Bromodomain and extra-terminal domain (BET) epigenetic reader decoy
BET decoy polypeptides and polynucleotides specifically target BRD4, addressing the issue of nonspecific inhibition by competing for binding sites, thereby reducing side effects and enhancing therapeutic efficacy.
Patent Information
- Application Number
- PCT/US2025/017725
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2025-02-27
- Publication Date
- 2025-09-04
AI Technical Summary
Current BET inhibitors cannot distinguish between BRD2, BRD3, and BRD4 proteins, leading to unwanted side effects due to nonspecific inhibition.
Development of BET decoy polypeptides and polynucleotides that specifically inhibit BRD4 by competing with it for binding sites, using engineered polynucleotides with modifications to enhance stability and specificity.
The BET decoy polypeptides effectively inhibit BRD4 while minimizing interference with BRD2 and BRD3, reducing unwanted side effects and providing targeted therapeutic benefits.
Smart Images

Figure IMGF000007_0001 
Figure IMGF000008_0001 
Figure IMGF000008_0002
Abstract
Description
[0001]Atty. Dkt. No.: 131986-5202 BET EPIGENETIC READER DECOY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 558,797, filed February 28, 2024, and U.S. Provisional Application No. 63 / 632,485, filed April 10, 2024, the entire contents of which are incorporated herein by reference. BACKGROUND Histone acetylation is typically associated with the activation of gene transcription, as the modification weakens the interaction between the DNA and the histone proteins, permitting greater access to DNA by the transcriptional machinery. Specific proteins bind to acetylated lysine residues within histones to "read" the epigenetic code. A highly conserved protein module called the bromodomain binds to acetylated lysine residues on histone and other proteins. There are more than 60 bromodomain-containing proteins in the human genome. The BET (Bromodomain and Extra-Terminal) family of bromodomain containing proteins comprises 4 proteins (BRD2, BRD3, BRD4 and BRD-t) that share a conserved structural organization containing tandem N-terminal bromodomains capable of binding to acetylated lysine residues of histones and other proteins. BRD2, BRD3 and BRD4 are ubiquitously expressed while BRD-t is restricted to germ cells. BRD proteins play essential, but non-overlapping roles in regulating gene transcription and controlling cell growth. Small molecule BET inhibitors ameliorate disease in several pre-clinical inflammatory models (e.g., LPS-endotoxemia, NASH, EAE, Psoriasis etc.). However, BET inhibitors cannot distinguish between BRD2, BRD3, and BRD4 proteins. There is an unmet need for specific inhibitors that can distinguish between BET family members in order to reduce or avoid unwanted side effects of nonspecific BET family inhibition. SUMMARY OF THE DISCLOSURE The present disclosure provides BET decoy polypeptides and polynucleotides that encode thereof. Without being bound by a particular theory, it is believed that the disclosed -1- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 BET decoy polypeptides specifically inhibit BRD4 by competing with BRD4 and preventing it from binding to its targets. Another aspect of the disclosure is directed to a pharmaceutical composition comprising an engineered, non-naturally occurring polynucleotide encoding a BET (bromodomain and extra-terminal domain) decoy polypeptide comprising at least one bromodomain of BRD4. In some embodiments, the polynucleotide comprises at least one non-naturally modified nucleotide. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the mRNA further comprises at least one, at least two, or all of the following: a 3’ UTR, a nucleotide cap, a stabilizing domain, a poly A tail, and a 5’ UTR. In some embodiments, the bromodomain of BRD4 comprises a Bromodomain 1 (BD1 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 56. In some embodiments, the bromodomain of BRD4 comprises a Bromodomain 2 (BD2 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 57. In some embodiments, the BET decoy polypeptide comprises at least one BD1 domain, at least one BD2 domain, or a combination thereof. In some embodiments, the BET decoy polypeptide comprises a domain structure selected from: (i) BD1; (ii) BD2; (iii) BD1-BD2; (iv) BD1-BD1; (v) (BD1-BD2)2; (vi) BD2- BD2; (vii) BD2-BD1; or (viii) (BD2-BD1)2. In some embodiments, the BET decoy polypeptide comprises a BD1 domain and the BD1 domain comprises a mutation or a combination of mutations, wherein the mutation or the combination of mutations affect ubiquitination and / or phosphorylation of the BD1 domain. In some embodiments, the mutation that affects ubiquitination comprises K91R and / or K99R with reference to SEQ ID NO: 56. -2- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the mutation that affects phosphorylation is a phosphomimic substitution that comprises Y97E and / or Y98E with reference to SEQ ID NO: 56. In some embodiments, the mutation that affects phosphorylation is a mutation that prevents phosphorylation at Y97 and / or Y98 with reference to SEQ ID NO: 56. In some embodiments, the mutation that affects phosphorylation comprises Y97A and / or Y98A with reference to SEQ ID NO: 56. In some embodiments, the BET decoy polypeptide comprises a BD1 domain and the BD1 domain comprises a mutation at its degron domain, wherein the wild type degron domain is as shown by SEQ ID NO: 72. In some embodiments, the mutation at the degron domain prevents ubiquitination of the BET decoy protein. In some embodiments, the mutation at the degron domain prevents degradation of the BET decoy polypeptide and increases its half-life. In some embodiments, the BET decoy polypeptide comprises a BD2 domain and the BD2 domain comprises a mutation that prevents ubiquitination of the BD2 domain, wherein the mutation comprises a mutation at position K67 with reference to SEQ ID NO: 57. In some embodiments, the BD2 domain comprises a K67R mutation with reference to SEQ ID NO: 57. In some embodiments, the BET decoy polypeptide further comprises at least one domain selected from an Enhancer of Zeste Homolog 2 (EZH2) protein domain, an EZH2 Su(var)3–9, Enhancer-of-zeste and Trithorax (SET) domain, a DNA (cytosine-5)- methyltransferase 3A (DNMT3A) domain, a DNA (cytosine-5)-methyltransferase 3-like (DNMT3L) domain, a positive transcription elongation factor b (pTEFb) binding domain, a mutant pTEFb binding domain, an Intrinsically Disordered Region (IDR) domain, a Hexamethylene Bis-Acetamide-Inducible Protein 1 (HEXIM1) positive patch domain, a HEXIM1 basic patch extended domain, a HEXIM1 acidic patch domain, a chromatin interference domain, a Cyclin-dependent kinase 9 (CDK9) inhibition domain, or a combination thereof. -3- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the EZH2 protein domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 59, the EZH2 SET domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 60, the DNMT3A domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61, the DNMT3L domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 62, the pTEFb binding domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 63, the mutant pTEFb binding domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64, the Intrinsically Disordered Region (IDR) domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, the HEXIM1 positive patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 67, the HEXIM1 basic patch extended domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 68, the HEXIM1 acidic patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 69, the chromatin interference domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 70, and / or the CDK9 inhibition domain comprises an amino acid -4- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 71. In some embodiments, the BET decoy polypeptide further comprises a linker sequence. In some embodiments, the linker sequence is selected from SEQ ID NOs: 48-54. In some embodiments, the BET decoy polypeptide further comprises at least one nuclear localization signal peptide. In some embodiments, the BET decoy polypeptide comprises at least two nuclear localization signal peptides. In some embodiments, wherein the nuclear localization signal peptide comprises an amino acid sequence set forth in SEQ ID NO: 55. In some embodiments, the BET decoy polypeptide further comprises a detectable label. In some embodiments, the detectable label comprises a V5 epitope tag comprising an amino acid sequence set forth in SEQ ID NO: 47. In some embodiments, the BET decoy polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-46. In some embodiments, the polynucleotide is an mRNA comprising one or more of the followings: (i) a 5′-UTR having the sequence of any of SEQ ID NOs: 74-104, (ii) a 3′ UTR having the sequence of any of SEQ ID NOs: 105-113, and / or (iii) a miR122 binding site having the sequence of SEQ ID NO: 114. Another aspect of the disclosure is directed to a pharmaceutical composition comprising the polynucleotide of the present disclosure and a pharmaceutically acceptable carrier. -5- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the pharmaceutical composition comprises a lipid nanoparticle (LNP), a liposome or a lipoplex, wherein the polynucleotide is an mRNA formulated in the lipid nanoparticle (LNP), the liposome or the lipoplex as described herein. In some embodiments, the pharmaceutical composition comprises an LNP, wherein the polynucleotide is an mRNA formulated in the LNP. In some embodiments, the LNP comprises an ionizable lipid as described herein. In some embodiments, the ionizable lipid has a chemical structure selected from any one of (a)-(p): (a) or a salt thereof, wherein: R1is -OH, -NRN-C4-10 cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H or C1-6alkyl; RN’is H or C1-6alkyl; RN’’is H or C1-6 alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8; M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2; M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3; R2aR2bR2cR2is or –(C1-6 alkylene)-(C3-8 cycloalkyl)-C1-6 alkyl; R2ais -H or C1-10 alkyl; R2bis -H or C1-10alkyl; -6- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 alkenyl; R3ais H or C1-10alkyl; R3bis H or C1-8 alkyl; and R3cis C1-10 alkyl or C2-8 alkenyl, or (b) or a salt thereof, wherein: R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2cis C4-8 alkyl; R3ais C7-10 alkyl; and R3cis C3-5alkyl, or (c) -7- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1is NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H; RN’is C1-2alkyl; RN’’is H; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2ais C7-10alkyl; R2cis C4-6 alkyl; R3ais C1-3 alkyl; and R3cis C4-6alkyl, or a salt thereof, wherein: R1is OH; -8- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2bis C3-5alkyl; R2cis C2-4alkyl; R3ais C7-10 alkyl; and R3cis C4-6alkyl, (e) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (f) or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8 alkyl. (g) -9- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (h) or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8alkyl. (i) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula (I); R2ais a C1-8 alkyl; and R3ais C1-8alkyl, (j) -10- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and -11- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 R3ais C1-8 alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl, or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8alkyl, -12- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl, or (p) or a salt thereof, wherein: o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8 alkyl, or N-oxides, salts, or isomers of each thereof. In some embodiments, the ionizable lipid is a compound selected from the group consisting of: -13- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or N-oxides, salts, or isomers thereof. Another aspect of the disclosure is directed to a lipid nanoparticle comprising: (1) an ionizable lipid having a chemical structure selected from any one of (a)-(p): (a) or a salt thereof, wherein: R1is -OH, -NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H or C1-6alkyl; RN’is H or C1-6alkyl; RN’’is H or C1-6 alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8; M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2; M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3; -14- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or –(C1-6 alkylene)-(C3-8 cycloalkyl)-C1-6 alkyl; R2ais -H or C1-10alkyl; R2bis -H or C1-10alkyl; alkenyl; R3ais H or C1-10alkyl; R3bis H or C1-8 alkyl; and R3cis C1-10 alkyl or C2-8 alkenyl, or (b) or a salt thereof, wherein: R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2cis C4-8 alkyl; R3ais C7-10 alkyl; and R3cis C3-5alkyl, or (c) -15- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1is NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H; RN’is C1-2alkyl; RN’’is H; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2ais C7-10alkyl; R2cis C4-6 alkyl; R3ais C1-3 alkyl; and R3cis C4-6alkyl, or a salt thereof, wherein: R1is OH; -16- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2bis C3-5alkyl; R2cis C2-4alkyl; R3ais C7-10 alkyl; and R3cis C4-6alkyl, (e) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (f) or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8 alkyl. (g) -17- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (h) or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8alkyl. (i) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula (I); R2ais a C1-8 alkyl; and R3ais C1-8alkyl, (j) -18- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and -19- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 R3ais C1-8 alkyl, or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl, or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8alkyl, -20- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl, or (p) or a salt thereof, wherein: o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8 alkyl, or N-oxides, salts, or isomers of each thereof, and (2) an mRNA encoding a BET (bromodomain and extra-terminal domain) decoy polypeptide, wherein the BET decoy polypeptide comprises at least one bromodomain of (Bromodomain-containing protein 4) BRD4, optionally wherein the polynucleotide comprises at least one non-naturally modified nucleotide. In some embodiments, the ionizable lipid is a compound selected from the group consisting of: -21- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or N-oxides, salts, or isomers thereof. Another aspect of the disclosure is directed to a method for treating an inflammatory disease comprising administering to a subject in need thereof the polynucleotide of the present disclosure, the pharmaceutical composition of the present disclosure, or the lipid nanoparticle (LNP) of the present disclosure. In some embodiments, the inflammatory disease is selected from arthritis, asthma, dermatitis, psoriasis, cystic fibrosis, post transplantation late and chronic solid organ rejection, multiple sclerosis, systemic lupus erythematosus, inflammatory bowel diseases, autoimmune diabetes, diabetic retinopathy, diabetic nephropathy, diabetic vasculopathy, ocular inflammation, uveitis, rhinitis, ischemia-reperfusion injury, post-angioplasty restenosis, chronic obstructive pulmonary disease (COPD), glomerulonephritis, Graves disease, gastrointestinal allergies, conjunctivitis, atherosclerosis, coronary artery disease, angina, or small artery disease. Another aspect of the disclosure is directed to a method for inhibiting inflammatory cytokine production in a subject comprising administering to a subject in need thereof the polynucleotide of the present disclosure, the pharmaceutical composition of the present disclosure, or the LNP of the present disclosure. -22- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Another aspect of the disclosure is directed to a kit comprising: the polynucleotide of the present disclosure, the pharmaceutical composition of the present disclosure, or the LNP of the present disclosure, and instructions for use. BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1D. Primary human monocyte-derived macrophages were transfected with indicated mRNA constructs for 24h, fixed in 4% paraformaldehyde and stained for V5-tag. (A) Cells were imaged for V5 tag. (B) Percent nuclear localization of the BET decoy constructs. (C) Percent of cells expressing the BET decoy proteins over time. (D) THP-1 cells were transfected with decoy mRNA constructs for 24h and fractionated to obtain cytoplasmic (C) , soluble nuclear (S) and chromatin-bound (CH) protein fractions. Samples were subsequently probed for V5 on western blot. FIGS. 2A-2C. (A) Schematic representation of alphaLISA assay used in the competition assays. (B) A representative plot for the competition assay: inhibition of the BRD4 and H4K5,8,12ac peptide binding at 5 nM concentration by titration of recombinant BRD4-BD1 protein at concentrations from 32 pM to 1 uM. The apparent IC50 value was calculated by using nonlinear regression fitting. (C) Percent inhibition of binding between H4K5,8,12ac and either BRD4 or BRD3 at constant concentration of 5 nM by the recombinant BD1 domain of BRD4 titrated in starting at equimolar ratio (5 nM) and up to 200:1 molar ratio (1 uM). FIGS. 3A-3B. (A) Schematic showing domain structures of select BET decoy polypeptides. (B) Primary human PBMC-derived macrophages or THP-1 PMA macrophages were transfected with indicated mRNA constructs for 24h and stimulated with LPS for 4h or 24h. FIG. 4. Expression of cytokines was examined by qPCR of cell lysates 4h post-LPS, and by multiplex ELISA at 24h post-LPS in supernatants. FIGS 5A-5B. (A) Primary human PBMC-derived macrophages or THP-1 PMA macrophages were transfected with Decoy 1 (D1) mRNA construct, 24h later D1-transfected cells were stimulated with LPS for 4h. Cells were lysed, and total RNA was extracted for -23- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 RNA-seq. Differential analyses were performed using logFC>0.6 or <-0.6, padj<0.05. (B) Primary human PBMC-derived macrophages or THP-1 PMA macrophages were transfected with Decoy 2 (D2) mRNA construct, 24h later D2-transfected cells were stimulated with LPS for 4h. Cells were lysed and total RNA was extracted for RNA-seq. Differential analyses were performed using logFC>0.6 or <-0.6, padj<0.05. FIGS. 6A-6D. (A)-(D) Primary human monocyte-derived macrophages were transfected with indicated mRNA constructs for 24h, stimulated with LPS (100ng / ml) for the following 24h, and co-cultured with allogenic T cells (pre-incubated with CSFE) for 96h. Cells were analyzed for markers of T-cell proliferation and activation by flow cytometry. FIGS. 7A-7B. BET decoy constructs compete with BRD4 binding to BRD4 target genes. (A) (BRD4), iBET reduces BRD4 occupancy at the given TSSs relative to the DMSO control. BD1 and BD2 treatment results in decreased BRD4 binding at the TSS of Decoy downregulated genes. (B) (V5) demonstrates V5 signal (BD1 or BD2 binding) is increased relative to background binding (GL) at the TSS of Decoy downregulated genes. FIGS. 8A-8B. BRD4 displacement at Decoy suppressed genes. (A) (DMSO (Dark grey), and iBET (light grey)) BRD4 signal is reduced following iBET signal. (B) (GL (black), BD1 (dark grey), BD2 (light grey)) indicates BRD4 signal is reduced following Decoy treatment. FIGS. 9A-9B. mRNA-encoded BET decoy recapitulates genomic occupancy of endogenous BET proteins. (A) Percentage V5 peaks overlapping corresponding BRD. (B) Percentage V5 peaks overlapping annotation. FIG. 10. mRNA-encoded BET decoy recapitulates genomic occupancy of endogenous BET proteins. FIG. 11. mRNA encoded decoy displaces and prevents recruitment of BET readers in human macrophages. FIG. 12. mRNA BET decoy displaces BRD4 at LPS response genes. -24- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 FIGS. 13A-13B. Decoy suppressed genes have lower H3K27ac, BRD2, and BRD4 levels both (A) Pre-LPS, (B) Post-LPS stimulation. FIG. 14. mRNA BET decoy preferentially blocks secondary LPS response genes. FIG. 15. mRNA BET decoy blocks inflammatory transcription in trained monocytes. Downregulated genes include CXCL10, CXCL11, CXCL9, GSDMC, GSDMD, HSH2D, HSPA1B, IFI27, IFI35, IFI44L, IFIT2, IFITM1, IFITM3, IFNA1, IFNA13, IFNA8, IFNB1, IFNL1, IGF2BP3, IGFBP4, IL12A, IL12B, IL27, IL31RA, IRF9, ISG15, LAG3, LAX1, LGALS17A, MX1, OAS2, OR8G3P, OSR2, PANX1, PDCD1, PDZRN4, PLCB1, PLEKHN1, PLSCR1, PLSCR4, PRLR, PSMA6P2, TCEA1, TFEC, TIAM2, TIPARP, TLR4, TLR7, TMEM110, TMEM217, TMEM229B, TMEM72, TNFSF10, TNFSF18, TRIM22, TRIM5, TRIM69, UNC5C, and USP18. FIG. 16. BET Decoy preferentially blocks secondary LPS response genes. FIG. 17. BD1 and BD2 do not displace BRD2 in the absence of LPS. FIG. 18. BD1 and BD2 displace BRD4 in the presence and absence of LPS. FIG. 19. Genes sensitive to decoys are lower in H3K27ac. FIGS. 20A-20B. Decoy blocks LPS recruitment of BRD proteins. (A) BRD2, (B) BRD4. FIG. 21. BET Decoy displaces BRD2 at LPS response genes. FIG. 22. BET Decoy displaces BRD4 at LPS response genes. FIG. 23. BET Decoy displaces BRD2 at LPS response genes. FIGS. 24A-24D. BET Decoy suppresses CpG-induced cytokine induction. C57BL / 6 mice were dosed Q.O.D. with LNP-formulated Decoy mRNA intravenously (i.v.) at 0.5mg / kg, followed by intraperitoneal injection of CpG ODN 1826 at 2.5mg / kg 6h later, and terminated on day 10. Plasma was isolated from whole blood, and examined for systemic cytokine levels. (A) Experimental setup. (B) Plasma Interleukin 6 (IL-6) levels on Day 10. -25- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 (C) Plasma Tumor Necrosis Factor-alpha (TNFα) levels on Day 10. (D) Plasma Interferon- gamma (IFNγ) levels on Day 10. DETAILED DESCRIPTION The present disclosure generally relates to, among other things, compositions and methods for treating inflammatory diseases comprising administering a polynucleotide encoding one or more BET decoy polypeptides. Without wishing to be bound by any one theory, it is understood that administration of the polynucleotide encoding one or more of the disclosed BET decoy polypeptides specifically inhibit BRD4 by competing with BRD4 and preventing it from binding to its targets. In some embodiments, the disclosed BET decoy polypeptides do not inhibit BRD2 or BRD3 proteins. The present disclosure also relates to polynucleotides and compositions and formulations utilized in the methods described herein (e.g., lipid nanoparticle compositions) and kits comprising such polynucleotides and / or compositions and formulations. It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology. The present disclosure is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the disclosure. All the various embodiments of the present disclosure will not be described herein. Many modifications and variations of the disclosure can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that the present disclosure is not limited to particular uses, methods, reagents, compounds, compositions or biological systems, which can, of course, vary. It is also to be -26- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology. I. Definitions This disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. This disclosure includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. In this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms “one or more,” and “at least one” can be used interchangeably herein. In certain aspects, the term “a” or “an” means “single.” In other aspects, the term “a” or “an” includes “two or more” or “multiple.” -27- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Furthermore, “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within this disclosure. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of this disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of this disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of -28- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed. Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. As used herein, the term “about” as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art, such interval of accuracy is ± 10 %. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of this disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. As used herein, the term “administration” of an agent (e.g., polynucleotides of the disclosure or compositions or formulations comprising such polynucleotides) to a subject (e.g., a subject in need thereof) includes any route of introducing or delivering the agent to a subject to perform its intended function. Administration can be carried out by any suitable route, including, but not limited to, intravenously, intramuscularly, intraperitoneally, subcutaneously, and other suitable routes as described herein. Administration includes self- administration and the administration by another. Administration of a polynucleotide or other agent and compositions containing same can be performed in one dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective -29- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 means and dosage of administration are known to those of skill in the art and will vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician or in the case of animals, by the treating veterinarian. In some embodiments, administering or a grammatical variation thereof also refers to more than one doses with certain interval. In some embodiments, the interval is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year or longer. In some embodiments, one dose is repeated for once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times or more. Suitable dosage formulations and methods of administering the agents are known in the art. Route of administration can also be determined and method of determining the most effective route of administration are known to those of skill in the art and will vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue. Non-limiting examples of route of administration include oral administration, intraperitoneal, infusion (e.g., intravenous administration), nasal administration, inhalation, injection (e.g., intramuscular administration), and topical application. In some embodiments, the administration is an infusion (for example to peripheral blood of a subject) over a certain period of time, such as about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 24 hours or longer. As used herein, the term “administered in combination” or “combined administration” or “combination therapy” means that two or more agents are administered to a subject at the same time or within an interval such that there can be an overlap of an effect of each agent on the patient. In some embodiments, they are administered within about 60, 30, 15, 10, 5, or 1 minute of one another. In some embodiments, they are administered within 1 day, 2, days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4, weeks, 5 weeks, or 6 weeks or more of one another. In some embodiments, the administrations of the agents are spaced sufficiently closely together such that a combinatorial (e.g., a synergistic) effect is achieved. -30- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, the term “amino acid substitution” refers to replacing an amino acid residue present in a parent or reference sequence (e.g., a wild type Claudin 18.2 sequence) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence (e.g., a wild type Claudin 18.2 polypeptide sequence), for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a “substitution at position X” refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the schema AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In other aspects, substitution patterns can be described according to the schema An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position X, and Y and Z are alternative substituting amino acid residue. In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid. As used herein, the term “analog” refers to a structurally related polypeptide or nucleic acid molecule having the function of a reference polypeptide or nucleic acid molecule. As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans at any stage of development. In some embodiments, “animal” refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and worms. In some embodiments, the animal is a transgenic animal, genetically engineered animal, or a clone. -31- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, an “antigen” refers to a molecule to which an antibody can selectively bind. A target antigen may be a protein (e.g., an antigenic peptide), carbohydrate, nucleic acid, lipid, hapten, or other naturally occurring or synthetic compound. An antigen (e.g., a target antigen expressed by a tumor cell) may also be administered to an animal subject to generate an immune response in the subject. As used herein, the term “approximately,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). As used herein with respect to a disease, the term “associated with” means that the symptom, measurement, characteristic, or status in question is linked to the diagnosis, development, presence, or progression of that disease. As association can, but need not, be causatively linked to the disease. For example, symptoms, sequelae, or any effects causing a decrease in the quality of life of a patient having an inflammatory disease are considered associated with the inflammatory disease and in some embodiments of the present invention can be treated, ameliorated, or prevented by administering the polynucleotides of the present invention to a subject in need thereof. When used with respect to two or more moieties, the terms “associated with,” “conjugated,” “linked,” “attached,” and “tethered,” when used with respect to two or more moieties, means that the moieties are physically associated or connected with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. An “association” need not be strictly through direct covalent chemical bonding. It can also suggest ionic or hydrogen bonding or a hybridization-based connectivity sufficiently stable such that the “associated” entities remain physically associated. -32- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, the term “biocompatible” means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system. As used herein, the term “biodegradable” means capable of being broken down into innocuous products by the action of living things. As used herein, the term “binding affinity” refers to the strength of the total noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Without wishing to be bound by theory, affinity depends on the closeness of stereochemical fit between antibody combining sites and antigen determinants, on the size of the area of contact between them, and on the distribution of charged and hydrophobic groups. Affinity also includes the term “avidity,” which refers to the strength of the antigen-antibody bond after formation of reversible complexes (e.g., either monovalent or multivalent). Methods for calculating the affinity of an antibody for an antigen are known in the art, comprising use of binding experiments to calculate affinity. The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). A low-affinity complex contains an antibody that generally tends to dissociate readily from the antigen, whereas a high-affinity complex contains an antibody that generally tends to remain bound to the antigen for a longer duration. Antibody activity in functional assays (e.g., flow cytometry assay) is also reflective of antibody affinity. Antibodies and affinities can be phenotypically characterized and compared using functional assays (e.g., flow cytometry assay). As used herein, the phrase “biologically active” refers to a characteristic of any substance that has activity in a biological system and / or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present invention can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant. As used herein, the terms “codon substitution” or “codon replacement” in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid -33- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a "substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon. As used herein, a "CpG site" refers to a region of DNA in which cytosine nucleotides follow a guanine nucleotide in a linear order of bases in the 5 'to 3' direction. CpG sites occur at high frequency in regions of the genome called CpG islands (or CG islands). Cytosine in CpG dinucleotides can be methylated to form 5-methylcytosine. In mammals, 70% to 80% of CpG cytosines are methylated. Methylation of cytosine within a gene can alter its expression. As used herein, the terms “coding region” and “region encoding” and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein. As used herein, the term “comprising” is intended to mean that the compounds, compositions and methods include the recited elements, but not exclude others. “Consisting essentially of” when used to define compounds, compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants, e.g., from the isolation and purification method and pharmaceutically acceptable carriers, preservatives, and the like. “Consisting of” shall mean excluding more than trace elements of other ingredients. Embodiments defined by each of these transition terms are within the scope of this technology. As used herein, “complementary” sequences refer to two nucleotide sequences which, when aligned anti-parallel to each other, contain multiple individual nucleotide bases which pair with each other. Paring of nucleotide bases forms hydrogen bonds and thus stabilizes the double strand structure formed by the complementary sequences. It is not necessary for every nucleotide base in two sequences to pair with each other for sequences to be considered “complementary”. Sequences may be considered complementary, for example, if at least -34- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the nucleotide bases in two sequences pair with each other. In some embodiments, the term complementary refers to 100% of the nucleotide bases in two sequences pair with each other. In addition, sequences may still be considered “complementary” when the total lengths of the two sequences are significantly different from each other. For example, a primer of 15 nucleotides may be considered “complementary” to a longer polynucleotide containing hundreds of nucleotides if multiple individual nucleotide bases of the primer pair with nucleotide bases in the longer polynucleotide when the primer is aligned anti-parallel to a particular region of the longer polynucleotide. Nucleotide bases paring is known in the field, such as in DNA, the purine adenine (A) pairs with the pyrimidine thymine (T) and the pyrimidine cytosine (C) always pairs with the purine guanine (G); while in RNA, adenine (A) pairs with uracil (U) and guanine (G) pairs with cytosine (C). Further, the nucleotide bases aligned anti-parallel to each other in two complementary sequences, but not a pair, are referred to herein as a mismatch. As used herein, the term “composition” is intended to mean a combination of active agent and another compound or composition, inert (for example, a nanoparticle, detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include carriers, such as pharmaceutically acceptable carriers. In some embodiments, the carrier (such as the pharmaceutically acceptable carrier) comprises, or consists essentially of, or yet further consists of a nanoparticle, such as an polymeric nanoparticle carrier or an lipid nanoparticle that can be used alone or in combination with another carrier, such as an adjuvant or solvent. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri, tetra- oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, -35- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol. A composition as disclosed herein can be a pharmaceutical composition. A “pharmaceutical composition” is intended to include the combination of an active agent with a carrier, inert or active, making the composition suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo. As used herein, the term “compound,” is meant to include all stereoisomers and isotopes of the structure depicted. As used herein, the term “stereoisomer” means any geometric isomer (e.g., cis- and trans- isomer), enantiomer, or diastereomer of a compound. The present disclosure encompasses any and all stereoisomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well-known. “Isotopes” refers to atoms having the same atomic number but different mass numbers resulting from a different number of neutrons in the nuclei. For example, isotopes of hydrogen include tritium and deuterium. Further, a compound, salt, or complex of the present disclosure can be prepared in combination with solvent or water molecules to form solvates and hydrates by routine methods. As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can -36- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition. As used herein, the term “conservative amino acid substitution” is one in which the amino acid residue in a protein sequence is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, or histidine), acidic side chains (e.g., aspartic acid or glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, or cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, or tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, or histidine). Thus, if an amino acid in a polypeptide is replaced with another amino acid from the same side chain family, the amino acid substitution is considered to be conservative. In another aspect, a string of amino acids can be conservatively replaced with a structurally similar string that differs in order and / or composition of side chain family members. Non-conservative amino acid substitution: Non-conservative amino acid substitutions include those in which (i) a residue having an electropositive side chain (e.g., Arg, His or Lys) is substituted for, or by, an electronegative residue (e.g., Glu or Asp), (ii) a hydrophilic residue (e.g., Ser or Thr) is substituted for, or by, a hydrophobic residue (e.g., Ala, Leu, Ile, Phe or Val), (iii) a cysteine or proline is substituted for, or by, any other residue, or (iv) a residue having a bulky hydrophobic or aromatic side chain (e.g., Val, His, Ile or Trp) is substituted for, or by, one having a smaller side chain (e.g., Ala or Ser) or no side chain (e.g., Gly). Other amino acid substitutions can be readily identified by workers of ordinary skill. For example, for the amino acid alanine, a substitution can be taken from any one of D- alanine, glycine, beta-alanine, L-cysteine and D-cysteine. For lysine, a replacement can be any one of D-lysine, arginine, D-arginine, homo-arginine, methionine, D-methionine, ornithine, or D- ornithine. Generally, substitutions in functionally important regions that can be expected to induce changes in the properties of isolated polypeptides are those in which (i) -37- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 a polar residue, e.g., serine or threonine, is substituted for (or by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, or alanine; (ii) a cysteine residue is substituted for (or by) any other residue; (iii) a residue having an electropositive side chain, e.g., lysine, arginine or histidine, is substituted for (or by) a residue having an electronegative side chain, e.g., glutamic acid or aspartic acid; or (iv) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having such a side chain, e.g., glycine. The likelihood that one of the foregoing non-conservative substitutions can alter functional properties of the protein is also correlated to the position of the substitution with respect to functionally important regions of the protein: some non-conservative substitutions can accordingly have little or no effect on biological properties. As used herein, the term "conserved" refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences. In some embodiments, two or more sequences are said to be “completely conserved” if they are 100% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of an polynucleotide or polypeptide or can apply to a portion, region or feature thereof. -38- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, a “control” is an alternative sample used in an experiment for comparison purpose. A control can be “positive” or “negative.” For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed. As used herein, the term “delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition. As used herein, when referring to polypeptides, the term "domain" refers to a motif of a polypeptide having one or more identifiable structural or functional characteristics or properties (e.g., binding capacity, serving as a site for protein-protein interactions). As used herein, a "dosing regimen" or a "dosing regimen" is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care. As used herein, the term “encapsulate” means to enclose, surround, or encase. As used herein, the term “effective amount” or “therapeutically effective amount” refers to a quantity of an agent (e.g., a polynucleotide as described herein) sufficient to achieve a beneficial or desired clinical result upon treatment. In the context of therapeutic applications, the amount of a therapeutic agent administered to the subject can depend on the type and severity of the disease or condition and on the characteristics of the individual, such as general health, age, sex, body weight, effective concentration of the polynucleotide(s) administered, and tolerance to drugs. It can also depend on the degree, severity, and type of disease. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. An effective amount can be administered to a subject in one or more doses. In terms of treatment, an effective amount is an amount that is sufficient to palliate, -39- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease. The effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. The terms “effective amount” or “therapeutically effective amount,” can be used interchangeably with “effective dose” or “therapeutically effective dose.” As used herein, “encapsulation efficiency” refers to the amount of a therapeutic and / or prophylactic (e.g., polynucleotide) that becomes part of a nanoparticle composition, relative to the initial total amount of therapeutic and / or prophylactic used in the preparation of an LNP. For example, if 97 mg of therapeutic and / or prophylactic are encapsulated in an LNP out of a total 100 mg of therapeutic and / or prophylactic initially provided to the composition, the encapsulation efficiency may be given as 97%. As used herein, “encapsulation” may refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement. As used herein, the term “enhanced delivery” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to the level of delivery of a polynucleotide by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. It will be understood that the enhanced delivery of a nanoparticle to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a mouse model). As used herein, the term “excipient” refers to a natural or synthetic substance formulated alongside the active ingredient of a medication, included for the purpose of long- -40- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 term stabilization, bulking up solid formulations, or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption, reducing viscosity, or enhancing solubility. As used herein, an “expression vector” includes vectors capable of expressing DNA that is operably linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments. Such additional segments can include promoter and terminator sequences, and optionally can include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or can contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and / or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome. As used herein, a "formulation" includes at least a polynucleotide and one or more of a carrier and an excipient. A "fragment," as used herein, refers to a portion. For example, fragments of proteins can comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. In some embodiments, a fragment is a subsequence of a full-length protein wherein N- terminal, and / or C-terminal, and / or internal subsequences have been deleted. In some preferred aspects of the present invention, the fragments of a protein of the present invention are functional fragments. As used herein, the term “helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). In some embodiments, the helper lipid is a phospholipid. A function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and / or to help facilitate endosomal -41- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP. As used herein, the term "homology" refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Generally, the term "homology" implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both to identity and similarity. In some embodiments, polymeric molecules are considered to be "homologous" to one another if at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of -42- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. In certain aspects, the percentage identity "%ID" of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y / Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually. As used herein, the term “insertional variants”, when referring to polypeptides are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native or starting sequence. "Immediately adjacent" to an amino acid means connected to either the alpha-carboxy or alpha-amino functional group of the amino acid. "Deletional variants" when referring to polypeptides are those with one or more amino acids in the native or starting amino acid sequence removed. In some embodiments, deletional variants will have one or more amino acids deleted in a particular region of the molecule. -43- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, the term “ionizable lipid” or “ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3- nonydocosa-13-16-dien-1-amine (L608), and a compound of any one of Formula I-XVI described herein. As used herein, the term “increase” or “enhance” means to alter positively by at least about 5%, including, but not limited to, alter positively by about 5%, by about 10%, by about 25%, by about 30%, by about 50%, by about 75%, or by about 100%. As used herein, the term “isolated,” “purified,” or “biologically pure” refers to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation. A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or polypeptide of the presently disclosed subject matter is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high performance liquid chromatography (HPLC). The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified. As used herein, the term “lipoplex” refers to a nucleic acid-liposome complex, where nucleic acid can be DNA, siRNA or mRNA. -44- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, the term “lymphocyte” refers to all immature, mature, undifferentiated, and differentiated white blood cell populations that are derived from lymphoid progenitors including tissue specific and specialized varieties, and encompasses, by way of non-limiting example, B cells, T cells, NKT cells, and NK cells. In some embodiments, lymphocytes include all B cell lineages including pre-B cells, progenitor B cells, early pro-B cells, late pro-B cells, large pre-B cells, small pre-B cells, immature B cells, mature B cells, plasma B cells, memory B cells, B-1 cells, B-2 cells, and anergic AN1 / T3 cell populations. As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body. As used herein, the term “messenger RNA” or “mRNA” refers to any polynucleotide (a ribonucleic acid) which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Traditionally, the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail. As used herein, the term “modified messenger RNA” or “modified mRNA” refers to mRNA polynucleotides that include naturally occurring and / or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone). Non- natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties. The modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified. As used herein, a “nanoparticle composition” is a composition comprising one or more lipids. Nanoparticle compositions are typically sized on the order of micrometers or -45- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less. As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and / or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. As used herein, the term “open reading frame”, abbreviated as “ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome. As used herein, “operably linked” with reference to nucleic acid sequences, regions, elements or domains means that the nucleic acid regions are functionally related to each other. For example, a nucleic acid encoding a leader peptide can be operably linked to a nucleic acid encoding a polypeptide, whereby the nucleic acids can be transcribed and translated to express a functional fusion protein, wherein the leader peptide affects secretion of the fusion polypeptide. In some instances, the nucleic acid encoding a first polypeptide (e.g., a leader peptide) is operably linked to nucleic acid encoding a second polypeptide and the nucleic acids are transcribed as a single mRNA transcript, but translation of the mRNA transcript can result in one of two polypeptides being expressed. For example, an amber stop codon can be located between the nucleic acid encoding the first polypeptide and the nucleic acid encoding the second polypeptide, such that, when introduced into a partial amber suppressor cell, the resulting single mRNA transcript can be translated to produce either a -46- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 fusion protein containing the first and second polypeptides, or can be translated to produce only the first polypeptide. In another example, a promoter can be operably linked to nucleic acid encoding a polypeptide, whereby the promoter regulates or mediates the transcription of the nucleic acid. Herein a phrase of the form "optionally substituted X" (e.g., optionally substituted alkyl) is intended to be equivalent to "X, wherein X is optionally substituted" (e.g., "alkyl, wherein said alkyl is optionally substituted"). It is not intended to mean that the feature "X" (e.g., alkyl) per se is optional. As used herein, a "part" or "region" of a polynucleotide is defined as any portion of the polynucleotide that is less than the entire length of the polynucleotide. As used herein, "patient" refers to a subject who can seek or be in need of treatment, requires treatment, is receiving treatment, will receive treatment, or a subject who is under care by a trained professional for a particular disease or condition. In some embodiments, the treatment is needed, required, or received to prevent or decrease the risk of developing acute disease, i.e., it is a prophylactic treatment. As used herein, the term “pharmaceutically acceptable carriers” refers to any diluents, excipients, or carriers that may be used in the compositions disclosed herein. In some embodiments, a pharmaceutically acceptable carrier comprises, or consists essentially of, or yet further consists of a nanoparticle, such as an polymeric nanoparticle carrier or an lipid nanoparticle (LNP). Additionally or alternatively, pharmaceutically acceptable carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances, such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, Mack Publishing Company, a standard reference text -47- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 in this field. They can be selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups and the like, and consistent with conventional pharmaceutical practices. The terms “polynucleotide”, “nucleic acid” and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof. Polynucleotides can have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double and single stranded molecules. Unless otherwise specified or required, any embodiment of this disclosure that is a polynucleotide encompasses both the double stranded form and each of two complementary single stranded forms known or predicted to make up the double stranded form. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. As used herein, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, -48- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. As used herein, the term "preventing" refers to partially or completely delaying onset of an infection, disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying progression from an infection, a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and / or condition. As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the spread of disease. As used herein, a "prophylaxis" refers to a measure taken to maintain health and prevent the spread of disease. An "immune prophylaxis" refers to a measure to produce active or passive immunity to prevent the spread of disease. As used herein, pseudouridine (ψ) refers to the C-glycoside isomer of the nucleoside uridine. A "pseudouridine analog" is any modification, variant, isoform or derivative of pseudouridine. For example, pseudouridine analogs include but are not limited to 1- -49- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 carboxymethyl-pseudouridine, 1-propynyl-pseudouridine, 1-taurinomethyl-pseudouridine, 1- taurinomethyl-4-thio-pseudouridine, 1-methylpseudouridine (m1ψ) (also known as N1- methyl-pseudouridine), 1-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-1-methyl- pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1- deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio- dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 1-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3 ψ), and 2′-O-methyl-pseudouridine (ψm). As used herein, "purify," "purified," "purification" means to make substantially pure or clear from unwanted components, material defilement, admixture or imperfection. As used herein, the term “reduce” means to alter negatively by at least about 5%, including, but not limited to, alter negatively by about 5%, by about 10%, by about 25%, by about 30%, by about 50%, by about 75%, or by about 100%. The term "reference nucleic acid sequence" or “reference nucleic acid” or “reference nucleotide sequence” or “reference sequence” refers to a starting nucleic acid sequence (e.g., a RNA, e.g., an mRNA sequence) that can be sequence optimized. In some embodiments, the reference nucleic acid sequence is a wild-type nucleic acid sequence, a fragment or a variant thereof. In some embodiments, the reference nucleic acid sequence is a previously sequence optimized nucleic acid sequence. As used herein, “regulatory sequence” of a nucleic acid molecule means a cis- acting nucleotide sequence that influences expression, positively or negatively, of an operably linked gene. Regulatory regions include sequences of nucleotides that confer inducible (i.e., require a substance or stimulus for increased transcription) expression of a gene. When an inducer is present or at increased concentration, gene expression can be increased. Regulatory regions also include sequences that confer repression of gene expression (i.e., a substance or stimulus decreases transcription). When a repressor is present or at increased concentration, gene expression can be decreased. Regulatory regions are known to influence, modulate or control many in vivo biological activities including cell proliferation, cell growth and death, cell differentiation and immune modulation. Regulatory regions typically bind to -50- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 one or more trans-acting proteins, which results in either increased or decreased transcription of the gene. Particular examples of gene regulatory regions are promoters and enhancers. Promoters are sequences located around the transcription or translation start site, typically positioned 5' of the translation start site. Promoters usually are located within 1 Kb of the translation start site, but can be located further away, for example, 2 Kb, 3 Kb, 4 Kb, 5 Kb or more, up to and including 10 Kb. Polymerase II and III are examples of promoters. A polymerase II or “pol II” promoter catalyzes the transcription of DNA to synthesize precursors of mRNA, and most shRNA and microRNA. Examples of pol II promoters are known in the art and include without limitation, the phosphoglycerate kinase (“PGK”) promoter; EF1-alpha; CMV (minimal cytomegalovirus promoter); and LTRs from retroviral and lentiviral vectors. In some embodiments, the promoter is a constitutive promoter. As used herein, the term “constitutive promoter” refers to a promoter that allows for continual transcription of the coding sequence or gene under its control in all or most tissues of a subject at all or most developing stages. Non-limiting examples of the constitutive promoters include a CMV promoter, a simian virus 40 (SV40) promoter, a polyubiquitin C (UBC) promoter, an EF1-alpha promoter, a PGK promoter and a CAG promoter. In some embodiments, the promoter is a conditional promoter, which allows for continual transcription of the coding sequence or gene under certain conditions. In further embodiments, the conditional promoter is an immune cell specific promoter, which allows for continual transcription of the coding sequence or gene in an immune cell. Non-limiting examples of the immune cell specific promoters include a promoter of a B29 gene promoter, a CD14 gene promoter, a CD43 gene promoter, a CD45 gene promoter, a CD68 gene promoter, a IFN-β gene promoter, a WASP gene promoter, a T-cell receptor β-chain gene promoter, a V9 γ (TRGV9) gene promoter, a V2 δ (TRDV2) gene promoter, and the like. Enhancers are known to influence gene expression when positioned 5' or 3' of the gene, or when positioned in or a part of an exon or an intron. Enhancers also can function at a significant distance from the gene, for example, at a distance from about 3 Kb, 5 Kb, 7 Kb, 10 Kb, 15 Kb or more. -51- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Regulatory regions also include, but are not limited to, in addition to promoter regions, sequences that facilitate translation, splicing signals for introns, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA and, stop codons, leader sequences and fusion partner sequences, internal ribosome binding site (IRES) elements for the creation of multigene, or polycistronic, messages, polyadenylation signals to provide proper polyadenylation of the transcript of a gene of interest and stop codons, and can be optionally included in an expression vector. As used herein, the term "sample" or "biological sample" refers to a subset of its tissues, cells or component parts (e.g., body fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). A sample further can include a homogenate, lysate or extract prepared from a whole organism or a subset of its tissues, cells or component parts, or a fraction or portion thereof, including but not limited to, for example, plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. A sample further refers to a medium, such as a nutrient broth or gel, which can contain cellular components, such as proteins or nucleic acid molecule. As used herein, the term “separate” therapeutic use refers to an administration of at least two active ingredients at the same time or at substantially the same time by different routes. As used herein, the term “sequential” therapeutic use refers to administration of at least two active ingredients at different times, the administration route being identical or different. More particularly, sequential use refers to the whole administration of one of the active ingredients before administration of the other or others commences. It is thus possible to administer one of the active ingredients over several minutes, hours, or days before administering the other active ingredient or ingredients. There is no simultaneous treatment in this case. As used herein, the term “sequence optimization” refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with -52- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity of the nucleic acid itself. In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by the codon optimized nucleotide sequence with respect to the polypeptide encoded by the reference nucleotide sequence. In some embodiments, codon optimization is achieved by modification of a coding sequence according to at least one of the following; (i) replacing the naturally occurring codon sequence with an alternative codon that retains the amino acid sequence encoding the protein but alters the composition and / or structure of the encoding RNA; (ii) adjusting the guanosine cytosine content of the coding sequence relative to the naturally occurring guanosine cytosine content of the coding sequence; (iii) adjusting the number of CpG sites of the coding sequence relative to the number of CpG sites in the naturally occurring coding sequence; (iv) substituting the naturally occurring codon sequence with an alternative codon relative to (ii) guanosine cytosine content and / or (iii) number of CpG sites. Codon optimization may include adjusting codons in the context of tRNA expression in a particular tissue and / or may include methods for evading the effects of natural, tissue-specific shRNAs or miRNAs. As used herein, the phrases "signal sequence," "signal peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus, references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide. As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of -53- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. As used herein, the term “simultaneous” therapeutic use refers to the administration of at least two active ingredients by the same route and at the same time or at substantially the same time. As used herein, a "single unit dose" is a dose of any therapeutic administered in one dose / at one time / single route / single point of contact, i.e., single administration event. As used herein, the term “specifically binds” or “specifically binds to” or “specifically target” refers to a molecule (e.g., a polypeptide or fragment thereof) that recognizes and binds a molecule of interest (e.g., an antigen), but which does not substantially recognize and bind other molecules. The terms “specific binding,” “specifically binds to,” or is “specific for” a particular molecule (e.g., an antigen), as used herein, can be exhibited, for example, by a molecule having a Kd for the molecule to which it binds to of about 10−4M, 10−5M, 10−6M, 10−7M, 10−8M, 10−9M, 10−10M, 10−11M, or 10−12M. As used herein, the term “specific delivery,” “specifically deliver,” or “specifically delivering” means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a polynucleotide by a nanoparticle to a target tissue of interest (e.g., mammalian liver) compared to an off-target tissue (e.g., mammalian spleen). The level of delivery of a nanoparticle to a particular tissue can be measured by comparing the amount of protein produced in a tissue to the weight of said tissue, comparing the amount of polynucleotide in a tissue to the weight of said tissue, comparing the amount of protein produced in a tissue to the amount of total protein in said tissue, or comparing the amount of polynucleotide in a tissue to the amount of total polynucleotide in said tissue. For example, for renovascular targeting, a polynucleotide is specifically provided to a mammalian kidney as compared to the liver and spleen if 1.5, 2- fold, 3-fold, 5-fold, 10-fold, 15 fold, or 20 fold more polynucleotide per 1 g of tissue is delivered to a kidney compared to that delivered to the liver or spleen following systemic administration of the polynucleotide. It will be understood that the ability of a nanoparticle to -54- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 specifically deliver to a target tissue need not be determined in a subject being treated, it can be determined in a surrogate such as an animal model (e.g., a rat model). As used herein "stable" refers to a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and in some cases capable of Formulation into an efficacious therapeutic agent. As used herein, the term "stabilize," "stabilized," "stabilized region" means to make or become stable. As used herein, by "subject" or "individual" or "animal" or "patient" or "mammal," is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include, but are not limited to, humans, domestic animals, farm animals, zoo animals, sport animals, pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows; primates such as apes, monkeys, orangutans, and chimpanzees; canids such as dogs and wolves; felids such as cats, lions, and tigers; equids such as horses, donkeys, and zebras; bears, food animals such as cows, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and so on. In certain embodiments, the mammal is a human subject. In other embodiments, a subject is a human patient. In a particular embodiment, a subject is a human patient in need of treatment. As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical characteristics rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical characteristics. As used herein, the term “substantially equal” as it relates to time differences between doses, the term means plus / minus 2%. As used herein, the term “sub-therapeutic dose” refers to a dose of an agent that does not achieve a particular therapeutic effect (e.g., wherein the particular therapeutic effect is -55- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 achieved using a therapeutically effective amount). Typically, a sub-therapeutic dose of an agent is an amount of a therapeutic dose that is less than a therapeutically effective amount of the agent. As used herein, the term “suffering from” refers to an individual who is “suffering from” a disease, disorder, and / or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and / or condition. An individual who is "susceptible to" a disease, disorder, and / or condition has not been diagnosed with and / or cannot exhibit symptoms of the disease, disorder, and / or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (for example, inflammatory disease) can be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and / or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and / or condition; (3) increased and / or decreased expression and / or activity of a protein and / or nucleic acid associated with the disease, disorder, and / or condition; (4) habits and / or lifestyles associated with development of the disease, disorder, and / or condition; (5) a family history of the disease, disorder, and / or condition; and (6) exposure to and / or infection with a microbe associated with development of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition. The presence of a therapeutic agent in an off-target tissue can be the result of: (i) leakage of a polynucleotide from the administration site to peripheral tissue or distant off- target tissue via diffusion or through the bloodstream (e.g., a polynucleotide intended to express a polypeptide in a certain tissue would reach the off-target tissue and the polypeptide would be expressed in the off-target tissue); or (ii) leakage of an polypeptide after administration of a polynucleotide encoding such polypeptide to peripheral tissue or distant off-target tissue via diffusion or through the bloodstream (e.g., a polynucleotide would -56- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 expressed a polypeptide in the target tissue, and the polypeptide would diffuse to peripheral tissue). As used herein, the phrase "targeting sequence" refers to a sequence that can direct the transport or localization of a protein or polypeptide. The term "therapeutic agent" refers to an agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. For example, in some embodiments, an mRNA encoding a BET decoy polypeptide can be a therapeutic agent. As used herein, the term "therapeutically effective outcome" means an outcome that is sufficient in a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. As used herein, the term "transcription" refers to methods to produce mRNA (e.g., an mRNA sequence or template) from DNA (e.g., a DNA template or sequence). As used herein, the term "treating" or "treatment" or "therapy" refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, and / or reducing incidence of one or more symptoms or features of a disease, e.g., an inflammatory disease. For example, "treating" inflammatory disease can refer to diminishing symptoms associate with the disease, prolong the lifespan (increase the survival rate) of patients, reducing the severity of the disease, preventing or delaying the onset of the disease, etc. Treatment can be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition. Therapeutic effects of treatment include, without limitation, inhibiting recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastases, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. By “treating an inflammatory -57- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 disease” is meant that the symptoms associated with the inflammatory disease are, e.g., alleviated, reduced, cured, or placed in a state of remission. As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild type or native form of a biomolecule. Molecules may undergo a series of modifications whereby each modified molecule may serve as the “unmodified” starting molecule for a subsequent modification. Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via a b-N1-glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine." The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence). The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and / or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable. A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine -58- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon can be replaced with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied. As used herein, the terms "uridine enriched" and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). As used herein, the terms "uridine rarefied" and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence). As used herein, the term “variant” refers to both natural variants (e.g., polymorphisms, isoforms, etc.) and artificial variants in which at least one amino acid residue in a native or starting sequence (e.g., a wild type sequence) has been removed and a different amino acid inserted in its place at the same position. These variants can be described as “substitutional variants.” The substitutions can be single, where only one amino acid in the -59- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 molecule has been substituted, or they can be multiple, where two or more amino acids have been substituted in the same molecule. If amino acids are inserted or deleted, the resulting variant would be an “insertional variant” or a “deletional variant” respectively. As used herein, the term “initiation codon”, used interchangeably with the term “start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as “alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAiMet) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”. As used herein, the term “lipid nanoparticle” or “LNP” refers to a nanoparticle comprising one or more lipids. In some embodiments, the LNP has a size of about 500 nm or less, about 450 nm or less, about 400 nm or less, about 350 nm or less, about 300 nm or less, about 250 nm or less, about 200 nm or less, about 150 nm or less, or about 100 nm or less. In some embodiments, the LNP has a size ranging from about 1 nm to about 100 nm. As used herein, the term “liposome” refers to a composite having at least one lipid bilayer. In some embodiments, the liposome has a size of about 500 nm or less, about 450 nm or less, about 400 nm or less, about 350 nm or less, about 300 nm or less, about 250 nm or less, about 200 nm or less, about 150 nm or less, or about 100 nm or less. In some embodiments, the liposome has a size ranging from about 1 nm to about 100 nm. As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe). -60- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As used herein, the term “in vivo” refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof). As used herein, the term “ex vivo” refers to events that occur outside of an organism (e.g., animal, plant, or microbe or cell or tissue thereof). Ex vivo events may take place in an environment minimally altered from a natural (e.g., in vivo) environment. As used herein, the “N:P ratio” is the molar ratio of ionizable (in the physiological pH range) nitrogen atoms in a lipid to phosphate groups in an RNA, e.g., in a TLA including a lipid component and an RNA. As used herein, a “PEG lipid” or “PEGylated lipid” refers to a lipid comprising a polyethylene glycol component. As used herein, a “polymeric lipid” refers to a lipid comprising repeating subunits in its chemical structure. In some embodiments, the polymeric lipid is a lipid comprising a polymer component. In some embodiments, the polymeric lipid is a PEG lipid. In some embodiments, the polymeric lipid is not a PEG lipid. In some embodiments, the polymeric lipid is Brij or OH-PEG-stearate. The term “free of”, as used herein, means not comprising the referenced component. For example, when a population, solution, or formulation is described as being “free of PEG lipid”, the population, solution, or formulation does not comprise PEG lipid (e.g., does not comprise a PEG lipid described herein (e.g., does not comprise PEG-DMG)). The compositions used in accordance with the disclosure can be packaged in dosage unit form for ease of administration and uniformity of dosage. The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the result and / or protection desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment -61- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition. Upon formulation, solutions are administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described herein. As used herein, “phosphomimic substitution” or “phosphomimetic substitution” refers to an amino acid substitution that mimic a phosphorylated amino acid. In some embodiments, a phosphomimic substitution comprises a glutamic acid (E) substitution. In some embodiments, a phosphomimic substitution comprises an aspartic acid (D) substitution. In some embodiments, a phosphomimic substitution mimics a phosphorylated tyrosine (Y) residue, a phosphorylated serine (S) residue, a phosphorylated threonine (T) residue, a phosphorylated arginine (R) residue, a phosphorylated histidine (H) residue, or a phosphorylated cysteine (C) residue. As used herein, “a mutation that prevents phosphorylation” refers to a mutation where the resulting amino acid cannot be phosphorylated. In some embodiments, a mutation that prevents phosphorylation comprises an alanine (A) substitution, a glutamine substitution (Q) or a phenylalanine (F) substitution. As used herein, “Enhancer of Zeste Homolog 2 (EZH2)” refers to a protein as shown by SEQ ID NO: 59 (UniProtKB / Swiss-Prot: Q15910), encoded by the EZH2 gene (HGNC: 3527, NCBI Gene: 2146, Ensembl: ENSG00000106462, OMIM®: 601573). As used herein, “DNA (cytosine-5)-methyltransferase 3A (DNMT3A)” refers to a protein as shown by UniProtKB / Swiss-Prot ID Q9Y6K1, encoded by DNMT3A gene (HGNC: 2978 NCBI Gene: 1788 Ensembl: ENSG00000119772 OMIM®: 602769). As used herein, “positive transcription elongation factor b (pTEFb)” refers to a protein as shown by UniProtKB / Swiss-Prot ID O60563, encoded by pTEFb gene (HGNC: 1599 NCBI Gene: 904 Ensembl: ENSG00000129315 OMIM®: 143055). As used herein, an “Intrinsically Disordered Region” or “IDR” refers to a polypeptide segment of a protein that does not form a defined three-dimensional structure. IDRs can be -62- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 found as flexible linkers or loops. IDRs are typically rich in polar uncharged amino acids. IDRs can be found bioinformatically from a given amino acid sequence, as shown in Tang, Yi-Jun, et al. "(BMC biology 21.1 (2023): 188) which is incorporated herein in its entirety. As used herein, “Hexamethylene Bis-Acetamide-Inducible Protein 1" or "HEXIM1” refers to a protein as shown by UniProtKB / Swiss-Prot ID O94992, encoded by HEXIM1 gene (HGNC: 24953 NCBI Gene: 10614 Ensembl: ENSG00000186834 OMIM®: 607328). As used herein, “Cyclin-dependent kinase 9 (CDK9)” refers to a protein as shown by UniProtKB / Swiss-Prot ID P50750, encoded by CDK9 gene (HGNC: 1780 NCBI Gene: 1025 Ensembl: ENSG00000136807 OMIM®: 603251). II. Detailed Description Engineered polynucleotides encoding BET decoy polypeptides An aspect of the disclosure is directed to an engineered, non-naturally-occurring polynucleotide encoding a BET (bromodomain and extra-terminal domain) decoy polypeptide comprising at least one bromodomain of BRD4. In some embodiments, the polynucleotide comprises at least one non-naturally modified nucleotide. In some embodiments, the polynucleotide is codon optimized for expressing in mammalian cells. In some embodiments, the polynucleotide is an mRNA. In some embodiments, the bromodomain of BRD4 comprises a Bromodomain 1 (BD1 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 56. In some embodiments, the bromodomain of BRD4 comprises a Bromodomain 2 (BD2 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 57. -63- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the BET decoy polypeptide comprises at least one BD1 domain, at least one BD2 domain, or a combination thereof. In some embodiments, the BET decoy polypeptide comprises a domain structure selected from:(i) BD1; (ii) BD2; (iii) BD1-BD2; (iv) BD1-BD1; (v) (BD1-BD2)2 ; (vi) BD2- BD2; (vii) BD2-BD1; or (viii) (BD2-BD1)2. In some embodiments, the BET decoy polypeptide comprises one BD1 domain (“BD1”). In some embodiments, the BET decoy polypeptide comprises one BD2 domain (“BD2”). In some embodiments, the BET decoy polypeptide comprises one BD1 domain and one BD2 domain, wherein the BD1 domain comes before the BD2 domain (“BD1-BD2”) (BD1 domain is closer to the N terminal of the polypeptide than the BD2 domain). In some embodiments, the BET decoy polypeptide comprises two BD1 domains (“BD1-BD1”). In some embodiments, the BET decoy polypeptide comprises a BD1-BD2 pair repeated in tandem (“(BD1-BD2)2”). In some embodiments, the BET decoy polypeptide comprises two BD2 domains (“(BD2-BD2)”). In some embodiments, the BET decoy polypeptide comprises one BD1 domain and one BD2 domain, wherein the BD2 domain comes before the BD1 domain (“BD2-BD1”) (BD2 domain is closer to the N terminal of the polypeptide than the BD1 domain). In some embodiments, the BET decoy polypeptide comprises a BD2-BD1 pair repeated in tandem (“(BD2-BD1)2”). In some embodiments, the BET decoy polypeptide comprises a BD1 domain and the BD1 domain comprises a mutation or a combination of mutations, wherein the mutation or the combination of mutations affect ubiquitination and / or phosphorylation of the BD1 domain. In some embodiments, the mutation that affects ubiquitination comprises K91R and / or K99R with reference to SEQ ID NO: 56. In some embodiments, the mutation that affects phosphorylation is a phosphomimic substitution that comprises Y97E and / or Y98E with reference to SEQ ID NO: 56. In some embodiments, the mutation that affects phosphorylation is a mutation that prevents phosphorylation at Y97 and / or Y98 with reference to SEQ ID NO: 56. In some embodiments, the mutation that affects phosphorylation comprises Y97A and / or Y98A with reference to SEQ ID NO: 56. -64- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the BET decoy polypeptide comprises a BD1 domain and the BD1 domain comprises a mutation at its degron domain, wherein the wild type degron domain is as shown by SEQ ID NO: 72. In some embodiments, the mutation at the degron domain prevents ubiquitination of the BET decoy protein. In some embodiments, the mutation at the degron domain prevents degradation of the BET decoy polypeptide and increases its half-life. In some embodiments, the BET decoy polypeptide comprises an amino acid sequence as shown in SEQ ID NO: 30. In some embodiments, the BET decoy polypeptide comprises a BD2 domain and the BD2 domain comprises a mutation that affects ubiquitination of the BD2 domain. In some embodiments, the BD2 domain comprises a K67R mutation with reference to SEQ ID NO: 57. In some embodiments, the BET decoy polypeptide further comprises at least one domain selected from an EZH2 protein domain, an EZH2 SET domain, a DNMT3A domain, a DNMT3L domain, a pTEFb binding domain, a mutant pTEFb binding domain, an Intrinsically Disordered Region (IDR) domain, a HEXIM1 positive patch domain, a HEXIM1 basic patch extended domain, a HEXIM1 acidic patch domain, a chromatin interference domain, or a CDK9 inhibition domain. In some embodiments, the EZH2 protein domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 59. In some embodiments, the EZH2 SET domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 60. In some embodiments, the DNMT3A domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61. In some embodiments, the DNMT3L domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 62. In some embodiments, the pTEFb binding domain comprises an -65- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 63. In some embodiments, the mutant pTEFb binding domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64. In some embodiments, the Intrinsically Disordered Region (IDR) domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66. In some embodiments, the HEXIM1 positive patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 67. In some embodiments, the HEXIM1 basic patch extended domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 68, In some embodiments, the HEXIM1 acidic patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 69. In some embodiments, the chromatin interference domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 70. In some embodiments, the CDK9 inhibition domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 71. In some embodiments, the BET decoy polypeptide further comprises a linker sequence. In some embodiments, the linker sequence is selected from SEQ ID NOs: 48-54. In some embodiments, the BET decoy polypeptide further comprises at least one nuclear localization signal. In some embodiments, the BET decoy polypeptide comprises at least two (e.g., two, three, four, five, or six) nuclear localization signals. In some -66- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 embodiments, the nuclear localization signal comprises an amino acid sequence set forth in SEQ ID NO: 55. In some embodiments, the BET decoy polypeptide further comprises a detectable label. In some embodiments, the detectable label comprises a V5 epitope tag comprising an amino acid sequence set forth in SEQ ID NO: 47. In some embodiments, the BET decoy polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-46. Table 1: BET decoy polypeptides. -67- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -68- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -69- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Features of polynucleotides encoding BET decoy polypeptides In some embodiments, the polynucleotides of the disclosure comprise one or more of the following features: i.Optimization of Nucleic Acid Sequence Intrinsic Properties In some embodiments of this disclosure, the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence. For example, the nucleotide sequence (e.g., a RNA, e.g., an mRNA) can be sequence optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence optimized for expression in a given -70- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 target tissue or cell. In some embodiments, the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases. In other embodiments, the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation. In other embodiments, the sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation. ii.Nucleic Acid Sequences Optimized for Protein Expression In some embodiments of this disclosure, the desired property of the polynucleotide is the level of expression of one or more BET decoy polypeptides encoded by a codon optimized sequence. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components. In other embodiments, the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc. In some embodiments, protein expression in solution form can be desirable. Accordingly, in some embodiments, a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form. Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.). -71- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 iii.Optimization of Target Tissue or Target Cell Viability In some embodiments, the expression of heterologous proteins (e.g., therapeutic proteins) encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity. Accordingly, in some embodiments of this disclosure, the sequence optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding one or more target BET decoy polypeptides, can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid. Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reaction can be measured according to methods known in the art. iv.Reduction of an Undesired Immune and / or Inflammatory Response In some cases, the administration of a sequence optimized nucleic acid encoding a one or more target BET decoy polypeptides can trigger an undesired immune response, which could be caused by the therapeutic agent itself (e.g., an mRNA). Accordingly, in some embodiments of the present disclosure the sequence optimization of nucleic acid sequence (e.g., RNA, e.g., an mRNA) disclosed herein can be used to decrease an immune or inflammatory response triggered by the administration of such a nucleic acid (e.g., the immune or inflammatory response caused by the nucleic acid itself). In some cases, an undesired inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to cytokines that are elevated in an -72- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1; also known as GROa, interferon-g (IFNg), tumor necrosis factor a (TNFa), interferon g-induced protein 10 (IP-10), or granulocyte- colony stimulating factor (G-CSF). The term “inflammatory cytokines” includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1), interleukin-8 (IL-8), interleukin-12 (IL-12), interleukin-13 (Il-13), interferon α (IFN-α). a. Untranslated Regions Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5′ UTR) and after a stop codon (3′ UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of this disclosure comprising an open reading frame (ORF) encoding one or more target BET decoy polypeptides further comprises a UTR (e.g., a 5′ UTR or functional fragment thereof, a 3′ UTR or functional fragment thereof, or a combination thereof). A UTR (e.g., 5′ UTR or 3′ UTR) can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the one or more target BET decoy polypeptides. In some embodiments, the UTR is heterologous to the ORF encoding the one or more target BET decoy polypeptides. In some embodiments, the polynucleotide comprises two or more 5′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the 5′ UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof is sequence optimized. In some embodiments, the 5′UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. -73- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and / or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5′ UTR or 3′ UTR comprises one or more regulatory features of a full length 5′ or 3′ UTR, respectively. Natural 5′UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG (SEQ ID NO: 73), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’. 5′ UTRs also have been known to form secondary structures that are involved in elongation factor binding. By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5′ UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5′UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i- NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A / B / C / D). In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide. -74- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the 5′ UTR and the 3′ UTR can be heterologous. In some embodiments, the 5′ UTR can be derived from a different species than the 3′ UTR. Co-owned International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO / 2014 / 164253, incorporated herein by reference in its entirety) provides a listing of exemplary UTRs that can be utilized in the polynucleotide of the present invention as flanking regions to an ORF. Additional exemplary UTRs of the application include, but are not limited to, one or more 5′UTR and / or 3′UTR derived from the nucleic acid sequence of: a globin, such as an α- or β-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 α polypeptide); an albumin (e.g., human albumin7); a HSD17B4 (hydroxysteroid (17-β) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); an actin (e.g., human α or β actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5′UTR of a TOP gene lacking the 5′ TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the β subunit of mitochondrial H+-ATP synthase); a growth hormone e (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 α1 (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a β-F1-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1); and a nucleobindin (e.g., Nucb1). -75- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the 5′ UTR is selected from the group consisting of a βglobin 5′ UTR; a 5′UTR containing a strong Kozak translational initiation signal; a cytochrome b- 245 α polypeptide (CYBA) 5′ UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5′ UTR; a Tobacco etch virus (TEV) 5′ UTR; a Venezuelen equine encephalitis virus (TEEV) 5′ UTR; a 5′ proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5′ UTR; a heat shock protein 70 (Hsp70) 5′ UTR; a eIF4G 5′ UTR; a GLUT15′ UTR; functional fragments thereof and any combination thereof. Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides of this disclosure. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5′ or 3′ UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR. Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 20138(3):568-82, the contents of which are incorporated herein by reference in their entirety. UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5′ and / or 3′ UTR can be inverted, shortened, lengthened, or combined with one or more other 5′ UTRs or 3′ UTRs. In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5′ UTR or 3′ UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3′UTR can be used (see US2010 / 0129877, the contents of which are incorporated herein by reference in its entirety). The polynucleotides of this disclosure can comprise combinations of features. For example, the ORF can be flanked by a 5′UTR that comprises a strong Kozak translational -76- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 initiation signal and / or a 3′UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5′UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, herein incorporated by reference in its entirety). Other non-UTR sequences can be used as regions or subregions within the polynucleotides of this disclosure. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of this disclosure. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of this disclosure comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010394(1):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide comprises an IRES instead of a 5′ UTR sequence. In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5′ UTR in combination with a non-synthetic 3′ UTR. In some embodiments, the UTR can also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, “TEE,” which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5′ UTR comprises a TEE. In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation. i. 5’-UTR Sequences 5′ UTR sequences are important for ribosome recruitment to the mRNA and have been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292: 1413-6). -77- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding one or more target BET decoy polypeptides, comprising, inter alia, a 5’ UTR. In an embodiment, the polynucleotide comprises: (a) a 5′-UTR (e.g., as provided in Table 2 or a variant or fragment thereof); (b) a coding region; and (c) a stop element and a 3′- UTR (e.g., as described herein), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 5′-UTR comprising a sequence provided in Table 2 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such 5’UTRs are incorporated into constructs not found in nature, e.g., such 5’ UTRs are synthetic, are altered in sequence from naturally occurring 5’UTRs, are truncated or lengthened versions of those found in nature, comprise chemically modified bases, are 5’ of ORF sequences different from those which they may be found in nature, or the like. In an embodiment, the 5′ UTR comprises a sequence provided in Table 2 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5′ UTR sequence provided in Table 2, or a variant or a fragment thereof. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 74. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 75. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 76. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 77. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 78. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 79. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 80. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 81. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 82. In an -78- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 83. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 84. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 85. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 86. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 87. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 88. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 89. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 90. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 91. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 92. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 93. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 94. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 95. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 96. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 97. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 98. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 99. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 100. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, -79- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 97%, 98%, 99% or 100% identity to SEQ ID NO: 101. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 102. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 103. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 104. In an embodiment, the 5′ UTR comprises the sequence of any one of SEQ ID NOs:74- 104. In an embodiment, the 5′ UTR consists of the sequence of any one of SEQ ID NOs:74- 104. In an embodiment, a 5′ UTR sequence provided in Table4 has a first nucleotide which is an A. In an embodiment, a 5′ UTR sequence provided in Table 2 has a first nucleotide which is a G. In an embodiment, a 5′ UTR sequence provided in Table 2 has two first nucleotides which are an AG. In an embodiment, a 5′ UTR sequence provided in Table 2 has two first nucleotides which are a GA. Table 2: 5′ UTR sequences -80- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -81- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -82- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -83- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the 5′ UTR comprises a variant of SEQ ID NO: 74. In an embodiment, the variant of SEQ ID NO: 74 comprises a nucleic acid sequence of: G G A A A U C G C A A A A (N2)X (N3)X C U (N4)X (N5)X C G C G U U A G A U U U C U U U U A G U U U U C U N6 N7 C A A C U A G C A A G C U U U U U G U U C U C G C C (N8 C C)x (SEQ ID NO: 83), wherein: (N2)x is a uracil and x is an integer from 0 to 5, e.g., wherein x =3 or 4; (N3)x is a guanine and x is an integer from 0 to 1; (N4)x is a cytosine and x is an integer from 0 to 1; (N5)x is a uracil and x is an integer from 0 to 5, e.g., wherein x =2 or 3; N6 is a uracil or cytosine; N7 is a uracil or guanine; N8 is adenine or guanine and x is an integer from 0 to 1. In an embodiment (N2)x is a uracil and x is 0. In an embodiment (N2)x is a uracil and x is 1. In an embodiment (N2)x is a uracil and x is 2. In an embodiment (N2)x is a uracil and x is 3. In an embodiment, (N2)x is a uracil and x is 4. In an embodiment (N2)x is a uracil and x is 5. -84- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, (N3)x is a guanine and x is 0. In an embodiment, (N3)x is a guanine and x is 1. In an embodiment, (N4)x is a cytosine and x is 0. In an embodiment, (N4)x is a cytosine and x is 1. In an embodiment (N5)x is a uracil and x is 0. In an embodiment (N5)x is a uracil and x is 1. In an embodiment (N5)x is a uracil and x is 2. In an embodiment (N5)x is a uracil and x is 3. In an embodiment, (N5)x is a uracil and x is 4. In an embodiment (N5)x is a uracil and x is 5. In an embodiment, N6 is a uracil. In an embodiment, N6 is a cytosine. In an embodiment, N7 is a uracil. In an embodiment, N7 is a guanine. In an embodiment, N8 is an adenine and x is 0. In an embodiment, N8 is an adenine and x is 1. In an embodiment, N8 is a guanine and x is 0. In an embodiment, N8 is a guanine and x is 1. In an embodiment, the 5′ UTR comprises a variant of any one of SEQ ID NOs: 74- 104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 50% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 60% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74- 104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 70% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 80% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 -85- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 comprises a sequence with at least 90% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 95% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 96% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 97% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 98% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74-104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a sequence with at least 99% identity to the corresponding non-variant sequence of any one of SEQ ID NOs: 74- 104. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 5%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 10%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 20%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 30%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 40%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 50%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 60%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 70%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises a uridine content of at least 80%. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises at least 2, 3, 4, 5, 6 or 7 consecutive uridines (e.g., a polyuridine tract). In an embodiment, the polyuridine tract in the variant of any one of SEQ ID NOs: 74-104 comprises at least 1-7, 2- 7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In an -86- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 embodiment, the polyuridine tract in the variant of any one of SEQ ID NOs: 74-104 comprises 4 consecutive uridines. In an embodiment, the polyuridine tract in the variant any one of SEQ ID NOs: 74-104 comprises 5 consecutive uridines. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises 3 polyuridine tracts. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises 4 polyuridine tracts. In an embodiment, the variant of any one of SEQ ID NOs: 74-104 comprises 5 polyuridine tracts. In an embodiment, one or more of the polyuridine tracts are adjacent to a different polyuridine tract. In an embodiment, each of, e.g., all, the polyuridine tracts are adjacent to each other, e.g., all of the polyuridine tracts are contiguous. In an embodiment, one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides. In an embodiment, each of, e.g., all of, the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides. In an embodiment, a first polyuridine tract and a second polyuridine tract are adjacent to each other. In an embodiment, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth, polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides from the first polyuridine tract, the second polyuridine tract, or any one of the subsequent polyuridine tracts. In an embodiment, a first polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides from a subsequent polyuridine tract, e.g., a second, third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth polyuridine tract. In an embodiment, one or more of the subsequent polyuridine tracts are adjacent to a different polyuridine tract. -87- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the 5′ UTR comprises a Kozak sequence, e.g., a GCCRCC nucleotide sequence (SEQ ID NO: 103) wherein R is an adenine or guanine. In an embodiment, the Kozak sequence is disposed at the 3′ end of the 5′UTR sequence. In an embodiment, the polynucleotide comprising a 5’ UTR sequence disclosed herein comprises a coding region which encodes for a payload, e.g., a therapeutic or prophylactic payload (e.g., one or more target BET decoy polypeptides). In an aspect, the polynucleotide (e.g., mRNA) comprising a 5’ UTR sequence disclosed herein is formulated as an LNP. In an embodiment, the LNP composition comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid. In another aspect, the LNP compositions of the disclosure are used in a method of treating a disease or disorder. In an aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a therapeutic payload or prophylactic payload, e.g., one or more target BET decoy polypeptides, can be administered with one or more other therapeutic agents, e.g., as described herein. ii.Stop elements and 3’-UTRs Translational stop codons, UAA, UAG, and UGA, are an important component of the genetic code and signal the termination of translation of an mRNA. During protein synthesis, stop codons interact with protein release factors and this interaction can modulate ribosomal activity thus having an impact translation (Tate WP, et al., (2018) Biochem Soc Trans, 46(6):1615-162). 3′ UTR sequences have been shown to influence translation, half-life, and subcellular localization of mRNAs (Mayr C., Cold Spring Harb Persp Biol 2019 Oct 1;11(10):a034728). Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding one or more target BET decoy polypeptides, which polynucleotide has a stop element in combination with a 3′ UTR that confers an increased half-life, increased -88- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 expression and / or increased activity of the one or more target BET decoy polypeptides encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5′-UTR; (b) a coding region; and (c) a stop element and 3′-UTR (e.g., as described herein), and LNP compositions comprising the same. Disclosed herein, inter alia, is a polynucleotide encoding a polypeptide comprising, inter alia, a 3’ UTR. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5’-UTR (e.g., as provided in Table 2 or a variant or fragment thereof); (b) a coding region; and (c) a stop element and 3’-UTR (e.g., as provided in Table 3 or a variant or fragment thereof), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 3’-UTR comprising a sequence provided in Table 3 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such 3’UTRs are incorporated into constructs not found in nature, e.g., such 3’ UTRs are synthetic, are altered in sequence from naturally occurring 3’UTRs, are truncated or lengthened versions of those found in nature, comprise chemically modified bases, are 3’ of ORF sequences different from those which they may be found in nature, or the like. In an embodiment, the 3′ UTR comprises a sequence provided in Table 3 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in Table 3, or a variant or a fragment thereof. In an embodiment, the 3′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 105-113. Table 3: 3′ UTR sequences (stop cassette is italicized; miR binding sites are boldened) -89- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 -90- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCC CAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO: 105) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:105). In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO: 105 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -91- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO: 105 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO: 105 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:105 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:105. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAGUCUAAGCUGGAGCCUCCUGAGAGACCUGUGUGAACUAUUGAGAAGAUCG GAACAGCUCCUUACUCUGAGGAAGUUGGUACCCCCGUGGUCUUUGAAUAAAG UCUGAGUGGGCGGC (SEQ ID NO:106) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:106). In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:106 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -92- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:106 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:106 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:106 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:106. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAAGCUCCCCGGGGCAAACACCAUUGUCACACUCCAGCCUCGGUGGCCUAGCU UCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUCC UCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCU UUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:107) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:107). In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:107 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -93- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:107 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:107 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:107 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:107. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUG GCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCC AGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCU GAGUGGGCGGC (SEQ ID NO:108) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:108. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:108 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -94- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:108 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:108 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:108 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:108. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCC CAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUC CAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:109) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:109. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:109 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -95- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:109 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:109 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:109 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:109. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAGCCCCUCCGGGGCAAACACCAUUGUCACACUCCAGCCUCGGUGGCCUAGC UUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCCAGCCCCUC CUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUCCAGUGGUCU UUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:110) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:110. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:110 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -96- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:110 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:110 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:110 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:110. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAGCCCCUCCGGGGUCCAUAAAGUAGGAAACACUACAGCCUCGGUGGCCUAG CUUCUUGCCCCUUGGGCCUCCAUAAAGUAGGAAACACUACAUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCCGCAUUAUUACUCACGGUACGAGUG GUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:111) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:111. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:111 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -97- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:111 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:111 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:111 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:111. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAGCCCCUCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGAGCCUCGGUG GCCUAGCUUCUUGCCCCUUGGGCCCAAACACCAUUGUCACACUCCAUCCCCCC AGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCU GAGUGGGCGGC (SEQ ID NO:112) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:112. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:112 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -98- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:112 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:112 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:112 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:112. In an embodiment, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): UAAGCCCCUCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCC CAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCCAAACACCAUUGUCACACUC CAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:113) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:113. In an embodiment, the polynucleotide having a 3’ UTR sequence provided in SEQ ID NO:113 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half-life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. -99- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the polynucleotide having a 3′ UTR sequence provided in SEQ ID NO:113 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of SEQ ID NO:113 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in SEQ ID NO:113 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in SEQ ID NO:113. b. 3’ stabilizing region Disclosed herein, inter alia, is a polynucleotide encoding a polypeptide (e.g., one or more target BET decoy polypeptides), wherein the polynucleotide comprises: (a) a 5’-UTR (e.g., as described herein); (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein), and (d) a 3’ stabilizing region. Also disclosed herein are LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 3’ stabilizing region, e.g., a stabilized tail e.g., as described herein. A polynucleotide containing a 3’-stabilizing region (e.g., a 3’-stabilizing region including an alternative nucleobase, sugar, and / or backbone) may be particularly effective for use in therapeutic compositions, because they may benefit from increased stability, high expression levels. In an embodiment, the 3’ stabilizing region comprises a poly A tail, e.g., a poly A tail comprising 80-150, e.g., 120, adenines. In an embodiment, the poly A tail comprises one or more non-adenosine residues, e.g., one or more guanosines, e.g., as described herein. In an embodiment, the poly A tail comprises a UCUAG sequence (SEQ ID NO: 44). In an embodiment, the poly A tail comprises about 80-120, e.g., 100, adenines upstream of SEQ ID NO: 44. In an embodiment, the poly A tail comprises about 1-40, e.g., 20, adenines downstream of SEQ ID NO: 44. -100- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the 3’ stabilizing region comprises at least one alternative nucleoside. In an embodiment, the alternative nucleoside is an inverted thymidine (idT). In an embodiment, the alternative nucleoside is disposed at the 3’ end of the 3’ stabilizing region. In an embodiment, the 3’ stabilizing region comprises a structure of: or a salt thereof, wherein each X is independently O or S, and A represents adenine and T represents thymine. In an aspect, disclosed herein is a polynucleotide encoding a polypeptide, wherein the polynucleotide comprises: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein) and; (d) a 3’ stabilizing region, e.g., as described herein. In an aspect, an LNP composition comprising a polynucleotide comprising a stabilizing region disclosed herein comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid. In another aspect, the LNP compositions of the disclosure are used in a method of treating a disease or disorder. In an aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a therapeutic payload or prophylactic payload, e.g., a polynucleotide encoding one or more target BET decoy polypeptides, can be administered with one or more other therapeutic agents, e.g., as described herein. -101- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 c. MicroRNA (miRNA) Binding Sites Polynucleotides of this disclosure can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of this disclosure comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of polynucleotides of this disclosure, and in turn, of the polypeptides encoded therefrom, based on tissue-specific and / or cell-type specific expression of naturally occurring miRNAs. A miRNA, e.g., a natural occurring miRNA, is a 19-25 nucleotide long noncoding RNA that binds to a polynucleotide (e.g., RNA, e.g., mRNA) and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a “seed” region, i.e., a sequence in the region of positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2-7 of the mature miRNA. In some embodiments, a miRNA seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. In some embodiments, a miRNA seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. See, for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. miRNA profiling of the target cells or tissues can be conducted to determine the presence or absence of miRNA in the cells or tissues. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure comprises one or more microRNA binding sites, microRNA target sequences, microRNA complementary sequences, or microRNA seed complementary sequences. Such sequences can correspond to, e.g., have complementarity to, any known microRNA such as those taught in US Publication US2005 / 0261218 and US -102- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Publication US2005 / 0059005, the contents of each of which are incorporated herein by reference in their entirety. As used herein, the term “microRNA (miRNA or miR) binding site” refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including in the 5′UTR and / or 3′UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a polynucleotide of this disclosure comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5′ UTR and / or 3′ UTR of the polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises the one or more miRNA binding site(s). A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In exemplary aspects of this disclosure, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA- induced silencing complex (RISC)-mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide long miRNA sequence, to a 19-23 nucleotide long miRNA sequence, or to a 22-nucleotide long miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally occurring miRNA) is preferred when the desired regulation is mRNA degradation. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) -103- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 with a miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations. In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5′ terminus, the 3′ terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5′ terminus, the 3′ terminus, or both. The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation. In some embodiments, the miRNA binding site binds the corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the polynucleotide comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the polynucleotide comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the polynucleotide comprising the miRNA binding site. In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA. In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one contiguous nucleotides -104- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA. By engineering one or more miRNA binding sites into a polynucleotide of this disclosure, the polynucleotide can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the polynucleotide. For example, if a polynucleotide of this disclosure is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5′ UTR and / or 3′ UTR of the polynucleotide. For example, one of skill in the art would understand that one or more miR binding sites can be included in a polynucleotide (e.g., RNA, e.g., mRNA) to minimize expression in certain cell types. In one embodiment, a miR122 binding site can be used. In another embodiment, multiple copies of these miR binding sites or combinations may be used. Conversely, miRNA binding sites can be removed from polynucleotide sequences in which they naturally occur to increase protein expression in specific tissues. For example, a binding site for a specific miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA. Regulation of expression in multiple tissues can be accomplished through introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision whether to remove or insert a miRNA binding site can be made based on miRNA expression patterns and / or their profilings in tissues and / or cells in development and / or disease. Identification of miRNAs, miRNA binding sites, and their expression patterns and role in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 201118:171-176; Contreras and Rao Leukemia 201226:404-413 (2011 Dec 20. doi: 10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al, Cell, 2007129:1401-1414; Gentner and Naldini, Tissue -105- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Antigens. 201280:393-403 and all references therein; each of which is incorporated herein by reference in its entirety). miRNAs and miRNA binding sites can correspond to any known sequence, including non-limiting examples described in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005, each of which are incorporated herein by reference in their entirety. Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR- 208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR- 16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-1d, miR- 149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR- 126). Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific miRNAs are involved in immunogenicity, autoimmunity, the immune response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue / organ transplantation. Immune cells specific miRNAs also regulate many aspects of development, proliferation, differentiation, and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, particularly abundant in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be shut-off by adding miR- 142 binding sites to the 3′-UTR of the polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety). An antigen-mediated immune response can refer to an immune response triggered by foreign antigens, which, when entering an organism, are processed by the antigen presenting -106- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 cells and displayed on the surface of the antigen presenting cells. T cells can recognize the presented antigen and induce a cytotoxic elimination of cells that express the antigen. Introducing one or more (e.g., one, two, or three) miR-142 binding sites into the 5′ UTR and / or 3′UTR of a polynucleotide of this disclosure can selectively repress gene expression in antigen presenting cells through miR-142 mediated degradation, limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing antigen-mediated immune response after the delivery of the polynucleotide. The polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic elimination. In one embodiment, binding sites for miRNAs that are known to be expressed in immune cells, in particular, antigen presenting cells, can be engineered into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure to suppress the expression of the nucleic acid molecule (e.g., RNA, e.g., mRNA) in antigen presenting cells through miRNA mediated RNA degradation, subduing the antigen-mediated immune response. Expression of the nucleic acid molecule (e.g., RNA, e.g., mRNA) is maintained in non-immune cells where the immune cell specific miRNAs are not expressed. For example, in some embodiments, to prevent an immunogenic reaction against a liver specific protein, any miR-122 binding site can be removed and a miR-142 (and / or mirR-146) binding site can be engineered into the 5’UTR and / or 3’UTR of a nucleic acid molecule of the disclosure. To further drive the selective degradation and suppression in APCs and macrophage, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can include a further negative regulatory element in the 5’UTR and / or 3’UTR, either alone or in combination with miR-142 and / or miR-146 binding sites. As a non-limiting example, the further negative regulatory element is a Constitutive Decay Element (CDE). In one embodiment, binding sites for miRNAs that are known to be expressed in liver cells can be engineered into a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure to suppress the expression of the polynucleotides (e.g., RNA, e.g., mRNA) in liver cells through miRNA mediated RNA degradation. Expression of the nucleic acid molecule (e.g., RNA, -107- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 e.g., mRNA) is maintained in non-liver cells where the liver cell specific miRNAs are not expressed. In some embodiments, a miRNA binding site is inserted in the polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure in any position of the polynucleotide (e.g., RNA, e.g., mRNA) (e.g., the 5’UTR and / or 3’UTR). In some embodiments, the 5’UTR comprises a miRNA binding site. In some embodiments, the 3’UTR comprises a miRNA binding site. In some embodiments, the 5’UTR and the 3’UTR comprise a miRNA binding site. The insertion site in the polynucleotide (e.g., RNA, e.g., mRNA) can be anywhere in the polynucleotide (e.g., RNA, e.g., mRNA) as long as the insertion of the miRNA binding site in the polynucleotide (e.g., RNA, e.g., mRNA) does not interfere with the translation of a functional polypeptide (e.g., one or more target BET decoy polypeptides) in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site in the polynucleotide (e.g., RNA, e.g., mRNA) and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing the translation of the polynucleotide (e.g., RNA, e.g., mRNA). In some embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codon of an ORF in a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure comprising the ORF. In some embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the disclosure. In some embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides -108- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 downstream from the stop codon of an ORF in a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure. miRNA gene regulation can be influenced by the sequence surrounding the miRNA such as, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence and / or structural elements in the surrounding sequence. The miRNA can be influenced by the 5′ UTR and / or 3′ UTR. As a non-limiting example, a non- human 3′ UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest (e.g., one or more target BET decoy polypeptides) compared to a human 3′ UTR of the same sequence type. In one embodiment, other regulatory elements and / or structural elements of the 5′ UTR can influence miRNA mediated gene regulation. One example of a regulatory element and / or structural element is a structured IRES (Internal Ribosome Entry Site) in the 5′ UTR, which is necessary for the binding of translational elongation factors to initiate protein translation. EIF4A2 binding to this secondarily structured element in the 5′-UTR is necessary for miRNA mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, herein incorporated by reference in its entirety). The polynucleotides (e.g., RNA, e.g., mRNA) of the disclosure can further include this structured 5′ UTR in order to enhance microRNA mediated gene regulation. At least one miRNA binding site can be engineered into the 3′ UTR of a polynucleotide of the disclosure. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into a 3′ UTR of a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding sites can be engineered into the 3′ UTR of a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure. In one embodiment, miRNA binding sites incorporated into a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure can be the same or can be different miRNA sites. A combination of different miRNA binding sites incorporated into a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure can include combinations in which -109- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 more than one copy of any of the different miRNA sites are incorporated. In another embodiment, miRNA binding sites incorporated into a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure can target the same or different tissues in the body. As a non- limiting example, through the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites in the 3′-UTR of a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure, the degree of expression in specific cell types (e.g., liver cells) can be reduced. In one embodiment, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR, about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR and / or near the 3′ terminus of the 3′ UTR in a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure. As a non-limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR. As another non-limiting example, a miRNA binding site can be engineered near the 3′ terminus of the 3′ UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR. As yet another non-limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR and near the 3′ terminus of the 3′ UTR. In another embodiment, a 3′ UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to a miRNA, miRNA seed sequence, and / or miRNA sequences flanking the seed sequence. A polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure can be engineered for more targeted expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in the different tissues, cell types, or biological conditions. Through introduction of tissue-specific miRNA binding sites, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition. In some embodiments, a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure can comprise at least one miRNA binding site in the 3′ UTR in order to selectively degrade mRNA therapeutics in the liver cells. As a non-limiting example, the miRNA binding site can make a polynucleotide (e.g., RNA, e.g., mRNA) of the disclosure more unstable in liver cells. Non-limiting examples of these miRNAs are shown in Table 4 below. -110- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Table 4: miRNA binding site sequences In some embodiments, the 3’UTRs of the polynucleotides described herein comprise miR122 bs (i.e., SEQ ID NO: 114 as shown in Table 4 above). In some embodiments, the 3’UTRs of the nucleic acid molecules described herein comprise miR-142-3p bs (i.e., SEQ ID NO: 115 as shown in Table 4 above). In some embodiments, the 3’UTRs of the nucleic acid molecules described herein comprise miR-126-3p bs (i.e., SEQ ID NO: 116 as shown in Table 4 above). In some embodiments, the 3’UTRs of the polynucleotides described herein comprise more than one miRNA binding site. In some embodiments, the 3’UTRs of the polynucleotides described herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. In some embodiments, where more than one miRNA binding sites are present, the miRNA -111- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 binding sites are the same. In some where more than one miRNA binding sites are present, the miRNA binding sites (e.g., any combination of any of the miRNA binding sites listed in Table 4 above). In some embodiments, where more than one miRNA binding sites are present, about 1-25 nucleotides may be present in between each of the miRNA binding sites. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides may be present in between each of the miRNA bindings. In some embodiments, the 3’UTRS of the polynucleotides described herein comprise both miR142-3p bs and miR-126-3p bs. In some embodiments, the 3’UTRS of polynucleotides described herein comprise three copies of miR-142-3p bs. In some embodiments, the 3’UTRS of the polynucleotides described herein comprise two copies of miR-142-3p bs. In some embodiments, the 3’UTRS of the polynucleotides described herein comprise two copies of miR-142-3p bs and one copy of miR-126-3p bs. In some embodiments, the 3’UTRS of the polynucleotides described herein comprise three copies of miR122bs. d. Nucleotide Caps The disclosure also includes a polynucleotide that comprises both a 5′ Cap and a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding one or more target BET decoy polypeptides to be expressed). The 5′ cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5′ proximal introns during mRNA splicing. Endogenous mRNA molecules can be 5′-end capped generating a 5′-ppp-5′- triphosphate linkage between a terminal guanosine cap residue and the 5′-terminal transcribed sense nucleotide of the mRNA molecule. This 5′-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5′ end of the mRNA can optionally also be 2′-O- -112- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 methylated. 5′-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation. In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding one or more target BET decoy polypeptides) incorporate a cap moiety. In some embodiments, polynucleotides of the present invention comprise a non- hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5′-ppp-5′ phosphorodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio- guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5′-ppp-5′ cap. Additional modified guanosine nucleotides can be used such as α-methyl-phosphonate and seleno-phosphate nucleotides. Additional modifications include, but are not limited to, 2′-O-methylation of the ribose sugars of 5′-terminal and / or 5′-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2′-hydroxyl group of the sugar ring. Multiple distinct 5′-cap structures can be used to generate the 5′-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type or physiological) 5′- caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of this disclosure. For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5′-5′-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3′-O-methyl group (i.e., N7,3′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine (m7G- 3′mppp-G; which can equivalently be designated 3′ O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other, unmodified, guanine becomes linked to the 5′-terminal nucleotide of the capped -113- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 polynucleotide. The N7- and 3′-O-methlyated guanine provides the terminal moiety of the capped polynucleotide. Another exemplary cap is mCAP, which is similar to ARCA but has a 2′-O-methyl group on guanosine (i.e., N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, m7Gm- ppp-G). Another exemplary cap is m7GpppG2′OMeor m7G-ppp-Gm-A (i.e., N7,guanosine-5′- triphosphate-2′-O-dimethyl-guanosine-adenosine). In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety. In another embodiment, the cap is a cap analog is a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog known in the art and / or described herein. Non- limiting examples of a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog include a N7-(4-chlorophenoxyethyl)-G(5′)ppp(5′)G and a N7-(4- chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analog (See, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 201321:4570-4574; the contents of which are herein incorporated by reference in its entirety). In another embodiment, a cap analog of the present invention is a 4- chloro / bromophenoxyethyl analog. Polynucleotides of this disclosure can also be capped post-manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5′-cap structures. As used herein, the phrase “more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural -114- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 or physiological feature in one or more respects. Non-limiting examples of more authentic 5′cap structures of the present invention are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5′ endonucleases and / or reduced 5′decapping, as compared to synthetic 5′cap structures known in the art (or to a wild-type, natural or physiological 5′cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2′-O-methyltransferase enzyme can create a canonical 5′-5′-triphosphate linkage between the 5′-terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5′- terminal nucleotide of the mRNA contains a 2′-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5′cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5′)ppp(5′)N1pN2p (cap 0), 7mG(5′)ppp(5′)N1mpNp (cap 1), and 7mG(5′)- ppp(5′)N1mpN2mp (cap 2). As a non-limiting example, capping chimeric polynucleotides post-manufacture can be more efficient as nearly 100% of the chimeric polynucleotides can be capped. This is in contrast to ~80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction. According to the present invention, 5′ terminal caps can include endogenous caps or cap analogs. According to the present invention, a 5′ terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2′fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA- guanosine, and 2-azido-guanosine. Also provided herein are exemplary caps including those that can be used in co- transcriptional capping methods for ribonucleic acid (RNA) synthesis, using RNA polymerase, e.g., wild type RNA polymerase or variants thereof, e.g., such as those variants described herein. In one embodiment, caps can be added when RNA is produced in a “one- pot” reaction, without the need for a separate capping reaction. Thus, the methods, in some embodiments, comprise reacting a polynucleotide template with an RNA polymerase variant, -115- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript. As used here the term “cap” includes the inverted G nucleotide and can comprise one or more additional nucleotides 3’ of the inverted G nucleotide, e.g., 1, 2, 3, or more nucleotides 3’ of the inverted G nucleotide and 5’ to the 5’ UTR, e.g., a 5’ UTR described herein. Exemplary caps comprise a sequence of GG, GA, or GGA, wherein the underlined, italicized G is an in inverted G nucleotide followed by a 5’-5’-triphosphate group. In one embodiment, a cap comprises a compound of formula: (cap-I), or a stereoisomer, tautomer or salt thereof, wherein ring B1 is a modified or unmodified Guanine; ring B2 and ring B3 each independently is a nucleobase or a modified nucleobase; -116- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 X2 is O, S(O)p, NR24 or CR25R26 in which p is 0, 1, or 2; Y0 is O or CR6R7; Y1 is O, S(O)n, CR6R7, or NR8, in which n is 0, 1, or 2; each --- is a single bond or absent, wherein when each --- is a single bond, Yi is O, S(O)n, CR6R7, or NR8; and when each --- is absent, Y1 is void; Y2 is (OP(O)R4)m in which m is 0, 1, or 2, or -O-(CR40R41)u-Q0-(CR42R43)v-, in which Q0 is a bond, O, S(O)r, NR44, or CR45R46, r is 0, 1, or 2, and each of u and v independently is 1, 2, 3 or 4; each R2 and R2' independently is halo, LNA, or OR3; each R3 independently is H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl and R3, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; each R4 and R4' independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3-; each of R6, R7, and R8, independently, is -Q1-T1, in which Q1 is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T1 is H, halo, OH, COOH, cyano, or Rs1, in which Rs1 is C1-C3 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1- C6 alkoxyl, C(O)O-C1-C6 alkyl, C3-C8 cycloalkyl, C6-C10 aryl, NR31R32, (NR31R32R33)+, 4 to 12- membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs1 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR31R32, (NR31R32R33)+, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R10, R11, R12, R13 R14, and R15, independently, is -Q2-T2, in which Q2 is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T2 is H, halo, OH, NH2, cyano, NO2, N3, Rs2, or ORs2, in which Rs2 is C1-C6 -117- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, NHC(O)-C1-C6 alkyl, NR31R32, (NR31R32R33)+, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs2 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1 - C6 alkoxyl, NR31R32, (NR31R32R33)+, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6- membered heteroaryl; or alternatively R12 together with R14 is oxo, or R13 together with R15 is oxo, each of R20, R21, R22, and R23 independently is -Q3-T3, in which Q3 is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, RS3, or ORS3, in which RS3 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, NHC(O)-C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs3 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, amino, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R24, R25, and R26 independently is H or C1-C6 alkyl; each of R27 and R28 independently is H or OR29; or R27 and R28 together form O-R30-O; each R29 independently is H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl and R29, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; R30 is C1-C6 alkylene optionally substituted with one or more of halo, OH and C1-C6 alkoxyl; each of R31, R32, and R33, independently is H, C1-C6 alkyl, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; -118- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 each of R40, R41, R42, and R43 independently is H, halo, OH, cyano, N3, OP(O)R47R48, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, or one R41 and one R43, together with the carbon atoms to which they are attached and Q0, form C4-C10 cycloalkyl, 4- to 14-membered heterocycloalkyl, C6-C10 aryl, or 5- to 14-membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl, or 5- to 6-membered heteroaryl is optionally substituted with one or more of OH, halo, cyano, N3, oxo, OP(O)R47R48, C1-C6 alkyl, C1-C6 haloalkyl, COOH, C(O)O-C1-C6 alkyl, C1-C6 alkoxyl, C1-C6 haloalkoxyl, amino, mono-C1-C6 alkylamino, and di-C1-C6 alkylamino; R44 is H, C1-C6 alkyl, or an amine protecting group; each of R45 and R46 independently is H, OP(O)R47R48, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, and each of R47 and R48, independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3. It should be understood that a cap analog, as provided herein, may include any of the cap analogs described in international publication WO 2017 / 066797, published on 20 April 2017, incorporated by reference herein in its entirety. In some embodiments, the B2 middle position can be a non-ribose molecule, such as arabinose. In some embodiments R2 is ethyl-based. Thus, in some embodiments, a cap comprises the following structure: -119- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 (cap-II) In other embodiments, a cap comprises the following structure: (cap-III) -120- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In yet other embodiments, a cap comprises the following structure: (cap-IV) In still other embodiments, a cap comprises the following structure: (cap-V) In some embodiments, R is an alkyl (e.g., C1-C6 alkyl). In some embodiments, R is a methyl group (e.g., C1 alkyl). In some embodiments, R is an ethyl group (e.g., C2 alkyl). -121- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, a cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA, GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, a cap comprises GAA. In some embodiments, a cap comprises GAC. In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GAU. In some embodiments, a cap comprises GCA. In some embodiments, a cap comprises GCC. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GCU. In some embodiments, a cap comprises GGA. In some embodiments, a cap comprises GGC. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises GGU. In some embodiments, a cap comprises GUA. In some embodiments, a cap comprises GUC. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GUU. In some embodiments, a cap comprises a sequence selected from the following sequences: m7GpppG, m7GpppApA, m7GpppApC, m7GpppApG, m7GpppApU, m7GpppCpA, m7GpppCpC, m7GpppCpG, m7GpppCpU, m7GpppGpA, m7GpppGpC, m7GpppGpG, m7GpppGpU, m7GpppUpA, m7GpppUpC, m7GpppUpG, and m7GpppUpU. In some embodiments, a cap comprises m7GpppApA. In some embodiments, a cap comprises m7GpppApC. In some embodiments, a cap comprises m7GpppApG. In some embodiments, a cap comprises m7GpppApU. In some embodiments, a cap comprises m7GpppCpA. In some embodiments, a cap comprises m7GpppCpC. In some embodiments, a cap comprises m7GpppCpG. In some embodiments, a cap comprises m7GpppCpU. In some embodiments, a cap comprises m7GpppGpA. In some embodiments, a cap comprises m7GpppGpC. In some embodiments, a cap comprises m7GpppGpG. In some embodiments, a cap comprises m7GpppGpU. In some embodiments, a cap comprises m7GpppUpA. In some embodiments, a cap comprises m7GpppUpC. In some embodiments, a cap comprises m7GpppUpG. In some embodiments, a cap comprises m7GpppUpU. A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3′OMepppApA, m7G3′OMepppApC, m7G3′OMepppApG, m7G3′OMepppApU, m7G3′OMepppCpA, m7G3′OMepppCpC, m7G3′OMepppCpG, m7G3′OMepppCpU, -122- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 m7G3′OMepppGpA, m7G3′OMepppGpC, m7G3′OMepppGpG, m7G3′OMepppGpU, m7G3′OMepppUpA, m7G3′OMepppUpC, m7G3′OMepppUpG, and m7G3′OMepppUpU. In some embodiments, a cap comprises m7G3′OMepppApA. In some embodiments, a cap comprises m7G3′OMepppApC. In some embodiments, a cap comprises m7G3′OMepppApG. In some embodiments, a cap comprises m7G3′OMepppApU. In some embodiments, a cap comprises m7G3′OMepppCpA. In some embodiments, a cap comprises m7G3′OMepppCpC. In some embodiments, a cap comprises m7G3′OMepppCpG. In some embodiments, a cap comprises m7G3′OMepppCpU. In some embodiments, a cap comprises m7G3′OMepppGpA. In some embodiments, a cap comprises m7G3′OMepppGpC. In some embodiments, a cap comprises m7G3′OMepppGpG. In some embodiments, a cap comprises m7G3′OMepppGpU. In some embodiments, a cap comprises m7G3′OMepppUpA. In some embodiments, a cap comprises m7G3′OMepppUpC. In some embodiments, a cap comprises m7G3′OMepppUpG. In some embodiments, a cap comprises m7G3′OMepppUpU. A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3′OMepppA2′OMepA, m7G3′OMepppA2′OMepC, m7G3′OMepppA2′OMepG, m7G3′OMepppA2′OMepU, m7G3′OMepppC2′OMepA, m7G3′OMepppC2′OMepC, m7G3′OMepppC2′OMepG, m7G3′OMepppC2′OMepU, m7G3′OMepppG2′OMepA, m7G3′OMepppG2′OMepC, m7G3′OMepppG2′OMepG, m7G3′OMepppG2′OMepU, m7G3′OMepppU2′OMepA, m7G3′OMepppU2′OMepC, m7G3′OMepppU2′OMepG, and m7G3′OMepppU2′OMepU. In some embodiments, a cap comprises m7G3′OMepppA2′OMepA. In some embodiments, a cap comprises m7G3′OMepppA2′OMepC. In some embodiments, a cap comprises m7G3′OMepppA2′OMepG. In some embodiments, a cap comprises m7G3′OMepppA2′OMepU. In some embodiments, a cap comprises m7G3′OMepppC2′OMepA. In some embodiments, a cap comprises m7G3′OMepppC2′OMepC. In some embodiments, a cap comprises m7G3′OMepppC2′OMepG. In some embodiments, a cap comprises m7G3′OMepppC2′OMepU. In some embodiments, a cap comprises m7G3′OMepppG2′OMepA. In some embodiments, a cap comprises m7G3′OMepppG2′OMepC. In some embodiments, a cap comprises m7G3′OMepppG2′OMepG. In some embodiments, a cap comprises m7G3′OMepppG2′OMepU. In -123- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 some embodiments, a cap comprises m7G3′OMepppU2′OMepA. In some embodiments, a cap comprises m7G3′OMepppU2′OMepC. In some embodiments, a cap comprises m7G3′OMepppU2′OMepG. In some embodiments, a cap comprises m7G3′OMepppU2′OMepU. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppG2′OMe, m7GpppA2′OMepA, m7GpppA2′OMepC, m7GpppA2′OMepG, m7GpppA2′OMepU, m7GpppC2′OMepA, m7GpppC2′OMepC, m7GpppC2′OMepG, m7GpppC2′OMepU, m7GpppG2′OMepA, m7GpppG2′OMepC, m7GpppG2′OMepG, m7GpppG2′OMepU, m7GpppU2′OMepA, m7GpppU2′OMepC, m7GpppU2′OMepG, and m7GpppU2′OMepU. In some embodiments, a cap comprises m7GpppA2′OMepA. In some embodiments, a cap comprises m7GpppA2′OMepC. In some embodiments, a cap comprises m7GpppA2′OMepG. In some embodiments, a cap comprises m7GpppA2′OMepU. In some embodiments, a cap comprises m7GpppC2′OMepA. In some embodiments, a cap comprises m7GpppC2′OMepC. In some embodiments, a cap comprises m7GpppC2′OMepG. In some embodiments, a cap comprises m7GpppC2′OMepU. In some embodiments, a cap comprises m7GpppG2′OMepA. In some embodiments, a cap comprises m7GpppG2′OMepC. In some embodiments, a cap comprises m7GpppG2′OMepG. In some embodiments, a cap comprises m7GpppG2′OMepU. In some embodiments, a cap comprises m7GpppU2′OMepA. In some embodiments, a cap comprises m7GpppU2′OMepC. In some embodiments, a cap comprises m7GpppU2′OMepG. In some embodiments, a cap comprises m7GpppU2′OMepU. In some embodiments, a cap comprises m7Gpppm6A2’OmepG. In some embodiments, a cap comprises m7Gpppe6A2’OmepG. In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises any one of the following structures: -124- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, the cap comprises m7GpppN1N2N3, where N1, N2, and N3 are optional (i.e., can be absent or one or more can be present) and are independently a natural, a modified, or an unnatural nucleoside base. In some embodiments, m7G is further methylated, e.g., at the 3’ position. In some embodiments, the m7G comprises an O-methyl at the 3’ position. In some embodiments N1, N2, and N3 if present, optionally, are independently an adenine, a uracil, a guanidine, a thymine, or a cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the -125- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 2’ position. In some embodiments, one or more (or all) of N1, N2, and N3, if present have an O-methyl at the 2’ position. In some embodiments, the cap comprises the following structure: wherein B1, B2, and B3 are independently a natural, a modified, or an unnatural nucleoside based; and R1, R2, R3, and R4 are independently OH or O-methyl. In some embodiments, R3 is O-methyl and R4 is OH. In some embodiments, R3 and R4 are O- methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O- methyl, and R4 is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl. In some embodiments, B1, B3, and B3 are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3 is a modified or unnatural base. In some embodiments, at least one of B1, B2, and B3 is N6-methyladenine. In some embodiments, B1 is adenine, cytosine, thymine, or uracil. In some embodiments, B1 is adenine, B2 is uracil, and B3 is adenine. In some embodiments, R1 and R2 are OH, R3 and R4 are O- methyl, B1 is adenine, B2 is uracil, and B3 is adenine. In some embodiments the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, -126- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments the cap comprises a sequence selected from the following sequences: GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC. A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3′OMepppApApN, m7G3′OMepppApCpN, m7G3′OMepppApGpN, m7G3′OMepppApUpN, m7G3′OMepppCpApN, m7G3′OMepppCpCpN, m7G3′OMepppCpGpN, m7G3′OMepppCpUpN, m7G3′OMepppGpApN, m7G3′OMepppGpCpN, m7G3′OMepppGpGpN, m7G3′OMepppGpUpN, m7G3′OMepppUpApN, m7G3′OMepppUpCpN, m7G3′OMepppUpGpN, and m7G3′OMepppUpUpN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3′OMepppA2′OMepApN, m7G3′OMepppA2′OMepCpN, m7G3′OMepppA2′OMepGpN, m7G3′OMepppA2′OMepUpN, m7G3′OMepppC2′OMepApN, m7G3′OMepppC2′OMepCpN, m7G3′OMepppC2′OMepGpN, m7G3′OMepppC2′OMepUpN, m7G3′OMepppG2′OMepApN, m7G3′OMepppG2′OMepCpN, m7G3′OMepppG2′OMepGpN, m7G3′OMepppG2′OMepUpN, m7G3′OMepppU2′OMepApN, m7G3′OMepppU2′OMepCpN, m7G3′OMepppU2′OMepGpN, and m7G3′OMepppU2′OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2′OMepApN, m7GpppA2′OMepCpN, m7GpppA2′OMepGpN, m7GpppA2′OMepUpN, m7GpppC2′OMepApN, m7GpppC2′OMepCpN, m7GpppC2′OMepGpN, m7GpppC2′OMepUpN, m7GpppG2′OMepApN, m7GpppG2′OMepCpN, m7GpppG2′OMepGpN, m7GpppG2′OMepUpN, m7GpppU2′OMepApN, m7GpppU2′OMepCpN, m7GpppU2′OMepGpN, and m7GpppU2′OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base. -127- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3′OMepppA2′OMepA2′OMepN, m7G3′OMepppA2′OMepC2′OMepN, m7G3′OMepppA2′OMepG2′OMepN, m7G3′OMepppA2′OMepU2′OMepN, m7G3′OMepppC2′OMepA2′OMepN, m7G3′OMepppC2′OMepC2′OMepN, m7G3′OMepppC2′OMepG2′OMepN, m7G3′OMepppC2′OMepU2′OMepN, m7G3′OMepppG2′OMepA2′OMepN, m7G3′OMepppG2′OMepC2′OMepN, m7G3′OMepppG2′OMepG2′OMepN, m7G3′OMepppG2′OMepU2′OMepN, m7G3′OMepppU2′OMepA2′OMepN, m7G3′OMepppU2′OMepC2′OMepN, m7G3′OMepppU2′OMepG2′OMepN, and m7G3′OMepppU2′OMepU2′OMepN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2′OMepA2′OMepN, m7GpppA2′OMepC2′OMepN, m7GpppA2′OMepG2′OMepN, m7GpppA2′OMepU2′OMepN, m7GpppC2′OMepA2′OMepN, m7GpppC2′OMepC2′OMepN, m7GpppC2′OMepG2′OMepN, m7GpppC2′OMepU2′OMepN, m7GpppG2′OMepA2′OMepN, m7GpppG2′OMepC2′OMepN, m7GpppG2′OMepG2′OMepN, m7GpppG2′OMepU2′OMepN, m7GpppU2′OMepA2′OMepN, m7GpppU2′OMepC2′OMepN, m7GpppU2′OMepG2′OMepN, and m7GpppU2′OMepU2′OMepN, where N is a natural, a modified, or an unnatural nucleoside base. In some embodiments, a cap comprises GGAG. In some embodiments, a cap comprises the following structure: (cap-X). -128- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 e. Stop Elements Translational stop codons, UAA, UAG, and UGA, are an important component of the genetic code and signal the termination of translation of an mRNA. During protein synthesis, stop codons interact with protein release factors and this interaction can modulate ribosomal activity thus having an impact translation (Tate WP, et al., (2018) Biochem Soc Trans, 46(6):1615-162). Disclosed herein, inter alia, is a polynucleotide encoding a polypeptide (e.g., one or more target BET decoy polypeptides), which polynucleotide has a coding region comprising a stop element which confers an increased half-life, increased expression and / or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, the polynucleotide comprises: (a) a 5’-UTR (e.g., as described herein); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3’-UTR (e.g., as described herein), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a coding region comprising a stop element provided in Table 5. A stop element as used herein, refers to a nucleic acid sequence comprising a stop codon. The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In an embodiment, a stop element comprises two consecutive stop codons. In an embodiment, a stop element comprises three consecutive stop codons. In an embodiment, a stop element comprises four consecutive stop codons. In an embodiment, a stop element comprises five consecutive stop codons. In an embodiment, the stop element comprises a plurality of the same stop codon. In an embodiment, the stop element comprises a plurality of different stop codons. In an embodiment, a stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides upstream and / or downstream of the one or more stop codons. In an embodiment, a stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides upstream of the one or more stop codons. In an embodiment, a stop element further comprises at least 1, 2, 3, 4, 5, or 10 nucleotides downstream of the one or more stop codons. -129- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 The invention also includes a polynucleotide that comprises both a stop codon element and the polynucleotide described herein. In some embodiments, a stop codon element comprises a stop codon region. In some embodiments, the coding region of the polynucleotide comprises the stop element. In some embodiments, the stop element is upstream, e.g., before, the 3’ UTR sequence in the polynucleotide. In some embodiments, the polynucleotides of the present invention can include at least two stop codons before the 3’ untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case or DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further embodiment the addition stop codon can be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more. It has been observed that stop elements comprising a sequence provided in Table 5can result in increased half-life of the polynucleotide and / or increased level or activity of the polypeptide encoded by the polynucleotide (e.g., one or more target BET decoy polypeptides). In an embodiment, the polynucleotide having a stop element provided in Table 5 results in an increased half-life of the polynucleotide or an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase in half-life is about 1.5-20-fold. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in half life is about 1.5-fold or more. In an embodiment, the increase in half life is about 2-fold or more. In an embodiment, the increase in half life is about 3-fold or more. In an embodiment, the increase in half life is about 4-fold. In an embodiment, the increase in half life is about 5-fold or more. In an embodiment, the polynucleotide having a stop element provided in Table 5results in an increased level and / or activity, e.g., output or duration of expression, of the polypeptide encoded by the polynucleotide (e.g., one or more target BET decoy -130- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 polypeptides). In an embodiment, the stop element results in about 1.5-20-fold increase in level and / or activity, e.g., detectable level or activity, of the polypeptide encoded by the polynucleotide for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days. In an embodiment, the stop element results in detectable level or activity of the polypeptide encoded by the polynucleotide for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days. In an embodiment, the increase in activity is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in activity is about 1.5-fold or more. In an embodiment, the increase in activity is about 2-fold or more. In an embodiment, the increase in activity is about 3-fold or more. In an embodiment, the increase in activity is about 4-fold or more. In an embodiment, the increase in activity is about 5-fold or more. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a stop element, has a different stop element, or does not have a stop element provided in Table 5. In an embodiment, the stop element comprises a sequence provided in Table 5. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133 or SEQ ID NO: 134, SEQ ID NO; 169, SEQ ID NO: 139 or SEQ ID NO: 140. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 124. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 125. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 126. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 127. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 128. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 129. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 130. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 131. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 132. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 133. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 134. In an -131- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 embodiment, the stop element comprises the sequence of SEQ ID NO: 135. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 139. In an embodiment, the stop element comprises the sequence of SEQ ID NO: 140. In some embodiments the polynucleotide includes a kappa stop cassette (i.e., UAAAGCUCCCCGGGG (SEQ ID NO: 131) or an iota stop cassette (i.e., UAAGCCCCUCCGGGG (SEQ ID NO: 130). In an embodiment, the coding region of (b) comprises a stop element comprising a consensus sequence of: X-3-X-2-X-1-U-A-A-X1-X2-X3-X4-X5-X6-X7-X8-X9-X10-X11-X12(SEQ ID NO: 136) wherein: X1 is a G or A; X2, X4, X5 X6 or X7 is each independently C or U; X3is C or A; X8, X10, X11, X12 X-1 or X-3 is each independently C or G; X9 is G or U; and / or X-2is A or U. In an embodiment, X1 is a G. In an embodiment, X1 is an A. In an embodiment, X2 is a C. In an embodiment, X2 is a U. In an embodiment, X4is a C. In an embodiment, X4is a U. In an embodiment, X5is a C. In an embodiment, X5is a U. In an embodiment, X6 is a C. In an embodiment, X6 is a U. In an embodiment, X7is a C. In an embodiment, X7is a U. -132- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, X3 is a C. In an embodiment, X3 is an A. In an embodiment, X8 is a C. In an embodiment, X8 is a G. In an embodiment, X10is a C. In an embodiment, X10is a G. In an embodiment, X11 is a C. In an embodiment, X11 is a G. In an embodiment, X12 is a C. In an embodiment, X12 is a G. In an embodiment, X-1is a C. In an embodiment, X-1is a G. In an embodiment, X-3is a C. In an embodiment, X-3is a G. In an embodiment, X9 is a G. In an embodiment, X9 is a U. In an embodiment, X-2is an A. In an embodiment, X-2is a U. In an embodiment, the consensus sequence of SEQ ID NO: 136 has a high GC content, e.g., GC content of about 50%, 60%, 70%, 80%, 90% or 99%. In an embodiment, the GC content is about 50%. In an embodiment, the GC content is about 60%. In an embodiment, the GC content is about 70%. In an embodiment, the GC content is about 80%. In an embodiment, the GC content is about 90%. In an embodiment, the GC content is about 99%. In an embodiment, the coding region of (b) comprises a stop element comprising a consensus sequence of: X-3-X-2-X-1-U-G-A-X1-X2-X3-X4-X5-X6-X7-X8-X9-X10-X11-X12 (SEQ ID NO: 137) wherein: X-3, X-1, X2, X5, X6, X7, X8, X9, or X12is each independently G or C; X-2, X3, or X4 is each independent A or C; X1is A or G; and / or X10or X11is each independently C or U. -133- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, X-3 is a G. In an embodiment, X-3 is a C. In an embodiment, X-1 is a G. In an embodiment, X-1 is a C. In an embodiment, X2is a G. In an embodiment, X2is a C. In an embodiment, X5 is a G. In an embodiment, X5 is a C. In an embodiment, X6 is a G. In an embodiment, X6 is a C. In an embodiment, X7is a G. In an embodiment, X7is a C. In an embodiment, X8is a G. In an embodiment, X8is a C. In an embodiment, X9 is a G. In an embodiment, X9 is a C. In an embodiment, X12is a G. In an embodiment, X12is a C. In an embodiment, X-2is an A. In an embodiment, X-2is a C. In an embodiment, X3 is an A. In an embodiment, X3 is a C. In an embodiment, X4 is an A. In an embodiment, X4 is a C. In an embodiment, X1is an A. In an embodiment, X1is a G. In an embodiment, X10 is a C. In an embodiment, X10 is a U. In an embodiment, X11 is a C. In an embodiment, X11 is a U. In an embodiment, the consensus sequence of SEQ ID NO: 137 has a high GC content, e.g., GC content of about 50%, 60%, 70%, 80%, 90% or 99%. In an embodiment, the GC content is about 50%. In an embodiment, the GC content is about 60%. In an embodiment, the GC content is about 70%. In an embodiment, the GC content is about 80%. In an embodiment, the GC content is about 90%. In an embodiment, the GC content is about 99%. -134- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, the coding region of (b) comprises a stop element comprising a consensus sequence of: X-3-X-2-X-1-U-A-G-X1-X2-X3-X4-X5-X6-X7-X8-X9-X10-X11-X12 (SEQ ID NO: 138) wherein: X-3, X-1, X2, X3, X10 is each independently G or C; X-2or X9is each independently A or U; X1or X4is each independently A or G; X5 or X8 is each independently A or C; and / or X6, X7, X11or X12is each independently C or U. In an embodiment, X-3is a G. In an embodiment, X-3is a C. In an embodiment, X-1 is a G. In an embodiment, X-1 is a C. In an embodiment, X2 is a G. In an embodiment, X2 is a C. In an embodiment, X3is a G. In an embodiment, X3is a C. In an embodiment, X10 is a G. In an embodiment, X10 is a C. In an embodiment, X-2 is an A. In an embodiment, X-2 is a U. In an embodiment, X9is an A. In an embodiment, X9is a U. In an embodiment, X1 is an A. In an embodiment, X1 is a G. In an embodiment, X4 is an A. In an embodiment, X4 is a G. In an embodiment, X5is an A. In an embodiment, X5is a C. In an embodiment, X8is an A. In an embodiment, X8is a C. In an embodiment, X6 is a C. In an embodiment, X6 is a U. -135- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an embodiment, X7 is a C. In an embodiment, X7 is a U. In an embodiment, X11 is a C. In an embodiment, X11 is a U. In an embodiment, X12is a C. In an embodiment, X12is a U. In an embodiment, the consensus sequence of SEQ ID NO: 138 has a high GC content, e.g., GC content of about 50%, 60%, 70%, 80%, 90% or 99%. In an embodiment, the GC content is about 50%. In an embodiment, the GC content is about 60%. In an embodiment, the GC content is about 70%. In an embodiment, the GC content is about 80%. In an embodiment, the GC content is about 90%. In an embodiment, the GC content is about 99%. Table 5: Stop elements -136- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In an aspect, disclosed herein is a polynucleotide encoding a polypeptide (e.g., one or more target BET decoy polypeptides), wherein the polynucleotide comprises: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as provided in Table 5); and (c) a 3’-UTR (e.g., as described herein). -137- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 f. PolyA tails In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding one or more target BET decoy polypeptides) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly-A tail comprises des-3′ hydroxyl tails. During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide such as an mRNA molecule to increase stability. Immediately after transcription, the 3′ end of the transcript can be cleaved to free a 3′ hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO: 141). aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa (SEQ ID NO:141) PolyA tails can also be added after the construct is exported from the nucleus. According to the present invention, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present invention can include des-3′ hydroxyl tails. They can also include structural moieties or 2'-Omethyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501–1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety). The polynucleotides of the present invention can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication-dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3ʹ poly(A) -138- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 tail, the function of which is instead assumed by a stable stem–loop structure and its cognate stem–loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi:10.1038 / nrm3645) the contents of which are incorporated herein by reference in its entirety. Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present invention. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000). In some embodiments, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In this context, the poly-A -139- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression. Additionally, multiple distinct polynucleotides can be linked together via the PABP (Poly-A binding protein) through the 3′-end using modified nucleotides at the 3′-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post- transfection. In some embodiments, the polynucleotides of the present invention are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO:142). aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa (SEQ ID NO: 142) In some embodiments, the poly-A tail is a mixed poly-A tail with intermittent non- adenosine residues (e.g., guanosine). In some embodiments, the poly-A tail is guanylated. Without wishing to be bound by theory, it is believed that in some embodiments the mixed poly-A tail can shield mRNA from rapid deadenylation. In some embodiments, the poly-A tail comprises one or more non-adenosine residues. In some embodiments, the non-adenosine residue is guanosine. In some embodiments, the poly-A tail comprises 1-20, e.g., 1-15, 1-10, 1-5, 15-20, 10-20, 5-20, 2-15, 5-10, 1-5, 2-10, or 5-15, non-adenosine residues (e.g., guanosine). For example, the poly-A tail can comprise 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. non-adenosine residues -140- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 (e.g., guanosine). In some embodiments, at least 1%, e.g., at least 2%, 5%, 10%, 15%, 20%, or 25%, of the residues in the poly-A tail are non-adenosine residues (e.g., guanosine). In some embodiments, the poly-A tail is guanylated, e.g., comprising one or more guanosine residues. In an embodiment, the poly-A tail comprising one or more non-adenosine residues is chemically synthesized. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence, e.g., as described herein, which recruits one or more terminal nucleotidyl transferases (TENTs) to the polynucleotide comprising the 3’ UTR. In an embodiment, the TENT is TENT4, e.g., TENT4A and / or TENT4B. Without wishing to be bound by theory, it is believed that in some embodiments one or more TENTs (e.g., TENT4A and / or TENT4B) generates a mixed poly-A tail with intermittent non-adenosine residues (e.g., guanosine), which shields mRNA from rapid deadenylation. Exemplary TENT recruiting sequences include, but are not limited to, CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG (SEQ ID NO: 143) and CCACCCCCAGCGCCACCACCGCUGCCGUCGCCACCGCGUUAUCCGUUCCUCGUA GGCUGGUCCUGGGGAACGGGUCGGCGGCCGGUCGGCUUCUGUUUUA (SEQ ID NO: 144) In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 144, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, -141- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides therefrom. In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 144. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) TENT recruiting sequences, e.g., one or more TENT recruiting sequences described herein. In an embodiment the 3’ UTR comprises one TENT recruiting sequence. In an embodiment the 3’ UTR comprises two TENT recruiting sequences. In an embodiment the 3’ UTR comprises three TENT recruiting sequences. In an embodiment the 3’ UTR comprises four TENT recruiting sequences. In an embodiment the 3’ UTR comprises five TENT recruiting sequences. For example, the multiple TENT recruiting sequences in the 3’ UTR can be identical or different. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) of a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises one TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises two TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises three TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, -142- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises four TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises five TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) of a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the 3’ UTR comprises two TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the 3’ UTR comprises three TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the 3’ UTR comprises four TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143. In an embodiment, the 3’ UTR comprises five TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 143. g. Additional 3’ UTR elements i. Identification and Ratio Determination (IDR) An Identification and Ratio Determination (IDR) sequence is a sequence of a biological molecule (e.g., nucleic acid or protein) that, when combined with the sequence of a target biological molecule, serves to identify the target biological molecule. Typically, an IDR sequence is a heterologous sequence that is incorporated within or appended to a sequence of a target biological molecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein); and (ii) a unique IDR sequence. An RNA species (e.g., RNA having a given coding sequence) may comprise an IDR sequence that differs from the IDR sequence of other RNA species (e.g., RNA(s) having -143- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 different coding sequence(s)). Each IDR sequence thus identifies a particular RNA species, and so the abundance of IDR sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct IDR sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNAs. Each RNA species in a multivalent RNA composition may comprise an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry). Each RNA species in a multivalent RNA composition may comprise an IDR sequence having a mass that differs from the mass of IDR sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each IDR sequence may differ from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of IDR sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs. Each RNA species in an RNA composition may comprises an IDR sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and so the use of IDR sequences of different lengths on different RNA species allows RNA fragments having different IDR sequences to be distinguished using chromatography-based methods (e.g., LC-UV). -144- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 IDR sequences may be chosen such that no IDR sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence. IDR sequences may be chosen such that no IDR sequence comprises a recognition site for a restriction enzyme. In one example, no IDR sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. ii. FUT8 In some embodiments, the 3’UTR comprises a FUT8 sequence. For example, the FUT8 sequence comprises the following sequence: CUGAGAGACCUGUGUGAACUAUUGAGAAGAUCGGAACAGCUCCUUACUCUGA GGAAGUUG (SEQ ID NO: 145). In an embodiment, the 3’ UTR comprises a FUT8 sequence comprising the nucleotide sequence of SEQ ID NO: 145, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In some embodiments, the FUT8 sequence can be combined with any of the miRNA binding sites present in the 3’UTR and as described here. iii. Ribosome engagement detection assay (REDA) REDA can be used to assess potency and effectiveness of cellular lipid nanoparticle- nucleic acid uptake and translation of mRNA of a manufactured nucleic acid. The assay incorporates some aspects of a Ribosome Engagement Detection Assay (REDA) in order to measure mRNA bound to ribosomes during the translation step in the cell. The assay does not need to involve actual protein expression, but rather, is representative of the effectiveness of a nucleic acid such as an mRNA in producing protein in a cell by demonstrating effective mRNA uptake and association with ribosomes, and thus effective intracellular translation. -145- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Accordingly, in some embodiments, any of the 3’ UTR sequences, as described herein, comprise a sequence that can be detected by qPCR in REDA. An RNA species (e.g., RNA having a given coding sequence) may comprise a REDA sequence that differs from the REDA sequence of other RNA species (e.g., RNA(s) having different coding sequence(s)). Each REDA sequence thus identifies a particular RNA species, and so the abundance of REDA sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct REDA sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full- length RNAs. Each RNA species in a multivalent RNA composition may comprise a REDA sequence that is not a sequence isomer of a REDA sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another REDA sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry). Each RNA species in a multivalent RNA composition may comprise a REDA sequence having a mass that differs from the mass of REDA sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each REDA sequence may differ from the mass of other REDA sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of REDA sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs. -146- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Each RNA species in an RNA composition may comprises a REDA sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and so the use of REDA sequences of different lengths on different RNA species allows RNA fragments having different REDA sequences to be distinguished using chromatography-based methods (e.g., LC-UV). REDA sequences may be chosen such that no REDA sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the REDA sequence. REDA sequences may be chosen such that no REDA sequence comprises a recognition site for a restriction enzyme. In one example, no REDA sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. h. Start codon region This disclosure also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding one or more target BET decoy polypeptides). In some embodiments, the polynucleotides of the present invention can have regions that are analogous to or function like a start codon region. In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 20105:11; the contents of each of which are herein incorporated by reference in its entirety). -147- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non-limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG. Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 20105:11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length and / or structure of a polynucleotide. In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 20105:11); the contents of which are herein incorporated by reference in its entirety). In another embodiment, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon. In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and / or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or -148- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide. In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and / or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and / or the structure of the polynucleotide. i. Combination of mRNA elements Any of the polynucleotides disclosed herein can comprise one, two, three, or all of the following elements: a 5’-UTR, e.g., as described herein; a coding region; a stop element + 3’- UTR (e.g., as described herein) and; optionally a 3’ stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the same. In an embodiment, a polynucleotide of the disclosure comprises a 5’ UTR described in Table 2 or a variant or fragment thereof and a stop element + 3’ UTR described in Table 3 or a variant or fragment thereof. In an embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. -149- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 j. Methods of Making Polynucleotides The present disclosure also provides methods for making a polynucleotide of this disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding one or more target BET decoy polypeptides) or a complement thereof. In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art. Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) (e.g., encoding one or more target BET decoy polypeptides). The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and / or produce a therapeutic outcome. The present disclosure also provides methods for making a polynucleotide disclosed herein or a complement thereof. In some aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed using in vitro transcription. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art. -150- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., an mRNA) (e.g., encoding one or more target BET decoy polypeptides). The resultant mRNAs can then be examined for their ability to produce one or more target BET decoy polypeptides and / or produce a therapeutic outcome. While RNA can be made synthetically using methods well known in the art, in one embodiment an RNA transcript (e.g., mRNA transcript) is synthesized by contacting a DNA template with a RNA polymerase (e.g., a T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of RNA transcript. In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, comprising contacting a DNA template with the RNA polymerase (e.g., a T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and buffer under conditions that result in the production of RNA transcripts. Other aspects of the present disclosure provide capping methods, e.g., co- transcriptional capping methods or other methods known in the art. In one embodiment, a capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript. IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system that includes dithiothreitol (DTT) and magnesium ions, and a RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA needed for a specific application. Typical IVT reactions are performed by incubating a DNA template with a RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs) in a transcription buffer. A RNA transcript having a 5^ terminal guanosine triphosphate is produced from this reaction. -151- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 A deoxyribonucleic acid (DNA) is simply a nucleic acid template for RNA polymerase. A DNA template may include a polynucleotide encoding one or more target BET decoy polypeptides. A DNA template, in some embodiments, includes a RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to polynucleotide encoding one or more target BET decoy polypeptides. A DNA template may also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest. Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins. The term “protein” encompasses peptides. A RNA transcript, in some embodiments, is the product of an IVT reaction and, as will be understood by one of ordinary skill in the art, the DNA template for making an RNA molecule is known based on base complementarity. A RNA transcript, in some embodiments, is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest linked to a polyA tail. In some embodiments, the mRNA is modified mRNA (mmRNA), which includes at least one modified nucleotide. A nucleotide includes a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) includes a nucleobase linked to a ribose and a single phosphate; a nucleoside diphosphate (NDP) includes a nucleobase linked to a ribose and two phosphates; and a nucleoside triphosphate (NTP) includes a nucleobase linked to a ribose and three phosphates. Nucleotide analogs are compounds that have the general structure of a nucleotide or are structurally similar to a nucleotide. Nucleotide analogs, for example, include an analog of the nucleobase, an analog of the sugar and / or an analog of the phosphate group(s) of a nucleotide. A nucleoside includes a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleoside analogs are compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. Nucleoside analogs, for example, include an analog of the nucleobase and / or an analog of the sugar of a nucleoside. -152- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 It should be understood that the term “nucleotide” includes naturally occurring nucleotides, synthetic nucleotides and modified nucleotides, unless indicated otherwise. Examples of naturally occurring nucleotides used for the production of RNA, e.g., in an IVT reaction, as provided herein include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m5UTP). In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used. Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotide, trinucleotide, tetranucleotide, e.g., a cap analog, or a precursor / substrate for enzymatic capping (vaccinia or ligase), a nucleotide labeled with a functional group to facilitate ligation / conjugation of cap or 5^ moiety (IRES), a nucleotide labeled with a 5^ PO4 to facilitate ligation of cap or 5^ moiety, or a nucleotide labeled with a functional group / protecting group that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited, to Ganciclovir, Entecavir, Telbivudine, Vidarabine and Cidofovir. Modified nucleotides may include modified nucleobases. For example, a RNA transcript (e.g., mRNA transcript) of the present disclosure may include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1- ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2- thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine (mo5U) and 2’-O-methyl uridine. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases. The nucleoside triphosphates (NTPs) as provided herein may comprise unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise unmodified -153- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 ATP. In some embodiments, NTPs of an IVT reaction comprise modified ATP. In some embodiments, NTPs of an IVT reaction comprise unmodified UTP. In some embodiments, NTPs of an IVT reaction comprise modified UTP. In some embodiments, NTPs of an IVT reaction comprise unmodified GTP. In some embodiments, NTPs of an IVT reaction comprise modified GTP. In some embodiments, NTPs of an IVT reaction comprise unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise modified CTP. The concentration of nucleoside triphosphates and cap analog present in an IVT reaction may vary. In some embodiments, NTPs and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphates in the reaction may be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction may be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100. The composition of NTPs in an IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP and UTP. As a non-limiting example, an IVT reaction may include 7.5 millimolar GTP, 7.5 millimolar CTP, 7.5 millimolar UTP, and 3.75 millimolar ATP. The same IVT reaction may include 3.75 millimolar cap analog (e.g., trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 5- methoxyuridine (mo5U), 5-methylcytidine (m5C), α-thio-guanosine and α-thio-adenosine. In some embodiments, a RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases. -154- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, an RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m1ψ). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (mo5U). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m5C). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes α-thio-guanosine. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes α-thio-adenosine. In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methylpseudouridine (m1ψ), meaning that all uridine residues in the mRNA sequence are replaced with 1-methylpseudouridine (m1ψ). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above. Alternatively, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) may not be uniformly modified (e.g., partially modified, part of the sequence is modified). Each possibility represents a separate embodiment of the present invention. In some embodiments, the buffer system contains tris. The concentration of tris used in an IVT reaction, for example, may be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10-100 mM. In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in an IVT reaction, for example, may be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 1-50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 5 mM. In some embodiments, the buffer system contains magnesium. In some embodiments, the molar ratio of NTP to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is -155- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 1:1 to 1:5. For example, the molar ratio of NTP to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5. In some embodiments, the molar ratio of NTP plus cap analog (e.g., trinucleotide cap, such as GAG) to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1:1 to 1:5. For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions may be 1:1, 1:2, 1:3, 1:4 or 1:5. In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON®X-100 (polyethylene glycol p-(1,1,3,3- tetramethylbutyl)-phenyl ether) and / or polyethylene glycol (PEG). The addition of nucleoside triphosphates (NTPs) to the 3^ end of a growing RNA strand is catalyzed by a polymerase, such as T7 RNA polymerase, for example, any one or more of the T7 RNA polymerase variants (e.g., G47A) of the present disclosure. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase variant) is present in a reaction (e.g., an IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in a reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml or 1.0 mg / ml. In some embodiments, the polynucleotide of the present disclosure is an IVT polynucleotide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5′UTR, a 3′UTR, a 5′ cap and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNA but are distinguished from wild-type mRNA in their functional and / or structural design features which serve, e.g., to overcome existing problems of effective polypeptide production using nucleic-acid based therapeutics. The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides that is flanked by a first flanking region and a second flaking region. This first region can include, but is not limited to, the encoded one or more target BET decoy polypeptides. The first flanking region can include a sequence of linked nucleosides which function as a 5’ untranslated region (UTR) such as the 5’ UTR of any of the nucleic acids encoding the native 5’ UTR of the polypeptide or a non-native 5’UTR such as, but not -156- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 limited to, a heterologous 5’ UTR or a synthetic 5’ UTR. The IVT encoding one or more target BET decoy polypeptides can comprise at its 5 terminus a signal sequence region encoding one or more signal sequences. The flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 5′ UTRs sequences. The flanking region can also comprise a 5′ terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3′ UTRs which can encode the native 3’ UTR of a one or more target BET decoy polypeptides, or a non-native 3’ UTR such as, but not limited to, a heterologous 3’ UTR or a synthetic 3’ UTR. The flanking region can also comprise a 3′ tailing sequence. The 3’ tailing sequence can be, but is not limited to, a polyA tail, a polyA-G quartet and / or a stem loop sequence. Additional and exemplary features of IVT polynucleotide architecture and methods of making a polynucleotide are disclosed in International PCT application WO 2017 / 201325, filed on 18 May 2017, the entire contents of which are hereby incorporated by reference. k. Purification In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be purified. Purification of the polynucleotides (e.g., mRNA) described herein can include, but is not limited to, polynucleotide clean-up, quality assurance and quality control. Clean-up can be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used in relation to a polynucleotide such as a "purified polynucleotide" refers to one that is separated from at least one contaminant. As used herein, a "contaminant" is any substance which makes another unfit, impure or inferior. Thus, a purified polynucleotide (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method. -157- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, purification of a polynucleotide (e.g., mRNA) of the disclosure removes impurities that can reduce or remove an unwanted immune response from the polynucleotide itself, e.g., reducing cytokine activity. In some embodiments, the polynucleotide (e.g., mRNA) of the disclosure is purified prior to administration using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)). In some embodiments, a column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP- HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) purified polynucleotide, which encodes one or more target BET decoy polypeptides disclosed herein increases expression of the one or more target BET decoy polypeptides, compared to polynucleotides encoding the one or more target BET decoy polypeptides, purified by a different purification method. In some embodiments, a column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) purified polynucleotide encodes one or more target BET decoy polypeptides. In some embodiments, the purified polynucleotide encodes one or more target BET decoy polypeptides. In some embodiments, the purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure. A quality assurance and / or quality control check can be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC. In another embodiment, the polynucleotides can be sequenced by methods including, but not limited to reverse-transcriptase-PCR. l. Chemical modifications of polynucleotides -158- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 As described above, modified nucleosides and nucleotides of a polynucleotide (e.g., RNA nucleic acids, such as mRNA nucleic acids) may be included in a polynucleotide of the invention. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides. Modified nucleotide base pairing encompasses not only the standard adenosine- thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker may be incorporated into nucleic acids of the present disclosure. In some embodiments, modified nucleobases in polynucleotides (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise N1-methyl-pseudouridine (m1ψ), 1-ethyl- pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5-methoxymethyl uridine, 5-methylthio uridine, 1-methoxymethyl pseudouridine, 5-methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications. -159- 4863-0924-7670.2 Atty. Dkt. No.: 131986-5202 In some embodiments, an RNA polynucleotide of the disclosure comprises N1- methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the polynucleotide. In some embodiments, an RNA polynucleotide of the disclosure comprises N1- methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the polynucleotide and 5-methyl cytidine substitutions at one or more or all cytidine positions of the polynucleotide. In some embodiments, an RNA polynucleotide of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the polynucleotide. In some embodiments, an RNA polynucleotide of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the polynucleotide and 5-methyl cytidine substitutions at one or more or all cytidine positions of the polynucleotide. In some embodiments, an RNA polynucleotide of the disclosure comprises uridine at one or more or all uridine positions of the polynucleotide. In some embodiments, polynucleotide (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1-methyl-pseudouridine. Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. The polynucleotides of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a polynucleotide of the disclosure, ...
Claims
Atty. Dkt. No.: 131986-5202 WHAT IS CLAIMED IS:
1. A pharmaceutical composition comprising an mRNA encoding a BET (bromodomain and extra-terminal domain) decoy polypeptide, wherein the BET decoy polypeptide comprises at least one bromodomain of (Bromodomain-containing protein 4) BRD4, wherein the mRNA comprises at least one non-naturally modified nucleotide.
2. The pharmaceutical composition of claim 1, wherein the mRNA further comprises at least one of a 3’ UTR, a nucleotide cap, a stabilizing domain, a poly A tail, and a 5’ UTR.
3. The pharmaceutical composition of claim 1 or 2, wherein the bromodomain of BRD4 comprises a Bromodomain 1 (BD1 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:
56.
4. The pharmaceutical composition of claim 1 or 2, wherein the bromodomain of BRD4 comprises a Bromodomain 2 (BD2 domain) having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:
57.
5. The pharmaceutical composition of any one of claims 1-4, wherein the BET decoy polypeptide comprises at least one BD1 domain, at least one BD2 domain, or a combination thereof.
6. The pharmaceutical composition of any one of claims 1-5, wherein the BET decoy polypeptide comprises a domain structure selected from the group consisting of: (i) BD1; (ii) BD2; (iii) BD1-BD2; (iv) BD1-BD1; (v) (BD1-BD2)2 ;(vi) BD2-BD2; (vii) BD2-BD1; and (viii) (BD2-BD1)2. -267- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 7. The pharmaceutical composition of any one of claims 1-6, wherein the BET decoy polypeptide comprises a BD1 domain and wherein the BD1 domain comprises one or more mutations that affect ubiquitination and / or phosphorylation of the BD1 domain.
8. The pharmaceutical composition of claim 7, wherein the mutation that affects ubiquitination comprises K91R and / or K99R with reference to SEQ ID NO:
56.
9. The pharmaceutical composition of claim 7, wherein the mutation that affects phosphorylation is a phosphomimic substitution that comprises Y97E and / or Y98E with reference to SEQ ID NO:
56.
10. The pharmaceutical composition of claim 7, wherein the mutation that affects phosphorylation is a mutation that prevents phosphorylation at Y97 and / or Y98 with reference to SEQ ID NO:
56.
11. The pharmaceutical composition of claim 7, wherein the mutation that affects phosphorylation comprises Y97A and / or Y98A with reference to SEQ ID NO:
56.
12. The pharmaceutical composition of any one of claims 1-6, wherein the BET decoy polypeptide comprises a BD1 domain and the BD1 domain comprises a mutation at its degron domain, wherein the wild type degron domain is as shown by SEQ ID NO:
72.
13. The pharmaceutical composition of any one of claims 1-12, wherein the BET decoy polypeptide comprises a BD2 domain and the BD2 domain comprises a mutation that prevents ubiquitination of the BD2 domain, wherein the mutation comprises a mutation at position K67 with reference to SEQ ID NO:
57.
14. The pharmaceutical composition of claim 13, wherein the BD2 domain comprises a K67R mutation with reference to SEQ ID NO:
57.
15. The pharmaceutical composition of any one of claims 1-14, wherein the BET decoy polypeptide further comprises at least one domain selected from the group consisting of: an Enhancer of Zeste Homolog 2 (EZH2) protein domain, an EZH2 Su(var)3–9, Enhancer-of- zeste and Trithorax (SET) domain, a DNA (cytosine-5)-methyltransferase 3A (DNMT3A) domain, a DNA (cytosine-5)-methyltransferase 3-like (DNMT3L) domain, a positive transcription elongation factor b (pTEFb) binding domain, a mutant pTEFb binding domain, an Intrinsically Disordered Region (IDR) domain, a Hexamethylene Bis-Acetamide-Inducible -268- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 Protein 1 (HEXIM1) positive patch domain, a HEXIM1 basic patch extended domain, a HEXIM1 acidic patch domain, a chromatin interference domain, a Cyclin-dependent kinase 9 (CDK9) inhibition domain, or a combination thereof.
16. The pharmaceutical composition of claim 15, wherein: the EZH2 protein domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 59, the EZH2 SET domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 60, the DNMT3A domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61, the DNMT3L domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 62, the pTEFb binding domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 63, the mutant pTEFb binding domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 64, the Intrinsically Disordered Region (IDR) domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, the HEXIM1 positive patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 67, the HEXIM1 basic patch extended domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 68, -269- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 the HEXIM1 acidic patch domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 69, the chromatin interference domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 70, and the CDK9 inhibition domain comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:
71.
17. The pharmaceutical composition of any one of claims 1-16, wherein the BET decoy polypeptide further comprises a linker sequence.
18. The pharmaceutical composition of claim 17, wherein the linker sequence is selected from any one of sequences as shown by SEQ ID NOs: 48-54.
19. The pharmaceutical composition of any one of claims 1-18, wherein the BET decoy polypeptide further comprises at least one nuclear localization signal peptide.
20. The pharmaceutical composition of claim 19, wherein the BET decoy polypeptide comprises at least two nuclear localization signal peptides.
21. The pharmaceutical composition of claim 19 or claim 20, wherein the nuclear localization signal peptide comprises an amino acid sequence set forth in SEQ ID NO:
55.
22. The pharmaceutical composition of any one of claims 1-21, wherein the BET decoy polypeptide further comprises a detectable label.
23. The pharmaceutical composition of claim 22, wherein the detectable label comprises a V5 epitope tag comprising an amino acid sequence set forth in SEQ ID NO:
47.
24. The pharmaceutical composition of claim 1 or claim 2, wherein the BET decoy polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 95%, at least 99%, or 100% sequence identity to any sequence of SEQ ID NOs: 1-46.
25. The pharmaceutical composition of any one of claims 1-24, wherein the mRNA comprises one or more of the followings: (i) a 5′-UTR having the sequence of any of SEQ ID -270- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 NOs: 74-104, (ii) a 3′ UTR having the sequence of any of SEQ ID NOs: 105-113, and optionally (iii) a miR122 binding site having the sequence of SEQ ID NO:
114.
26. The pharmaceutical composition of any one of claims 1-25 further comprising a pharmaceutically acceptable carrier.
27. The pharmaceutical composition of claim 26, wherein the mRNA is formulated in a lipid nanoparticle (LNP) 28. The pharmaceutical composition of claim 27, wherein the LNP comprises an ionizable lipid.
29. The pharmaceutical composition of claim 28, wherein the ionizable lipid has a chemical structure selected from any one of (a)-(p): (a)or a salt thereof, wherein: R1is -OH, -NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H or C1-6 alkyl; RN’is H or C1-6 alkyl; RN’’is H or C1-6alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8; M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2; M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3;or –(C1-6alkylene)-(C3-8cycloalkyl)-C1-6alkyl; -271- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 R2ais -H or C1-10 alkyl; R2bis -H or C1-10 alkyl; R2cis C1-8alkyl or C2-8alkenyl;R3ais H or C1-10 alkyl; R3bis H or C1-8 alkyl; and R3cis C1-10alkyl or C2-8alkenyl, or (b)or a salt thereof, wherein: R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2cis C4-8 alkyl; R3ais C7-10alkyl; and R3cis C3-5 alkyl, or (c) -272- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1is NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H; RN’is C1-2alkyl; RN’’is H; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2ais C7-10alkyl; R2cis C4-6 alkyl; R3ais C1-3 alkyl; and R3cis C4-6alkyl,or a salt thereof, wherein: R1is OH; -273- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2bis C3-5alkyl; R2cis C2-4alkyl; R3ais C7-10 alkyl; and R3cis C4-6alkyl, (e)or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (f)or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8 alkyl. (g) -274- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (h)or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8alkyl. (i)or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula (I); R2ais a C1-8 alkyl; and R3ais C1-8alkyl, (j) -275- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and -276- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 R3ais C1-8 alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl,or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8alkyl,-277- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 (XV) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8 alkyl, or (p)or a salt thereof, wherein: o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl, or N-oxides, salts, or isomers of each thereof.
30. The pharmaceutical composition of claim 28 or claim 29, wherein the ionizable lipid is a compound selected from the group consisting of:-278- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or N-oxides, salts, or isomers thereof.
31. A lipid nanoparticle comprising: (1) an ionizable lipid having a chemical structure selected from any one of (a)-(p):or a salt thereof, wherein: R1is -OH, -NRN-C4-10 cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H or C1-6alkyl; RN’is H or C1-6 alkyl; RN’’is H or C1-6 alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8; M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2; M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3; R2aR2bor –(C1-6 alkylene)-(C3-8 cycloalkyl)-C1-6 alkyl; -279- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 R2ais -H or C1-10 alkyl; R2bis -H or C1-10 alkyl; R2cis C1-8alkyl or C2-8alkenyl;R3ais H or C1-10 alkyl; R3bis H or C1-8 alkyl; and R3cis C1-10alkyl or C2-8alkenyl, or (b)or a salt thereof, wherein: R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2cis C4-8 alkyl; R3ais C7-10alkyl; and R3cis C3-5 alkyl, or (c) -280- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1is NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or - N(RN’RN’’); RNis H; RN’is C1-2alkyl; RN’’is H; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2ais C7-10alkyl; R2cis C4-6 alkyl; R3ais C1-3 alkyl; and R3cis C4-6alkyl,or a salt thereof, wherein: R1is OH; -281- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2bis C3-5alkyl; R2cis C2-4alkyl; R3ais C7-10 alkyl; and R3cis C4-6alkyl, (e)or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (f)or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8 alkyl. (g) -282- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula I; and R3ais C1-8alkyl. (h)or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for Formula (I); and R3ais C1-8alkyl. (i)or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula (I); R2ais a C1-8 alkyl; and R3ais C1-8alkyl, (j) -283- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8alkyl; and R3ais C1-8 alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8alkyl; and R3ais C1-8alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and -284- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 R3ais C1-8 alkyl,or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl,or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8alkyl,-285- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202 (XV) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for formula I; R2bis a C1-8 alkyl; and R3ais C1-8 alkyl, or (p)or a salt thereof, wherein: o, M, M’, R2c, and R3care as defined for formula I; R2ais a C1-8 alkyl; and R3ais C1-8alkyl, or N-oxides, salts, or isomers of each thereof; and (2) an mRNA encoding a BET (bromodomain and extra-terminal domain) decoy polypeptide, wherein the BET decoy polypeptide comprises at least one bromodomain of (Bromodomain-containing protein 4) BRD4, wherein the mRNA comprises at least one non- naturally modified nucleotide.
32. The lipid nanoparticle of claim 31, wherein in the ionizable lipid is a compound selected from the group consisting of:-286- 4863-0924-7670.2Atty. Dkt. No.: 131986-5202or N-oxides, salts, or isomers thereof.
33. A method for treating an inflammatory disease comprising administering to a subject in need thereof the pharmaceutical composition of any one of claims 1-30, or the lipid nanoparticle of any one of claims 31-32.
34. The method of claim 33, wherein the inflammatory disease is selected from the group consisting of: arthritis, asthma, dermatitis, psoriasis, cystic fibrosis, post transplantation late and chronic solid organ rejection, multiple sclerosis, systemic lupus erythematosus, inflammatory bowel diseases, autoimmune diabetes, diabetic retinopathy, diabetic nephropathy, diabetic vasculopathy, ocular inflammation, uveitis, rhinitis, ischemia- reperfusion injury, post-angioplasty restenosis, chronic obstructive pulmonary disease (COPD), glomerulonephritis, Graves disease, gastrointestinal allergies, conjunctivitis, atherosclerosis, coronary artery disease, angina, and small artery disease.
35. A method for inhibiting inflammatory cytokine production in a subject comprising administering to a subject in need thereof the pharmaceutical composition of any one of claims 1-30, or the lipid nanoparticle of any one of claims 31-32.
36. A kit comprising: the pharmaceutical composition of any one of claims 1-30, or the lipid nanoparticle of any one of claims 31-32, and instructions for use. -287- 4863-0924-7670.2
Citation Information
Patent Citations
Microrna molecules
US20050059005A1
Polycationic compositions for cellular delivery of polynucleotides
US20050222064A1
Oligomeric compounds and compositions for use in modulation small non-coding RNAs
US20050261218A1
Modification of RNA, Producing an Increased Transcript Stability and Translation Efficiency
US20100129877A1
Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression
US20100293625A1