyrosyl transferase, more preferably a E. coli derived tyrosyl transferase, most preferably a his-tagged E. coli tyrosyl transferase, and / or c) of the nucleic acid sequence encoding for the suppressor tRNA or co-transcription of any combination of a), b) and c) is performed.

[0043] The co-transcription as described herein may be followed by co-transcription as described herein in any combination.

[0044] It is further possible translation of different molecules within the same reaction mixture while the same reaction run. In an embodiment of the method of the present invention, co-translation is performed a) of the mRNA that encodes for a predetermined amino acid sequence comprising the at least one non-sense codon (Target) and b) of the mRNA that encodes for the aminoacyl transferase.

[0045] In another embodiment of the method according to the present the expression of the aminoacyl transferase, in particular transcription of the nucleic acid followed by translation, is performed a) simultaneously with the cell-free manufacture of the artificial protein within one reaction mixture, in particular resulting in aminoacyl transferase immediately available within the reaction mixture wherein the claimed method is performed or b) within a spatially and temporally independent expression step, preferably by means of a cell-free manufacture method according to the present invention, and subsequently the achieved tRNA transferase is added to the cell-free manufacture of the artificial protein, or c) the tRNA transferase is added as an active component to the cell-free manufacture of the artificial protein.

[0046] Preferably it is a E. coli tyrosyl transferase, more preferably a E. coli derived tyrosyl transferase, most preferably a his-tagged E. coli tyrosyl transferase.

[0047] In an embodiment of the method of the present invention, the co-transcription of the c) suppressor tRNA is performed simultaneously while cell-free manufacture of a) the artificial protein and / or b) of the aminoacyl transferase within the one reaction mixture or the suppressor tRNA, preferably already carrying the chemically linked desired uaa, is added as a component to the method of cell-free manufacture of the artificial protein. Preferably, it is added to the reaction mixture. The respective mRNA can be added at any timepoint of the inventive method, the transcription of the suppressor tRNA and / or aminoacyl transferase can be performed in- vitro in a separate cell-free lysate according to the present invention or in another suitable system or method for transcription. Finally, the present invention encompasses the following combinations:

[0048] Table 1 essential components of the present invention and its alternative forms

[0049] The transcription of tRNA transferase and tRNA can be performed in any other method suitable to synthesize the desired aminoacyl transferase and tRNA. The translation of aminoacyl transferase can be performed in any other method suitable to synthesize said transferase.

[0050] The most important features in order to be able to reproduce the present invention are the provision and production of the different components and their use within a cell-free protein synthesis system (CFPS), preferably within ALiCE®. The aminoacyl transferase has to be produced by adding the plasmid coding for the desired tRNA aminoacyl synthetase (aminoacyl transferase), most preferably for a his-tagged E. coll tyrosyl transferase in the CFPS, such as ALICE®, as described by the manufacturer. After the expression, the aminoacyl transferase is preferably purified by Ni-NTA purification (see also example 2.2), and then concentrated in an appropriate storage buffer and stored at -80 until further use. The tRNA template is generated via PCR amplification of a nucleic acid sequence containing a T7 promoter, a hammerhead ribozyme sequence and the tyrosine tRNA sequence, preferably the E. coli tyrosine tRNA sequence as described in detail below. Primers must be used with a modification suitable to prevent exonuclease activity, preferably the primers have PTO modifications that are used to prevent degradation by exonucleases. The skilled person has the knowledge of suitable and to PTO alternative modifications of primers to prevent exonucleases. The Rv primer must contain a methoxy modification in the second to last nucleotide as to ensure proper tRNA length. After the PCR, the product is purified and stored at -20°C. The unnatural amino acid must be solubilized in an adequate buffer. An adequate buffer e.g. includes 20% DMSO as to ensure proper solubilization, and then stored at -80°C until use. A full overview of all sequences used in the examples is shown in table 3.

[0051] In another embodiment of the present invention, the method - and any embodiment described herein -, in particular is suitable for and comprises a coupled transcription and co-translational translocation of the at least one artificial protein as defined herein and preferably of any artificial protein with the need of posttranslational modification. This is achieved by the use of the artificial eukaryotic cell-free translation system of the present invention, preferably derived from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum, most preferably derived from the BY-2 cell line as defined herein. Preferably a mixed translation system is used in the method of the present invention comprising the eukaryotic cell-free translation system for natural amino acid incorporation as part of the BY-2 lysate and the artificial translation system for incorporation of the unnatural amino acid as defined herein, preferably an E. coli tyrosyl transferase system. Any embodiments and aspects defined herein, are also applicable to this embodiment.

[0052] A preferred aspect of the present invention is the combination of the method - and any embodiment described herein - for the manufacture of an artificial protein as described therein and of the co-translational translocation of the nascent polypeptide of the artificial protein, including posttranslational modification such as glycosylation, and / or protein folding, and nonsense codon based incorporation of at least one uaa into the nascent polypeptide by means of the cell-free system or the artificial eukaryotic cell-free translation system of the present invention. Preferably by the mixed translation system as defined herein. All embodiments of artificial eukaryotic cell-free translation system and cell-free system applies accordingly, to this aspect of the present invention. More precisely, in this aspect of the present invention, the method for a cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein, comprises the steps: transcription, preferably by means of a suitable protein machinery, more preferably by means of a cell-free lysate of BY-2, of a nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position, wherein the transcription is a coupled transcription and co-translational translocation of the at least one artificial protein into an endoplasmic reticulum or golgi-derived microsome, where posttranslational modifications and folding of complex proteins can occur. co-translational translocation of a nascent polypeptide comprising the at least one uaa into the microsome, comprising i) incorporation of the at least one uaa into the nascent polypeptide at the predetermined position encoded by the at least one non-sense codon, wherein

[0053] • a suppressor transfer RNA (tRNA) carrying the uaa specifically interacts with the at least one non-sense codon of the mRNA sequence, in particular the uaa is chemically linked to the suppressor tRNA, and

[0054] • a site-specific incorporation of the uaa into the nascent polypeptide at the position encoded by the at least one non-sense codon in the mRNA occurs, and ii) wherein the artificial protein is translocated into the microsomes of the cell-free lysate, preferably translocation is mediated by a signal peptide that is suitable to mediate the translocation of the artificial protein into the microsome, and achieving the artificial protein comprising the at least one uaa in the at least one predetermined position of the artificial protein.

[0055] The method combining both as described above is an in-vitro method for a cell-free manufacture of an artificial protein and co-translational translocation. The same applies for all embodiments.

[0056] In this aspect of the present invention the combined method is performed by means of a protein machinery derived from a eukaryotic species, preferably from a plant as disclosed in WO2018148530A1 that enables in vitro synthesis of an artificial protein, as defined herein, wherein the cell-free lysate comprises mitochondria and / or chloroplasts, wherein creatine phosphate and creatine kinase are not added to the reaction to provide artificial energy regeneration. Thus, it is preferred that any aspect and any embodiment of the present invention is suitable to manufacture any desired artificial protein without the need of supplementation with artificial energy regeneration. The cell-free lysate is derived from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum, most preferably derived from the BY-2 cell line as defined herein.

[0057] The method of co-translational translocation of the artificial protein and incorporation of at least one uaa is preferred for complex proteins comprising proteins comprising at least one or more subunits, membrane proteins, transmembrane proteins and pos-translationally modified proteins, e.g. receptor binding domain from SarsCov-2 (RBD).

[0058] In a preferred embodiment of the method of the present invention, the at least one uaa comprises a functional group conferring a predetermined function to the artificial protein. Preferably, the predetermined function of the at least one uaa comprises fluorescence, takes part in post-translational modification, in stabilization of the artificial protein, in bioorthogonal chemistry reactions and / or takes part in chemical linking reactions according to the present invention (e. g. Copper-catalyzed azide-alkyne cycloaddition (CuAAC), photoclick, Strain- promoted azide-alkyne cycloaddition (SPAAC), an inverse electron demand Diels-Alder (IEDDA) reaction). More preferably, the predetermined function of the at least one uaa is mediated by a modification comprising a fluorophore, a hapten of a hapten pair, a phosphorylgroup, a hydroxy-group, a methyl-group, a sugar-residue, a reactive chemical group (synonym: reactive group) comprising acidic groups, hydrophobic groups, nucleophilic groups, azido residues, alkyne residues, an alkyl-groups, alkyno groups, alkene groups, photocaged or photo-switchable groups or any combination thereof. In one embodiment the predetermined function is mediated by a reactive chemical group of the at least uaa enabling the linking reaction according to the present invention.

[0059] For a later linking reaction - as described herein - uaa comprising azido residues and / or alkyne residues are preferred. In context of this embodiment of the inventive method at least one or more uaa comprising azido residues and / or alkyne residues are added to the reaction mixture for incorporation in a predetermined position of artificial protein in the method according to the present invention.

[0060] In the method of the present invention the unnatural amino acid encompasses derivates and analogue of any of the common twenty amino acids, derivates and analogue of Methionine, tyrosine, phenylalanine, leucine, glycine, lysine, pyrrolysine, serine, Triptophan, proline, phenylalanine, and comprises uaa such as azido phenylalanine, 3-iodo-L-tyrosine, O-methyl- L-tyrosine, a paraacyl-L-phenylalanine, or a para-azido-L-phenylalanine, beO-Propargyl-L- tyrosine, 4-azidomethyl-L-phenylalanine, O-2-azidoethyl-tyrosine, 4-Azido-L-phenylalanine, 6-azidohexanoic acid, N-E-[(2-azidoethoxy)carbonyl]- L-Lysine and 2-amino-hexanoic acid preferably, the uaa is selected from O-Propargyl-L-tyrosine and 4-Azido-L-phenylalanine. Suitable unnatural amino acids (uuas) are disclosed in EP2796546B1 (see e.g. Fig. 16, 17, 18 und 19) as well as aminoacyl-tRNA synthetases (EP2796546B1 , whole disclosure) Suitable unnatural amino acids, aminoacyl-tRNA synthetases and suitable pairs are also disclosed in Krahn et al 2020 and Kiga et al. 2002. Those are also suitable within the meaning of the present invention for incorporation in the method for a cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) by means of a cell-free system, preferably by means of a eukaryotic cell free system, most preferably derive from a N. tabacum plant, from a BY-2 cell line.

[0061] In a further aspect of the method according to the present invention, the artificial protein is a soluble protein, soluble linear protein, soluble three-dimensional protein, membrane protein, receptor binding domain, peplomer, glycoprotein, Spike-Protein, protein based immunomodulating molecule, transmembrane protein, an antibody, an antibody fragment, fc fragment, fab fragment, receptors, an antigen, an antigen binding domain, an extracellular domain of an antigen, an epitope domain, or any other polypeptide, respectively comprising at least one unnatural amino acid at a predetermined position.

[0062] The present method is suitable for the manufacture of any desired natural antibody and antigen in which at least one uaa or more are desired to be incorporated. An antibody within the meaning of the present invention comprises antibodies for the treatment of auto-immune and cancerous diseases, e.g. antibodies targeting the antigens CD20, CD3, CD22, CD33, CD123 and CD19. Accordingly, the antibodies and respective antigens are also proteins according to the present invention. Further examples of antibodies and antigens are disclosed in W02015006555A2. Those, disclosed therein can also be manufactured by the method and the system of the present invention, wherein the present invention ensures posttranslational modification and in particular for the antigens, correct folding by anchoring the antigen within the membrane of the microsomes of the cell-free system according to the present invention.

[0063] Another object of the present invention is to provide a cell-free manufacture of artificial proteins for linking said artificial proteins with other molecules. It is further an object of the present invention to provide a tool and method for linking the artificial protein with another molecule. More precisely it is an object of the present invention to enable linking of at least two artificial proteins, produced by the inventive method, to each other via their uaas. Thus, it is a further object of the present invention to provide conjugates comprising artificial proteins and conjugates of artificial proteins. It is an object to provide a method for cell-free manufacture of modified antibodies and engineered VLPs which are artificial proteins within the meaning of the present invention and a method or step for the manufacture of antibody drug conjugated (ADC) and VLPs, respectively comprising said artificial proteins. It is a further object to provide VLPs with increased immunogenicity potential for vaccination. To provide a tool box for the manipulation of any desired protein and linking it with any desired other molecule or protein is also an object of the present invention.

[0064] The first part of the solution is the method as described above and the second part of the solution is the method or step for linking the achieved artificial protein as described below.

[0065] In a further embodiment of the method of the present invention, the method for a cell-free manufacture of an artificial protein further comprises a step of linking, in particular a linking reaction, the at least one artificial protein via the incorporated at least one unnatural amino acid to at least one other molecule carrying a reactive chemical group (synonym: reactive group) suitable for linking with the at least one artificial protein. The at least one molecule preferably comprises at least one uaa.

[0066] The linking reaction may be spatially and / or temporally independent from the manufacture method of the present invention or the linking reaction is performed as part of the manufacture method of the present invention as a further step, in particular as a linking step. The components for the linking reaction are supplemented to the reaction mixture of the manufacturing method or supplemented to the artificial protein after washing, isolation and and / or purification. Thus, the linking reaction is feasible within the same reaction mixture without any washing, isolation and / or purification and also feasible spatially and temporally independent from the reaction mixture used in the manufacture method of the present invention. Suitable conditions for the artificial protein and the linking reaction are adjustable

[0067] It may be advantageous to isolate, to wash and / or to purify the achieved artificial protein comprising the at least one uaa prior the subsequent linking reaction. An example for suitable isolation, washing and / or purification is described in example 2.4 of the present invention. Any generalization is well-known in the prior art and the skilled person in the field of protein chemistry and biochemistry is competent to choose suitable methods and analytics for solation, washing and / or purification if any artificial protein according to the present invention. Alternatively, the linking reaction may be performed without any isolation, washing and / or purifications step. It is also suitable to perform the linking step within the same reaction mixture. Where it is desired to perform the linking reaction or the linking step spatially and temporally independent from the manufacture method of the present invention, the achieved artificial protein is transferred to a reaction mixture comprising the other molecule for the desired linking reaction.

[0068] Finally, another aspect of the present invention is a kit for linking an artificial protein according to the present invention - or any embodiment described herein - with at least one other molecule comprising at least one artificial protein - as defined herein - at least one other molecule - as defined herein, wherein both are carrying reactive chemical groups suited to each other for the linking reaction and excipients for the linking reaction.

[0069] Another aspect of the invention is a conjugate achieved or obtained by the method according to the present invention or by the linking step of the present invention, wherein the conjugate comprises

[0070] - at least one artificial protein obtained by the method according to the present invention, comprising at least one uaa with a reactive chemical group, and

[0071] - at least one other molecule, wherein the artificial protein and the other molecule are covalently linked via their reactive chemical groups to each other. The other molecule is not a protein (e.g. chemotherapeutic drug, any chemical pharmaceutic molecule) or any other protein not produced with the method of the present invention (e. g. any commercially available protein) or an artificial protein produced according to the present invention.

[0072] More preferably the conjugate is achieved or obtained by the linking reaction or by the linking step of the present invention combined with the method for the manufacture of an artificial protein of the present invention.

[0073] In one embodiment the conjugate according to the present invention, it comprises at least one virus like particle as the other molecule, preferably achieved or obtained by the method for the manufacture of an artificial protein according to the present invention, comprising at least one uaa, wherein more than two artificial proteins each comprising at least one uaa, preferably achieved or obtained by the method of the manufacture of an artificial protein, are linked to said virus like particle. An example of such a conjugate is shown in the present application and the results are depicted in Fig. 7-10. It has been shown that an unnatural HBc VLP produced in ALiCE® carrying the azido-tyrosine (Fig. 7) and an unnatural influenza RBD antigen also produced in ALiCE® carrying the alkyne-tyrosine (Fig. 8) are successfully linked to each other (Fig. 9 and Fig. 10). Other conjugates comprising a VLP and any desired antibody or fragment thereof can be achieved by the present invention, such as virus-like particles suitable to recognize a target molecule on a cell surface and with an increased immunogenicity potential. The instructions presented herein are sufficient for a skilled person in art to feasibly achieve desired embodiments of the conjugate according to the present invention.

[0074] In a further embodiment, the conjugate according to the present invention comprises at least one artificial protein, preferably an antibody or fragment thereof, comprising at least one uaa, preferably achieved or obtained by the method of the manufacture of an artificial protein, and at least one other molecule, preferably a pharmaceutical active agents, chemotherapeutic drugs and / or immune response mediating molecule, wherein the other molecule is linked to the artificial protein.

[0075] A known example is an antibody drug conjugated or ADCs that can be achieved by the method or step according to the present invention. In particular, by use of uaa-modified antibodies covalently bound to specific drugs, in order to direct drug delivery into a specific tissue (e.g. cancerous or tumor cells). Another example is an adapter molecule for use in combination with a CAR (chimeric antigen receptor) expressing immune cell (e.g. T cell, NK cell, dendritic cell, hematopoietic (stem) cell) that is suitable to interact with the CAR expressed on the immune cell on the one hand and is able to interact with the antigen expressed on a target cell (target cell comprises tumor cells and diseases cells of a patient). In this context the adapter molecule is a fragment of an antibody, preferably a fab fragment, that is specific for the respective antigen. Whereas the CAR is unspecific and suitable for use in any therapy. In combination the adapter confers specificity to the CAR expressing immune cells in the desired cell therapy, e.g. targeting tumor cells for the treatment of a leukemia, e.g. AML. The use of such adapters are disclosed in Nixdorf et al 2023 e.g. for anti-CD33, anti-CD123, and anti- CLL1 adapter molecules.

[0076] Such adapters for use in cell therapy which comprise at least one uaa are artificial proteins within the meaning of the present invention. Those can further be linked to a chemotherapeutic drug to create a conjugate according to the present invention. Table 2 overview of conjugates and selected embodiments of the present invention

[0077] Table 2 give some indication to feasible embodiments of conjugates of the present invention without limiting the invention to listed embodiments. It is clear to the skilled person that by application of the teaching of the present invention and the instructions herein, any desired artificial protein can be synthesized which is suitable for linking with any other desired other molecule to create conjugate for the intended use. The use of the conjugates of the present invention comprises immunotherapy, vaccination, vaccination against infection diseases (e.g. influenza, SARS-CoV-2), vaccination against cancer diseases (e.g. Cervical cancer caused by human papillomavirus (HPV)), anti-autoimmune therapy, analytics and diagnostics. Finally, the achieved conjugates of the present invention preferably interact with other molecules, interact with receptor molecules and / or are capable of binding reactions. Preferably, the conjugate exhibits an immune modulating activity and / or interaction with surface proteins of target cells (e.g. healthy human cells, diseased human cells, tumor cells). For example the conjugate is a VLP for vaccination against influenza A and is able to interact with sialic acids. Any other embodiment of the VLP for vaccination against other infections are achievable based on the teaching and instructions of the present invention. Example 3 shows that VLPs produced (described in section 2.4) by the inventive method for cell-free manufacture of an VLP with the unnatural amino acid (uaa) azido tyrosine in position 79 are efficiently conjugated to the influenza RBD proteins, produced also via cell-free manufacture and containing the alkyne tyrosine uaa. Free RBD was removed from VLP-RBD conjugates via SEC (Figure 1 1 A). TEM analysis of the VLP-RBD conjugates showed that the VLP structure remained intact, whilst VLPs acquired a “fuzzy” form when compared to the non-conjugated VLPs, probably indicating the conjugation of RBD to their surface (Figure 1 1 B,C). RBD-VLP conjugates can successfully hemagglutinate chicken erythrocytes via the binding to the sialicic acid-modified receptors on their surface, whilst unconjugated VLPs are unable to achieve said activity (Figure 1 1 D).

[0078] All conjugates according to the present invention are achieved in the method for the cell-free manufacture of an artificial protein of the present invention, wherein the method further comprises a step of linking the at least one artificial protein via the incorporated at least one unnatural amino acid to at least one other molecule carrying a reactive chemical group suitable for linking with the at least one artificial protein.

[0079] Alternatively, the conjugates according to the present invention are achieved or obtained in a spatially and temporally independent method for linking an artificial protein comprising at least one uaa with at least one other molecule. Therefore, Another aspect of the present invention is a method for linking an artificial protein comprising at least one uaa, preferably produced by the cell-free manufacture of an artificial protein of the present invention, with at least one other molecule, wherein the method comprise step of

[0080] - providing the at least one artificial protein - as defined herein

[0081] - providing at least one other molecule - as defined herein, wherein both are carrying to each other suited reactive chemical groups suitable for a linking reaction,

[0082] - contacting the artificial protein and the other molecule and - achieving a conjugate wherein the at least one artificial protein and at least one other molecule are covalently bound.

[0083] In an embodiment of the present invention, the other molecule is also an artificial protein, preferably produced by the inventive cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein. This embodiment is suitable for the method for cell-free manufacture of an artificial protein of the present invention continued with a step of linking the at least one artificial protein as well as for the spatially and temporally independent method for linking an artificial protein according to the present invention.

[0084] In another embodiment of the present invention, the other molecule is a particle, biobased- particle or non-biological particle - as defined herein - carrying a reactive chemical group suitable for a linking reaction according to the present invention. According to the present invention a conjugate is obtained wherein the artificial protein comprising at least one unnatural amino acid (uaa) preferably produced by the inventive cell-free manufacture of an artificial protein manufacture is linked to said particle as defined herein.

[0085] In another embodiment of the method according to the present invention the at least one artificial protein is linked by means of a chemical linking reaction of a functional group, preferably a reactive chemical group, of the at least one unnatural amino acid with the reactive chemical group of the other molecule. Preferably, the reactive chemical group of the other molecule is part of an unnatural amino acid.

[0086] In another embodiment of the method according to the present invention, the linking reaction between the at least one uaa of the artificial protein and the reactive chemical group of the at least one other molecule is mediated via a Copper-catalyzed azide-alkyne cycloaddition (CuAAC), photoclick, Strain-promoted azide-alkyne cycloaddition (SPAAC) or an inverse electron demand Diels-Alder (IEDDA) reaction. Said reactions are suitable for the method of the present invention continued with a step of linking the at least one artificial protein as well as for the spatially and temporally independent method for linking an artificial protein according to the present invention.

[0087] In another embodiment of the method according to the present invention the other molecule comprises pharmaceutical active agents, chemotherapeutic drugs, none-protein molecules, another protein or any fragment thereof, immune response mediating molecules, particles, virus like particles (VLP), preferably VLPs for use in vaccination, other biobased particles and nanoparticles comprising a protein shell, respectively carrying at least one reactive chemical group suitable for the linking with the at least one uaa of the artificial protein. More preferably at least one reactive chemical group is part of at least one uaa. Any particle as defined herein is suitable for this embodiment. This embodiment is suitable for the method for cell-free manufacture of an artificial protein of the present invention continued with a step of linking the at least one artificial protein as well as for the spatially and temporally independent method for linking an artificial protein according to the present invention.

[0088] The other molecule is preferably an immune modulating molecule (suitable to stimulate, activate, inhibit an immune reaction), more preferably it is an immune modulating polypeptide. In another embodiment the other molecule is an immune modulating molecule particle. In one embodiment the other molecule is a second artificial protein comprising at least one uaa that alone or in combination with the first artificial protein is suitable to modulate an immune reaction of a subject (patient). The teaching of the conjugates of the present invention applies here accordingly. In one embodiment the other molecule is a virus like protein comprising at least one or more uaa.

[0089] In another embodiment of the method of the present invention the other molecule comprising the at least one reactive chemical group is added to the linking reaction or it is synthesized by means of the cell-free manufacture according to the present invention, preferably either simultaneously within one reaction mixture or within a separate reaction mixture spatially and temporally independent from the cell-free manufacture of the artificial protein.

[0090] In another embodiment of the method of the present invention, the artificial protein is selected from the group comprising an antigen, an extracellular domain of an antigen, an epitope domain, or any antigen fragment, respectively comprising the at least one uaa, and the artificial protein is linked via the at least one uaa with at least one uaa of the at least one VLP. Preferably, said artificial protein is associated with or coated on the surface of the VLP (see also table 2).

[0091] The VLP comprises suitable chemical reactive groups for the linking reaction as defined herein with the artificial protein of the present invention, wherein the chemical reactive groups are not part of an uaa. In another embodiment the VLP comprises suitable chemical reactive groups for the linking reaction as defined herein with the artificial protein of the present invention, wherein the chemical reactive groups are part of at least one uaa according to the present invention (see also table 2). More preferably the at least one VLP exposes its uaas, preferably the reactive groups of the uaas, to the surrounding environment of the VLP. The other molecule, preferably the VLP, are provided as a component and supplement to the linking reaction or linking method according to the present invention or the other molecule, preferably the VLP, is synthesized by the cell-free manufacture according to the present invention.

[0092] The VLP is linked to the desired immune modulating suitable for use in vaccination, e.g. against viral infection diseases comprising influenza A and its subtypes, A / H1 N1 , SARS-CoV-2 and its subtypes.

[0093] In another embodiment of method of the present invention a sufficient amount of the artificial protein is linked to at least one or more and up to all accessible unnatural amino acids, preferably accessible reactive chemical groups of the uaas, of the at least one VLP. According to the present invention “accessible unnatural amino acids” means that the reactive chemical groups are associated with or coated on the surface of the VLP in order to enable the linking reaction according to the present invention. Are not sterically hindered or shielded.

[0094] The advantage of the method for the manufacture of artificial proteins in combination with the linking step or linking reaction is, that commercially applicable VLPs linked an antigen can be produced under controlled conditions. The production platform described herein allows flexible VLP production with the desired antigen or fragments for pharmaceutical applicable, for use as therapeutic products, for use in (pre)clinical studies and for fast and multiplex screening of effective and specific VLPs. By the inventive production platform combining the methods or steps of the present invention standardized VLPs are post translationally linked to any other desired molecule via the uaas of the VLP. The inventive production platform of the present invention entails the production of virus-like particle vaccines rapidly adaptable to new pathogenic threats using a common particle and changing the antigen to be displayed, post translationally binding it to VLP via the unnatural amino acid. This approach has the added advantage that it imposes lower constraints to antigen design, as the virus-like particle is preassembled, thus allowing more complex antigens to be displayed, which in turn can generate vaccines with increased immunogenicity potential. Lastly, the production of ADCs in ALiCE® is also permitted by the expression of the antibodies including the unnatural amino acid required for drug binding.

[0095] Another aspect of the present invention is an artificial eukaryotic cell-free translation system, preferably a plant based artificial eukaryotic cell-free translation system, for incorporation of at least one unnatural amino acids into a predetermined amino acid sequence comprising i) ribosomes derived from a eukaryotic species, preferably provided in a eukaryotic cell- free lysate, preferably derived from a non-human species, more preferably derived from a plant. ii) an aminoacyl-tRNA-Synthetase (aminoacyl-transferase) capable of transferring an unnatural amino acid into the suppressor tRNA, and iii) a suppressor tRNA that specifically recognizes a non-sense codon in a mRNA sequence encoding for the predetermined amino acid sequence.

[0096] The artificial eukaryotic cell-free translation system having both functions while translation of natural amino acid incorporation and unnatural amino acid incorporation. Preferably it is derived from a BY-2 cell line and is a BY-2 lysate also comprising or supplemented with an artificial translation system for incorporation of the unnatural amino acid as defined herein, preferably an E. coli tyrosyl transferase system. If not otherwise indicate in all aspects of the present invention the mixed eukaryotic cell-free translation system is meant.

[0097] More preferably, the artificial eukaryotic cell-free translation system, preferably a plant based artificial eukaryotic cell-free translation system, is derived from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum. According to the present invention the artificial eukaryotic cell-free translation system is derived from the BY-2 cell line as defined herein. It is preferred to combine the artificial eukaryotic cell-free translation system with an aminoacyl transferase derived E. coli, more preferably with an E. coli derived tyrosyl transferase.

[0098] Another aspect of the present invention is the use of the inventive artificial eukaryotic cell-free translation system, preferably a plant based, more preferably ALiCE® based - any one of the mentioned plants, artificial eukaryotic cell-free translation system, in the method of the present invention for the cell-free manufacture of an artificial protein as defined herein.

[0099] In an embodiment of the present invention, the artificial eukaryotic cell-free translation system, further comprises iv) at least one unnatural amino acid, preferably in an amount sufficient for incorporation into the amount of amino acid sequence molecules synthesized from the amount of mRNA molecules encoding for the predetermined amino acid sequence.

[0100] Most preferably, the artificial eukaryotic cell-free translation system (ALiCE® based) comprises i) ribosomes derived from a cell-free lysate from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum, most preferably derived from the BY-2 cell line as defined herein, ii) an aminoacyl transferase (aminoacyl-tRNA-Synthetase) capable of transferring an unnatural amino acid into the suppressor tRNA as defined herein, iii) a suppressor tRNA that specifically recognizes a non-sense codon in a mRNA sequence encoding for the predetermined amino acid sequence as defined herein, and iv) at least one unnatural amino acid, preferably in an amount sufficient for incorporation into the amount of amino acid sequence molecules synthesized from the amount of mRNA molecules encoding for the predetermined amino acid sequence as defined herein. v) a posttranslational modification machinery enabling folding of complex proteins and glycosylation derived from a cell-free lysate from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum, most preferably derived from the BY-2 cell line as defined herein, and vi) microsome for incorporation and stabilization of membrane protein, derived from a cell- free lysate from a plant of the family Solanaceae, preferably derived from a plant of the genus Nicotiana, more preferably from the species Nicotiana tabacum, most preferably derived from the BY-2 cell line as defined herein

[0101] The ALiCE® based artificial eukaryotic cell-free translation system preferably comprises mitochondria and / or chloroplasts, wherein creatine phosphate and creatine kinase are not added to the reaction to provide artificial energy regeneration. The AliCE® based artificial eukaryotic cell-free translation system is in the form of a Kit, wherein

[0102] 1 . one component is a cell-free lysate - as defined herein - comprising i), v) and vi) as defined above,

[0103] 2. as second component is the aminoacyl-tRNA-Synthetase (aminoacyl transferase) as defined herein, as a) an active component (liquid, dray or lypysylate) or as b) a nucleic acid sequence or mRNA sequence encoding for the desired aminoacyl-tRNA-Synthetase

[0104] 3. a suppressor tRNA as defined herein, a) as an active component or b) as a nucleic acid sequence encoding for the suppressor tRNA, preferably a nucleic acid sequence encoding for a suppressor tRNA that specifically recognizes a non-sense codon , and

[0105] 4. at least one unnatural amino acid or a mixture of the desired uaas and

[0106] 5. optionally a raw plasmid for genetic modification to achieve a plasmid carrying the nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position.

[0107] Another aspect of the present invention is a combination of nucleic acid constructs comprising ii) a nucleic acid sequence encoding for a suppressor tRNA that specifically recognizes a nonsense codon, and / or iii) a nucleic acid sequence encoding for an aminoacyl transferase, preferably it is a E. coli derived transferase, more preferably a E. coli derived tyrosyl transferase, most preferably a his-tagged E. coli tyrosyl transferase (see table 3), and / or iv) optionally a raw plasmid for genetic modification to achieve a plasmid carrying the nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position.

[0108] The most preferred embodiments of nucleic acid sequences (constructs) and the resulting amin acid sequences are shown in table 3:

[0109] Table 3: Sequences used in the examples of the present invention:

[0110] Further, the use of the combination of nucleic acid constructs in the cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein according to the present invention.

[0111] Another aspect of the present invention is a Kit for the manufacture of an artificial protein in a cell-free system, the kit comprises the artificial eukaryotic cell-free translation system as defined herein, an artificial eukaryotic cell-free translation system for incorporation of at least one unnatural amino acids into a predetermined amino acid sequence according to the present invention and / or the combination of nucleic acid constructs according to the present invention. Further components are at least one or more desired unnatural amino acids, buffer and excipients.

[0112] Definitions

[0113] An artificial protein according to the present invention means any protein comprising soluble protein, soluble linear protein, soluble three-dimensional protein, membrane protein, peplomers, glycoproteins, Spike-Proteins, receptor binding domains, an antibody, an antibody fragment, fc fragment, fab fragment, receptors, an antigen, an antigen binding domain, an extracellular domain of an antigen, an epitope domain, or any other polypeptide, polypeptide / protein based immune response mediating molecules, protein based immunomodulating molecules, that respectively comprises at least one unnatural amino acid in a predetermined position. The artificial protein may comprise at least one, two, three, four, five, six, seven, eight, nine, 10 or more unnatural amino acids (uuas). The one or more uaas are incorporated adjacent to each other, in different predetermined positions separated from each other by at least one or more natural amino acid or are incorporated as short “uua sequences” in different positions separated from each other by at least one or more natural amino acid.

[0114] A fragment of a protein generally means that its length is shorter compared to the original full length protein. The fragment of a protein may be defined by its original function, e.g. a fab fragment or fc fragment or other of an antibody, it is a domain or subdomain of a protein e.g. a transmembrane domain, an extracellular domain, an epitope region, a cytosolic domain or other of an antigen, or the fragment is any other polypeptide. The fragment is encoded by a nucleic acid sequence that is part of the nucleic sequence encoding for the original full length protein. Said nuclei acid sequences encoding for the fragments may be genetically modified to comprise at least one or more non-sense codons

[0115] The predetermined position within the meaning of the present invention is the position of the amino acid sequence of the artificial protein in that the unnatural amino acid is incorporated. The position of the uaa in the amino acid sequence of the artificial protein is predetermined by a non-sense codon according to the present invention in the nucleic acid sequence encoding for the protein. Where two or more uaa at different positions in the amino acid sequence are desired, the respective encoding nucleic acid sequence comprises two or more different nonsense codons at which position the desired uaa is incorporated selectively. Different non-sense codons are necessary where different uaa are desired to be incorporated. Where the same uaa shall be incorporated at more than one position, repetition of the same non-sense codon allows multiple incorporation of the same uaa into the amino acid sequence

[0116] Where the protein is e.g. a receptor protein and the uaa is for linking the receptor to another molecule or to another surface via another molecule (e.g. to a particle), the one or more uaa is outside of the antigen binding domain and in a position that allows orientation of the receptor exposing the antigen binding domain for successful interaction with an antigen. Thus, where it is desired to maintain protein-protein interaction it is preferred to incorporate one or more uaa in predetermine positions outside any sequence that is essential or relevant for protein-protein interaction. Where it is desired to abrogate protein-protein interaction it is preferred to incorporate one or more uaa in predetermined positions within any sequence that is essential or relevant for protein-protein interaction, preferably in the epitope and / or antigen binding domain, or in a region not affecting the epitope and / or antigen binding domain but the conformation and thereby affecting access to the epitope and / or antigen binding domain.

[0117] Where it is desired to maintain protein conformation (3D) and orientation it is preferred to incorporate one or more uaa in predetermine positions outside any sequence that is essential or relevant for protein folding, e.g. not affecting amino acids enabling disulfide bounds. Where it is desired to abrogate the original protein conformation (3D) and orientation or to manipulate protein conformation (3D) and orientation it is preferred to incorporate one or more uaa in predetermine positions adjacent to and / or within any sequence that is essential or relevant for protein folding, e.g. targeting / exchanging amino acids enabling disulfide bounds and / or certain H-bonds.

[0118] Where it is desired to maintain any selected protein-protein interaction (antigen-antibody or antigen-immune cell interaction or antigen-CAR interaction) and combining it with another molecule, it is preferred to incorporate one or more uaa in predetermine positions outside any sequence that is essential or relevant for protein-protein interaction and at the same time that is suitable for linking the other molecule, e.g. another drug (chemo therapeutic drug) in order to transport the other molecule to the protein. By doing so it is possible to transport e.g. a chemotherapeutic drug by the artificial protein of the present invention to a desired antigen expressed on a tumor cell. The same strategy may be adapted to auto-immune diseases.

[0119] Site-specific incorporation refers to the incorporation of an unnatural amino acid in a predetermined position into the nascent polypeptide, wherein the tRNA recognizes the nonsense codon according to the present invention in the mRNA sequence while translation at the ribozymes and the ribosome site-specifically incorporates the unnatural amino acid linked to the tRNA into the nascent polypeptide in the position of the non-sense-codon. For site-specific incorporation a suiting pair of an aminoacyl-tRNA synthetase and a suppressor tRNA is preferred. However, chemically linked uaa to the tRNA can alternatively be used. Therefore, even if not expressly indicated, any method, system and embodiments as well as examples are performed with pairs of an aminoacyl-tRNA synthetase and a suppressor tRNA, both suited to each other to enable site-specific incorporation of the desired uaa at the predetermined position defined by a non-sense codon according to the present invention.

[0120] Generally, any protein can be transformed or manipulated to an artificial protein according to the present invention. Proteins are a diverse group of molecules with an expansive scope of functions, ranging from providing cellular structure, to allowing specific live-essential chemical reactions to occur, between others. These functions are provided by the specific structure of the protein, which is in turn determined by the amino acid sequence. There are 20 natural / canonical amino acids of different structure and chemical properties that are added to the protein sequences of most living beings. These 20 amino acids are enough to provide the needed functionality to proteins in nature. Thus, “protein” and “artificial protein” encompasses peptides (e.g. Dipeptide, Tripeptide, Tetrapeptide, Pentapeptide, Hexapeptide, Heptapeptide, Octapeptide, Nonapeptide, Oligopeptide), polypeptides, soluble proteins, membrane proteins and protein complexes, respectively, of microbial, bacterial, fungal, viral, plant, animal and / or mammalian origin, whereas the artificial protein comprises at least one uaa or more.

[0121] An unnatural amino acid (uaa) or non-canonical amino acid refers to any amino acid, modified amino acid, and / or amino acid analogue that is not one of the 20 natural amino acids. Unnatural amino acid are synthetic structures that resemble amino acids, but that have been specifically modified in order to provide special functions to the recombinant protein in which they are incorporated. Such modifications include the addition of specific reactive handles, fluorescent dyes and stabilizing groups, between others. Uaa-modified proteins can be used to covalently attach other molecules to proteins, study protein-protein interactions and to provide enhanced stability or activity to specific enzymes.

[0122] A nucleic acid sequence encoding for a predetermined amino acid sequence (synonym “template” or “template sequence” is the nucleic acid sequence comprising at least one nonsense codon or more that determines the position in the amino acid sequence wherein the at least one uaa is incorporated. The one or more non-sense codons are genetically designed into the template encoding for the artificial protein. The non-sense codon may replace a codon coding for a natural amino acid to allow incorporation of the desired uaa at its position (replacement). The non-sense codon may also be placed additionally into the natural sequence encoding for the neutral amino acid sequence. In this alternative the non-sense codon interrupts the natural sequence encoding for the natural amino acid and extends the amino acid sequence (extension). Both alternatives - replacement and extension - may also be combined. .

[0123] A nascent polypeptide within the meaning of the present invention is the amino acid-chain that is in the process of being synthesized by the ribosome, using the mRNA transcribed from the template sequence and the tRNAs carrying the required natural or unnatural amino acids. It encompasses a polypeptide chain ranging from the first amino acid, to any point of the final protein until the last amino acid and it might contain one or more unnatural amino acids. The desired at least one or more uaas are incorporated into the nascent polypeptide to achieve the artificial protein according to the present invention.

[0124] According to the present invention a “cell-free” protein manufacture means that the artificial protein is synthesized outside a living cell like bacterial, fungal, insect, an animal cell, plant or fungal cell and instead an extract of said cells comprising the respective protein machinery of the cells is used for protein synthesis. By breaking down of the membrane of a cell (lysis), the internal liquid containing the internal components the so called lysate, is obtained. Within the meaning of the present invention a lysate composes at least all essential components for protein production: transcription, translation, folding and posttranslational modification. The lysate is essentially a liquid formulation There are many variations of CFPS, composed of either recombinant transcription-translation machinery or derived from prokaryotic or eukaryotic cell lysates. The most utilized lysates are Escherichia coli extract (ECE), rabbit reticulocyte lysate (RRL), Chinese hamster ovary (CHO) lysate, wheat germ (WGE) lysate and insect cell extract (ICE). However, the main CFPS platforms used right now are not completely ideal, with an overall low protein production yield, slow production time, unavailable or inappropriate protein modification and are not feasible, or not sufficiently feasible, for the biosynthesis of complex proteins. Within the meaning of the invention a “cell-free” protein machinery is one of the aforementioned. Preferably, it is one derived from eukaryotic cells, preferably derived from a plant species, more preferably from preferably from a plant of the genus Nicotiana of the family Solanaceae, preferably from a cellular lysate of N. tabacum, more preferably a cellular lysate of a BY-2 cell line from N. tabacum (BY-2 = bright yellow - 2, see Buntru et al. 2014). The protein machinery comprise an active protein synthesis machinery (translation, protein folding) and energy regeneration machinery (ribosomes, mitochondria, etc.) and preferably it has a posttranslational modification capacity, more preferably posttranslational modification (PTM) mediated by microsome.

[0125] The BY-2 (bright yellow - 2, see Buntru et al. 2014) is a cell line and BY-2 cell-free protein synthesis (CFPS) were developed to overcome the drawbacks presented by most eukaryotic CFPS systems. Compared to lysates of wheat germ (WGE) for protein production, BY-2 shows a faster lysate production with higher translational activity and higher potential for scaling-up (Buntru et al., 2014). It was shown that by means of a BY-2 lysate a functional full-size antibody can be produced (Buntru et al., (2015)), showing that BY-2 lysate is a potential expression system for biopharmaceutical manufacturing. BY-2 cells comprise microsomes derived from the Endoplasmic Reticulum (ER) and the Golgi of the plant cells. The advantage of the endogenous microsome is that complications due to the use of artificial components, artificial membranes or other artificial excipients, are avoided and in addition the native protein biosynthesis machinery, in particular the native posttranslational modification capacity, is maintained for posttranslational modification of the artificial protein according to the present invention.

[0126] A non-sense codon within the meaning of the present invention is a codon recognized by the suppressor tRNA during the translation process but is not recognized by an endogenous tRNA. The suppressor tRNA anticodon loop recognizes the stop codon in the mRNA sequence and incorporates the respective unnatural amino acid specifically at this site in the nascent polypeptide. Non-sense codons include, e.g., stop codons, amber codons, ochre codons, opal codons, unnatural codons and four base codons, more base codons, codons derived from natural or unnatural base pairs and the like. More base codons comprise four, five, six or more base codons. Examples of four base codons include, e.g., AGGA, CUAG, UAGA, CCCU and the like. Examples of five base codons include, e.g., AGGAC, CCCCU, CCCUC, CUAGA, CUACU, UAGGC and the like. For example, in the presence of mutated O-tRNAs, e.g., a special frameshift suppressor tRNAs, with anticodon loops, e.g., with at least 8-10 nt anticodon loops, the four or more base codon is read as single amino acid. In other embodiments, the anticodon loops can decode, e.g., at least a four-base codon, at least a five-base codon, or at least a six-base codon or more. Since there are 256 possible four-base codons, multiple unnatural amino acids can be encoded in the same cell using the four or more base codon. See, J. Christopher Anderson et al., Exploring the Limits of Codon and Anticodon Size, Chemistry and Biology, Vol. 9, 237-244 (2002 ); Thomas J. Magliery, Expanding the Genetic Code: Selection of Efficient Suppressors of Four-base Codons and Identification of "Shifty" Four-base Codons with a Library Approach in Escherichia coli, J. Mol. Biol. 307: 755-769 (2001 ).

[0127] The other molecule within the meaning of the invention is a molecule consisting of two or more connected atoms that are linked by covalent bonds and carrying a reactive chemical group (synonym reactive group) suitable for the linking reaction within the meaning of the present invention. The other molecule comprises pharmaceutical active agents, chemotherapeutic drugs, none-protein molecules, another protein and any fragment thereof, antibodies and fragments (fab, fc) thereof, immune response mediating molecules, chemical immunomodulating molecules, polypeptide / protein based immunomodulating molecules, peplomers, glycoproteins, Spike-Proteins, receptor binding domains, particles, virus like particles (VLP) other biobased biological, particles comprising a protein shell, respectively carrying at least one reactive chemical group suitable for the linking within the meaning of the present invention. The at least one molecule comprises in a preferred embodiment at least one uaa. The reactive chemical group suitable for the linking reaction within the meaning of the present invention may be part of an uaa or of at least one uaa of the artificial protein. Thus, any of the aforementioned “other molecules” that comprise at least one uaa comprising at least one reactive chemical group are suitable for the linking reaction within the meaning of the present invention. In the embodiment of a particle, the at least one reactive chemical group or at least one uaa comprising at least reactive group may be associated with or coated on the particle surface or it (the uaa or reactive chemical group), respectively, is part of the artificial protein according to the present invention that is associated with or coated on the particle surface. Thus a particle may comprise artificial proteins according to the present invention associated with or coated on the particle surface.

[0128] Virus like particles (VLPs) within the meaning of the present invention are well known to the skilled person. VLPs are molecules that are structurally closely related to the active viruses, but without being infectious because the viral genetic material is missing. VLPs can be naturally occurring or synthesized through the individual expression of viral structural proteins. The proteins self-assemble into the virus-like structure composed of proteins derived from the same or from a combination of different viruses. VLPs comprises those derived from the Hepatitis B virus (HBV), composed of the small HBV derived surface antigen (HBsAg), VLPs derived from a variety of virus families including Parvoviridae (e.g. adeno-associated virus), Flaviviridae (e.g. Hepatitis C virus), TMV, QB, AP205, Norovirus, HPV and AAVs.

[0129] A particle within the meaning of the present invention comprises “biobased particles” or “non- biological particles”. Biobased particles comprise particles derived from an organism, particles derived from viruses, particles derived from bacteria, virus like particles, genetically biobased particles, biochemically modified biobased particles, genetically modified virus like particles and protein based particles. Non-biological particles comprise synthetic particles, metallic particles, particles made of or comprising carbon, carbon-based, Zn, Cu, Ni, Ag, Au, Fe, Pt, Ti and / or Si, SiO2, TiO2, AI2O3, Fe2O3, Fe3O4 and / or ZnO. Non-biological particles may comprise i) at least or more reactive chemical groups associated with or coated on the particle surface, ii) at least one or more uaas comprising at least reactive chemical group associated with or coated on the particle surface or ill) at least one or more artificial protein according to the present invention associated with or coated on the particle surface. The particles have diameter in the range of 1 nm to 1000 nm, 1 nm to 900 nm, 1 nm to 800 nm, 1 nm to 700 nm, 1 nm to 600 nm, 1 nm to 500 nm, 1 nm to 400 nm, 1 nm to 300 nm, 1 nm to 200 nm, 1 nm to 100 nm. The particle as defined herein is a nanoparticle with a diameter < 200 nm, preferably with a diameter < 100 nm, or microparticle (1 -1000 micrometer). Within the meaning of the present inventions a particle is a nanoparticle either a biobased nanoparticle or non-biological nanoparticle.

[0130] A “reactive group” or “reactive chemical group” within the meaning of the present invention is suitable for the linking reaction described herein. In particular it is suitable to initiate and to conduct the linking of two molecule by creation a covalent bound. Thus, for a linking reaction two reactive groups are necessary. More precisely, at least one “reactive group” is part of the at least one uaa of artificial protein of the present invention.

[0131] The “linking reaction” within the meaning of the present invention takes place between at least one uaa of the artificial protein of the present invention and a reactive group of at least one other molecule. The linking reaction is mediated via a Copper-catalyzed azide-alkyne cycloaddition (CuAAC), photoclick, Strain-promoted azide-alkyne cycloaddition (SPAAC) or an inverse electron demand Diels-Alder (IEDDA) reaction. The linking reaction is performed in the presence of the two or more different molecules, possibly adjusting the molar ratio between them to adjust the final yield of conjugated molecules. The linking reaction contains all the different components required for the covalent binding between the two molecules containing the reactive groups, such as catalysts, ligands etc. A known example would be the use of uaa- modified antibodies (or fragments thereof) covalently bound to specific drugs, known as antibody drug conjugated or ADCs, in order to direct drug delivery into a specific tissue (e.g. Cancer). The linking reaction according to the present inventions enables the production of such ADCs. Preferably, the linking reaction comprises at least one artificial protein according to the present invention that is linked to a desired drug. In another embodiment the linking reaction comprises at least one artificial protein according to the present invention that is linked to a desired drug that is another artificial protein according to the present invention.

[0132] A conjugate, a conjugate of artificial proteins or an artificial protein-based conjugate within the meaning of the present invention is defined by two components. The first component is the artificial protein according to the present invention that comprises at least one uaa that carried prior linking the one reactive group for the linking reaction according to the present invention. The second component is any other molecule that carried prior linking the other reactive group for the linking reaction according to the present invention. The second component may be another protein - not produced according to the present invention - or an artificial protein produced according to the present invention. In any case the conjugate is produced by the linking step or linking method as defined herein. After linking between the two reactive chemical groups, the conjugate consists of the first components and second components covalently bound to each other . The conjugate may consist of one artificial protein covalently bound to one another molecule. The conjugate may also comprise a plurality (at least two, three, four, five or more) of artificial proteins covalently bound to a plurality (at least two, three, four, five or more) of other molecules (e.g. VLP). The conjugate may also comprise a plurality (at least two, three, four, five or more) of artificial proteins covalently bound two one other molecules (e.g. particle) or it comprises one artificial protein (e.g. comprising two or more uaas with reactive groups) covalently bound to a plurality of other molecules.

[0133] Bioorthogonal chemistry is a chemical reaction that occurs in complex biological systems without it interfering with other native processes. It can include processes such as the introduction of unnatural amino acids into a nascent polypeptide, or linking reactions performed within the living system as previously described.

[0134] A suppressor tRNA is a tRNA molecule genetically engineered to contain an anti-sense codon and used for the specific incorporation of unnatural amino acids into a nascent polypeptide. One or more different suppressor tRNAs might be included at the same time in order to introduce one or more unnatural amino acids into the same protein. The suppressor tRNA might be a modified tRNA from a living organism, or a fully artificially designed tRNA. An aminoacyl transferase or aminoacyl-tRNA synthetase (both are synonyms) refers to an enzyme capable of transferring and attaching a natural or unnatural amino acid onto a tRNA molecule. It does so by catalysing the transesterification of a specific cognate amino acid or its precursor to one of all its compatible cognate tRNAs to form an aminoacyl-tRNA. The aminoacyl transferase might specifically recognize only one tRNA molecule, or might recognize a subgroup of tRNAs. The aminoacyl transferase might preferably transfer one natural or unnatural amino acid into the tRNA, or it might be able to transfer different ones. The aminoacyl transferase might come from a native sequence from a living organism, or it can be genetically engineered for better affinity or specificity. A transferase system comprises an aminoacyl-tRNA synthetase and a tRNA. Preferably, both components are suited to each other for specific incorporation. In a preferred embodiment it is a E. coli tyrosyl transferase system comprising an E. coli derived transferase.

[0135] A translation system according to the present invention refers to the combination of components necessary to incorporate natural amino acids into a nascent polypeptide. Components of a translation system comprise e.g., ribosomes, tRNAs, amino acids, synthetases, mRNA and the like. According to the present invention further components allowing in-vitro incorporation of unnatural amino acids are added to the translation system resulting in an artificial eukaryotic cell-free translation system, preferably a plant-based artificial eukaryotic cell-free translation system, more preferably a family Solanaceae derived, a genus Nicotiana derived, a N. tabacum derived artificial eukaryotic cell-free translation system and most preferably a BY-2 cell line derived based artificial eukaryotic cell-free translation system. The artificial eukaryotic cell-free translation system, most preferably a BY-2 cell line derived based artificial eukaryotic cell-free translation system is part of a eukaryotic cell free system as used herein.

[0136] Co-translation: refers to the process of translating two or more proteins from one or more mRNA molecules simultaneously in the same biological or biotechnological process. The coding sequences necessary for translation might be contained within the same mRNA molecule or different ones. Within the meaning of the present invention, co-translation preferably means a cell-free co-translation by means of a lysate comprising a suitable protein machinery, preferably a eukaryotic lysate, more preferably from a plant lysate, preferably from a plant of the genus Nicotiana of the family Solanaceae. The species N. tabacum is preferred, more preferably it is a cell-free lysate from a BY-2 cell line from N. tabacum comprising a suitable protein machinery.

[0137] Co-transcription: refers to the process of transcribing two or more RNA sequences from one or more DNA templates simultaneously in the same biological or biotechnological process. The same transcriptase, or different transcriptases could be used for that purpose. The same promoter or different promoters allowing for transcriptional regulation of the different transcripts could also be used. Within the meaning of the present invention, co-transcription preferably means a cell-free co-translation by means of a lysate comprising a suitable protein machinery, preferably a eukaryotic lysate, more preferably from a plant lysate, preferably from a plant of the genus Nicotiana of the family Solanaceae. The species N. tabacum is preferred, more preferably it is a cell-free lysate from a BY-2 cell line from N. tabacum comprising a suitable protein machinery.

[0138] The invention is explained in more detail with reference to the figures, without limiting the invention to these embodiments. The figures show:

[0139] Fig. 1 : Unnatural amino acid incorporation using the amber suppression system. (A)

[0140] The aminoacyl-transferase specifically binds the unnatural amino acid to the tRNA with the AUC anti-codon. (B) The uaa-tRNA is used to code for the amber-codon, leading to the site-specific introduction of the unnatural amino acid into the nascent protein sequence.

[0141] Fig. 2: eTyr tRNA template generation. Agarose gel-electrophoresis showing the purified eTyr tRNA PCR templates used for the incorporation of unnatural amino-acids in ALiCE®. 1 -E. coli tRNA template containing the hammerhead ribozyme 2- 1 -E. coli tRNA template without the hammerhead ribozyme Abbreviations: M: molecular size marker, HH: hammerhead ribozyme

[0142] Fig. 3: eTyr in vitro tRNA generation. Agarose gel-electrophoresis showing the in vitro transcribed tRNA resulting from the tRNA templates with (1 -3) and without (4) the hammerhead ribozyme. 1 -tRNA after IVT, 2- tRNA after 1 h 60°C incubation, 3- tRNA after 1 h 60°C incubation and addition of extra Mg. Abbreviations: M: molecular size marker, HH: hammerhead ribozyme

[0143] Fig. 4: Production and purification of the E. coli tyrosyl transferase in ALiCE®. SDS- PAGE showing the purification process of the E. coli tyrosyl transferase. Abbreviations: M: molecular size marker, N: Non-template ALiCE® control, L: ALiCE® lysate after expression, P: ALiCE® pellet after centrifugation, S: ALiCE® supernatant after centrifugation, F: Flow-through, W1 -2: wash 1 and 2, E: Elution, F: final sample

[0144] Fig. 5: Incorporation efficiency of the alkyne-tyrosine unnatural amino acid in ALiCE®.

[0145] The efficiency of the incorporation was measured in terms of fluorescence (Flou. [a.u.]) of the amber eYFP construct after 48h ALiCE® reaction. Expression of pALiCEOl is used as comparison, and the orthogonal controls 1 and 2 indicate the un-specific incorporation of native amino acids and incorporation of the unnatural amino acids (lane C: uaa [mM]) by native transferases, respectively. Different concentrations of the tRNA template (lane A; tRNA [nm]) and eTyrT enzyme (lane B: eTyrT [m]) were explored as indicated. Data points represent averages of experiments performed in duplo. Abbreviations: a.u: arbitrary units N: Non-template ALiCE® control. Orth: orthogonality control.

[0146] Fig. 6: Incorporation efficiency of the azido-tyrosine unnatural amino acid in ALiCE®. The efficiency of the incorporation was measured in terms of fluorescence (Flou. [a.u.]) of the amber eYFP construct after 48h ALiCE® reaction with (A) lysate 1 and with (B) lysate 2). Expression of pALiCEOl is used as comparison, and the orthogonal controls 1 and 2 indicate the un-specific incorporation of native amino acids and incorporation of the unnatural amino acids (lane C: uaa [mM]) by native transferases, respectively. Different concentrations of the tRNA template (lane A; tRNA [nm]) and eTyrT enzyme (lane B: eTyrT [m]) were explored as indicated. Data points represent averages of experiments performed in duplo. Abbreviations: a.u: arbitrary units N: Non-template ALiCE® control. Orth: orthogonality control.

[0147] Fig. 7: Production and purification of an unnatural HBc VLP in ALiCE® carrying the azido-tyrosine. SDS-PAGE showing the purification process of the HBc VLP with the azido tyrosine inserted at the MIR site. Abbreviations: HBc VLP: Hepatitis B-core viruslike particle, M: molecular size marker, N: Non-template ALiCE® control, L: ALiC® lysate after expression, P: ALiCE® pellet after centrifugation, S: ALiCE® supernatant after centrifugation, FT: Flow-through, W1 -2: wash 1 and 2, E: Elution, F: Final sample 1 kig-

[0148] Fig. 8: Production and purification of an unnatural influenza RBD antigen in ALiCE® carrying the alkyne-tyrosine. SDS-PAGE showing the purification process of the influenza RBD with the alkyne tyrosine inserted at the N-terminus. In the first load (1st), the solubilized pellet fraction from the ALiCE® reaction was loaded. After in-column protein re-fold, the soluble ALiCE® fraction after expression was loaded (second load; 2nd). Abbreviations: RBD: Receptor binding domain, M: molecular size marker, N: Non- template ALiCE® control, L: ALiCE® lysate after expression, P: ALiCE® pellet after centrifugation, S: ALiCE® supernatant after centrifugation, F: Flow-through, W1 -2: wash 1 and 2, E: Elution, F: Final sample 1 pig.

[0149] Fig. 9: CuAAC conjugation of azido-VLP to alkyne-RBD. SDS-PAGE showing the results of the CuAAC conjugation reaction using the indicated molar ratios of the two binding partners. For the negative controls, same conditions were applied to recombinant HBc and RBD proteins containing a regular tyrosine instead of the unnatural variant. Abbreviations: HBc VLP: Hepatitis B-core virus-like particle RBD: Receptor binding domain, M: molecular size marker, Fig. 10: Transmission electron microscopy of VLP to RBD conjugates. (A) Nonconjugated azido HBc-VLP (B-D) alkyno-RBD to azido-HBc conjugated VLPs. Bar represents 100nm.

[0150] Fig. 11 : Analysis of VLP-RBD conjugates. (A) Coomassie blue-stained SDS-PAGE gel showing the removal of free RBD from VLP-RBD conjugates. (B) TEM image from the resulting conjugates showing VLP-RBD conjugates and (C) fuzzy cut out showing the surface structure of RBDs with loaded / bound VLPs. (D) Hemagglutination assay showing sialic-acid binding properties of the VLP-RBD conjugates. For tested samples, 4 pg of protein were plated in the initial column, and a serial dilution was performed as indicated. Commercial inactivated influenza vaccine (positive control), and hemagglutinin trimer protein (Hemagglutinin) were used as controls. Abbreviations: SEC: size-exclusion chromatography; HBc VLP: hepatitis B-core VLP; RBD: receptor binding domain from influenza hemagglutinin.

[0151] Examples

[0152] 1. Sequences and plasmids used in the present examples

[0153] In the table 3 different plasmid, primer, protein and tRNA transcript sequences used are shown. All sequences encoding for a protein were cloned into the expression plasmid pALiCEOl , as previously described (Armero-Gimenez et al., 2023; Gupta et al., 2023) if not otherwise indicated.

[0154] 2.1 Design and production of the E. coli tyrosyl tRNA template

[0155] The E. coli tyrosine tRNA sequence was obtained from NCBI (GenBank: X69401.1 ) and synthesized by IDT. A T7 promoter was used to drive the transcription of all tRNA transcripts. In order to increase 5’ homogeneity of the tRNA transcripts, a hammerhead ribozyme sequence was included after the T7 promoter, from which the first 4nt were changed to match the 4nt in the Tyrosine tRNA hybridization box (CACC), resulting in the following sequence: CACCCTGATGAGTCCGTGAGGACGAAACGGTACCCGGTACCGTC (Seq ID No. 03). The raw plasmid “pIDT amp” has the Seq ID No 06. The plasmid pIDT amp carrying the tRNA tyrinse hammerhead sequence (Seq ID No. 4) is named plasmid pLB0443. A version of this plasmid without the hammerhead ribozyme (Seq ID No. 5) was also generated and tested (plasmid plB0461 ).

[0156] PCR templates were utilized to co-transcribe the tRNA (Seq ID No. 04, Seq ID No. 05) within ALiCE®. For that purpose, primers for template generation included 4 PTO linkages to prevent exonuclease degradation in the ALiCE® lysate, thus allowing their simultaneous transcription in the lysate. The Fw primer (P0782, Seq ID No 01 ) was designed to bind ~400bp upstream the T7 promoter. The Rv primer (P0901 , Seq ID No 02) included a Methoxy modification in the second to last nucleotide to prevent untemplated addition at 3’ by the T7 polymerase (Kao et al., 1999, 2001 ). PCR reactions to generate the E. coli tRNA template were performed using Phusion polymerase (NEB) with the GC buffer and following instructions provided by the manufacturer. PCR purification was performed using the PCR clean-up kit (Macherey nagel), as per manual instructions. Representative pictures of the final tRNA templates analysed via Agarose gel electrophoresis are shown in Fig. 2.

[0157] In-vitro transcription (IVT) of the different PCR tRNA templates was utilized to determine their capacity to generate the tRNA of the desired size. IVT reactions were performed using the HiScribe® T7 Quick High Yield RNA (NEB) as per manual instructions, using 1 pig of purified PCR product as template. After reaction completion, 2x RNA dye (NEB) was added, and samples were incubated at 60°C for 10 min, and immediately cooled on ice prior to loading. Samples were run in 0.5x TB buffer (45 mM Tris, 45 mM boric acid) at 250V for 20 min in 4% Agarose gels as previously described (Sanderson et al., 2014), SYBR gold staining (ThermofisherScientific) was used as a dye for gel visualization. Pictures were taken using a Gel Doc XR+ LIV transilluminator (BioRad). The resulting tRNA transcripts are shown in Figure 3.

[0158] 2.2 Production and purification of the E. coli tyrosyl transferase in ALICE®

[0159] The protein sequence for the E. coli tyrosyl transferase was retrieved from NCBI (GenBank: ALJ52437.1 , Seq ID No. 8, DNA template: Seq ID No. 7), codon optimized for expression in Nicotiana tabacum, and synthesized by IDT. The following mutations in protein sequence (DNA template: Seq ID No. 9, Insert 529) were included to allow the introduction of the alkyno and azido tyrosine unnatural amino acids: Tyr37Thr, Asp182Ser and Phe183Ala (Deiters et al., 2003). A 6x histidine tag was included at C-term for affinity purification resulting in amino acid sequenced Seq ID No. 10. Gibson cloning was used to clone the coding the engineered coding sequence Seq ID no. 9 (Insert 529) into the pALiCEOl expression plasmid (Gupta et al 2023), resulting in plasmid pLB0529. Expression plasmids were purified from Escherichia coli DH5alpha cultures using the NucleoBond Xtra Maxi kit (Macherey Nagel) and their correct assembly was confirmed by sequencing (Eurofins).

[0160] Similarly a 6x histidine tag was included at C-term for affinity purification resulting in amino acid sequenced Seq ID No. 1 1. Accordingly, a plasmid named pLB0460 has been created, carrying a different set of mutations. Gibson cloning was used to clone the coding the engineered coding sequence Seq ID no. 11 , Insert 460 into the pALiCEOl expression plasmid (Gupta et al 2023) resulting in plasmid pLB0460. Expression plasmids were purified from Escherichia coli DH5alpha cultures using the NucleoBond Xtra Maxi kit (Macherey Nagel) and their correct assembly was confirmed by sequencing (Eurofins).

[0161] ALiCE® expression was performed as previously described (Armero-Gimenez et al., 2023). Briefly, 10ml reactions were set by thawing the ALiCE® lysate on ice, and expression plasmid was added to 5nM. Reactions were run in a KuhnerShakerX for 48h in sterile 100ml Erlenmeyer flasks at 25°C and 95rpm with a shaking diameter of 50mm. After reaction completion, resulting lysate was centrifuged at 15.000xg for 10 min to remove insoluble debris, and soluble recombinant E. coli tyrosyl transferase in the supernatant was purified via immobilized-metal affinity chromatography (IMAC). Briefly, 2x IMAC sample buffer (100mM phosphate buffer pH 7.4, 1 M NaCI and 20mM Imidazole) was added to the lysate supernatant and filtered using 0.45pm filters (ThermofisherScientific). Resulting samples were loaded into gravity flow columns containing Ni-NTA resin (Cube Biotech) already equilibrated in 1x IMAC Sample buffer. After load, column was washed with IMAC wash buffer (50mM phosphate buffer pH 7.4, 300mM NaCI and 20mM imidazole), and bound proteins were eluted in IMAC Elution Buffer (20mM phosphate buffer pH 7.4, 300Mm NaCI, 250mM imidazole and 10% v / v glycerol). Elution fractions containing the protein of interest were combined, concentrated and buffered exchanged to Storage buffer (20mM phosphate buffer pH 7.4, 150mM KCI, 1 mM DTT and 20% v / v glycerol) using 10kDa concentrator tubes (ThermofisherScientific).

[0162] Protein samples were analyzed using NuPAGE™ 4 to 12%, Bis- Tris (Invitrogen™) SDS- PAGE pre-cast gels. Protein samples were prepared according to the manufacturer’s instructions. 5pl of PageRuler™ Prestained Protein Ladder (ThermoFisher Scientific) were also loaded as size standard. Gels were then run in 1 x MES running buffer (ThermoFisher Scientific) for 25min at 200V or until sufficient resolution was obtained. Successively, gels were stained with Coomassie Blue-staining solution (25% (v / v) isopropanol, 10% (v / v) acetic acid and 0.05% (w / v) Coomassie brilliant blue R-250) and destained with 10% acetic acid until protein bands were clearly discernible. Gel images were captured using the Gel Doc XR+ UV transilluminator (Bio-Rad Laboratories, Inc.). The transferase purification process and final product are shown in Figure 4

[0163] 2.3 Unnatural amino-acid incorporation in ALiCE®

[0164] Unnatural amino acid incorporation in ALiCE® requires the combination of the E. coli tRNA template, the recombinant E. coli tyrosyl transferase, the unnatural amino acid of choice, the ALiCE® lysate and the plasmid containing the coding sequence of the protein of interest including an amber Stop codon for the incorporation of the unnatural amino acid at the desired position. The unnatural amino acids used in this research were H-L-Phe(4-N3)-OH and H-L- Tyr(Propargyl)-OH, both purchased from Iris Biotech and included in the ALiCE® reaction at a 5mM final concentration. 50pl ALiCE® reactions were set as previously discussed, and incubated at 25°C with 75% humidity in half-well 96-well plates and 500 rpm with a 12.5mm shaking diameter. The tRNA PCR template was included at concentrations ranging from 25nM to 75nM and the E. coli tyrosyl transferase was tested in concentrations ranging from 1 to 5pM. In order to determine the optimal efficiency of the unnatural amino-acid incorporation in ALiCE®, an amber Stop codon was introduced into the eYFP encoding sequence at bp position 205 (Seq ID No. 13, Insert 426) and finally cloned into plasmid pALiCEOl eYFP expression plasmid (see also: https: / / www.sigmaaldrich.com / DE / en / technical- documents / protocol / protein-biology / protein-expression / alice-cell-free-protein-expression), resulting in plasmid pLB0426 (aa sequence Seq ID No. 18). The amber codon was introduced in a loop structure previous to the sequence encoding for the chromophore at amino-acid position 50 of the eYFP , position 69 of the pALiCEOl strep-tagged eYFP construct, resulting in amino acid sequence (Seq ID No. 19; Insert 426; ), so fluorescence would only be observed upon correct introduction of the unnatural amino-acid. Consequently, a quantitative fluorescent signal is obtained allowing for reaction optimization. Fluorescence signal after reaction completion was measured using an Infinite M1000 device (Tecan Group Ltd.), with an excitation and emission wavelengths of 485 and 528nm, respectively. Results showing the incorporation efficiency of H-L-Tyr(Propargyl)-OH and H-L-Phe(4-N3)-OH at different tRNA and transferase concentrations are shown in Figures 5 and 6, respectively.

[0165] In order instances of this invention, the transferase could be co-expressed together with the protein of interest to be modified, or the tRNA could be transcribed in-vitro and exogenously added to a CFPS reaction. Alternatively, a CFPS reaction could be started containing only the transferase enzyme, the tRNA and the unnatural amino acid, and part of this reaction could be directly fed or purified and then fed into a new reaction expressing the protein of interest. Lastly a tRNA transcribed, and modified in-vitro with the unnatural amino acid could also be directly fed into an ALiCE® reaction expressing the protein of interest.

[0166] 2.4 Production and purification of unnatural and natural HBc VLP (VLP=Virus like particle) and RBD variants

[0167] The HBc VLP was used as the model VLP to be decorated with the influenza receptor-binding domain (RBD) antigens. Two versions of the HBc VLP were used: as a monomer without the C-terminal domain (aa 1 -149), and as a fused dimer known as “tandem-core”. The tandem core HBc VLP construct contains the first 149 amino acids of the HBc VLP, followed by a long flexible linker with the following sequence: GGSGGSGGSGGSGGSGGSGGS (part of Seq ID No. 26 and Seq ID No 27). After the linker, a second copy of the CDS of the HBc 1 -149aa is included (Peyret et al., 2015). For the two kinds of protein constructs, a C-terminal His-tag was included for purification. Best results were obtained for tandem-core HBc VLPs, so two constructs were built one with either an amber stop codon or a tyrosine residue at position 79 (at the MIR), resulting in constructs pLB0530 (Insert 530, Seq ID No. 24) and pLB0531 (Insert 531 , Seq ID No. 25) respectively, termed unnatural (Seq ID No. 26) and natural HBc VLPs (Seq ID No. 27). The natural HBc VLP variants were used in order to determine assembly properties and optimize purification conditions prior to their application to unnatural HBc VLPs. Purification via IMAC was performed under denaturing conditions, using the same procedure as previously described, but with the following modifications to the buffers: 2x denaturing IMAC Sample buffer (100 mM Phosphate buffer pH 8.5, 1 M NaCI, 8M Urea and 40mM imidazole), denaturing IMAC wash buffer (50mM phosphate buffer pH 8.5, 500Mm NaCI, 4M urea and 50mM imidazole), denaturing IMAC elution buffer (50mM phosphate buffer pH 8.5, 300mM NaCI, 4M urea and 250mM imidazole). VLP re-folding was performed by overnight dialysis into re-assembly buffer (50mM phosphate buffer pH 7, 800Mm NaCI). After re-assembly, resulting VLPs were concentrated, and buffer exchanged to PBS buffer using a 10OkDa concentrator tube (ThermofisherScientific). The unnatural HBc VLP purification process and final product is shown in Figure 7.

[0168] The influenza hemagglutinin RBD amino acid sequence (amino acids 63 to 286, (DuBois et al., 2011 ) ) for influenza A virus (A / Puerto Rico / 8-SV1 / 1934) was retrieved from NCBI (GenBank: ACO94826.1 ), codon optimized within the encoding nucleic acid sequence for expression in Nicotiana tabacum, and synthesized by IDT. The coding sequence was cloned into pALiCEOl for cytosolic ALiCE® expression. An N- and C-terminal Strep-tag was introduced for purification, in which an HRV-3C protease cleavage site was introduced prior linker sequences, resulting in the sequences:

[0169] MAWSHPQFEKGGSLEVLFQGPGGS*GGSGGSG (part of Seq ID No 15 and Seq ID No 17) & GGSGGS*GGSLEVLFQGPGGSAWSHPQFEK (part of Seq ID No 14 and Seq ID No 16), respectively. The (*) indicates either the amber stop codon or a tyrosine residue for the unnatural and natural RBD constructs, thus resulting in the following nucleic acid constructs Seq ID No 14: Sequence encoding for RBD with C-term Strep and amber codon at position indicated with * (insert 541 ) => aa Seq ID No. 20

[0170] Seq ID No 15: Sequence encoding for RBD with N-term Strep and amber codon at position indicated with * (insert 542) => aa Seq ID No. 21

[0171] Seq ID No 16: Sequence encoding for RBD with C-term Strep a Tyr residue at position indicated with * (insert 543) => aa Seq ID No. 22

[0172] Seq ID No 17: Sequence encoding for RBD with N-term Strep a Tyr residue at position indicated with *(insert 544) => aa Seq ID No. 23 All constructs have been cloned into expression plasmid pALiCEOl resulting in plasmid pLB0541 , pLB0542 (with the amber codon), pLB0543 and pLB0544 (with the tyrosine residue)].

[0173] Purification of the corresponding RBD protein constructs (Seq ID Nos. 20, 21 , 22 and 23) after expression in ALiCE® was performed as follows: the non-soluble fraction was solubilized in 2X denaturing strep sample buffer (200mM phosphate buffer pH 8.5, 300mM NaCI and 8M Urea), and diluted 1 :1. The resulting solution was filtered and loaded into a chromatographic column containing Strep-tactin XT (iba lifesciences) pre-equilibrated in 1x denaturing strep sample buffer. After washing with 1x strep denaturing sample buffer, protein was re-folded in column by changing the buffer to PBS+400mM arginine. Afterwards, 2x Strep buffer (200mM phosphate buffer pH 7.4, 300mM NaCI), was added to the soluble ALiCE® fraction, and the buffer in the column was changed to 1 x Strep buffer. The soluble fraction was then loaded into the same column and washed with 1 x Strep buffer. Bound proteins were eluted using 1x Strep elution buffer (100mM phosphate pH 7.4, 150mM NaCI and 50mM Biotin). Relevant fractions were combined and dialyzed to PBS prior to their concentration using 10kDa concentrator tubes (ThermofisherScientific). A representative figure for the unnatural RBD purification process and final product is shown in Figure 8.

[0174] The unnatural HBc VLP amber constructs were expressed using the optimal ALiCE® conditions with the azido-uaa, whereas the unnatural RBD amber constructs were expressed using the optimal conditions for the alkyno-uaa. Purification for each protein containing the unnatural amino acid was performed as previously described.

[0175] 2.5 CuAAC reaction and analysis

[0176] Copper(l)-catalysed azide-alkyne cycloaddition (CuAAC) reactions were performed by combining each of the coupling partners in a reaction vessel as to reach a molar ratio of 5:1 (unless otherwise indicated) alkyne-RBD to azide-VLP with a minimum protein concentration of 10pM for the Azido-VLP. Final CuAAC reaction conditions were 250pM CuSO4, 1.25 mM THPTA ligand, 5mM Na-Ascorbate, 500pM NiCI2 and 5mM aminoguanidine. Reactions were incubated for 2 hours at room temperature, and EDTA was added as to reach 10mM to stop the reaction. Reaction yields were then estimated via SDS-PAGE electrophoresis and gel densitometry analysis using GelAnalyzer software.

[0177] To determine if resulting RBD-VLPs conjugates formed proper VLP structures, Transmission Electron microscopy (TEM) was performed. For TEM analysis, formvar-carbon coated 400 mesh copper grids (SigmaAldrich) were glow discharged in vacuum for 20 s. 10 pl of each VLP suspension was placed on a grid and incubated for 2 min. Negative staining was performed with 1% (v / v) phosphotungstic acid (PTA, pH 7.2) for 1 min. The specimens were examined in a JEOL 1400 transmission EM equipped with a Matataki (2K x 2K). The Prometheus Panta (Nanotemper) device was utilized as per manufacturer instructions for DLS and stability analysis of the resulting samples.

[0178] 3. Hemagglutination assay

[0179] The basis of the hemagglutination assay is the process of hemagglutination, wherein sialic acid receptors on the surface of red blood cells (RBCs) interact with and bind to the hemagglutinin glycoprotein which are represented on the surface of viruses. Thereby a lattice structure or network, of interconnected RBCs and virus particles is formed which appears like fuzzy particles in solution.

[0180] Presently, chicken erythrocytes were purchased from Fiebig GmbH and washed three time with PBS supplemented with 2 mM Penicillin / Streptomycin. 50|_il samples were plated in 96- well round well plates at the indicated concentrations, and a 1 :1 dilution series was performed column-wise. Subsequently, 50|_il of 1 % (v / v) erythrocytes were added to each well, and the plate was incubated for 1 h at 4°C. Hemagglutination titre could then be measured by the last serial dilution that induces erythrocyte agglutination. Commercial inactivated influenza vaccine (kindly provided by Her Dr. Keul), and hemagglutinin protein (Abeam) were used as controls.

[0181] 4. animal models

[0182] For testing the functionality of the vaccines, BALB / c mice models were utilized, different configuration of the HBc VLP and RBD produced in ALiCE, either on their own, combined but unconjugated, and conjugated as described above are tested.

[0183] References

[0184] Armero-Gimenez, J., Wilbers, R., Schots, A., Williams, C., & Finnern, R. (2023). Rapid screening and scaled manufacture of immunogenic virus-like particles in a tobacco BY-2 cell- free protein synthesis system. Frontiers in Immunology, 14. https: / / doi.Org / 10.3389 / FIMMU.2023.1088852 / BIBTEX

[0185] Cui, Z., Johnston, W. A. and Alexandrov, K. Cell-Free Approach for Non-canonical Amino Acids Incorporation Into Polypeptides. Front Bioeng Biotechnol. 2020; 8: 1031. doi: 10.3389 / fbioe.2020.01031

[0186] Deiters, A., Cropp, T. A., Mukherji, M., Chin, J. W., Anderson, J. C., & Schultz, P. G. (2003). Adding amino acids with novel reactivity to the genetic code of Saccharomyces cerevisiae. Journal of the American Chemical Society, 125(39), 1 1782-11783. https: / / doi.Org / 10.1021 / ja0370037

[0187] DuBois, R. M., Aguilar-Yanez, J. M., Mendoza-Ochoa, G. I., Oropeza-Almazan, Y., Schultz- Cherry, S., Alvarez, M. M., White, S. W., & Russell, C. J. (2011 ). The Receptor-Binding Domain of Influenza Virus Hemagglutinin Produced in Escherichia coli Folds into Its Native, Immunogenic Structure. Journal of Virology, 85(2), 865-872. https: / / doi.Org / 10.1128 / JVI.01412-10

[0188] Gupta, M. Das, Flaskamp, Y., Roentgen, R., Juergens, H., Armero-Gimenez, J., Albrecht, F., Hemmerich, J., Arfi, Z. A., Neuser, J., Spiegel, H., Schillberg, S., Yeliseev, A., Song, L., Qiu, J., Williams, C., & Finnern, R. (2023). Scaling eukaryotic cell-free protein synthesis achieved with the versatile and high-yielding tobacco BY-2 cell lysate. Biotechnology and Bioengineering, 120(10), 2890-2906. https: / / doi.org / 10.1002 / BIT.28461

[0189] Kao, C., Rudisser, S., & Zheng, M. (2001 ). A Simple and Efficient Method to Transcribe RNAs with Reduced 3' Heterogeneity. Methods, 23(3), 201-205. https: / / doi.org / 10.1006 / METH.2000.1131

[0190] Kao, C., Zheng, M., & Rudisser, S. (1999). A simple and efficient method to reduce nontemplated nucleotide addition at the 3 terminus of RNAs transcribed by T7 RNA polymerase. RNA (New York), 5(9), 1268-1272. https: / / doi.org / 10.1017 / s1355838299991033 Kiga, D., Sakamoto, K., Kodama, K., and Yokoyama, S., “An engineered Escherichia coli tyrosyl-tRNA synthetase for site-specific incorporation of an unnatural amino acid into proteins in eukaryotic translation and its application in a wheat germ cell-free system” July 3, 2002, 99 (15) 9715-9720 https: / / doi.org / 10.1073 / pnas.142220099

[0191] Krahn N., Tharp J.M., Crnkowic A., Soil D., “Chapter Twelve - Engineering aminoacyl-tRNA synthetases for use in synthetic biology”; The Enzymes, Volume 48, 2020, Pages 351-395, https: / / doi.org / 10.1016 / bs.enz.2020.06.004

[0192] Nixdorf, D., Sponheimer, M., Berghammer, D., Engert, F., Bader, II., Philipp, N., Kazerani, M., Straub, T., Rohrbacher, L., Wange, L., Dapa, S., Atar, D., Seitz, C. M., Brandstetter, K., Linder, A., von Bergwelt, M., Leonhardt, H., Mittelstaet, J., Kaiser, A., Bucklein, V. and Subklewe, M. Adapter CAR T cells to counteract T-cell exhaustion and enable flexible targeting in AML. Leukemia (2023) 37:1298-1310; https: / / doi.org / 10.1038 / s41375-023-01905-0

[0193] Peyret, H., Gehin, A., Thuenemann, E. C., Blond, D., El Turabi, A., Beales, L., Clarke, D., Gilbert, R. J. C., Fry, E. E., Stuart, D. I., Holmes, K., Stonehouse, N. J., Whelan, M., Rosenberg, W., Lomonossoff, G. P., & Rowlands, D. J. (2015). Tandem fusion of hepatitis B core antigen allows assembly of virus-like particles in bacteria and plants with enhanced capacity to accommodate foreign proteins. Pios One, 10(4), e0120751. https: / / d0i.0rg / l 0.1371 / journal. pone.0120751

[0194] Quast, R. B., Claussnitzer, I., Merk, H., Kubick, S., Gerrits, M., “Synthesis and site-directed fluorescence labeling of azido proteins using eukaryotic cell-free orthogonal translation systems”, Anal Biochem. 2014 Apr 15:451 :4-9. Doi: 10.1016 / j.ab.2O14.01 .013.

[0195] Sanderson, B. A., Araki, N., Lilley, J. L., Guerrero, G., & Lewis, L. K. (2014). Modification of gel architecture and TBE / TAE buffer composition to minimize heating during agarose gel electrophoresis. Analytical Biochemistry, 454, 44-52. https: / / doi.Org / 10.1016 / j.ab.2014.03.003

Claims

Claims1 . A method for a cell-free manufacture of an artificial protein comprising at least one unnatural amino acid (uaa) in at least one predetermined position of the artificial protein, the method comprises: transcription of a nucleic acid sequence encoding for (template) a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position, translation of a transcribed mRNA sequence into a nascent polypeptide, comprising i) incorporation of the at least one uaa into the nascent polypeptide at the predetermined position encoded by the at least one non-sense codon, wherein• a suppressor transfer RNA (tRNA) carrying the uaa specifically interacts with the at least one non-sense codon of the mRNA sequence, and• a site-specific incorporation of the uaa into the nascent polypeptide at the position encoded by the at least one non-sense codon in the mRNA occurs, and achieving the artificial protein comprising the at least one uaa in the at least one predetermined position of the artificial protein.

2. The method of claim 1 , wherein the at least one uaa is chemically linked to the suppressor tRNA.

3. The method of claim 1 , wherein a step of ii) transferring the at least one uaa to the suppressor tRNA by means of an aminoacyl transferase or by a flexizyme is performed.

4. The method of claim 3, wherein the aminoacyl transferase is derived from Escherichia coli, Methanosarcina mazei, Methanosarcina barkeri or Methanococcus jannaschii, is an isolated and / or genetically modified aminoacyl transferase derived from Escherichia coli, Methanosarcina mazei, Methanosarcina barkeri or Methanococcus jannaschii.

5. The method of any one of the claims 1 to 4, wherein the non-sense codon is a stop codon, a four base codon, a re-assigned sense codon, an unnatural base pair or an amber codon, preferably the non-sense codon is an amber codon, most preferably the amber codon is TAG or LIAG.

6. The method of any one of the claims 1 to 5, wherein the manufacture of the artificial protein is performed by means of a protein machinery derived from a eukaryotic species, preferably from a plant.

7. The method of any one of the claims 1 to 6, wherein the cell-free manufacture is performed with a cell-free lysate comprising a protein machinery derived from a nonhuman eukaryotic species, preferably from a plant.

8. The method of any one of the claims 1 to 7, wherein the cell-free manufacture is performed with a cell-free lysate comprising a protein machinery derived from a plant, preferably from a plant of the genus Nicotiana of the family Solanaceae, most preferably the plant is N. tabacum, most preferably a BY-2 cell line from N. tabacum.

9. The method of any one of the claims 1 to 8, wherein a step of post-translational modification of the nascent polypeptide is performed.

10. The method of any one of the claims 1 to 9, wherein a co-transcription a) of the nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position, b) of the nucleic acid sequence encoding for the aminoacyl transferase and / or c) of the nucleic acid sequence encoding for the suppressor tRNA is performed or co-transcription of any combination of a), b) and c) is performed.11 . The method of any one of the claims 1 to 10, wherein a co-translation a) of the mRNA that encodes for a predetermined amino acid sequence comprising the at least one non-sense codon (Target) and b) of the mRNA that encodes for the aminoacyl transferase is performed.

12. The method of any one of the claims 1 to 11 , wherein the expression of the aminoacyl transferase is performed a) simultaneously with the cell-free manufacture of the artificial protein within one reaction mixture, or b) within a spatially and temporally independent expression step, and subsequently the achieved tRNA transferase is added to the cell-free manufacture of the artificial protein, or c) the tRNA transferase is added as an active component to the cell-free manufacture of the artificial protein.

13. The method of any one of the preceding claims, wherein the at least one uaa comprises a functional group conferring a predetermined function to the artificial protein.

14. The method of any one of the preceding claims, wherein the predetermined function of the at least one uaa comprises fluorescence, takes part in post-translational modification, in stabilization of the artificial protein and / or in bioorthogonal chemistry reactions.

15. The method of any one of the preceding claims, wherein the predetermined function of the at least one uaa is mediated by a modification comprising a fluorophore, a hapten of a hapten pair, a phosphoryl-group, a hydroxy-group, a methyl-group, a sugar- residue, a reactive chemical group comprising acidic groups, hydrophobic groups, nucleophilic groups, azido residues, alkyne residues, an alkyl-groups, alkyno groups, alkene groups, photocaged or photo-switchable groups or any combination thereof.

16. The method of any one of the preceding claims, wherein the unnatural amino acid encompasses derivates and analogue of any of the common twenty amino acids, derivates and analogue of Methionine, tyrosine, phenylalanine, leucine, glycine, lysine, pyrrolysine, serine, Triptophan, proline, phenylalanine, and comprises uaa such as azido phenylalanine, 3-iodo-L-tyrosine, O-methyl-L-tyrosine, a paraacyl-L- phenylalanine, or a para-azido-L-phenylalanine, beO-Propargyl-L-tyrosine, 4-azidomethyl-L-phenylalanine, O-2-azidoethyl-tyrosine, 4-Azido-L-phenylalanine, 6-azidohexanoic acid, N-E-[(2-azidoethoxy)carbonyl]- L-Lysine and 2-amino-hexanoic acid preferably, the uaa is selected from O-Propargyl-L-tyrosine and 4-Azido-L- phenylalanine17. The method of any one of the preceding claims, wherein the artificial protein is a soluble protein, soluble linear protein, soluble three-dimensional protein, membrane protein, receptor binding domain, peplomer, glycoprotein, Spike-Protein, protein based immunomodulating molecule, transmembrane protein, an antibody, an antibody fragment, fc fragment, fab fragment, receptors, an antigen, an antigen binding domain, an extracellular domain of an antigen, an epitope domain, or any other polypeptide, respectively comprising at least one unnatural amino acid at a predetermined position.

18. The method of any one of the preceding claims, wherein the method further comprises a step of linking the at least one artificial protein via the incorporated at least one unnatural amino acid to at least one other molecule carrying a reactive chemical group suitable for linking with the at least one artificial protein.

19. The method of claim 18, wherein the at least one artificial protein is linked by means of a chemical linking reaction via a functional group of the at least one unnatural amino acid with the reactive chemical group of the other molecule.

20. The method of claim 18 or 19, wherein the reactive chemical group of the other molecule is part of an unnatural amino acid.21 . The method of any one of the claims 18 to 20, wherein the linking reaction between the at least one uaa of the artificial protein and the reactive chemical group of the at least one other molecule is mediated via a Copper-catalyzed azide-alkyne cycloaddition (CuAAC), photoclick, Strain-promoted azide-alkyne cycloaddition (SPAAC) or an inverse electron demand Diels-Alder (IEDDA) reaction.

22. The method of any one of the claims 18 to 21 , wherein the other molecule comprises pharmaceutical active agents, chemotherapeutic drugs, none-protein molecules, another protein or any fragment thereof, immune response mediating molecules, particles, virus like particles (VLP) or other (biobased biological) nanoparticles comprising a protein shell, respectively carrying at least one reactive chemical group suitable for the linking with the at least one uaa of the artificial protein.

23. The method of any one of the preceding claims, wherein the other molecule comprising the reactive chemical group is added to the linking reaction or it is synthesized by means of the cell-free manufacture according to any one of the claims 1 to 17, preferably either simultaneously within one reaction mixture or within a separate reaction mixture spatially and temporally independent from the cell-free manufacture of the artificial protein.

24. The method of any one of the claims 19 to 23, wherein the artificial protein is selected from the group comprising an antigen, an extracellular domain of an antigen, an epitope domain, or any antigen fragment respectively comprising the at least one uaa, and the artificial protein is linked via the at least one uaa with at least one uaa of the at least one VLP.

25. The method of any one of the preceding claims, wherein a sufficient amount of the artificial protein is linked to at least one or more and up to all accessible unnatural amino acids of the at least one VLP.

26. A conjugate obtained by the method according to any one of the claims 18 to 25, wherein the conjugate comprises- at least one artificial protein obtained by the method according to any one of the claims 1 to 15, comprising at least one uaa with a reactive chemical group, and- at least one other molecule, wherein the artificial protein and the other molecule are covalently linked via their reactive chemical groups to each other.

27. An artificial eukaryotic cell-free translation system for incorporation of at least one unnatural amino acids into a predetermined amino acid sequence comprising i) ribosomes derived from a eukaryotic species, preferably provided in a eukaryotic cell-free lysate, preferably derived from a non-human species, more preferably derived from a plant. ii) an aminoacyl-tRNA-Synthetase capable of transferring an unnatural amino acid into the suppressor tRNA, and iii) a suppressor tRNA that specifically recognizes a non-sense codon in a mRNA sequence encoding for the predetermined amino acid sequence.

28. The artificial eukaryotic cell-free translation system of claim 27, wherein it further comprises iv) at least one unnatural amino acid, preferably in an amount sufficient for incorporation into the amount of amino acid sequence molecules synthesized from the amount of mRNA molecules encoding for the predetermined amino acid sequence.

29. A combination of nucleic acid constructs comprising ii) a nucleic acid sequence encoding for a suppressor tRNA that specifically recognizes a non-sense codon, and / or iii) a nucleic acid sequence encoding for an aminoacyl transferase, and / or iv) optionally a raw plasmid for genetic modification to achieve a plasmid carrying the nucleic acid sequence encoding for a predetermined amino acid sequence (Target), wherein the nucleic acid sequence comprises at least one non-sense codon in at least one predetermined position.

30. A Kit for the manufacture of an artificial protein in a cell-free system, the kit comprises the artificial eukaryotic cell-free translation system according to any one of the claims 27 or 28, and / or the combination of nucleic acid constructs of claim 29.

Citation Information

Patent Citations

  • Methods of genetically encoding unnatural amino acids in eukaryotic cells using orthogonal trna / synthetase pairs

    EP2155890A1

  • Incorporation of unnatural amino acids

    EP2796546B1

  • Unnatural reactive amino acid genetic code additions

    US7888063B2

  • Unnatural reactive amino acid genetic code additions

    WO2005003294A2

  • Dual charging system for selectively introducing non-native amino acids into proteins using an in vitro synthesis method

    WO2010081110A1