Quality control marker for megakaryocyte

By employing miRNA switches and KAT7 regulation, the variability in megakaryocyte quality is addressed, ensuring consistent and high-quality platelet production through the identification and management of immune-biased subpopulations in megakaryocytes.

WO2025183123A1PCT designated stage Publication Date: 2025-09-04KYOTO UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/007000
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-27
Filing Date
2025-02-27
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

The heterogeneity in megakaryocyte quality, particularly in immortalized megakaryocytic cell lines (imMKCLs), leads to variability in platelet production efficiency and quality, complicating the standardization of ex vivo iPSC-derived platelet production, with factors like cellular senescence and immune-biased properties contributing to reduced productivity.

Method used

The use of miRNA switches to identify subpopulations with heterogeneous miRNA activity, specifically targeting let-7a-5p and let-7g-5p miRNAs, and the regulation of lysine acetyltransferase 7 (KAT7) to maintain megakaryocyte quality, along with the development of quality control markers such as Ral and Kat7 proteins, to assess and improve megakaryocyte quality.

Benefits of technology

Enables stable and high-quality platelet production by identifying and regulating immune-biased megakaryocyte subpopulations, thereby enhancing the efficiency and standardization of iPSC-PLT production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

The present invention provides a quality control marker for a megakaryocyte, the marker comprising, for example, a transcript or protein of a RAS like proto-oncogene (Ral) gene. The present invention also provides a method for evaluating the quality of a megakaryocyte, the method including a step for detecting one or more of the biomarkers in the megakaryocyte.
Need to check novelty before this filing date? Find Prior Art

Description

Megakaryocyte quality control marker

[0001] The present invention relates to a quality control marker for megakaryocytes. More specifically, the present invention relates to a quality control marker for megakaryocytes that consists of a transcription product or protein of the Ral gene.

[0002] Despite ongoing supply shortages due to various factors, including viral contamination, alloimmune transfusion refractoriness, and the recent COVID-19 pandemic, donor-dependent platelet transfusions have become standard medical practice. In this context, we adopted a strategy of ex vivo blood product production using human induced pluripotent stem cells (iPSCs). We developed an immortalized megakaryocytic cell line (imMKCL) as the starting cell source for ex vivo iPSC-derived platelet (iPSC-PLT) production (Non-Patent Documents 1 and 2). imMKCL showed sustained proliferation over several months in the presence of doxycycline (DOX), released iPSC-PLTs after DOX removal, and were cultured in a turbulent flow bioreactor for 10 years. 11 It is possible to generate more than 100 iPSC-PLTs (Non-Patent Document 3). Based on these results, the present inventors initiated the world's first clinical trial, the iPLAT1 clinical trial (Non-Patent Documents 4-6). iPLAT1 showed promising results without significant side effects, but transient increases in D-dimer levels and white blood cell counts were observed after transfusion of the maximum dose (Non-Patent Document 4). These observations suggest the involvement of recently identified immune-biased megakaryocytes (Non-Patent Documents 7 and 8), raising concerns about the quality control of imMKCL as master cells. However, the present inventors found considerable variability in the quality of imMKCL clones with respect to proliferation and iPSC-PLT production capacity (Non-Patent Document 9). Specifically, certain imMKCL clones exhibiting cellular senescence exhibited reduced ability to produce iPSC-PLTs, but this ability was restored by knockdown of p53 and CDKN1A (Non-Patent Document 9). However, the molecular factors underlying this heterogeneity, which significantly hinders the efficiency and standardization of iPSC-PLT production, remain unclear.

[0003] Takayama, N. et al. J Exp Med 207, 2817-2830 (2010)Nakamura, S. et al. Cell Stem Cell 14, 535-548 (2014)Ito, Y. et al. Cell 174, 636-648.e618 (2018)Sugimoto, N. et al. Blood 140, 2398-2402 (2022)Sugimoto, N. et al. Blood Adv 6, 6056-6069 (2022)Chen, SJ, Sugimoto, N. & Eto, K. Int J Hematol 117, 349-355 (2023)Wang, H. et al. Cell Stem Cell 28, 535-549.e538 (2021) Sun, S. et al. Blood 138, 1211-1224 (2021)Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021)

[0004] Therefore, an objective of the present invention is to provide a biomarker or the like that can control the quality of megakaryocytes by elucidating the molecular factors underlying the heterogeneity.

[0005] While conducting a study using megakaryocytes (MK), one of the members of the present inventors' research team encountered a lack of reproducibility in platelet production efficiency. The inventors investigated the cause of this lack of reproducibility and discovered that the megakaryocytes had been cultured for a long period of time, causing them to age. Analysis of RNA-seq data revealed that culturing megakaryocytes for a long period of time aged the megakaryocytes and enhanced their immune properties. This led to the idea that elucidating the mechanism of megakaryocyte aging could help maintain the quality of megakaryocytes. To elucidate this mechanism, the inventors focused on microRNAs.

[0006] MicroRNAs (miRNAs) are small non-coding RNAs that negatively regulate the stability and translation of target mRNAs by binding to complementary mRNA sequences. In hematopoietic cells, miRNAs have been shown to play important roles in cell fate determination and function (Mehta, A. & Baltimore, D. Nat Rev Immunol 16, 279-294 (2016)). Based on evidence that DNA-based genetic circuits rely on miRNA activity, rather than miRNA expression, to regulate protein expression (Mullokandov, G. et al. Nat Methods 9, 840-846 (2012)), we developed an innovative biotechnology method, the miRNA switch, that enables the identification of specific cell types (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015); Fujita, Y. et al. Sci Adv 8, eabj1793 (2022)). The miRNA switch can detect endogenous miRNA activity and distinguish heterogeneous cell populations without the need for antibody labeling. This technology has proven successful in various cell types, including iPS cell-derived hepatocytes, endothelial cells, and cardiomyocytes (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)), mouse embryonic stem cell (ESC)-derived neurons (Sunohara, T. et al. Front Neurosci 13, 1141 (2019)), and undifferentiated human ES cells and iPS cells (Parr, CJ et al. Sci Rep 6, 32532 (2016)).

[0007] Therefore, we hypothesized that miRNA switches could be used to identify subpopulations of imMKCLs with heterogeneous miRNA activity (i.e., gradients of miRNA activity). First, we screened a library containing 269 target miRNA switches and identified let-7a-5p and let-7g-5p miRNAs, which exhibit heterogeneous activity among imMKCLs. Through transcriptional analysis of imMKCL subpopulations with high and low let-7 activity (hereafter referred to as "let-7 high" and "let-7 low," respectively), we discovered that let-7 low imMKCLs exhibit immune-skewed transcriptional signatures. Further studies revealed that let-7a-5p and its downstream target, RALB (RAS-like proto-oncogene B), play an important role in regulating the "immune" megakaryocyte lineage commitment within imMKCLs. Importantly, the present inventors elucidated that dysregulation of immune characteristics / subpopulations within imMKCLs, along with secretion of inflammatory cytokines, leads to growth arrest and reduced quality due to impaired iPSC-PLT production.

[0008] Furthermore, in our search for factors underlying immune-biased imMKCL, we focused on lysine acetyltransferase 7 (KAT7, also known as HBO1 and MYST2), a key member of the MYST family of histone acetyltransferases, which are essential for chromatin modification and gene regulation. KAT7 forms complexes with proteins such as MEAF6, ING4 / 5, JADE, and BRPF, and functions to acetylate histone H3 at lysine 14 and histone H4 at lysines 5, 8, and 12 (Yokoyama A. et al. BiochimBiophys Acta Gene Regul Mech. 2024 Sep;1867(3):195045). Analysis of the function of KAT7 in imMKCL revealed that it plays a critical role in suppressing the immune-biased properties of imMKCL. Specifically, KAT7 is important for maintaining the cell cycle of imMKCL and, by maintaining their proliferative potential, influences platelet production during later maturation. In imMKCL, platelets are produced from the proliferation phase G1 or G2 / M. However, it has been revealed that in aged imMKCL, KAT7 is reduced, IL-8 or TNF-α secretion is increased, the transition from G1 or G2 / M to G0 is accelerated, the cell cycle is arrested, and platelet formation from the G1 or G2 / M phase is reduced. Based on these findings, the present inventors conducted further research and completed the present invention.

[0009] That is, the present invention provides the following: [1] A quality control marker for megakaryocytes, comprising a transcription product or protein of the Ral (RAS-like proto-oncogene) gene. [2] The marker according to [1], wherein the Ral gene is the RalB (RAS-like proto-oncogene B) gene. [3] A quality control marker for megakaryocytes, comprising a transcription product or protein of the Kat7 (lysine acetyltransferase 7) gene, or an acetylated histone protein that is a target of the Kat7 protein. [4] A method for evaluating the quality of megakaryocytes, comprising the step of detecting one or more of the biomarkers according to any one of [1] to [3] in megakaryocytes. [5] The method according to [4], comprising the step of detecting a transcription product or protein of the RalB gene and a transcription product or protein of the Kat7 gene in megakaryocytes. [6] The method of [4] or [5], comprising: (1) measuring the abundance or activity of one or more biomarkers according to any one of [1] to [3] in a subject's megakaryocytes; and (2) evaluating the quality of the megakaryocytes based on the values ​​measured in step (1). [7] The method of [4] or [5], wherein the markers are detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Ral gene, or an antibody that specifically recognizes the Ral protein. [8] The method of [4] or [5], wherein the markers are detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is a target of the Kat7 protein. [9] The method of any one of [4] to [7], wherein the megakaryocytes are derived from pluripotent stem cells.

[10] A quality control kit for megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Ral gene, or an antibody that specifically recognizes the Ral protein.

[11] A quality control kit for megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is a target of the Kat7 protein.

[12] A method for producing megakaryocytes of improved quality, comprising a step of culturing megakaryocytes in a medium containing a Ral inhibitor.

[13] The method described in

[12] , wherein at least one of the Ral inhibitors is an inhibitor of RBC8 or Ral expression.

[14] A method for producing megakaryocytes of improved quality, comprising a step of increasing the abundance of Kat7 protein in megakaryocytes.

[15] The method described in any one of

[12] to

[14] , wherein the megakaryocytes are derived from pluripotent stem cells.

[16] Megakaryocytes evaluated by the method described in any one of [4] to [9], or megakaryocytes obtained by the method described in any one of

[12] to

[15] . [17-1] A method for producing platelets, comprising a step of maturing the megakaryocytes described in

[16] . [17-2] The method according to [17-1], which comprises a shaking culture step. [17-3] The method according to [17-1] or [17-2], wherein the medium comprises a Ral inhibitor.

[18] Platelets obtained by the method according to any one of [17-1] to [17-3]. [19-1] A blood product comprising the cells according to

[16] or

[18] . [19-2] The agent according to [19-1], for treating or preventing a blood disease or bleeding.

[20] A method for treating or preventing a blood disease or bleeding, comprising administering or transplanting an effective amount of the cells according to

[16] or

[18] into a mammal.

[21] The cells according to

[16] or

[18] , for use in treating or preventing a blood disease or bleeding.

[22] Use of the cells according to

[16] or

[18] in the manufacture of a medicament for treating or preventing a blood disease or bleeding.

[0010] The present invention makes it possible to control and evaluate the quality of megakaryocytes, which may enable a stable supply of high-quality platelets.

[0011] A miRNA switch-based screen identified endogenously active miRNAs in imMKCLs. (a) Schematic diagram of the miRNA switch design. The mRNA consists of an antisense sequence of the target miRNA and a reporter transgene. In the presence of an active target miRNA, reporter gene expression is suppressed. (b) Design of the miRNA switch for imMKCLs. A pair of mRNA encoding tagBFP, which contains an antisense sequence of the miRNA target in its 5' UTR, and Azami Green protein mRNA was synthesized in vitro. These two mRNAs were cotransfected into imMKCLs using lipofection. 24 hours after transfection, cells were analyzed by flow cytometry, and miRNA activity in imMKCLs was identified by screening. (c) Representative dot plot of target miRNA activity in imMKCLs. Activated miRNAs were shown to reduce TagBFP expression. (d) Flow cytometry analysis of endogenously active target miRNAs in imMKCLs. We performed miRNA switch-based screening of a library containing 269 miRNA switches (Table 1) and identified 24 miRNAs with endogenous activity in imMKCLs. The let-7 miRNA enabled the identification of immune-biased imMKCLs. (a) The let-7a-5p or let-7g-5p miRNA switch identified heterogeneous response activity within imMKCLs, resulting in let-7 hypo- and let-7 hyper-responsive subpopulations. (b) Schematic diagram showing the bulk RNA-seq sampling workflow. The let-7a-5p and let-7g-5p switches were transfected into imMKCLs, and let-7 hypo- and hyper-responsive cells were selected by flow cytometry. Three different imMKCL clones (clone 7, clone 7-3, and M35-1) were used for bulk RNA-seq analysis. Bar graphs showing the results of gene sets enrichment analysis (GSEA) of the top enriched immune-related gene sets in let-7-hyporesponsive imMKCLs at the proliferation (c) and maturation (d) stages.GSEA plot of a representative enriched immune-related gene set during the proliferation phase (e) and maturation phase (g). Heatmap of the top differentially expressed TNF targets in let-7-hyperresponsive and -hyperresponsive imMKCLs during the proliferation phase (f) and maturation phase (h). (a) Expression levels of let-7a-5p and let-7g-5p were measured by RT-qPCR in let-7 high / low imMKCLs (clone 7). Expression levels were normalized to RNU6B (U6). Sampling was performed 48 hours after sorting. Data are shown as mean ± standard error of the mean (SEM) from three independent experiments. (b) Clone 7-3 is an older stock with the same genetic background as clone 7. (c) iPSC-PLT production from let-7 high / low imMKCLs under quiescent conditions. After sorting, cells were directly advanced to the DOX-OFF step. Three different imMKCL clones were used. Data are shown as mean ± SEM from three independent experiments. Student's t test was used to assess statistical significance. * P < 0.05. CD34 derived from in vitro-induced ESCs. +Hematopoietic progenitor cells (HPCs) exhibited an immune-biased transcriptional signature in the let-7 low subpopulation. (a) Schematic of ESC-derived HPC derivation by the Sac method. (b) GSEA plot of immune-related gene sets significantly enriched in let-7 low ESC-derived HPCs. (c) Heatmap of gene sets enriched in the same cells. Single-cell RNA-seq analysis revealed the existence of a transcriptionally distinct immune-biased subpopulation enriched in let-7a-5p hyporesponsive imMKCLs. (a) Uniform manifold approximation and projection (UMAP) visualization of imMKCLs (clone 7), color-coded by let-7a-5p hyper- and hypo-responsive imMKCLs (top) and imMKCL subclusters (bottom). (b) Distribution of let-7a-5p hypo- and hyper-responsive cells within each cluster (left) and bar graphs showing the distribution of let-7a-5p hypo- and hyper-responsive cells within each cluster (right). (c) Relative expression levels of the top 10 differentially expressed genes (DEGs) in each cluster. (d) Representative Gene Ontology (GO):Biological Process (BP) terms enriched in each cluster. (e) Typical immune-related GO:BP terms in each cluster. (f) Violin plot showing the expression levels of typical platelet production- and immune-related genes in each cluster. Let-7a-5p plays a functional role in the development of immune-biased subsets in imMKCLs. (a) Schematic diagram of the experimental workflow using specific let-7a-5p inhibitors. (b) Expression levels of let-7a-5p in imMKCLs (clone 7) treated with a negative control or a let-7a-5p inhibitor. Expression levels were measured by qRT-PCR and normalized to the endogenous control RNU6B (U6). (c) The activity pattern of let-7a-5p was analyzed by FACS.(d) Inhibition of let-7a-5p induced increased IL-8 secretion from imMKCLs during the proliferation phase (DOX-ON). After transfection with a let-7a-5p inhibitor or negative control, imMKCLs were incubated for 24 hours in the absence or presence of LPS (50 ng / mL) during the proliferation phase. Proinflammatory molecules were measured in the supernatant by cytometric bead array. (e) Inhibition of let-7a-5p in imMKCLs (clone 7) increased the mRNA expression levels of marker genes identified in clusters 3 and 5 (Figure 5). mRNA expression levels were measured by qRT-PCR and normalized to GAPDH. Data are shown as mean ± SEM from three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. RALB is a target of let-7a-5p in the development of immune-biased imMKCLs. (a) Flowchart of upstream regulator analysis. (b) Bar graph showing the top 10 upstream regulators of clusters 3 and 5 identified by ingenuity pathway analysis (IPA) based on the scRNA-seq dataset. (c) Identification of eight potential upstream regulators by comparing the common upstream regulators of clusters 3 and 5 with predicted has-let-7a-5p targets. (d) Violin plot showing the expression levels of identified upstream regulators in each cluster. The regulators CUX1 and RALB, which showed elevated expression levels in let-7a-5p-hyperresponsive cells (clusters 3 and 5), are colored gray. (e) Let-7a-5p binding sites on CUX1 and RALB predicted by TargetScan. The sequences in the figure are listed as SEQ ID NOs: 41 to 43, from top to bottom. (f) In imMKCLs, let-7a-5p inhibition induced CUX1 and RALB mRNA expression. (g) Lentivirus-mediated overexpression of RALB increased RALB mRNA expression in both the proliferation (DOX-ON) and maturation (DOX-OFF) stages.(h) Overexpression of RALB induced the expression of interferon signaling genes. (i) Schematic diagram of the let-7 miRNA-RALB axis regulating interferon signaling in imMKCLs. Data are shown as the mean ± standard deviation (SD) of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05, **P < 0.01. (a) Lentivirus-mediated overexpression of CUX1 (O / E) increased CUX1 mRNA expression in both the proliferation (DOX-ON) and maturation (DOX-OFF) stages of imMKCLs (clone 7). (b) Overexpression of CUX1 did not affect the mRNA expression of ISG15 or IFIT3. Expression levels were normalized to GAPDH. (c) Expression of let-7a-5p was not significantly altered by CUX1 overexpression. Expression levels were normalized to RNU6B. Neither proliferation rate (d) nor iPSC-PLT production (e) was affected by CUX1 overexpression. Data are shown as mean ± SEM from three independent experiments. (a) Intracellular protein expression of RALB (mean fluorescence intensity, MFI) detected in mock or RALB-overexpressing imMKCLs (O / E RALB) by intracellular flow cytometry. (b) RALB expression was compared using histogram overlay. (c) Similar levels of let-7a-5p expression were observed in mock and RALB-overexpressing imMKCLs. (d) RALB overexpression did not significantly affect the expression of genes related to MK maturation. Bar graphs show gene FPKM values. Data are shown as mean ± SEM from three independent experiments. Dysregulation of immune characteristics is associated with growth arrest and impaired iPSC-PLT production in imMKCL clones. (a) Schematic showing the correlation between proliferation and iPSC-PLT production from a previous study (Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021)). (b) GSEA plot showing the enriched set of TNF signaling and interferon response genes in low- to medium-quality clones compared to high-quality clones.(c) Fold change in proliferation and cell number for clone 7 and clone 7-3 at day 14. (d) iPSC-PLT production from clone 7 and clone 7-3 under static or turbulent flow conditions. (e) Representative flow cytometry plots of iPSC-PLTs generated from clone 7 and clone 7-3 under static or turbulent flow conditions. (f) GSEA plot showing enriched TNF signaling and interferon response gene sets in clone 7-3. (g) Clone 7-3 shows elevated RALB mRNA expression compared to clone 7. (h) IL-8 secretion from clone 7 and clone 7-3 during the proliferation phase. Data are shown as mean ± SEM from three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05, **P < 0.01. GSEA plot (a) and heatmap (b) showing that low- to moderate-quality clones are enriched for senescence- and aging-related gene sets compared to high-quality clones. (c) Heat map of immune-related gene sets enriched in low- to medium-quality clones. (d) Expression levels of RALB in clones of different quality. (a) Flow cytometry analysis of let-7a-5p activity patterns in clone 7 and clone 7-3 using miRNA switch technology. (b) Heat map of gene sets enriched in clone 7-3. Let-7 low cells from each clone were compared. (c) GSEA plot showing enrichment of downregulated senescence-associated TP53 targets in clone 7-3 compared to clone 7. (d) Clone 7-3 showed elevated expression levels of genes encoding inflammatory cytokines compared to clone 7. (a) Representative flow cytometry plot of iPSC-PLTs generated from clone 7 in the presence of human recombinant IL-8 at the indicated concentrations. (b) Flow cytometry analysis of ploidy. (c) iPSC-PLT production under the indicated conditions. (d) Molecular structure of Reparixin, a specific inhibitor of CXCR1 / 2. (e) iPSC-PLT production under the conditions indicated in the figure.(f) Representative flow cytometry plots of iPSC-PLTs generated from imMKCLs (clone 7) overexpressing RALB in the presence of Reparixin at the indicated concentrations. (g) Flow cytometry analysis of ploidy. Data are shown as mean ± SD from three independent experiments. Statistical significance was assessed using one-way ANOVA with multiple comparisons. *P < 0.05. Administration of human recombinant interferon-α2a dose-dependently suppressed imMKCL proliferation (a) and iPSC-PLT production (b). imMKCLs (clone 7) were treated with human IFN-α2a at concentrations of 0, 1, 10, or 100 ng / mL. (c) Induction of mRNA expression of interferon-related genes and CDKN2A in imMKCLs. mRNA expression levels were measured by RT-qPCR and normalized to GAPDH. (d) Representative flow cytometry plots of iPSC-PLTs generated under the indicated conditions. Statistical significance was assessed using one-way analysis of variance (ANOVA) with multiple comparisons or a two-tailed Student's t-test. * P < 0.05, ** P < 0.01, *** P < 0.001. Overexpression of RALB reduces the proliferation and iPSC-PLT production capacity of imMKCLs, possibly due to the induction of dysregulation of immune properties. Lentiviral overexpression of RALB (O / E) results in growth arrest (a) and impaired iPSC-PLT production (b) in imMKCLs (clone 7). (c) Representative flow cytometry plots of iPSC-PLTs generated from MOCK and O / E RALBs under static and turbulent flow conditions. (d) O / E RALBs secreted greater amounts of IL-8 than MOCK imMKCLs. (e) GSEA plot showing enriched TNF signaling and interferon-responsive gene sets in O / E RALB imMKCL. (f) Gene expression correlation analysis between RALB and immune-related genes. Data are shown as mean ± SEM of three independent experiments.(a) GSEA plot and heat map showing the enriched senescent- and aging-related gene sets in imMKCLs overexpressing RALB (O / E RALB imMKCL) compared to mock. (b) Heat map of the enriched gene sets in O / E RALB (clone 7). (a) Molecular structure of RBC8, a specific inhibitor of RALA and RALB. (b) Administration of 0.1 μM RBC8 suppressed the proliferation of imMKCLs (clone 7). (c) iPSC-PLT production under the conditions indicated. (d) Representative flow cytometry plot of iPSC-PLTs generated from imMKCLs overexpressing RALB (clone 7) in the presence or absence of RBC8. (e) Flow cytometry analysis of ploidy. (f) siRNA-mediated knockdown of RALB improved iPSC-PLT production in imMKCLs (clone 7). Cells were transfected with RALB-targeting siRNA (siRALB) or a non-targeting control (siNT). (g) Representative flow cytometry plots of iPSC-PLTs generated from siNT or siRALB. (h) Knockdown of RALB did not significantly affect IL-8 secretion during maturation. (i) Relative mRNA expression of the indicated genes in imMKCLs was assessed 48 hours after the transfection procedure. mRNA expression levels were measured by RT-qPCR and normalized to GAPDH. Data are shown as mean ± SEM of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05. PAC-1 binding (a) and P-selectin expression (b) in iPSC-PLTs generated from clone 7 or clone 7-3 with or without PMA or ADP / TRAP6 stimulation. (c) Representative flow cytometry plots of activated iPSC-PLTs. (d) CD41 from clone 7 and clone 7-3. +Representative histogram of Annexin V binding to iPSC-PLTs. PAC-1 binding (e) and P-selectin expression (f) in iPSC-PLTs generated from MOCK or imMKCL overexpressing RALB (O / E RALB) with or without PMA or ADP / TRAP6 stimulation. (g) Representative flow cytometry plot of activated iPSC-PLTs. (h) CD41 binding from MOCK or O / E RALB. + Representative histograms of Annexin V binding to iPSC-PLTs. (a) Cord blood-derived CD34 + Schematic diagram of in vitro differentiation of cord blood-derived MKs. (b) Inhibition of let-7a-5p did not significantly affect the mRNA expression of the indicated genes (b) or PLT production (cd). (e) Significant increases in the expression levels of RALB, IRF7, ISG15, and IFIT3 were observed in RALB-overexpressing (O / E) cells. Total RNA was isolated from cells on day 16, and mRNA expression levels were measured by RT-qPCR and normalized to GAPDH. (fg) Overexpression of RALB increased the production of CD41a from cord blood-derived MKs on day 20. + CD42b +A significant decrease in platelet-like particles was induced. Data are shown as the mean ± SEM of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05. Flow cytometry gating strategies for (a) imMKCL subpopulations distinguished by the miRNA switch and (b) iPSC-PLTs counted using Absolute Counting Beads. Reduction of KAT7 and H3K14ac levels in LT-C (long-term culture) imMKCLs. (A) KAT7 protein levels measured by Wes Simple Western system for ST-C, LT-C, and WS clones. (B) H3K14ac protein levels measured by Wes Simple Western system for ST-C, LT-C, and WS clones. (C) Cell proliferation measured by CCK8 assay for ST-C and WS clones during a 3-day DOX-ON culture period. (D) Platelet productivity for ST-C and WS clones after the DOX-OFF maturation period. Data are shown as mean ± SEM from at least three independent experiments. Statistical significance was assessed using an unpaired two-tailed Student's t-test or one-way analysis of variance. WM3835 inhibited the proliferation and maturation of imMKCLs by inducing cell cycle arrest. (A) WM3835 (5 μM) effectively inhibited KAT7 signaling compared with WM1119. (B) Platelet productivity of ST-C clones after WM3835 treatment on the indicated days during the maturation period. (C) Decreased platelet productivity in ST-C clones after WM3835 treatment during the proliferation period. (D) Cell proliferation measured by CCK8 assay for ST-C clones during 3, 6, and 9 days of DOX-ON culture with WM3835 treatment. (E) Cell cycle analysis of ST-C clones after WM3835 treatment using the Fucci system. Data are shown as mean ± SEM from at least three independent experiments.Statistical significance was assessed using an unpaired two-tailed Student's t-test or two-way ANOVA. KAT7 loss-of-function analysis. imMKCLs were transduced with a lentiviral vector encoding shKAT7 or a control vector (shLacZ). After transduction, selection was performed using hygromycin. (A) KAT7 expression measured by real-time qPCR. (B) Platelet productivity. (C) Cell cycle analysis during proliferation. Data are shown as mean ± SEM from three or more independent experiments. Statistical significance was assessed using an unpaired two-tailed Student's t-test or one-way ANOVA. KAT7 gain-of-function analysis. imMKCLs were transduced with a lentiviral vector containing the KAT7 CDS sequence or a control vector (Mock). After transduction, selection was performed using blasticidin. (A) KAT7 expression measured by real-time qPCR. (B) H3K14ac expression detected by intracellular flow cytometry. (C) Cell proliferation measured by CCK8 assay during a 3-day DOX-ON culture period. (D) Platelet productivity. (E) Cell cycle analysis of proliferation phase. Data are shown as mean ± SEM from three or more independent experiments. Statistical significance was assessed using an unpaired, two-tailed Student's t-test.

[0012] As used herein, the singular forms "a," "an," and "the" are intended to include both the singular and the plural unless a word expressly indicates otherwise using words such as "only," "single," and / or "one." It is further understood that as used herein, the terms "comprises," "comprising," "includes," and / or "including" specify the presence of stated features, steps, operations, elements, ideas, and / or components, but do not of themselves exclude the presence or addition of one or more other features, steps, operations, elements, components, ideas, and / or groups thereof.

[0013] 1. Megakaryocyte Quality Control Markers The present invention provides megakaryocyte quality control markers (hereinafter also referred to as "biomarkers of the present invention"). Using the biomarkers of the present invention allows for the evaluation of megakaryocyte quality, making the biomarkers useful for managing megakaryocyte quality (particularly, ensuring that megakaryocytes have a certain quality). Herein, "quality control of megakaryocytes" can also be appropriately interpreted as "quality evaluation of megakaryocytes." Specific examples of the biomarkers of the present invention include transcripts or proteins of the Ral (RAS-like proto-oncogene) gene, transcripts or proteins of the Kat7 (lysine acetyltransferase 7) gene, and acetylated histone proteins that are targets of the Kat7 protein (hereinafter, "histone proteins" will be simply referred to as "histones").

[0014] Ral proteins are a type of small GTPase, and there are two types of Ral proteins: RalA (RAS-like proto-oncogene A) protein (also called "GTPase RalA") and RalB (RAS-like proto-oncogene B) protein (also called "GTPase RalB"). RalA and RalB proteins share approximately 80% homology, and these proteins share largely identical amino acid sequences except for the hypervariable region at the C-terminus. While either RalA or RalB can be used as a biomarker in the present invention, RalB is preferred.

[0015] Kat7 protein is a histone acetyltransferase (HAT) that primarily acetylates lysines on histones H3 and H4, contributing to the regulation of chromatin structure, gene expression, and cell division. Histones H3 and H4 are the targets of Kat7 acetylation. Examples of acetylated histones targeted by Kat7 include H3K14ac (histone 3 acetylated at lysine 14), H4K5ac (histone 4 acetylated at lysine 5), H4K8ac (histone 4 acetylated at lysine 8), H4K12ac (histone 4 acetylated at lysine 12), and H4K16ac (histone H4 acetylated at lysine 16). Among these, H3K14ac is preferred. Here, lysine 14 refers to the methylation of the 14th lysine (excluding the methionine encoded by the start codon) in the protein. The same applies to lysines 8, 12, and 16.

[0016] As used herein, "megakaryocytes" may refer to cells characterized as, for example, CD41a-positive / CD42a-positive / CD42b-positive. In addition to these markers, megakaryocytes may further express one or more markers selected from the group consisting of CD9, CD34, CD61, CD62p, CD42c, CD42d, CD49f, CD51, CD110, CD123, CD131, and CD203c. Megakaryocytes may also express GATA1, FOG1, NF-E2, and β1-tubulin. In one embodiment, megakaryocytes are CD34-positive, CD41-positive cells. In another embodiment, megakaryocytes are CD38-negative, CD90-positive, and / or CD49f-positive.

[0017] As used herein, the term "transcription product" refers to RNA that encodes a protein, and hereinafter refers to mRNA unless otherwise specified. Complementary DNA (cDNA) synthesized using reverse transcriptase with RNA as a template is also included in the term transcription product.

[0018] Transcription products of the Ral gene (also simply referred to as "Ral transcripts") are known transcription products; for example, the sequence of the human RalA transcript is disclosed under NCBI Accession No. NM_005402.4 (SEQ ID NO: 1), and the sequence of the human RalB transcript is disclosed under NCBI Accession No. NM_001369400.1 (SEQ ID NO: 2) and NCBI Accession No. NM_002881.3 (SEQ ID NO: 3). Transcription products of the Kat7 gene are known transcription products; for example, the sequence of the human Kat7 transcript (isoform 1) is disclosed under NCBI Accession No. NM_007067.5 (SEQ ID NO: 4). In addition to isoform 1, other isoforms 2 to 6 (shown in the Sequence Listing as SEQ ID NOS: 5 to 9, respectively) with shorter sequences are also known for the Kat7 protein. Any of the transcripts encoding these can be used as biomarkers of the present invention. However, the transcript of the Kat7 gene herein preferably consists of the sequence shown in SEQ ID NOS: 4. In the present invention, each transcript may be RNA containing a nucleotide sequence shown in any of SEQ ID NOS: 1 to 9 (with T replaced with U), or may be RNA containing a nucleotide sequence substantially identical to the nucleotide sequence. The origin of each transcript is not particularly limited, but is preferably mammalian (e.g., human, mouse, rat, monkey, bovine, equine, porcine, canine, etc.), with human-derived transcripts being particularly preferred. Each transcript may also be a homolog of the corresponding human transcript in a mammalian species other than human.

[0019] Examples of nucleotide sequences substantially identical to the nucleotide sequences set forth in any of SEQ ID NOs: 1 to 9 include nucleotide sequences that have 80% or more, preferably 90% or more, and more preferably 95% or more (e.g., 96%, 97%, 98%, 99% or more) identity with these nucleotide sequences. Such sequences typically encode proteins having substantially the same activity as Ral protein or Kat7 protein.

[0020] Furthermore, examples of nucleotide sequences substantially identical to the nucleotide sequences set forth in any of SEQ ID NOs: 1 to 9 include nucleotide sequences in which one or more nucleotides (preferably about 1 to 300, preferably about 1 to 150, more preferably about 1 to 30, and particularly preferably one to several (2, 3, 4, 5, 6, 7, 8, 9, or 10)) have been substituted, inserted, added, and / or deleted from these nucleotide sequences. Such sequences typically encode proteins having substantially the same activity as Ral protein or Kat7 protein.

[0021] Each transcription product can be obtained, for example, by isolation and purification from cells or biological samples containing the transcription product by methods known per se, or may be produced by chemical synthesis or in vitro transcription (IVT).

[0022] Ral proteins are known proteins; for example, the sequence of human RalA protein is disclosed under NCBI Accession No. NP_005393.2 (SEQ ID NO: 10), and the sequence of human RalB protein is disclosed under NCBI Accession No. NP_001356329.1 and NP_002872.1 (both of which have the same sequence (SEQ ID NO: 11)). Kat7 protein is also known protein; for example, the sequence of human Kat7 protein (isoform 1) is disclosed under NCBI Accession No. NP_NP_008998.1 (SEQ ID NO: 12). The sequences of isoforms 2 to 6 of human Kat7 protein are set forth in the Sequence Listing as SEQ ID NOs: 13 to 17. In the present invention, each protein may be a protein comprising an amino acid sequence set forth in any of SEQ ID NOs: 10 to 17, or may be a protein comprising an amino acid sequence substantially identical to said amino acid sequence. The origin of each protein is not particularly limited, but is preferably mammalian (e.g., human, mouse, rat, monkey, cow, horse, pig, dog, etc.), with human origin being particularly preferred. Each protein may be a homolog of the corresponding human protein in a mammalian species other than human.

[0023] Examples of amino acid sequences substantially identical to the amino acid sequences set forth in any of SEQ ID NOs: 10 to 17 include amino acid sequences that have 80% or more, preferably 90% or more, and more preferably 95% or more (e.g., 96%, 97%, 98%, 99% or more) identity with these amino acid sequences. Proteins containing such sequences typically have substantially the same activity as Ral protein or Kat7 protein.

[0024] Furthermore, amino acid sequences substantially identical to any of the amino acid sequences shown in SEQ ID NOs: 10 to 17 include amino acid sequences in which one or more amino acids (preferably about 1 to 100, preferably about 1 to 50, more preferably about 1 to 10, and particularly preferably one to several (2, 3, 4, or 5)) have been substituted, inserted, added, and / or deleted from these amino acid sequences. Proteins containing such sequences typically have substantially the same activity as Ral protein or Kat7 protein.

[0025] Ral protein or Kat7 protein can be produced by known protein synthesis methods, such as solid-phase synthesis or liquid-phase synthesis. The obtained protein can be purified and isolated by known purification methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, or a combination thereof. Alternatively, the protein may be isolated and purified from a biological sample by known methods. Alternatively, Ral protein or Kat7 protein can be produced by culturing a transformant containing a nucleic acid encoding it and isolating and purifying the protein from the resulting culture. Such nucleic acid may be DNA, RNA, or a DNA / RNA chimera, but is preferably DNA. The nucleic acid may be double-stranded or single-stranded.

[0026] 2. Method for Evaluating Megakaryocyte Quality The present invention provides a method for evaluating megakaryocyte quality (hereinafter, sometimes referred to as the "evaluation method of the present invention"), which comprises detecting a biomarker of the present invention in megakaryocytes. In this specification, "evaluate" can be interpreted as "assess," "examine," "verify," or the like, as appropriate. In the evaluation method of the present invention, only one biomarker of the present invention may be detected, or two or more biomarkers may be detected. When two or more biomarkers are detected, the combination of biomarkers to be detected is not particularly limited. Different types of transcripts or proteins may be detected (e.g., detecting a RalA transcript and a RalB transcript), or the same type of transcript or protein may be detected (e.g., detecting a RalB transcript and a RalB protein). Another preferred embodiment is detecting a transcript or protein (in one embodiment, a transcript) of a Ral gene (in one embodiment, the RalB gene) and a transcript or protein (in one embodiment, the Kat7 protein) of a Kat7 gene.

[0027] As used herein, unless otherwise specified, "cells" such as megakaryocytes include "cell populations." Furthermore, unless otherwise specified, "cells" refer to those obtained by cell culture. A cell population may be composed of one type of cell, or may be composed of two or more types of cells.

[0028] The megakaryocytes used in the present invention may be multinucleated cells, mononucleated cells, or binucleated cells. Furthermore, megakaryocytes may be immortalized as megakaryocyte lines or cloned cell populations. Non-multinucleated megakaryocytes can be expanded by expansion culture and are sometimes referred to as immortalized megakaryocytes (imMKCL). The megakaryocytes used in the present invention are typically CD34-positive and CD41-positive immortalized megakaryocytes. Immortalized megakaryocytes produce functional platelets through maturation. Megakaryocyte maturation refers to the differentiation of megakaryocytes into the required multinucleated state and the ability to produce functional platelets. Functional platelets may be, for example, CD42b-positive platelets. Megakaryocyte maturation can also be confirmed by increased expression of megakaryocyte maturation-related genes, such as GATA1, FOG1, FLI1, NF-E2, and β1-tubulin.

[0029] In one embodiment of the present invention, megakaryocytes have an exogenous gene encoding a MYC protein and an exogenous gene encoding an apoptosis inhibitor protein, and preferably also have an exogenous gene encoding a polycomb group protein. Hereinafter, these MYC protein, apoptosis inhibitor protein, and polycomb group protein may be collectively referred to as "megakaryocyte-inducing factor."

[0030] As used herein, "exogenous" means that megakaryocytes present in a mammalian organism do not exist unless introduced from the outside. Furthermore, as used herein, "expressing" or "positive" a gene means that the protein encoded by the gene is produced, unless otherwise specified. Therefore, if the target protein is detected by FACS as used in the examples below, it can be said that the gene is expressed.

[0031] Examples of genes encoding MYC proteins (hereinafter also referred to as "MYC genes") include the c-MYC gene, the N-MYC gene, and the L-MYC gene. The c-MYC gene is more preferred. Examples of c-MYC genes include the gene consisting of the nucleic acid sequence shown by NCBI accession number NM_002467.

[0032] The c-MYC gene may be a c-MYC gene encoding a protein fused with a destabilization domain. A "destabilization domain" refers to a domain that destabilizes the protein to which it is operably linked. The destabilization domain can be operably linked to the N-terminus or C-terminus of the protein. Examples of destabilization domains include ubiquitin, PEST sequences (proline, glutamic acid, serine, and threonine-rich sequences), cyclin destruction boxes, hydrophobic stretches of amino acids, Escherichia coli dihydrofolate reductase (ecDHFR), human estrogen receptor ligand binding domain (ERLBD), FK506 binding protein (FKBP12), and mutants thereof. Examples of destabilization domains include FKBP12 and mutants thereof. Examples of FKBP12 mutants used as destabilizing domains include F15S, V24A, H25R, E60G, L106P, M66T, R71G, D100G, D100N, E102G, and K105I mutants (Banaszynski et al. Cell 126:995 (2006)). Commercially available destabilizing domains may be used, for example, those available from TAKARA Bio (Clontech ProteoTuner TM It is sold by Shield System C, #631072.

[0033] The "apoptosis-inhibitory gene" is not particularly limited as long as it is a gene that inhibits apoptosis, and examples thereof include the BCL2 gene, the BCL2L1 gene (protein name: Bcl-xL), Survivin, and MCL1. The BCL2L1 gene is preferred. Examples of the BCL2L1 gene include genes consisting of the nucleic acid sequences represented by NCBI accession numbers NM_001191 and NM_138578.

[0034] As used herein, genes encoding Polycomb group proteins (hereinafter also referred to as "Polycomb genes") refer to genes known to negatively regulate CDKN2a (cyclin-dependent kinase inhibitor 2A, INK4a / ARF) and function to prevent cellular senescence. Specific examples of polycomb genes include BMI1 (Polycomb complex protein BMI-1, polycomb group RING finger protein 4 (PCGF4), RING finger protein 51 (RNF51)), Mel18 (Polycomb group RING finger protein 2), Ring (Ring Finger Protein) 1a / b, Phc (Polyhomeotic Homolog) 1 / 2 / 3, Cbx (Chromobox) 2 / 4 / 6 / 7 / 8, Ezh2 (Enhancer of Zeste 2 Polycomb Repressive Complex 2 Subunit), Eed (Embryonic Ectoderm Development), Suz12 (SUZ12 Polycomb Repressive Complex 2 Subunit), HADC (Histone deacetylases), and Dnmt (DNA (cytosine-5)-methyltransferase) 1 / 3a / 3b, with the BMI1 gene being preferred. An example of the BMI1 gene is a gene consisting of the nucleic acid sequence shown by NCBI accession number NM_005180.

[0035] The origin of each gene encoding a megakaryocyte-inducing factor (hereinafter also referred to as "megakaryocyte-inducing factor gene") is not particularly limited, but is preferably mammalian (e.g., human, mouse, rat, monkey, cow, horse, pig, dog, etc.), with human-derived genes being particularly preferred. Alternatively, a homolog of a human gene in a mammalian species other than human is also preferred as a megakaryocyte-inducing factor gene. Genes with a high degree of nucleotide sequence identity to the wild-type gene (e.g., 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity) are also preferred.

[0036] Each megakaryocyte-inducing factor gene is preferably linked under the control of a drug-responsive promoter. A drug-responsive promoter is a promoter that expresses or represses gene expression in the presence of a corresponding drug. Examples of drug-responsive promoters include the TRE promoter, which can bind to a fusion protein (rtTA) of reverse tetR (rtetR) and VP16AD, or a fusion protein (rTA) of tetR and VP16AD, in the presence or absence of a corresponding drug. Examples of such drugs include doxycycline (Dox), tetracycline, or their derivatives (abbreviated as "Dox, etc."). Other examples of drug-responsive promoters include metallothionein promoters (corresponding drug: heavy metal ions) and steroid-responsive promoters (corresponding drug: steroid hormones or their derivatives). Vectors containing these drug-responsive promoters are also referred to as drug-responsive vectors. In addition to drug-responsive promoters, light-responsive promoters (induced by light), heat shock protein promoters (induced by heat shock), etc. may also be used, and promoters that are induced by these drugs or stimuli are also called inducible promoters.

[0037] The megakaryocytes used in the present invention can be obtained by known methods, such as isolating them from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) using known techniques, inducing differentiation of pluripotent stem cells or hematopoietic progenitor cells, or obtaining them from companies such as ATCC. Specific isolation and production methods are described below.

[0038] Furthermore, as used herein, "detecting a biomarker" encompasses not only examining the presence or absence of a biomarker of the present invention in megakaryocytes (i.e., whether or not a transcript or protein is present in an amount equal to or greater than the detection limit of a detection method), but also measuring (quantifying) the abundance or activity level of the biomarker. Thus, the evaluation method of the present invention can also be carried out using the abundance or activity level of a biomarker of the present invention as an index. Thus, in another aspect, the evaluation method of the present invention comprises: (1) measuring the abundance or activity level of one or more biomarkers of the present invention in a subject's megakaryocytes; and (2) evaluating the quality of the megakaryocytes based on the value measured in step (1).

[0039] In one embodiment, step (2) is a step (2') in which the quality of megakaryocytes is evaluated as high if the value measured in step (1) is equal to or less than a reference value. In one embodiment, the reference value used in this step is a value based on the measurement of the biomarker of the present invention in low-quality megakaryocytes (e.g., megakaryocytes that have aged through multiple passages after establishment or isolation from biological tissue, or megakaryocytes with high expression of aging markers such as IL-8). Such measurements are typically obtained in a cell population containing the same number of megakaryocytes as the target megakaryocyte population. The "reference value" used in the present invention can be, for example, the average, mode, or median of measurements in multiple cell populations, or a value calculated from these values ​​using arithmetic operations.

[0040] The reference values ​​used in this step may be values ​​based on the measured values ​​of the biomarkers of the present invention in high-quality megakaryocytes (e.g., megakaryocytes immediately after establishment or isolation from biological tissue, megakaryocytes with low expression of aging markers such as IL-8, etc.).

[0041] The reference value may be a cutoff value. Methods for calculating the cutoff value are well known in the art. For example, a receiver operating characteristic (ROC) curve may be created, and the values ​​at which the diagnostic sensitivity and diagnostic specificity are as close to 100% as possible may be determined and used as the cutoff value.

[0042] As used herein, "quality of megakaryocytes" refers to the proliferation capacity and platelet production capacity of megakaryocytes. Thus, "high quality megakaryocytes" means that at least one (preferably both) of the proliferation capacity and platelet production capacity of megakaryocytes is high or is predicted to be high.

[0043] The detection or quantification of the biomarkers of the present invention in megakaryocytes can be investigated by preparing an RNA (e.g., total RNA, mRNA) fraction from a megakaryocyte population and detecting Ral or Kat7 transcripts contained in the fraction. Thus, in one embodiment, the evaluation method of the present invention comprises detecting or quantitating Ral or Kat7 transcripts using a nucleic acid probe or nucleic acid primer that can specifically recognize the Ral or Kat7 transcripts, respectively.

[0044] RNA fractions can be prepared using known techniques such as guanidine-CsCl ultracentrifugation and the AGPC method. Highly pure total RNA can also be rapidly and easily prepared from minute samples using commercially available RNA extraction kits (e.g., RNeasy Mini Kit; manufactured by QIAGEN, etc.). Ral or Kat7 transcripts in RNA fractions can be detected by hybridization (e.g., Northern blot, dot blot) or quantitative PCR (e.g., real-time PCR, digital PCR, etc.).

[0045] When using Northern blot or dot blot hybridization, detection or quantification of Ral or Kat7 transcripts can be performed using, for example, a nucleic acid probe capable of specifically recognizing Ral or Kat7 transcripts. Examples of such nucleic acid probes include nucleic acids containing a sequence complementary to a contiguous region of 15 or more bases, preferably 16 to 100 bases, more preferably 17 to 80 bases, and even more preferably 18 to 50 bases, in the base sequence of the known transcripts described above. The nucleic acid may be DNA, RNA, or a DNA / RNA chimera, with DNA being preferred. Furthermore, nucleic acids used as probes may be double-stranded or single-stranded. In the case of double-stranded probes, they may be double-stranded DNA, double-stranded RNA, or a DNA:RNA hybrid. In the case of single-stranded probes, those containing an antisense strand sequence may be used.

[0046] The nucleic acid probe is preferably labeled with a labeling agent to enable detection of the target nucleic acid. Examples of the labeling agent include radioisotopes, enzymes, fluorescent substances, and luminescent substances. Examples of the radioisotopes include [ 32 P], [ 3 H], [ 14 C] and the like are used. As the enzyme, those that are stable and have high specific activity are preferred, such as β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, and the like. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate, and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin, and the like are used. Furthermore, biotin-(strept)avidin can also be used to bind the probe and the labeling agent.

[0047] The nucleic acid probes can be obtained by amplifying nucleic acids of a desired length by PCR using a primer set designed based on the sequence of the Ral or Kat7 transcription product and cell-derived cDNA or genomic DNA as a template, or by cloning the gene or cDNA from the cDNA or genomic DNA library by colony or plaque hybridization or the like, and then, if necessary, dividing the gene or cDNA into fragments of an appropriate length using restriction enzymes, etc. Alternatively, the probes can be obtained by chemical synthesis using a commercially available automatic DNA / RNA synthesizer or the like.

[0048] In a preferred embodiment, quantitative PCR is used to detect or quantify Ral or Kat7 transcription products. Quantitative PCR can be performed by known methods, for example, by synthesizing cDNA using reverse transcriptase with total RNA as a template, and performing PCR in the presence of a set of nucleic acid primers specific to the target gene, DNA polymerase, and a dye or probe that can function as a DNA intercalator to quantify the expression level.

[0049] Examples of digital PCR include droplet digital PCR (ddPCR) and chip-based digital PCR (cdPCR). Digital PCR is performed, for example, by the following procedure: A reaction solution containing a probe set, a DNA sample, a PCR primer set, and DNA polymerase is placed in a digital PCR device. The mixing ratio of each reaction solution component can be appropriately selected and optimized within known ranges and can be changed appropriately depending on the primer set, probe set, etc. used.

[0050] Ral protein or Kat7 protein can be detected or quantified by preparing a protein fraction from a megakaryocyte population and detecting or quantifying the proteins contained in the fraction. These proteins can be detected or quantified by immunoassays (e.g., ELISA, FIA, RIA, Western blot, etc.) using antibodies that specifically recognize each protein.

[0051] Antibodies capable of specifically recognizing Ral protein or Kat7 protein can be produced by conventional production methods using these proteins or partial peptides containing the epitope as immunogens. As used herein, "antibodies" includes, but is not limited to, natural antibodies such as polyclonal antibodies and monoclonal antibodies (mAbs), chimeric antibodies produced using recombinant DNA technology, humanized antibodies, single-chain antibodies, and binding fragments thereof. Preferably, the antibody is a polyclonal antibody, a monoclonal antibody, or a binding fragment thereof. "Binding fragment" refers to a partial region of the aforementioned antibody that has specific binding activity, and specific examples include F(ab')2, Fab', Fab, Fv, sFv, dsFv, and sdAb (Exp. Opin. Ther. Patents, Vol. 6, No. 5, pp. 441-456, 1996). The class of the antibody is not particularly limited, and includes antibodies of any isotype, such as IgG, IgM, IgA, IgD, or IgE. Preferably, IgG or IgM is used, and IgG is more preferred in consideration of ease of purification, etc. In the present invention, it is also preferable to use commercially available antibodies or kits or arrays containing antibodies as antibodies capable of specifically recognizing Ral protein or Kat7 protein, respectively.

[0052] When applying each immunological detection or quantification method to the evaluation method of the present invention, no special conditions, procedures, etc. are required. A detection or quantification system for the biomarker of the present invention can be constructed by adding the usual technical considerations of a person skilled in the art to the usual conditions and procedures of each method.

[0053] The activity of the biomarkers of the present invention in megakaryocytes can be measured, for example, by the following method. Ral protein exists in two forms: GTP-bound (active) and GDP-bound (inactive). Therefore, the activity can be measured by measuring the amount of GTP-bound Ral protein present or calculating the ratio of active to inactive forms. Specific examples include a pull-down assay in which the Ral-binding domain of a Ral protein effector (e.g., RalBP1) is used to pull down only active (GTP-bound) RalB, and the amount of protein is detected or measured by immunoassay, a GTPase-linked immunosorbent assay (G-LISA) is used to detect GTP-bound Ral protein, a FRET (Forster Resonance Energy Transfer) assay is used to measure changes in Ral protein activity, and a GDP / GTP exchange assay is used to measure the GDP / GTP exchange rate of Ral protein.

[0054] The degree of Kat7 protein activity can be measured, for example, by a radiolabeled acetyltransferase assay ( 14 C-acetyl-CoA method) 14 These include methods for measuring the amount of acetylated histones, methods for detecting or measuring acetylated histones using immunoassays using anti-acetyl histone antibodies, methods for analyzing acetylated histones using mass spectrometry (LC-MS / MS), and methods for analyzing changes in fluorescence intensity when acetylation occurs using a FRET (fluorescence resonance energy transfer) assay.

[0055] In accordance with the above, in one embodiment, the evaluation method of the present invention is a method characterized by detecting the biomarker using a nucleic acid probe and / or nucleic acid primer that specifically recognizes one or more Ral transcription products, or an antibody that specifically recognizes Ral protein. In another embodiment, the evaluation method of the present invention is a method characterized by detecting the marker using a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Kat7 gene transcription product, or an antibody that specifically recognizes Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is a target of Kat7 protein. These evaluation methods may be used in combination. In one embodiment, the evaluation method of the present invention includes the steps of: (1) detecting a Ral transcription product or protein using a nucleic acid probe and / or nucleic acid primer that specifically recognizes one or more Ral transcription products, or an antibody that specifically recognizes a Ral protein (in one embodiment, a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Ral gene (particularly, the RalB gene) transcription product); and (2) detecting a Kat7 transcription product or protein using a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Kat7 gene transcription product, or an antibody that specifically recognizes a Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein, a target of the Kat7 protein (in one embodiment, an antibody that specifically recognizes the Kat7 protein). These steps may be performed sequentially or simultaneously. Alternatively, step (1) may be performed after step (2).

[0056] 3. Megakaryocyte Quality Control Kit The present invention further provides a megakaryocyte quality control kit (hereinafter referred to as the "kit of the present invention"). The kit of the present invention preferably includes a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Ral transcription product, or an antibody that specifically recognizes a Ral protein. In another embodiment, a megakaryocyte quality control kit (this kit is also encompassed by the "kit of the present invention") is also provided, which includes a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Kat7 gene transcription product, an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is the target of the Kat7 protein. These may be included in one or more types. These kits may be used in combination, and in one embodiment, the kit of the present invention comprises (1) a nucleic acid probe and / or nucleic acid primer that specifically recognizes one or more Ral transcription products, or an antibody that specifically recognizes a Ral protein (in one embodiment, a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of a Ral gene (particularly, the RalB gene)), and (2) a nucleic acid probe and / or nucleic acid primer that specifically recognizes a Kat7 gene transcription product, or an antibody that specifically recognizes a Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is a target of the Kat7 protein (in one embodiment, an antibody that specifically recognizes a Kat7 protein).

[0057] When the kit of the present invention comprises the nucleic acid probe or nucleic acid primer (also simply referred to as "nucleic acid") as a component, the nucleic acid can be the same as that exemplified in the evaluation method of the present invention described above in 2. These nucleic acids can be provided as solids, in a dried or alcohol-precipitated state, or dissolved in water or an appropriate buffer (e.g., TE buffer, etc.). When used as a labeled probe, the nucleic acid can be provided in advance labeled with one of the above-mentioned labeling substances, or can be provided separately from the labeling substance and labeled immediately before use. Alternatively, the nucleic acid can be provided immobilized (also referred to as supported or solid-phased) on a suitable substrate. Examples of substrates include, but are not limited to, glass, silicone, plastic, nitrocellulose, nylon, polyvinylidene difluoride, etc. Further, examples of immobilization methods include, but are not limited to, a method in which a functional group such as an amino group, an aldehyde group, an SH group, or biotin is introduced into the nucleic acid in advance, and a functional group that can react with the nucleic acid (e.g., an aldehyde group, an amino group, an SH group, streptavidin, etc.) is also introduced onto the substrate, and the substrate and nucleic acid are crosslinked by a covalent bond between the two functional groups; and a method in which, for polyanionic nucleic acids, the substrate is coated with polycations and the nucleic acid is immobilized using electrostatic bonds.

[0058] When the kit of the present invention contains the above-mentioned antibodies as a component, these antibodies include the same antibodies as those exemplified in the evaluation method of the present invention in 2 above.

[0059] In addition to the nucleic acids and antibodies, the kits of the present invention may contain other substances necessary for the reaction to detect or quantitate the expression of the biomarkers of the present invention. These other substances may be provided in a coexistent state with the nucleic acids, antibodies, etc., or may be provided together with separate reagents, as long as they do not adversely affect the reaction. For example, when the reaction to detect or quantitate the expression of the biomarkers of the present invention is PCR, examples of such other substances include a reaction buffer, dNTPs, a heat-stable DNA polymerase, etc. When quantitative PCR is used, the kit may further contain a competitor nucleic acid, a fluorescent reagent (such as the above-mentioned intercalator or fluorescent probe), etc. Furthermore, when the reaction to detect or quantitate the expression of the biomarkers of the present invention is an antigen-antibody reaction, examples of such other substances include a reaction buffer, a competitor antibody, a labeled secondary antibody (e.g., mouse anti-rabbit IgG labeled with peroxidase, alkaline phosphatase, etc., when the primary antibody is a rabbit antibody), a blocking solution, an ELISA plate, etc. Furthermore, the kits of the present invention may include instructions describing the use of the kit and reagents, evaluation criteria, etc. Furthermore, the above-mentioned determination kit may contain one or more biomarkers of the present invention for use, for example, as a positive control. The types, specific examples, and methods of use of reagents used in the kit of the present invention are all incorporated by reference in the contents of "2. Method for evaluating megakaryocyte quality."

[0060] 4. Method for Producing Megakaryocytes and Platelets In another aspect, the present invention provides a method for producing megakaryocytes of improved quality. Specifically, the method includes a step of culturing megakaryocytes in a medium containing a Ral (RAS-like proto-oncogene) inhibitor (hereinafter, this may be referred to as the "production method of the present invention").

[0061] Furthermore, as shown in the Examples below, it has been shown that the expression level of the Kat7 gene affects the maintenance of megakaryocyte proliferation capacity and the subsequent platelet production (yield) in the maturation stage. Therefore, a method for producing improved quality megakaryocytes (this method is also considered to be included in the "production method of the present invention") is also provided, which includes a step of increasing the amount of Kat7 protein present in megakaryocytes. The megakaryocytes used in this method are typically megakaryocytes with low Kat7 gene expression. Examples of megakaryocytes with low Kat7 gene expression include megakaryocytes with reduced Kat7 gene expression due to multiple passages compared to megakaryocytes established or isolated from living tissue, and megakaryocytes with a mutation in the Kat7 gene that result in lower Kat7 gene expression compared to megakaryocytes with wild-type Kat7 gene.

[0062] These production methods may be used in combination, and in one embodiment, the production method of the present invention comprises (1) the step of culturing megakaryocytes in a medium containing a Ral inhibitor, and (2) the step of increasing the amount of Kat7 protein present in the megakaryocytes. These steps may be performed sequentially or simultaneously. Alternatively, step (1) may be performed after step (2). Megakaryocytes obtained by the production method of the present invention may also be referred to as "megakaryocytes of the present invention.") The phrase "method for producing megakaryocytes with improved quality" can also be appropriately interpreted as "method for improving the quality of megakaryocytes."

[0063] As used herein, "increasing the abundance of Kat7 protein" refers to increasing the amount of Kat7 protein present in megakaryocytes compared to the amount of Kat7 protein present in megakaryocytes prior to the step of increasing its abundance. Megakaryocytes may be constantly maintained at a high protein level, or may be transiently elevated. Methods for increasing the abundance of Kat7 protein in megakaryocytes are not particularly limited, and include, for example, introducing nucleic acid (DNA or RNA) encoding Kat7 protein (hereinafter also referred to as "exogenous nucleic acid") into megakaryocytes or cells capable of differentiating into megakaryocytes (e.g., hematopoietic progenitor cells, pluripotent stem cells, etc.) from the outside to force expression of the protein, activating the expression of an endogenous gene encoding Kat7 protein by modifying the promoter using techniques such as genome editing, and adding Kat7 protein to the culture medium to deliver the protein into cells. Kat7 protein or a nucleic acid encoding the protein may be introduced into cells once or multiple times.

[0064] Exogenous nucleic acids are typically introduced into cells (e.g., megakaryocytes, hematopoietic progenitor cells, pluripotent stem cells, etc.) in the form of an expression vector carrying the nucleic acid. Examples of vectors that can be used to express exogenous nucleic acids include viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and Sendai viruses, as well as animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo). Retroviral or lentiviral vectors are preferred because they can be introduced in a single step.

[0065] Examples of promoters used in expression vectors include the EF-α promoter, CAG promoter, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, and HSV-TK (herpes simplex virus thymidine kinase) promoter. In addition to the promoter, the expression vector may optionally contain an enhancer, poly(A) addition signal, a selectable marker gene, an SV40 replication origin, and the like. Useful selectable marker genes include, for example, the dihydrofolate reductase gene, the neomycin resistance gene, and the puromycin resistance gene.

[0066] Various techniques can be used to introduce exogenous nucleic acids into cells, including lipofection, liposomes, electroporation, nucleofection, calcium phosphate coprecipitation, DEAE-dextran, microinjection, and gene guns. When the exogenous nucleic acid is contained in a viral vector, the exogenous nucleic acid can be introduced into cells by introducing a plasmid containing the nucleic acid into appropriate packaging cells (e.g., Plat-E cells) or complementing cell lines (e.g., 293 cells), recovering the virus produced in the culture supernatant, and contacting and infecting the cells.

[0067] As used herein, "improved quality" means that megakaryocytes after the method of the present invention have higher proliferation and / or platelet production capabilities than megakaryocytes before the method of the present invention. Furthermore, as used herein, "platelet production capabilities" refers to the ability of megakaryocytes to be transitioned to the mature phase, thereby producing platelets through the formation of cytoplasmic processes. Transition of megakaryocytes to the mature phase can be achieved by the "step of maturing megakaryocytes" described below. In the Examples described below, if the proliferation rate calculated by dividing the number of megakaryocytes on day 14 after the start of proliferation by the number of megakaryocytes at the time of initiation of megakaryocyte proliferation is higher than the proliferation rate of megakaryocytes before the method of the present invention, it can be said that the proliferation ability of megakaryocytes is high. Furthermore, as in the Examples described below, if the ratio of platelets recovered after transitioning megakaryocytes to the mature phase and culturing them for 6 days (number of platelets / number of megakaryocytes) is higher than the ratio of platelets recovered from megakaryocytes before the method of the present invention, it can be said that the platelet production ability of megakaryocytes is high.

[0068] The method of the present invention typically includes a step of proliferating megakaryocytes in the presence of a Ral inhibitor. In one embodiment, megakaryocyte proliferation can be initiated by increasing the abundance of MYC protein (particularly c-MYC) and apoptosis inhibitor protein (particularly Bcl-xL), preferably by further increasing the abundance of polycomb group proteins (particularly BMI1). Methods for increasing the abundance of these proteins in megakaryocytes are not particularly limited, but include, for example, increasing the expression level of nucleic acids encoding the proteins, or adding proteins to the culture medium and delivering them into cells. Specific methods for increasing the expression level of proteins include, for example, introducing exogenous nucleic acids (DNA or RNA) encoding the proteins into megakaryocytes, or culturing megakaryocytes using the above-mentioned inducible promoter in the presence of corresponding drugs or stimuli. From the perspective of efficient maturation, it is preferable that the period during which the abundance of megakaryocyte-inducing factors (particularly MYC protein) is maintained elevated in megakaryocytes is the period during which megakaryocytes are proliferated.

[0069] The Ral inhibitors used in the present invention are not limited to those specific to RalA or RalB. They may also inhibit both RalA and RalB, or may also have inhibitory activity against other molecules (typically, other GTPases). Examples of such Ral inhibitors include RBC6 (Cas No. 381186-64-7), RBC8 (Cas No. 361185-42-4; 6-amino-4-(2,5-dimethoxyphenyl)-1,4-dihydro-3-(2-naphthalenyl)-pyrano[2,3-c]pyrazole-5-carbonitrile), RBC10 (CAS No. 362503-73-9), BAY 293 Negative Control, BQU57, CE3F4, and CID-1067700, with RBC8 being preferred. Antibodies, peptides, or aptamers against Ral proteins are also preferred. Alternatively, the Ral inhibitor may be an agent for suppressing the expression of Ral, such as an antisense nucleic acid, siRNA, shRNA, or heteroduplex nucleic acid, which suppresses the expression of Ral. Only one type of Ral inhibitor may be used, or multiple types of Ral inhibitors may be used.

[0070] The concentration of the Ral inhibitor can be appropriately selected by those skilled in the art depending on the Ral inhibitor used. When the Ral inhibitor is RBC8, its concentration in the medium is typically 1 nM to 100 μM, preferably 10 nM to 10 μM, and more preferably 20 nM to 1 μM (in one embodiment, 100 nM).

[0071] The culture in the production method of the present invention may be either suspension culture or adherent culture, but is typically suspension culture. Megakaryocytes isolated from a living body can also be cultured by adherent culture. The culture period (period for growing megakaryocytes) in the presence of a Ral inhibitor is not particularly limited, but is typically 3 days or more, 5 days or more, 7 days or more, or 10 days or more, and typically 20 days or less, 17 days or less, 15 days or less, or 14 days or less. During the culture period, it is preferable to change the medium every 3 to 4 days.

[0072] Furthermore, the period for culturing megakaryocytes in a medium containing a Ral inhibitor (i.e., the period for contacting megakaryocytes with a Ral inhibitor) and the period for maintaining the elevated Kat7 protein abundance in megakaryocytes are not particularly limited, and may be only the period for proliferating megakaryocytes, or may be continued during the period for maturing megakaryocytes. Such a period is typically 6 days or more, and may be 12 days or more, 18 days or more, 24 days or more, 30 days or more, 36 days or more, 42 days or more, 48 days or more, 54 days or more, or 60 days or more.

[0073] As used herein, "suspension culture" refers to culture carried out under conditions in which cells or cell aggregates are maintained suspended in a culture medium, i.e., culture under conditions that do not allow the formation of strong cell-substratum junctions between the cells or cell aggregates and the culture vessel. Suspension culture may be static culture or shaking culture, and in the case of shaking culture, it can be said to be suspension culture as long as the cells are not fixed to one place.

[0074] Incubators used for suspension culture include, but are not limited to, flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multi-dishes, microplates, microwell plates, micropores, multi-plates, multi-well plates, chamber slides, Petri dishes, tubes, trays, culture bags, and roller bottles. For the shaking culture described below (also referred to as "agitation culture"), sealed incubators are preferred. Examples of such incubators include tissue culture flasks, culture bags, and roller bottles. Furthermore, to enable culture under non-adhesive conditions, the incubator is preferably non-cell-adhesive. Examples of non-cell-adhesive incubators include those whose surfaces have not been artificially treated to improve cell adhesion (e.g., coated with an extracellular matrix, etc.) or those whose surfaces have been artificially treated to suppress cell adhesion (e.g., coated with polyhydroxyethyl methacrylate (poly-HEMA)).

[0075] The megakaryocytes used in the present invention can be obtained by known methods. Examples include isolation from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) using known techniques, differentiation-inducing methods of pluripotent stem cells or hematopoietic progenitor cells, and methods for obtaining megakaryocytes from companies such as ATCC. Megakaryocytes can be isolated from biological tissues, for example, using surface antigens as an indicator, flow cytometry or mass cytometry, magnetic cell separation, or affinity columns immobilized with desired antigens. The megakaryocytes used in the present invention are preferably obtained by a method for inducing differentiation of hematopoietic progenitor cells. Therefore, the production method of the present invention may include a step of producing megakaryocytes from pluripotent stem cells or hematopoietic progenitor cells (also referred to as "differentiation induction") (hereinafter also referred to as the "megakaryocyte production step") prior to the production of improved-quality megakaryocytes. Hematopoietic progenitor cells can be obtained, for example, by isolation from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) or by differentiation-inducing methods from pluripotent stem cells.

[0076] The megakaryocyte production step is not particularly limited and can be carried out by a known induction method. Specific examples of megakaryocyte production include the methods described in International Publication Nos. 2011 / 034073 and 2012 / 157586. In one embodiment, the megakaryocyte production step includes (A) culturing pluripotent stem cells to produce hematopoietic progenitor cells (this can also be referred to as "differentiation induction"), and / or (B) culturing hematopoietic progenitor cells to produce megakaryocytes.

[0077] The method for differentiating pluripotent stem cells into hematopoietic progenitor cells in step (A) is not particularly limited as long as it allows differentiation into hematopoietic progenitor cells, and examples include a method for preparing hematopoietic progenitor cells from a net-like structure (also referred to as ES-sac or iPS-sac) obtained by culturing pluripotent stem cells on C3H10T1 / 2 in the presence of VEGF according to the method described in Takayama N., et al., J Exp Med. 2817-2830 (2010). Here, the term "net-like structure" refers to a three-dimensional sac-like structure (with an internal space) derived from pluripotent stem cells, formed from an endothelial cell population or the like, and containing hematopoietic progenitor cells therein. Other examples include methods involving the formation of embryoid bodies and the addition of cytokines (Chadwick et al., Cell Stem Cell 2009, 4: 248-62; Saeki et al., Stem Cells 2009, 27: 59-67) and co-culture with heterologous stromal cells (Niwa A et al., J Cell Physiol. 2009 Nov; 221(2): 367-77). Further examples include methods described in, for example, WO 2013 / 075222, WO 2016 / 076415, WO 2017 / 221975, Liu S. et al., Cytotherapy, 17 (2015); 344-358, etc.

[0078] The term "pluripotent stem cells" refers to stem cells that can differentiate into various tissues and cells with different morphologies and functions in the body and have the ability to differentiate into cells of any of the three germ layers (endoderm, mesoderm, and ectoderm). Examples of pluripotent stem cells used in the present invention include induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), embryonic stem cells derived from cloned embryos obtained by nuclear transfer (ntES cells), multipotent germline stem cells (mGS cells), and embryonic germ stem cells (EG cells). Preferably, iPS cells (more preferably, human iPS cells) are used. When the pluripotent stem cells are ES cells or any cells derived from human embryos, they may be produced by or without the destruction of the embryo. However, from an ethical standpoint, cells produced without the destruction of the embryo are preferred.

[0079] ES cells are stem cells that are established from the inner cell mass of early mammalian embryos (e.g., blastocysts) such as humans and mice, and have the ability to proliferate through pluripotency and self-renewal. ES cells were discovered in mice in 1981 (MJ Evans and MH Kaufman (1981), Nature 292:154-156), and subsequently, ES cell lines were established in humans, monkeys, and other primates (JA Thomson et al., (1998), Science 282:1145-1147; JA Thomson et al., (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; JA Thomson et al., (1996), Biol. Reprod., 55:254-259; JA Thomson and VS Marshall (1998), Curr. Top. Dev. Biol., 38:133-165). ES cells can be established by isolating the inner cell mass from the blastocyst of a fertilized egg of a target animal and culturing the inner cell mass on a fibroblast feeder. Alternatively, ES cells can be established using only a single blastomere from an embryo at the cleavage stage prior to the blastocyst stage (Chung Y. et al., (2008), Cell Stem Cell 2: 113-117), or from a developmentally arrested embryo (Zhang X. et al., (2006), Stem Cells 24: 2669-2676).

[0080] Examples of ES cell lines that can be used in the present invention include mouse ES cell lines established by, for example, inGenious targeting laboratory, Inc., RIKEN (Riken), etc., and human ES cell lines established by, for example, the University of Wisconsin, NIH, RIKEN, Kyoto University, National Center for Child Health and Development, and Cellartis, Inc. Specific examples of human ES cell lines include CHB-1 to CHB-12, RUES1, RUES2, and HUES1 to HUES28 strains distributed by ESI Bio, H1 and H9 strains distributed by WiCell Research, and KhES-1, KhES-2, KhES-3, KhES-4, KhES-5, SSES1, SSES2, and SSES3 strains distributed by RIKEN.

[0081] iPS cells are cells obtained by reprogramming mammalian somatic cells or undifferentiated stem cells by introducing specific factors (nuclear reprogramming factors). Currently, there are various types of iPS cells, including iPSCs established by Yamanaka et al. by introducing four factors, Oct3 / 4, Sox2, Klf4, and c-Myc, into mouse fibroblasts (Takahashi K, Yamanaka S., Cell, (2006) 126: 663-676); human-derived iPSCs established by introducing the same four factors into human fibroblasts (Takahashi K, Yamanaka S., et al., Cell, (2007) 131: 861-872); Nanog-iPSCs established by selecting using Nanog expression as an indicator after introducing the above four factors (Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Nature 448, 313-317); and iPSCs created using a method that does not include c-Myc (Nakagawa M, Yamanaka S., et al., Nature Biotechnology, (2008) 26, 101-106), iPSCs established by introducing six factors using a virus-free method (Okita K et al., Nat. Methods 2011 May;8(5):409-12, Okita K et al., Stem Cells. 31(3):458-66.), etc. can also be used. Other examples that can be used include induced pluripotent stem cells established by introducing four factors, OCT3 / 4, SOX2, NANOG, and LIN28, as developed by Thomson et al. (Yu J., Thomson JA., et al., Science (2007) 318: 1917-1920), induced pluripotent stem cells developed by Daley et al. (Park IH, Daley GQ. et al., Nature (2007) 451: 141-146), and induced pluripotent stem cells developed by Sakurada et al. (JP Patent Publication No. 2008-307007).In addition, all published papers (e.g., Shi Y., Ding S., et al., Cell Stem Cell, (2008) Vol. 3, Issue 5, 568-574; Kim JB., Scholer HR., et al., Nature, (2008) 454, 646-650; Huangfu D., Melton DA., et al., Nature Biotechnology, (2008) 26, No. 7, 795-797), or patent publications (e.g., JP 2008-307007 A, JP 2008-283972 A, US 2008-2336610 A, US 2009-047263 A, WO 2007-069666 A, WO 2008-118220 A, WO 2008-124133 A, WO 2008-151058 A, WO 2009-006930 A, WO 2009-006997 A, WO 2009-007852 A) and known in the art can be used.

[0082] Available induced pluripotent stem cell lines include various iPSC lines established by the NIH, RIKEN, Kyoto University, etc. Examples of human iPSC lines include RIKEN's HiPS-RIKEN-1A, HiPS-RIKEN-2A, HiPS-RIKEN-12A, and Nips-B2 lines, and Kyoto University's 253G1, 253G4, 1201C1, 1205D1, 1210B2, 1383D2, 1383D6, 201B7, 409B2, 454E2, 606A1, 610B1, 648A1, 1231A3, FfI-01s04, Ff-MH23s01, 15M41, and TkDN-sev2 lines.

[0083] The induced pluripotent stem cells used in the present invention may be cells derived from patients with hereditary diseases (e.g., patients with hereditary blood disorders). Cells induced to differentiate from pluripotent stem cells derived from patients with hereditary blood disorders can serve as disease models that reflect the pathology of the disease and are therefore suitable for screening therapeutic or preventive drugs for the disease. Alternatively, pluripotent stem cells derived from patients with hereditary blood disorders can be genetically repaired by genome editing using the CRISPR-Cas system or the like, and then differentiated into the desired cells, making it possible to use the cells as a therapeutic agent for the disease.

[0084] The species from which the pluripotent stem cells are derived is not particularly limited, and may be cells from, for example, rodents such as rats, mice, hamsters, and guinea pigs, lagomorphs such as rabbits, ungulates such as pigs, cows, goats, and sheep, carnivores such as dogs and cats, and primates such as humans, monkeys, rhesus monkeys, marmosets, orangutans, and chimpanzees. The preferred species is human.

[0085] As used herein, "hematopoietic progenitor cells" refers to cells capable of differentiating into blood cells such as lymphocytes, eosinophils, neutrophils, basophils, erythrocytes, and megakaryocytes. As used herein, hematopoietic progenitor cells and hematopoietic stem cells are not distinguished from each other and refer to the same cell unless otherwise specified. Hematopoietic progenitor cells are typically cells that express the CD34 gene and / or the CD43 gene.

[0086] Those skilled in the art can appropriately determine the culture period in step (A) while monitoring the number of hematopoietic progenitor cells, etc. The number of days is not particularly limited as long as hematopoietic progenitor cells are obtained, but is typically 6 days or more, and preferably 7 days or more, 8 days or more, 9 days or more, 10 days or more, 11 days or more, 12 days or more, 13 days or more, or 14 days or more (particularly 14 days). A long culture period is not a problem in producing hematopoietic progenitor cells, but is typically 30 days or less, and may be 20 days or less.

[0087] Step (B) can also be performed by a method described in known methods (e.g., WO 2011 / 034073, WO 2012 / 157586, WO 2014 / 123242, WO 2021 / 075568). Specific examples include a method in which an apoptosis-inhibiting gene (e.g., BCL2L1 gene) and a MYC gene (e.g., c-MYC gene) are simultaneously forcibly expressed in hematopoietic progenitor cells and the cells are cultured.

[0088] The culture period in step (B) can be appropriately determined by those skilled in the art while monitoring the number of megakaryocytes, etc. The number of days is not particularly limited as long as megakaryocytes are obtained, but is typically 5 days or more, preferably 6 days or more, and more preferably 7 days or more. The upper limit of the culture period is also not particularly limited, but is typically 20 days, preferably 17 days or less, and more preferably 14 days or less.

[0089] Furthermore, the expression of the TP53 gene (protein name: p53) and / or the CDKN1A gene (protein name: p21) or the function of its expression product may be suppressed in hematopoietic progenitor cells. Examples of the TP53 gene include a gene consisting of the nucleic acid sequence represented by NCBI accession number NM_000546.6. Examples of the CDKN1A gene include a gene consisting of the nucleic acid sequence represented by NCBI accession number NM_001291549.3. The origin of these genes is not particularly limited, but is preferably mammalian (e.g., human, mouse, rat, monkey, bovine, equine, porcine, canine, etc.), with human origin being particularly preferred. In one embodiment, these genes are human genes or homologs of human genes in other mammalian species. Genes that have a high degree of identity in nucleotide sequence to the wild-type gene (e.g., 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity) are also preferred.

[0090] The megakaryocytes of the present invention are suitable as starting cells for producing platelets. Therefore, in another aspect, there is provided a method for producing platelets (hereinafter, sometimes referred to as the "method for producing platelets of the present invention"; further, platelets obtained by the method of the present invention may also be referred to as the "platelets of the present invention"), which comprises a step of maturing the megakaryocytes of the present invention.

[0091] The method for producing platelets of the present invention can be carried out by known methods. For example, when megakaryocytes are forced to express a megakaryocyte-inducing factor, the megakaryocytes can be matured by reducing or terminating the forced expression of one or more (preferably at least the MYC gene) or all of the megakaryocyte-inducing factors. For example, when the megakaryocyte-inducing factor is forcedly expressed using a drug, the forced expression can be reduced or terminated by culturing the megakaryocytes in the absence of the drug. Alternatively, when the megakaryocyte-inducing factor gene is introduced into cells using a vector containing LoxP, this can be achieved by introducing Cre recombinase into the cells. Furthermore, when a transient expression vector, or RNA or protein introduction is used, this can be achieved by terminating contact with the vector, etc.

[0092] In a preferred embodiment, the medium used in the platelet production method of the present invention contains one or more (preferably all) of an ADAM17 inhibitor, an AhR (aryl hydrocarbon receptor) inhibitor, and a ROCK inhibitor. Examples of ADAM17 inhibitors include KP-457, DPC333, GW280264X, Aderbasib, TMI-1, and JG26, with KP-457 being preferred. Examples of AhR inhibitors include stemregenin 1 (SR-1), SR-1 analogs (e.g., those described in US2014 / 0369973, etc.), stilbene derivatives (e.g., (E)-1-(4'-trifluoromethylphenyl)-2-(3,5-ditrifluoromethylphenyl)-ethene, (E)-1-(4'-methoxyphenyl)-2-(3,5-dichlorophenyl)-ethene, (E)-1-(4'-chlorophenyl)-2-(3,5-dichlorophenyl)-ethene, 3,5,4'-trihydroxystilbene, etc.), and CH-223191, with SR-1 being preferred. Examples of ROCK inhibitors include Y-27632 (see, e.g., Ishizaki et al., Mol. Pharmacol. 57, 976-983 (2000); Narumiya et al., Methods Enzymol. 325, 273-284 (2000)), fasudil / HA1077 (see, e.g., Uenata et al., Nature 389: 990-994 (1997)), SR3677 (see, e.g., Feng Y et al., J Med Chem. 51: 6642-6645 (2008)), GSK269962 (see, e.g., Stavenger RA et al., J Med Chem. 50: 2-5 (2007) or WO2005 / 037197), GSK429286A, H1152 (see, e.g., Sasaki et al., J Med Chem. 50: 2-5 (2007) or WO2005 / 037197), and the like. al., Pharmacol. Ther. 93: 225-232 (2002)), Wf-536 (see, e.g., Nakajima et al., Cancer ChemotherPharmacol. 52(4): 319-324 (2003)), thiazovivin and derivatives thereof, with Y-27632 being preferred.

[0093] The medium used in the method for producing platelets of the present invention may contain the above-mentioned Ral inhibitor. In one embodiment, the medium used in the method for producing platelets of the present invention contains a Ral inhibitor. Specific compound types, concentrations in the medium, and the like are all incorporated by reference in the description of the method of the present invention. The Ral inhibitor is preferably RBC8, and the concentration of RBC8 in the medium is preferably 20 nM to 1 μM (100 nM in one embodiment).

[0094] Mature megakaryocytes induced by the platelet production method of the present invention can be CD34+CD41+ cells. Mature megakaryocytes induced by this method can also be CD38-negative, CD90-positive, and / or CD49f-positive.

[0095] The culture period in the platelet production method of the present invention is not particularly limited as long as the platelet function is maintained, but is, for example, 2 to 9 days (6 days in one embodiment). When a Ral inhibitor is used, culture may be performed in the presence of the Ral inhibitor for the entire culture period (6 days in one embodiment) in the platelet production method of the present invention, or for part of the period. During the culture period, the medium may or may not be replaced as appropriate, but in one embodiment, the medium is not replaced.

[0096] The culture in the platelet production method of the present invention is typically suspension culture. Furthermore, the culture is preferably performed with shaking. Therefore, in one embodiment, the platelet production method of the present invention includes a shaking culture step. Shaking culture can be performed by stirring the culture solution with the rotating motion of a stirring blade, using, for example, a commercially available rotary shaking culture machine (e.g., VerMES Reactor (manufactured by Satake Multimix)). The stirring speed can be 50 to 200 rpm, for example, about 100 rpm.

[0097] The shaking culture in the platelet production method of the present invention may be carried out using the device and method described in WO 2019 / 009364. Specifically, for example, the shaking culture may include a step of stirring the medium in the culture vessel using a stirring blade, and the stirring step may be carried out by using the following: (a) about 0.0005 m 2 / s 2 ~ approx. 0.02m 2 / s 2(b) a turbulence energy of about 0.2 Pa to about 6.0 Pa; and (c) a Kolmogorov scale of about 100 μm to about 600 μm.

[0098] Specifically, the culture device includes, for example, a container for accommodating a medium containing megakaryocytes, and a stirring blade that reciprocates within the container, and the following is present in the medium: 2 / s 2 ~ approx. 0.02m 2 / s 2 (b) a turbulence energy of about 0.2 Pa to about 6.0 Pa; and (c) a Kolmogorov scale of about 100 μm to about 600 μm.

[0099] The turbulence energy, shear stress, and Kolmogorov scale of the medium in the vessel being stirred can be calculated by simulation based on the basic equations of turbulence. For example, calculations can be performed using the thermal fluid analysis software FLUENT (manufactured by ANSYS), but the software is not limited to this. More specifically, when the stirring blade is configured to reciprocate, the turbulence energy varies depending on the reciprocating stroke, reciprocating speed, and reciprocating frequency of the stirring blade. When multiple stirring blades are used, the number of stirring blades can also be a factor that causes changes. Shear stress and Kolmogorov scale also vary with changes in the same factors.

[0100] The medium used in the present invention is not particularly limited, but a medium used for culturing animal cells can be prepared as a basal medium. Examples of basal media include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM), αMEM medium, Dulbecco's modified Eagle's Medium (DMEM), Ham's F12 medium, RPMI 1640 medium, Fischer's medium, Neurobasal Medium (Life Technologies), and mixtures thereof. The medium may contain serum or may be serum-free. If necessary, the medium may also contain one or more substances, such as albumin, insulin, transferrin, selenium, fatty acids, trace elements, 2-mercaptoethanol, thioglycerol, lipids, amino acids, L-glutamine, non-essential amino acids, vitamins, growth factors, small molecules, antibiotics, antioxidants, pyruvate, buffers, inorganic salts, and cytokines. Cytokines are proteins that promote hematopoietic differentiation, such as VEGF, TPO, and SCF. Instead of TPO, TA-316 ((2E)-2-[1-[5-(4-Bromophenyl)-4-hydroxy-3-thienyl]ethylidene]hydrazide-5-[[[[4-[[(2-hydroxyethyl)amino]carbonyl]phenyl]methyl]amino]carbonyl]-2-thiophenecarboxylic Acid) is also preferably used. In one embodiment, the medium used in the method of the present invention contains SCF and TA-316. In another embodiment, the medium used in the method of the present invention for producing platelets contains SCF, TA-316, SR-1, KP-457, and Y27632. When megakaryocytes have a drug-responsive promoter, it is preferable to add the corresponding drug, such as tetracycline or doxycycline, to the medium when expressing a gene under the promoter.

[0101] In the present invention, the cell culture conditions are not particularly limited, and conventional culture conditions can be used. Specific examples of the culture temperature include about 35 to about 42°C, about 36 to about 40°C, and about 37 to about 39°C. The CO2 concentration is, for example, about 5 to about 15%. The O2 concentration is, for example, about 15 to about 25%.

[0102] In each step of the production method of the present invention and the platelet production method of the present invention, cells may be cultured under feeder-free conditions and / or xeno-free conditions. In the production method of the present invention and the platelet production method, all steps may be performed under feeder-free and xeno-free conditions. As used herein, "feeder-free" refers to a medium or culture conditions that do not contain other cell types (i.e., feeder cells) that play a supporting role and are used to establish culture conditions for the cells to be cultured. Furthermore, "xeno-free" refers to a medium or culture conditions that do not contain components derived from organisms other than the biological species of the cells to be cultured.

[0103] The seeding density of cells in each step of the production method of the present invention and the method for producing platelets of the present invention is not particularly limited as long as the cells can grow. 2 ~1.0×10 7 cells / cm 2 , preferably 1.0 x 10 3 ~1.0×10 6 cells / cm 2 , more preferably 1.0 × 10 4 ~1.0×10 5 cells / cm 2 is.

[0104] When the substance used in the present invention is a low molecular weight compound, the compound includes not only the free form but also its pharmacologically acceptable salt and hydrate.Pharmacologically acceptable salts vary depending on the type of compound, but include, for example, inorganic base salts such as alkali metal salts (sodium salt, potassium salt, etc.), alkaline earth metal salts (calcium salt, magnesium salt, etc.), aluminum salt, ammonium salt, etc., and organic base salts such as trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, etc., base addition salts, or inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, phosphate, etc., and organic acid salts such as citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, paratoluenesulfonate, etc., acid addition salts.

[0105] Each substance used in the present invention may be synthesized by a known method or may be a commercially available product. Furthermore, when a protein or peptide is used, the protein or peptide may be obtained from a cell that expresses it. Cells that express the protein or peptide of interest can be produced by inserting DNA encoding the protein or peptide of interest into a known expression vector and then introducing the resulting expression vector into an appropriate host cell.

[0106] The production methods of the present invention and the platelet production methods of the present invention may include a step of recovering the target cells or tissues obtained in each step. The recovered cells may be cryopreserved using a cell cryopreservation solution. The obtained cells may be counted using a cell counter, or may be labeled with an antibody against a cell surface marker and then selected or purified by flow cytometry, mass cytometry, magnetic cell sorting, or the like.

[0107] 5. Uses of Megakaryocytes and Platelets In another aspect of the present invention, megakaryocytes (i.e., megakaryocytes of the present invention) and platelets (i.e., platelets of the present invention) that have been evaluated by the evaluation method of the present invention (typically evaluated as being of high quality) or obtained by the production method of the present invention and the method for producing platelets of the present invention ("obtained" can be read as "obtained" as appropriate) are provided. Hereinafter, the megakaryocytes and platelets of the present invention may be collectively referred to as "cells of the present invention."

[0108] Since the cells of the present invention can be used in medical treatments such as blood transfusions, in another embodiment, a blood product containing the cells of the present invention (hereinafter, sometimes referred to as the "blood product of the present invention") is provided. As used herein, "blood product" refers to a composition containing blood cells such as megakaryocytes and platelets. The megakaryocytes of the present invention can be used, for example, by administration or transplantation into a living body to produce functional platelets in the living body. Furthermore, the platelets of the present invention can be used, for example, to prevent bleeding due to thrombocytopenia or platelet dysfunction, to treat bleeding, or to treat blood diseases. The present invention also encompasses methods for treating or preventing blood diseases or bleeding, in which an effective amount of the cells of the present invention is administered or transplanted into a mammal (e.g., human, mouse, rat, monkey, cow, horse, pig, dog, etc.) to be treated or prevented. Unless otherwise specified herein, the term "drug for treating or preventing a disease (or therapeutic or preventive method)" also encompasses pharmaceuticals (or methods) that can both treat and prevent the disease.

[0109] Examples of blood diseases to be treated or prevented include thrombocytopenia and platelet dysfunction. Causes of thrombocytopenia include pancytopenia due to bone marrow failure, thrombocytopenia due to shortened platelet lifespan due to platelet destruction, thrombocytopenia due to increased platelet consumption, drug-induced thrombocytopenia, and thrombocytopenia due to abnormal platelet distribution in organs. Causes of platelet dysfunction include drug-induced platelet dysfunction and hereditary platelet dysfunction (e.g., thrombasthenia, Bernard-Soulier syndrome, MYH9 abnormality, Wiskott-Aldrich syndrome, etc.).

[0110] When the cells of the present invention are used as blood products, it is desirable to use cells derived from iPS cells established from somatic cells with the same or substantially the same HLA genotype as the recipient individual, in order to avoid rejection. Here, "substantially the same" refers to HLA genotypes that are sufficiently identical to those of the administered or transplanted cells that immune responses can be suppressed with immunosuppressants, e.g., somatic cells with HLA types that match the three HLA loci (HLA-A, HLA-B, and HLA-DR) or four HLA loci (HLA-C). If sufficient cells cannot be obtained due to age, constitution, or other reasons, they can be administered or transplanted in a state that avoids rejection by embedding them in capsules or porous containers made of polyethylene glycol or silicone. Furthermore, HLA-A, HLA-B, and HLA-C proteins are highly associated with rejection following cell transplantation. Therefore, the cells of the present invention preferably have only the HLA-A and HLA-B genes disrupted, or all three loci (HLA-A, HLA-B, and HLA-C) disrupted, and even more preferably have the HLA-E gene disrupted. For example, genetically modified cells can be produced by disrupting the HLA-A and HLA-B genes, or the HLA-A, HLA-B, and HLA-C genes (and optionally the HLA-E gene) in pluripotent stem cells or in any cell at the differentiation stage from pluripotent stem cells to platelets (e.g., hematopoietic progenitor cells, megakaryocytes, etc., particularly megakaryocytes), and then producing platelets from these cells through a differentiation induction process and / or maturation process, thereby eliminating the expression of HLA proteins on the platelet surface. This is expected to reduce antigenicity during platelet transplantation. Furthermore, transplantable blood products, such as platelet products, can be provided to patients with antibodies against HLA class 1.

[0111] The cells of the present invention are prepared as parenteral preparations such as injections, suspensions, and infusions by mixing with a pharmaceutically acceptable carrier according to conventional methods. Thus, in one embodiment, there is provided a method for producing a blood product, which includes a step of formulating the cells of the present invention. Such a method may include a step of preparing the cells of the present invention. Furthermore, it may also include a step of preserving the cells of the present invention.

[0112] Pharmaceutically acceptable carriers that can be included in such parenteral formulations include aqueous solutions for injection, such as physiological saline, isotonic solutions containing glucose or other adjuvants (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), etc. The cells of the present invention may be formulated with, for example, human plasma, infusion agents, buffers (e.g., phosphate buffer, sodium acetate buffer), soothing agents (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives, antioxidants, etc.

[0113] The blood products of the present invention are provided in a frozen state stored under conditions typically used for cryopreserving cells and can be thawed immediately before use. In this case, they may further contain serum or a serum substitute, an organic solvent (e.g., DMSO), etc. In this case, the concentration of the serum or serum substitute is not particularly limited, but may be about 1 to about 30% (v / v), preferably about 5 to about 20% (v / v). The concentration of the organic solvent is not particularly limited, but may be about 0 to about 50% (v / v), preferably about 5 to about 20% (v / v).

[0114] The cells of the present invention can also be used in methods for screening candidate drugs useful for treating or preventing blood diseases. Thus, in yet another aspect of the present invention, a method for screening therapeutic or preventive drugs for blood diseases is provided, comprising culturing the cells of the present invention in the presence or absence of a test substance. For example, a disease model reflecting the pathology of a blood disease can be used as the cells. If the pathology improves in the presence of the test substance, the test substance can be selected as a candidate drug for treating or preventing a blood disease. Examples of such blood diseases include those similar to those described above that are the target of treatment or prevention using the blood products of the present invention.

[0115] The step of contacting the test substance with the cells of the present invention can typically be carried out by adding the test substance to a medium in which the cells of the present invention are cultured, or by transferring the cells of the present invention to a medium to which the test substance has been added in advance. The period of time for the step of contacting the test substance with the cells of the present invention is not particularly limited, but is typically 1 minute to 5 days, preferably 1 hour to 1 day.

[0116] Test substances used in the present invention include, for example, cell extracts, cell culture supernatants, microbial fermentation products, extracts derived from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic low-molecular-weight compounds, natural compounds, etc. Test substances may also be existing or candidate components of pharmaceuticals, nutritional foods, etc.

[0117] The present invention will be more fully understood by reference to the following examples, which provide illustrative, non-limiting embodiments of the invention.

[0118] Results: Identification of endogenously active miRNAs in imMKCLs. miRNA switch technology refers to synthetic mRNA-based genetic circuits that control transgene expression through miRNA activity (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015); Fujita, Y. et al. Sci Adv 8, eabj1793 (2022)). We hypothesized that miRNA switches could identify subsets of imMKCLs with distinct miRNA activities, providing a useful tool for exploring heterogeneity within imMKCLs. Figure 1a shows a schematic diagram of the miRNA switch technology. We designed synthetic mRNAs that contain complementary sequences to target miRNAs in their 5' untranslated regions (UTRs) and encode reporter fluorescent proteins for monitoring endogenous miRNA activity. A pair of mRNAs, encoding Azami-Green 1 (AG1) as a transfection control and TagBFP containing the target miRNA sequence, was synthesized and cotransfected into imMKCLs (Fig. 1b). The expression level of TagBFP was measured by flow cytometry in cells with endogenous activity for a specific miRNA (Fig. 1c). A miRNA switch-based screen was performed using a library containing 269 miRNA switches (Table 1), resulting in the identification of 24 miRNAs with endogenous activity in imMKCLs (Fig. 1d).

[0119]

[0120]

[0121] Enrichment of immune-biased imMKCLs by the Let-7 miRNA switch. Among the activated miRNAs, we focused on let-7a-5p and let-7g-5p, which showed heterogeneous activity among imMKCLs (Fig. 2a). We selected subpopulations with high and low let-7 activity and found that the subpopulation with low let-7 activity accounted for less than 5% of the total. We confirmed that the let-7 activity levels in these populations correlated with their expression levels in the imMKCL subpopulations (Fig. 3a). To characterize the molecular differences between the let-7 high and let-7 low subpopulations, we performed bulk RNA-seq analysis of three different imMKCL clones (M35-1, clone 7, and clone 7-3) at the proliferation and maturation stages. The properties of clone 7 imMKCLs and the functions of iPSC-PLTs derived from them have been previously reported (Non-Patent Documents 2 and 3). Clone 7 has also been used by several research groups to study megakaryopoiesis and thrombopoiesis (Lo, RW et al. Blood 136, 715-725 (2020); Ver Donck, F. et al. Blood (2023); Seo, H. et al. Blood Adv 2, 2262-2272 (2018)), highlighting its importance as a research tool. We also selected clone 7-3, which is derived from clone 7 and exhibits an aging phenotype characterized by reduced proliferation and iPSC-PLT production after repeated subculture (Figure 3b). M35-1 was established from patient iPSCs for the iPLAT1 clinical trial because it exhibits relatively superior proliferation and iPSC-PLT production capabilities compared to other suitable patient-derived imMKCL clones (Non-Patent Document 5). Equivalent iPSC-PLT production was observed in the let-7 low or let-7 high subpopulations of the three clones (Fig. 3c).

[0122] The bulk RNA-seq sampling procedure is shown in Figure 2b. Differential gene expression analysis revealed many genes with altered expression profiles between let-7 high im MKCLs and let-7 low im MKCLs. To identify transcriptional pathways enriched in each subpopulation, we performed gene set enrichment analysis (GSEA). Notably, we observed that immune-related gene sets were significantly enriched in let-7 low im MKCLs at both the proliferation and maturation stages (Figures 2c and d). Particularly during the proliferation phase, gene sets related to responses to tumor necrosis factor (TNF), lipopolysaccharide (LPS), and enterotoxins were enriched in let-7 low cells. This result is consistent with reports that naive mouse and human megakaryocytes possess pathogen-sensing properties (Pariser, DN et al. J Clin Invest 131 (2021); Campbell, RA et al. Blood 133, 2013-2026 (2019)). TNF-driven inflammation has also been suggested to induce age-related platelet hyperresponsiveness (Davizon-Castillo, P. et al. Blood 134, 727-740 (2019)). During maturation, gene sets related to interferon signaling were significantly enriched in let-7 low cells. Some immune-related properties were maintained from the proliferation phase to maturation (Figure 2e-h, Table 2). These findings suggest that imMKCLs with lower let-7 activity selectively enrich for immune-biased MK phenotypes.Our bulk RNA-seq analysis also revealed that multiple genes encoding chemokines and cytokines, including C-X-C motif chemokine ligand 10 (CXCL10), C-C motif chemokine ligand 2 (CCL2), and CCL3, were upregulated in the let-7 low immune-biased imMKCL subpopulation (Figure 2f, h), suggesting the coherence of diverse immune responses mediated by the secretion of these molecules (Cunin, P. & Nigrovic, PA J Leukoc Biol 105, 1111-1121 (2019)). Interestingly, elevated mRNA levels of these molecules have been reported in patients with severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS) (Channappanavar, R. & Perlman, S. Semin Immunopathol 39, 529-539 (2017)). Furthermore, in COVID-19 patients, elevated mRNA expression levels of CXCL10, CCL2, and TNF correlate with increased MK (Ren, X. et al. Cell 184, 5838 (2021); Bernardes, JP et al. Immunity 53, 1296-1314.e1299 (2020)).

[0123]

[0124] Identification of immune-type MKs using the let-7 miRNA switch The present inventors further investigated whether immune-type MKs could be identified using the let-7 miRNA switch in MKs directly differentiated from human embryonic stem cells (ESCs). The present inventors used CD34 miRNAs generated by the Sac. method (Takayama, N. et al. Blood 111, 5298-5306 (2008); Yuzuriha, A. et al. Stem Cell Res 53, 102287 (2021)). +We performed bulk RNA-seq analysis of two distinct cell populations, hematopoietic progenitor cells (HPCs), that differ in let-7a-5p and let-7g-5p activity (Fig. 4a). GSEA revealed a similar enrichment of immune-related gene sets in let-7 low ESC-derived HPCs (Fig. 4b, c; Table 2), suggesting that immune-biased MK fate determination during MK development may occur as early as the hematopoietic progenitor stage.

[0125] scRNA-seq Reveals Heterogeneity and Functional Diversity of ImMKCLs To further characterize the cellular heterogeneity of imMKCLs and explore the mechanism underlying the enrichment of "immune" imMKCLs by the let-7 miRNA switch, we performed single-cell (sc) RNA-seq analysis on proliferating let-7 low and let-7 high imMKCLs. Because bulk RNA-seq analysis demonstrated similar behavior of both the let-7a-5p and let-7g-5p miRNA switches (Fig. 2), we focused our investigation on let-7a-5p. We identified five transcriptionally distinct imMKCL subpopulations (Fig. 5a), with let-7 low imMKCLs relatively concentrated in clusters 3 and 5 (Fig. 5b). We further determined the expression of the most differentially expressed genes (DEGs) and characterized the gene ontology (GO) terms enriched in each cluster (Fig. 5c, d).

[0126] Cluster 1 was enriched in GO:BP (biological process) terms related to oxidative phosphorylation, suggesting their role in energy supply. Clusters 2 and 4, on the other hand, were enriched in GO:BP terms related to the cell cycle and mitotic nuclear division, indicating a subset of cycling MK progenitors. The identification of two marker genes for dividing MKs, PCNA (proliferating cell nuclear antigen) and TPM4 (tropomyosin 4), is consistent with a recent study of dividing MKs in human bone marrow (BM) (Liu, C. et al. Adv Sci (Weinh) 8, e2100921 (2021)). Cluster 3 showed high expression of genes related to "platelet activation" and "blood coagulation," suggesting a subset of MK progenitors specialized for platelet production. In particular, genes related to thrombopoiesis, such as thrombospondin 1 (THBS1) (Non-Patent Document 7), von Willebrand factor (VWF) (Ruggeri, Z. M. Von Willebrand factor, platelets and endothelial cell interactions. J. Thromb. Haemost. 1, 1335-1342 (2003)), and platelet membrane glycoprotein IX (GP9) (Romo, G. M. et al. J. Exp. Med. 190, 803-814 (1999)), were more highly expressed in cluster 3 than in other clusters (Fig. 5f). Furthermore, genes related to immune system processes were also enriched in cluster 3, suggesting that this may represent a subset of MK progenitors with functional duality.For example, platelet factor 4 (PF4), one of the most abundant DEGs in cluster 3, promotes blood coagulation (Figure 5c) (Kowalska, MA, Rauova, L. & Poncz, M. Thromb Res 125, 292-296 (2010)) and is a key regulator of innate immunity through its activity on macrophages (Scheuerer, B. et al. Blood 95, 1158-1166 (2000)) and neutrophils (Xiao, Z., Visentin, GP, Dayananda, KM & Neelamegham, S. Blood 112, 1091-1100 (2008)). Furthermore, proplatelet basic protein (PPBP), an activator of neutrophils against bacteria (Laarman, AJ et al. EMBO J 31, 3607-3619 (2012)), was also significantly upregulated in cluster 3.

[0127] Both clusters 3 and 5 may represent subpopulations of MK progenitors with highly elevated expression of potential immune-related genes. GO analysis revealed that immune genes annotated in clusters 3 and 5 are involved in immune system processes and responses (Figure 5e). Cluster 5 showed high expression of genes involved in type I interferon, cytokines, and viral responses, whereas cluster 3 appeared to respond to myeloid leukocyte-mediated immunity. CCL5, an important inflammatory chemokine (Marques, RE, Guabiraba, R., Russo, RC & Teixeira, MM Expert Opin Ther Targets 17, 1439-1460 (2013)), was one of the most abundant DEGs in cluster 5. In particular, CCL5 has been reported to promote the formation of platelet precursor cells during thrombopoiesis (Machlus, KR et al. Blood 127, 921-926 (2016)), and CCL5 expression was upregulated in cluster 3 compared to clusters 1, 2, and 4 (Fig. 5c, f). Interferon-stimulated gene 15 (ISG15), a ubiquitin-like protein that can covalently bind to host and viral proteins (Perng, YC & Lenschow, DJ Nat Rev Microbiol 16, 423-439 (2018)), was identified as a top DEG in cluster 5. Considering that type I interferon secretion from virus-infected cells is a hallmark of antiviral immunity (Grandvaux, N., tenOever, BR, Servant, MJ & Hiscott, J. Curr Opin Infect Dis 15, 259-267 (2002)), these results indicate that cluster 5 represents a representative "immune-type" MK with antiviral function.Recent in vivo models of naive MKs have demonstrated the existence of "immune" MKs, MKs that support the hematopoietic stem cell (HSC) niche, and MKs that are biased toward thrombopoiesis (Non-Patent Documents 7, 8; Liu, C. et al. Adv Sci (Weinh) 8, e2100921 (2021)). In particular, these results suggest that imMKCLs contain a thrombopoietic-biased subset (cluster 3) and a representative immune-biased subset (cluster 5). Although no niche-supporting subset was observed, imMKCLs likely contain immune-biased cell populations similar to those found in endogenous MKs.

[0128] Inhibition of let-7a-5p activity drives the development of "immune-type" imMKCLs. Next, we performed loss-of-function experiments to investigate whether let-7 functionally drives the development of the "immune-type" subset of imMKCLs (Fig. 6a). When let-7a-5p expression / activity was inhibited using a let-7a-5p inhibitor (Fig. 6b, c), we found that the expression of various immune-related molecules, including PF4, PPBP, ISG15, and interferon-induced protein with tetratricopeptide repeats 3 (IFIT3), identified in clusters 3 and 5, was enhanced (Fig. 6e). We also investigated whether inhibition of let-7a-5p activity in imMKCLs altered their response to immune stimulation. Cells were stimulated with the pathogen receptor agonist LPS or control buffer, and the supernatants were analyzed by flow cytometry using a cytometric bead array kit. We found that inhibition of let-7a-5p in imMKCLs promoted the secretion of interleukin-8 (IL-8), a key inflammatory chemokine (David, JM, Dominguez, C., Hamilton, DH & Palena, C. Vaccines (Basel) 4 (2016)) (Figure 6d). IL-8 and its receptor are known to regulate MK proliferation and maturation (Emadi, S. et al. Blood 105, 464-473 (2005)). These results are consistent with a previous report that found that MKs derived from human umbilical cord blood produced IL-8 even without stimulation (Higuchi, T. et al. Br J Haematol 99, 509-516 (1997)). Taken together, we conclude that let-7a-5p is a functional factor regulating the development of "immune-type MKs" among imMKCLs.

[0129] RALB is a functional target of let-7a-5p in the development of immune-biased imMKCL. Previous experiments revealed a critical role for let-7a-5p in immune-biased imMKCL. To further identify underlying factors contributing to immune-related outcomes, we performed ingenuity pathway analysis (IPA) to investigate upstream regulators of cluster 3 and cluster 5 (let-7 low imMKCL). Figure 7a shows a flowchart illustrating the overall analytical design. The IPA analysis identified GATA1, a transcription factor for MK (Orkin, SH, Shivdasani, RA, Fujiwara, Y. & McDevitt, MA Stem Cells 16 Suppl 2, 79-83 (1998)), and KLF2, a regulator of myeloid development, as potential transcriptional activators in cluster 3 (Figure 7b). In particular, KLF2 has been shown to regulate the host innate immune response to multimicrobial infection (Mahabeleshwar, GH et al. Immunity 34, 715-728 (2011)). Meanwhile, known activators of virus-induced intracellular genes, such as IRF7 (Ning, S., Pagano, JS & Barber, GN Genes Immun 12, 399-414 (2011)) and IRF3 (Kubota, T. et al. J Biol Chem 283, 25660-25670 (2008)), were identified as potential upstream regulators in cluster 5 (Fig. 7b). We also compared the shared upstream regulators in clusters 3 and 5 with predicted targets of let-7a-5p (Fig. 7c). This analysis identified 20 candidate upstream regulators, eight of which showed detectable expression levels in imMKCL (Fig. 7d). Furthermore, based on their elevated expression levels in the enriched let-7 low clusters (clusters 3 and 5), cut-like homeobox 1 (CUX1) and RAS-like proto-oncogene B (RALB) were suggested to be targets of let-7a-5p (Figure 7e), which may contribute to the observed immune-related outcomes.Concomitantly, inhibition of let-7a-5p upregulated the mRNA expression levels of CUX1 and RALB during both the proliferation and maturation phases (Fig. 7f). While overexpression of CUX1 had no significant effect (Fig. 8), overexpression of RALB upregulated the mRNA expression of IRF7, ISG15, and IFIT3 (Fig. 7g, h; Fig. 9a, b), but not the expression level of let-7a-5p (Fig. 9c). On the other hand, despite being predicted as an upstream regulator of both clusters 3 and 5, overexpression of RALB did not affect the expression of thrombopoiesis-related genes identified in cluster 3 (Fig. 9d). This suggests that distinct let-7 targets may be involved in the regulation of immune and platelet formation pathways in imMKCLs. Combined with the findings from the IPA analysis (Fig. 7b), we propose that let-7a-5p regulates the immune properties of imMKCLs by targeting RALB (Fig. 7i).

[0130] Dysregulation of immune characteristics / subsets is associated with the quality of imMKCLs. We previously reported that certain imMKCL clones with slow proliferation rates exhibited a reduced ability to generate iPSC-PLTs (Fig. 10a) (Non-Patent Document 9). However, the factors that cause the decline in imMKCL quality, along with the transcriptional signature of cellular senescence / aging (Fig. 11a, b), remained unclear. Therefore, we reanalyzed the GSEA of MKCLs of various qualities used in our previous study (Non-Patent Document 9). Similar to the GSEA of let-7 low and let-7 high populations (Fig. 2), we found that TNF signaling and interferon response gene sets were significantly enriched in intermediate- to low-quality MKCLs (Fig. 10b, Fig. 11c). We also found that clone 7 and clone 7-3, despite being derived from the same iPSC clone with the same genetic background (Non-Patent Documents 2 and 3), exhibited distinct characteristics in terms of proliferation and iPSC-PLT production under both quiescent and turbulent conditions (Fig. 10c-e), as well as distinct let-7a-5p activity patterns (Fig. 12a). Clone 7-3 showed enrichment in TNF signaling and interferon response signals compared with clone 7 (Fig. 10f, Fig. 12b). These results suggest that induced immune-related pathways are associated with low-quality imMKCL. GSEA further demonstrated that downregulated, senescent tumor protein 53 (TP53) targets were enriched in clone 7 (Fig. 12c), indicating cellular senescence in clone 7-3. RALB mRNA expression and IL-8 secretion in clone 7-3 were higher than those in clone 7 (Fig. 10g, h). Inflammatory cytokines are known to be secreted by senescent cells with persistent DNA damage (Rodier, F. et al. Nat Cell Biol 11, 973-979 (2009)).In addition to IL-8 secretion (Fig. 10h), genes encoding inflammatory cytokines (IFNB1, CXCL8, CXCL10, and CXCL11) also showed higher expression levels in clone 7-3 (aged clone) compared with clone 7 (younger clone) (Fig. 12d). Notably, induction of recombinant IL-8 in imMKCL resulted in a decrease in iPSC-PLT production (Fig. 13a–c). On the other hand, blockade of IL-8 signaling with Reparixin (Gorio, A. et al. J Pharmacol Exp Ther 322, 973–981 (2007)), a specific CXCR1 / 2 inhibitor, improved iPSC-PLT production without affecting proliferation (data not shown) (Fig. 13d–g). Furthermore, administration of recombinant interferon-α2a not only reduced the proliferation rate (Fig. 14a) but also reduced iPSC-PLT production in a concentration-dependent manner (Fig. 14b, d). Interferon treatment increased the mRNA expression of the senescence marker CDKN2A and the interferon-responsive genes ISG15 and IFIT3 in imMKCLs (Figure 14c). Collectively, these findings suggest that dysregulation of immune signatures / subpopulations within imMKCLs and secretion of inflammatory cytokines leads to the overall growth arrest and reduced platelet production of the imMKCL population, which may be due to upregulation of RALB levels. Furthermore, these results highlight the impact of immune cytokines on ex vivo iPSC-PLT production, which has important implications for clinical applications.

[0131] Interestingly, investigation of RALB revealed that upregulation of RALB levels induced proliferation arrest, decreased iPSC-PLT production, and increased IL-8 secretion (Figures 15a-d), accompanied by the transcriptional signature of cellular senescence / aging (Figure 16a). We hypothesized that this mechanism may recapitulate the characteristics of low-quality imMKCLs. Furthermore, bulk RNA-seq analysis revealed that TNF signaling and interferon response were enriched in imMKCLs overexpressing RALB (Figures 15e and 16b), further supporting our hypothesis. Furthermore, RALB expression levels correlated with the expression levels of interferon-responsive genes in multiple imMKCL clones (Figure 15f).

[0132] We employed two additional approaches to verify the effects of RALB. Addition of RBC8 (Figure 17a), a small molecule compound reported as a selective inhibitor of the GTPase Ral (Yan, C. et al. Nature 515, 443-447 (2014)), at 0.1 μM resulted in enhanced proliferation (Figure 17b) and improved iPSC-PLT production (Figures 17c-e). siRNA-mediated knockdown of RALB also promoted iPSC-PLT production (Figures 17f, g). Although no significant changes in IL-8 secretion were observed (Figure 17h), knockdown of RALB reduced the mRNA expression levels of IRF7, ISG15, and IFIT3 (Figure 17i). Finally, iPSC-PLTs generated from low-quality clones showed reduced PAC-1 binding and P-selectin expression (Figure 18). Taken together, these results suggest that dysregulation of immune signatures / subsets within imMKCLs is associated with reduced proliferation of imMKCLs and reduced iPSC-PLT production, and that this phenotype may be due to upregulation of RALB expression.

[0133] Finally, we investigated the CD34 +We validated our findings in an in vitro differentiated MK model derived from imMKCLs (Figure 19a). Inhibition of let-7 did not significantly affect interferon signaling or platelet production (Figure 19b-d). However, overexpression of RALB resulted in upregulation of interferon-responsive genes and decreased platelet production (Figure 19e-g). These results suggest that imMKCLs and primary MKs respond differently to let-7 inhibition, but the effects of RALB are shared, highlighting the pivotal role of RALB in determining immune characteristics / subsets during MK development.

[0134] LT-C imMKCLs have reduced KAT7 and H3K14ac levels. Cell cycle arrest is also an indicator of cellular senescence (Kumari, R., Jat, P., 2021. Front. Cell Dev. Biol. 9, 645593; Mohamad Kamal, NS et al. 2020. Eur. J. Cell Biol. 99, 151108), and we previously reported that clones with low or intermediate PLT production capacity exhibit a senescence signature (Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021)). In particular, because KAT7 has been suggested as a novel regulator of cellular senescence (Wang, W. et al., 2021. Sci. Transl. Med. 13, eabd2655), we examined KAT7 levels in ST-C (short-term culture, less than one month) and LT-C imMKCLs (long-term culture, more than four months), which may correlate with proliferation rate and subsequent PLT production. Western blot analysis revealed that both LT-C imMKCLs and imMKCLs derived from iPSCs of patients with Werner syndrome (WS imMKCLs), a known progeria disorder, had reduced levels of KAT7 and its downstream protein, H3K14ac, compared with ST-C imMKCLs (Paul, SK, et al., 2024. Nat. Commun. 15, 4772) (Figure 21A, B). Furthermore, WS imMKCLs showed reduced proliferation and platelet production capacity compared with ST-C imMKCLs (Figure 21C, D). These results suggest that KAT7 is a key regulator of imMKCL proliferation and that age-dependent KAT7 levels may affect cell cycle progression.

[0135] Pharmacological inhibition of KAT7 causes cell cycle arrest and inhibits proliferation and maturation of imMKCLs. To investigate the role of KAT7 in imMKCLs, we first suppressed H3K9 acetylation activity using the KAT6 / KAT7 inhibitors WM3835 and WM1119. Initial studies confirmed that 5 μM WM3835 significantly reduced H3K14ac levels compared to WM1119, suggesting its suitability as a selective KAT7 inhibitor in this study (MacPherson, L., et al. 2020. 266-270) (Figure 22A). Administration of WM3835 from days 1 to 5 of the Dox-OFF phase did not affect PLT production, suggesting that KAT7 does not function during maturation (Figure 22B). In contrast, pretreatment with WM3835 for 3 or 6 days at the Dox-ON stage had no effect, but pretreatment for 9 days, followed by removal of Dox and an additional 6 days of platelet maturation, significantly reduced platelet production (Fig. 22C, D). Analysis using the Fucci sensor confirmed that KAT7 inhibition increased cells in the G0 phase and decreased cells in the G1 and G2 / M phases (Fig. 22E).

[0136] To avoid off-target effects of WM3835, we also performed shRNA-mediated KAT7 knockdown (shKAT7) experiments, and confirmed a significant decrease in KAT7 mRNA expression by RT-qPCR (Figure 23A). Both cell proliferation and platelet production were significantly reduced in shKAT7 imMKCLs (Figure 23B). Furthermore, the percentage of cells in G0 phase increased twofold in shKAT7 imMKCLs, suggesting cell cycle arrest at G0 phase due to KAT7 knockdown (Figure 23C). These results demonstrated a phenotype similar to that observed with WM3835 treatment. Meanwhile, overexpression of KAT7 did not alter proliferation rate, PLT production, or cell cycle status (Figures 23A–E). These results highlight the importance of KAT7 for cell cycle maintenance in Dox-ON imMKCLs and its role in maintaining the proliferative potential of imMKCLs and in influencing platelet yield during the subsequent maturation stage.

[0137] Materials and Methods: Cells. The human iPSC lines TkDN-Sev2 and T-1 were established in our laboratory. imMKCL (clone 7, clone 7-3, M35-1) were derived from human iPSCs using DOX-inducible factors and were used in previous studies (Non-Patent Documents 2 and 3). The human ESC line KhES-3 was obtained from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan). WS imMKCL was provided by the Chiba University Graduate School of Medicine (Innovative Regenerative Medicine, where one of the present inventors, Hiroyuki Eto, also holds a position at Kyoto University). The use of all cells was approved by the ethics committees of Kyoto University and Chiba University.

[0138] Cell culture imMKCL (clone 7, clone 7-3, M35-1) was cultured as previously reported (Non-Patent Document 3). The proliferation and differentiation stages were controlled using doxycycline.

[0139] Cell proliferation assay. Cell proliferation was assessed using a CCK-8 kit according to the manufacturer's instructions. ImMKCLs cultured for 3 days at the Dox-ON stage were plated in 96-well plates at 5 × 10 3 Cells were seeded at a density of 1000 cells / well. The absorbance at 450 nm was measured using a microplate reader (Envision 2104, PerkinElmer).

[0140] A miRNA-responsive mRNA (miRNA switch) was constructed using the MegaScript T7 kit (Ambion) according to a previously reported method (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)). The miRNA switch is encoded on a modified mRNA that posttranscriptionally regulates the blue fluorescent protein TagBFP in response to the activity of a specific miRNA (miR-X) expressed in imMKCLs. The mRNA encoding TagBFP contains a target miR-X sequence in its 5'UTR, and TagBFP expression levels are suppressed in response to increased miR-X activity. mRNA encoding Azami Green 1 (hmAG1) was used as a transfection control (Figure 1B).

[0141] miRNA switch-based screening. The miRNA switch-based screening was performed using a custom-constructed library (269 miRNA switches in total). Two different mRNAs encoding TagBFP and AG1, respectively, were co-transfected into cells. The miRNA switch transfection was performed as previously described (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)). Briefly, during the growth phase of imMKCL, 150 ng of mRNA (75 ng each) was transfected with StemFect mRNA (Stemgent) into 50 μL of cell suspension (1 × 10 6 Reverse transfection was performed for 30 minutes in imMKCLs (100 cells / mL) and then diluted to 200 μL with culture medium in a 96-well plate. After 24 hours, flow cytometry was performed using an LSRFortessa (BD Biosciences, San Jose, CA, USA). Candidate miRNA switches were selected based on the activity response pattern of imMKCLs to their target miR-X ("active" in Figure 1c). miRNAs that did not show strong response activity in imMKCLs were defined as "inactive" (Figure 1c). For let-7a-5p and let-7g-5p, we individually transfected the candidate switches into imMKCLs along with mRNA encoding the control hmAG1. After 24 hours of incubation, cells were sorted using a BD FACSAria II for further analysis.

[0142] Cell sorting and flow cytometry. Cells were suspended in staining medium and incubated with the appropriate antibodies on ice for 30 minutes in the dark before sorting or analysis using a BD FACSAria II. Platelet counts were measured as previously described (Non-Patent Documents 2 and 3). The following antibodies were used for flow cytometry: allophycocyanin (APC)-conjugated anti-CD41a (integrin αIIbβ3 complex: HIP8 clone) (Biolegend, San Diego, CA), phycoerythrin (PE)-conjugated anti-CD42b (GPIbα) (eBioscience, San Diego, CA), and PE-conjugated anti-CD41a (HIP8 clone) (Biolegend). Alternatively, imMKCLs were sorted using a FACS S6 instrument equipped with a 100 μm nozzle and run using the DIVA software package (version 8.0.2).

[0143] Antibody-based quantitative protein analysis (Simple WES). Cell lysates were prepared using the EpiQuik Total Histone Extraction Kit (Epigentek). Protein concentrations were determined using Pierce TM Measurements were performed using a BCA Protein Assay Kit (Thermo Fisher Scientific). Lysates were adjusted to a final concentration of 0.5 or 1 μg / μL and analyzed using a Wes automated Western blotting system (ProteinSimple). The antibodies used were mouse anti-β-actin (1:500, Sigma), rabbit anti-histone H3 (1:50, Cell Signaling Technology), rabbit anti-acetyl histone H3 (Lys14) (D4B9) (1:25, Cell Signaling Technology), and rabbit anti-MYST2 (D4N3F) (1:50, Cell Signaling Technology).

[0144] Reverse transcription and real-time PCR Total RNA was extracted using the microRNeasy Micro Kit or microRNeasy Mini Kit (Qiagen, Hilden, Germany) and analyzed using SuperScript VILO. TM Reverse transcription was performed using SYBR Master Mix (Thermo Fisher Scientific) or ReverTraAce® qPCR RT Master Mix with gDNA Remover (Toyobo). qPCR was performed using the StepOnePlus system (Thermo Fisher Scientific) with SYBR TM Alternatively, real-time PCR was performed using THUNDERBIRD® Next SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on a QuantStudio3 system (Applied Biosystems). TM PCR was performed using qPCR Mix (Toyobo). GAPDH was used as an internal control. The primer sets used are shown in Table 3. The sequences in Table 3 are listed in the sequence listing as SEQ ID NOS: 18 to 39, from top to bottom. Reverse transcription of let-7a-5p and let-7g-5p miRNAs was performed using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) and miRNA-specific stem-loop RT primers according to the manufacturer's instructions. qPCR was performed using the StepOnePlus system with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). The expression level of let-7 was calculated relative to that of RNU6B using a specific TaqMan probe.

[0145]

[0146] Analysis of cytokine secretion by imMKCL. Cytokine secretion in the culture supernatant was measured using a human inflammatory cytokine cytometric bead array kit (BD Biosciences) according to the manufacturer's guidelines. Briefly, a population of beads with different fluorescence intensities coated with capture antibody proteins was mixed with a PE-conjugated detection antibody and recombinant standards or samples, followed by incubation to form sandwich complexes. After sample data acquisition by flow cytometry, cytokine concentrations were measured using the FCAP Array. TM Calculations were performed using software (BD Biosciences).

[0147] Transfection of let-7a-5p inhibitors. mirVana let-7a-5p-specific inhibitors and negative controls were purchased from Thermo Fisher Scientific and used according to the manufacturer's instructions. Transfection was performed using the Stemfect RNA Transfection Kit (ReproCell, Yokohama, Japan).

[0148] Lentivirus Production. The use of viral vectors was approved by the committees of Kyoto University and Chiba University. The full-length coding sequences for human CUX1 and RALB were cloned into the lentiviral vector CS2-Ubic-IG-GFP or CS2-Ubic-IB. For overexpression experiments, the full-length coding sequence for human KAT7 was cloned into the CS2-Ubic-IB lentiviral vector. For knockdown experiments, shRNA oligonucleotides targeting KAT7 or LacZ (control) were inserted into the FG12-HYG lentiviral vector plasmid. The Fucci vector was obtained from Takara Bio. Lentivirus production using 293T cells was performed as previously described (Non-Patent Document 1). The shKAT7 oligonucleotide sequence was as follows: GCCCTTCCTGTTCTATGTTAT (SEQ ID NO: 40).

[0149] Immunofluorescence confocal microscopy. Cells were fixed with 4% paraformaldehyde (Wako) for 10 minutes and permeabilized with 0.1% Triton X-100 (Sigma) for 5 minutes. Samples were blocked with 10% goat serum (Sigma) and incubated with mouse anti-CD41a antibody (eBioscience) for 1 hour. Cells were then treated with Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher Scientific) for 30 minutes. Nuclear staining was performed using DAPI (Vector). Images were acquired using a Zeiss LSM900 confocal microscope equipped with a 63x / 1.40 numerical aperture oil immersion objective.

[0150] Bulk RNA sequencing analysis. Total RNA was extracted using the microRNeasy Micro Kit. RNA-seq libraries were prepared according to the manufacturer's protocol. Briefly, approximately 10 ng of total RNA was used for cDNA synthesis using the SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara Bio). The cDNA was fragmented using an S220 Focused-ultrasonicator (Covaris, Woburn, MA, USA). The cDNA was then fragmented using the NEBNext® Ultra TMcDNA libraries were generated using the DNA Library Prep Kit for Illumina (New England BioLabs, Beverly, MA, USA). Finally, the size of the NEBnext libraries was assessed using a bioanalyzer equipped with the Agilent High Sensitivity DNA Kit. Sequencing was performed using a HiSeq2500 (Illumina) or NextSeq 500 (Illumina) platform with a single-read sequencing length of 60 bp. TopHat (version 2.1.1) was used for mapping to the reference genome (UCSC / hg19) using annotation data from iGenomes (Illumina). Gene expression levels were quantified using Cuffdiff (Cufflinks version 2.2.1) and expressed as fragments per kilobase of exon per million mapped sequence reads (FPKM).

[0151] Gene Set Enrichment Analysis (GSEA) Based on bulk RNA-seq datasets, GSEA was applied to screen for pathways enriched in (1) let-7 (let-7a-5p and let-7g-5p) low or high imMKCLs (M35-1, clone 7, clone 7-3), (2) let-7 low imMKCLs from clone 7-3 or clone 7, and (3) imMKCLs overexpressing MOCK or RALB (clone 7). Plots were generated using the Broad Institute's GSEA software (version 4.2.3). We also reanalyzed bulk RNA-seq datasets from high-, medium-, and low-quality MKCL clones (NPL 9). Alternatively, we used the Python GSEApy package employing the MsigDB Hallmarks library to identify pathways enriched in bulk RNA-seq data from WM3835-treated and DMSO-treated imMKCLs. The normalized gene expression matrix was input into GSEA, and FDR and P values ​​less than 0.05 were considered statistically significant.

[0152] Construction of Chromium 10x Single-Cell RNA-Seq Libraries. ImMKCL (clone 7) with different let-7a-5p activity was separately selected and resuspended in PBS containing 0.4% BSA at a concentration of 1,000 cells / μL (Figure 5). Cells were loaded onto the Chromium Next Gel Beads-in-EMulsion (GEMs) Chip G Single Cell Kit (10x Genomics, USA). GEM generation and barcoding, reverse transcription, cDNA generation, and library construction were performed according to the manufacturer's protocol (Chromium Next GEM Single Cell 3' Reagent Kits v3.1 Dual Index, 10x Genomics). Dual-indexed single-cell libraries were pooled and sequenced using paired-end reads on a NovaSeq6000 (Illumina).

[0153] Bioinformatics Analysis: Datasets from 10x Genomics were collected and quality control was performed to remove low-quality and contaminating cells. Reads were generally preprocessed using Cell Ranger pipeline v.3.0.2 (10x Genomics). Downstream analysis and visualization were performed using Seurat (version 4.0.5) implemented in R (version 4.1.1). After examining quality control metrics, cells with mitochondrial content greater than 15% and cells with fewer than 2,500 detected genes were excluded from downstream analysis. We normalized and scaled the unique molecular identifier (UMI) counts using normalized negative binomial regression. We then performed linear dimensionality reduction (principal component analysis) and unsupervised uniform manifold approximation projection (UMAP) and clustering using the top 20 principal components, with resolutions ranging from 1.2 to 0.05. The let-7a-5p high and low MKCL populations were combined in all subsequent analyses. Cell clusters were identified using the FindClusters function in Seurat. Five clusters were identified in the DOX-ON sample (resolution 0.2). DEGs between different clusters were identified using the FindAllMarkers function in Seurat. Wilcoxon tests were performed for each gene, and P values ​​and adjusted P values ​​were calculated. Adjusted P values ​​less than 0.01 were considered statistically significant. g:Profiler was used to identify enriched functional terms from GO.

[0154] Statistical analysis: Statistical analysis was performed using GraphPad Prism software (GraphPad Software, La Jolla, CA). Data are presented as the mean ± standard error of the mean (SEM). P values ​​less than 0.05 were considered statistically significant. Details of the sample size, statistical methods, and statistical significance used are provided in the brief legends of each figure. The thresholds for statistical significance were set at *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

[0155] Human ESC-derived CD34 + Cell differentiation. Human embryonic stem cell (ESC) line KhES-3 was obtained from the Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan) and maintained in AK02N medium (Ajinomoto, Tokyo, Japan) on six-well plates precoated with iMatrix-511 silk (Takara Bio, Shiga, Japan). CD34 + HPC differentiation was performed using the Sac method previously established by the present inventors (Takayama, N. et al. Blood 111, 5298-5306 (2008); Yuzuriha, A. et al. Stem Cell Res 53, 102287 (2021)). Briefly, equal amounts of cells (1.5-1.6 × 10 5 Small clusters of cells (800 cells / 2000 cells) were transferred to 10-cm dishes coated with mitomycin C-treated C3H10T1 / 2 mouse feeder cells (RIKEN BioResource Center, Ibaraki, Japan) and cultured in IMDM medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with L-glutamine (Thermo Fisher Scientific, Waltham, MA, USA), insulin-transferrin-selenium (Thermo Fisher Scientific), 50 μg / mL ascorbic acid (Sigma-Aldrich), 450 μM α-monothioglycerol (Sigma-Aldrich), and 20 ng / mL recombinant human VEGF (Wako Pure Chemical Industries, Osaka, Japan). From days 4 to 7, 50 ng / mL basic FGF (Wako) and 10 μM SB431542 (Wako) were added, and from days 4 to 10, 10 U / mL heparin (AY Pharmaceuticals, Tokyo, Japan) was added. Medium changes were performed on days 4, 7, and 11 (Fig. 4a). On day 14, cells were harvested with a cell scraper and filtered through a cell strainer for further investigation.

[0156] Human umbilical cord blood-derived CD34 +Fresh umbilical cord blood (UCB) samples from healthy donors were obtained from the Japanese Red Cross Kanto-Koshinetsu Block Blood Center. Mononuclear cells (MNCs) were isolated by density centrifugation using lymphocyte separation medium (Ficoll). Cells were then incubated with immunomagnetic beads (CD34) (Miltenyi Biotech) and selected using a QuadroMACS® separation device according to the manufacturer's instructions. Purification efficiency was confirmed by flow cytometry. The resulting CD34 + The fractions were aliquoted and stored in liquid nitrogen until use.

[0157] Cord blood-derived CD34 + Differentiation of cells into megakaryocytes CD34 derived from umbilical cord blood + In vitro differentiation of the cells was performed using a previously published protocol with minor modifications (Kaushansky, K. et al. Proc Natl Acad Sci USA 92, 3234-3238 (1995); Bruno, S. et al. Haematologica 88, 379-387 (2003)). + Cells were expanded in X-VIVO 10 medium (Lonza) supplemented with 1% bovine serum albumin (BSA, StemCell Technologies), 100 ng / mL human SCF (R&D Systems), 100 ng / mL human Flt-3 ligand (PeproTech EC Ltd.), 50 ng / mL human thrombopoietin (TPO) (R&D Systems), 10 ng / mL human IL-6 (PeproTech EC Ltd.), and 10 ng / mL human IL-3 (PeproTech EC Ltd.). After 9 days of culture, cells were harvested and counted. 4 × 10 5 Cells were seeded in a total volume of 1 mL of X-VIVO10 medium supplemented with 1% BSA, SCF, TPO, and IL-6 and cultured for an additional 11 days. RNA was isolated on day 16, and flow cytometry analysis was performed on day 20 to detect CD41a + CD42b +The medium was changed every 2 days during the differentiation period (Fig. 18a).

[0158] siRNA-mediated gene knockdown: Dharmacon designed siRNAs against the human RALB gene, including four siRNAs targeting different sites and a non-targeting control siRNA (siNT). TM siGENOME siRNA SMARTpool (siRALB) was purchased from Horizon Discovery Ltd. The gene silencing procedure was performed based on Dharmacon's reverse transcription transfection protocol with minor modifications. Briefly, 10 nM final concentration of siRNA was diluted in the transfection buffer of the Stemfect RNA Transfection Kit (ReproCELL), and the transfection reagent was diluted with the same volume of buffer. The diluted siRNA and transfection reagent were mixed and incubated at room temperature for 15 minutes. Then, 12.5 μL / well of the transfection mixture was added to a 96-well plate, followed by 2 × 10 siRNA in 100 μL of medium. 5 Cells were added to each well. After a 4-hour incubation period, cells were washed with PBS and subjected to proliferation or differentiation culture conditions. To confirm knockdown efficiency, total RNA was isolated and analyzed 48 hours after transfection.

[0159] Addition of recombinant human interferon-α2a or IL-8 in imMKCL culture. To investigate the potential involvement of interferon or IL-8 in imMKCL proliferation and iPSC-PLT production, cells were cultured under proliferation or differentiation culture conditions with the addition of recombinant human interferon-α2a (Miltenyi Biotec) or IL-8 (R&D Systems). Working concentrations ranging from 0 to 100 ng / mL were used. Proliferation and iPSC-PLT production capacities were evaluated accordingly.

[0160] Addition of small molecule compounds to imMKCL cultures. We investigated the effects of two small molecule compounds on imMKCL proliferation and iPSC-PLT production. (1) Reparixin (Selleckchem), a specific inhibitor of the CXCL8 receptor CXCR1 / 2, commonly used to inhibit the IL-8 signaling pathway, and (2) RBC8 (Selleckchem), a selective inhibitor of the GTPases RALA and RALB. ImMKCLs were cultured under either proliferation or differentiation conditions in the presence or absence of Reparixin or RBC8 at working concentrations of 0–10 μM. Under proliferation conditions, imMKCLs were treated with Reparixin or RBC8 for 14 days. Medium changes were performed every 3–4 days, and imMKCL numbers were counted during medium changes to generate growth curves. Under differentiation conditions, imMKCLs were treated with Reparixin or RBC8 for 6 days and their iPSC-PLT production was assessed. In these studies, dimethyl sulfoxide (DMSO) was added to control wells. Remarkably, application of high concentrations (10 μM) of either molecule arrested proliferation.

[0161] Intracellular flow cytometry: Cells were fixed with 4% PFA for 15 min and permeabilized with methanol (15 min on ice). After washing with PBS, they were stained with anti-RalB antibody (Merck Millipore, 1:3000) for 1 h on ice. Then, secondary antibody Alexa Fluor 1000 was used. TM Cells were stained with 647 (Invitrogen, 1:1000) and analyzed by flow cytometry. The intracellular flow cytometry assay was optimized for imMKCL as follows: cells were fixed with 4% paraformaldehyde (PFA) for 15 minutes at room temperature, followed by methanol permeabilization (15 minutes on ice). After washing twice with PBS, cells were incubated with anti-RalB antibody (Merck Millipore, 1:3000) on ice for 1 hour. Cells were then washed and incubated with goat anti-mouse secondary antibody Alexa Fluor 800 (V800). TM647 (Invitrogen, 1:1000) on ice, and then the stained cells and the unstained control were analyzed by flow cytometry.

[0162] ImMKCL cells were fixed and stained using the PerFix-nc kit (Beckman Coulter) according to the manufacturer's instructions. The primary antibody used was rabbit acetyl histone H3 (Lys14) (D4B9) antibody (Cell Signaling Technology), followed by Alexa Fluor 647-conjugated goat secondary antibody (Thermo Fisher Scientific). Samples were analyzed using a FACSLyric instrument (BD Biosciences).

[0163] PAC-1 Binding and P-Selectin Expression in iPSC-PLTs. Measurement of PAC-1 binding and P-selectin expression levels followed the protocol outlined in our previous study (Sugimoto, N. et al. Blood Adv 6, 6056-6069 (2022)). Briefly, culture suspensions (iPSC-PLTs) were stimulated with or without phorbol-12-myristate-13-acetate (PMA, 0.2 μM) or adenosine triphosphate plus thrombin receptor activator peptide 6 (ADP / TRAP6, 100 μM and 40 μM, respectively). The mixture was then incubated with BV421 mouse anti-human CD62P (BD Biosciences), APC-anti-human CD41a (Bio Legend), and FITC-PAC-1 (BD Biosciences) antibodies. After 30 min of incubation at room temperature, samples were diluted in Hepes-Tyrode's buffer and analyzed by flow cytometry.

[0164] This application is based on U.S. Provisional Patent Application No. 63 / 558,394 (filing date: February 27, 2024), the contents of which are incorporated herein in their entirety.

Claims

1. A quality control marker of megakaryocytes consisting of the transcript or protein of the Ral (RAS-like proto-oncogene) gene.

2. The marker according to claim 1, wherein the Ral gene is the RalB (RAS-like proto-oncogene B) gene.

3. A quality control marker of megakaryocytes consisting of the transcript or protein of the Kat7 (lysine acetyltransferase 7) gene or acetylated histone proteins that are targets of the Kat7 protein.

4. A method for evaluating the quality of megakaryocytes, comprising the step of detecting one or more biomarkers according to any one of claims 1 to 3 in megakaryocytes.

5. The method according to claim 4, which comprises the step of detecting a transcription product or protein of the RalB gene and a transcription product or protein of the Kat7 gene in megakaryocytes.

6. The method according to claim 4 or 5, comprising: (1) measuring the abundance or activity of one or more of the biomarkers according to any one of claims 1 to 3 in megakaryocytes of a subject; and (2) evaluating the quality of the megakaryocytes based on the values ​​measured in step (1).

7. A method according to claim 4 or 5, characterized in that the marker is detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcription product of the Ral gene, or an antibody that specifically recognizes the Ral protein.

8. A method according to claim 4 or 5, characterized in that the marker is detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcription product of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is the target of the Kat7 protein.

9. The method according to any one of claims 4 to 7, wherein the megakaryocytes are derived from pluripotent stem cells.

10. A quality control kit for megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Ral (RAS-like proto-oncogene) gene, or an antibody that specifically recognizes the Ral protein.

11. A quality control kit for megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes a transcription product of the Kat7 (lysine acetyltransferase 7) gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone protein that is a target of the Kat7 protein.

12. A method for producing megakaryocytes of improved quality, comprising culturing megakaryocytes in a medium containing a Ral (RAS-like proto-oncogene) inhibitor.

13. The method of claim 12, wherein at least one of the Ral inhibitors is an inhibitor of RBC8 or Ral expression.

14. A method for producing megakaryocytes of improved quality, comprising a step of increasing the amount of Kat7 protein present in megakaryocytes.

15. The method according to any one of claims 12 to 14, wherein the megakaryocytes are derived from pluripotent stem cells.

16. Megakaryocytes evaluated by the method according to any one of claims 4 to 9, or megakaryocytes obtained by the method according to any one of claims 12 to 15.

17. A method for producing platelets, comprising the step of maturing megakaryocytes according to claim 16.

18. Platelets obtained by the method of claim 17.

19. A blood product comprising the cells of claim 16 or 18.

Citation Information

Patent Citations

  • Use of abscisic acid in promoting differentiation of human induced pluripotent stem cells into megakaryocytes and platelets in vitro

    CN113249320A

  • Compositions for drug delivery and methods of use thereof

    JP2021529770A

  • Method for purifying hematopoietic cells

    JP2022151223A