Methods of treating inflammation related disorders

Abstract

Featured are methods of treating an inflammatory condition or disorder in a subject in need thereof. The methods involve administering to the subject a therapeutically effective amount of an agent that reduces expression of or inhibits an activity of Granzyme K (GZMK).

Description

[0001] METHODS OF TREATING INFLAMMATION RELATED DISORDERS

[0002] GOVERNMENT SUPPORT CLAUSE

[0003] This invention was made with government support under contract number 5R01 AI1 13046- 04, 5R01 AI1 13046- 09, and 5R01 AR073290- 05 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0004] CROSS REFERENCE TO RELATED APPLICATIONS

[0005] This application claims benefit of the filing dates of U.S. provisional application no. 63 / 561 ,124, filed March 4, 2024 and U.S. provisional application no. 63 / 749,451 , filed January 24, 2025, each of which is hereby incorporated by reference in its entirety.

[0006] BACKGROUND OF THE INVENTION

[0007] The complement system was first identified in the late 19thcentury as a heat-labile component of serum that complements the antimicrobial activity of antibodies. Since then, it has become clear that this ancient immune-surveillance system has additional functions that regulate innate and adaptive immunity and maintain tissue homeostasis. While the complement system plays a central role in many protective immune responses and homeostasis, excessive complement activation triggers and / or sustains tissue damage in many diseases. However, for many of these diseases, the specific pathways that drive complement activation remain unclear. Accordingly, there remains a need for exploring the unidentified mechanisms and pathways of complement activation.

[0008] SUMMARY OF THE INVENTION

[0009] The disclosure is directed towards the use of inhibition of an activity of granzyme K (GZMK) or a decrease in GZMK expression in treatment of inflammation related disorders and regulation of complement activation.

[0010] In one aspect, the disclosure features a method of treating an inflammatory condition or disorder in a subject in need thereof. This method includes administering to the subject a therapeutically effective amount of an agent that reduces expression of or inhibits an activity of GZMK.

[0011] In some embodiments, the agent is a full-length antibody (e.g., a monoclonal antibody) or functional fragment thereof, a small molecule, or an inhibitory RNA molecule. In some embodiments, the antibody is clone GM26E7, clone GM6C3, clone GM-24C3, clone EPR24601 -178, or clone EPR24601 - 14.

[0012] In some embodiments, the inhibitory RNA molecule is a small interfering RNA (siRNA), an antisense oligonucleotide, a short hairpin RNA, a double-stranded RNA, or a microRNA.

[0013] In a particular embodiment, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 15-30 or 15-25 (e.g., 15, 19, 21 , or 25) nucleotides set forth within the sequence of SEQ ID NO: 1 .

[0014] In some embodiments, the siRNA contains 3’ overhangs and / or comprises a non-natural or modified nucleoside or nucleotide. In some embodiments, the siRNA comprises the sequence

[0015] CAACCTTGTCCCGCCTCATACAAAT (SEQ ID NO: 2), CCGCCTCATACAAATTAAGTTACAA (SEQ ID NO: 3), CAGGTTAGAGTTGGGTGTAAGTAAA (SEQ ID NO: 4), CAAAGGGCAATAAGGTCACTGAATA (SEQ ID NO: 5), or CCACCTTCAACTAGGTGTAACTTCT (SEQ ID NO: 6).

[0016] In some embodiments, the small molecule is Compound A

[0017] (FPR-CMK);

[0018] Glu-Gly-Arg-chloromethyl ketone (EGR-CMK);

[0019] D-Phe-Pro-Lys-chloromethyl ketone;

[0020] Phenylmethylsulfonyl fluoride (PMSF); or

[0021] 4-(2-Aminoethyl)-benzolsulfonylfluorid-hydrochloride.

[0022] In some embodiments, the agent inhibits GZMK gene expression and / or inhibits an activity of GZMK.

[0023] In some embodiments, the activity is inhibiting binding to a complement pathway component or inhibiting a proteolytic activity.

[0024] In some embodiments, the agent is a cytokine or a modulatory factor that alters GZMK expression in a myeloid cell or a lymphocyte.

[0025] In another aspect, the disclosure features another method of treating an inflammatory condition or disorder in a subject in need thereof. This method comprises reducing the number of cells expressing GZMK in the subject or reducing the production of GZMK in a cell in the subject.

[0026] In some embodiments, the cell is a myeloid cell. In some embodiments, the cell is a lymphocyte (e.g., a CD8+T cell, a CD4+T cell, a natural killer (NK) T cell, a NK cell, a mucosal-associated invariant T (MAIT) cell, an innate-like lymphocyte, or a yb T cell).

[0027] In some embodiments, the reducing comprises targeting a surface marker on the cell (e.g., Signal Regulatory Protein Gamma (SIRPG) or a chemokine receptor).

[0028] In some embodiments, migration of the cell is inhibited by targeting a chemokine receptor or an integrin. In some embodiments, the chemokine receptor is chemokine receptor 2 (CCR2), CCR5, CXCR3, or CX3CR1 . In some embodiments, the surface markers expressed by the cell comprise CCR2, CCR5, and CXCR3.

[0029] In some embodiments, the inflammatory condition or disorder is an autoimmune condition or disorder.

[0030] In some embodiments, the inflammatory condition or disorder is associated with a viral infection.

[0031] In some embodiments, the viral infection is acute (e.g., a coronavirus infection, e.g., a SARS- CoV-2 infection).

[0032] In some embodiments, the viral infection is chronic (e.g., a hepatitis B virus infection, a hepatitis C virus infection, an Epstein Barr virus infection, a cytomegalovirus infection, or a human immunodeficiency virus infection.

[0033] In some embodiments, the inflammatory condition or disorder is rejection of a transplanted organ, atherosclerosis, type 1 diabetes, type 2 diabetes, acute respiratory distress syndrome, osteoarthritis, cancer, a neurodegenerative disorder, a fibrosing disorder, a cardiovascular disease, an age-related disease, psoriatic arthritis, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, inflammatory arthritis, COVID-19, psoriasis, ulcerative colitis, Crohn’s disease, Sjogren’s syndrome, multiple sclerosis, glomerulonephritis, inflammatory bowel disease, psoriasis, and psoriasiform dermatitis.

[0034] In one embodiment, the neurodegenerative disorder is Alzheimer’s disease. In another embodiment, the fibrosing disorder is interstitial lung disease. In one embodiment, the acute respiratory distress syndrome is due to a viral infection.

[0035] In some embodiments, the inflammatory condition or disorder results in the accumulation of GZMK positive cells in a tissue.

[0036] In some embodiments, the inflammatory condition or disorder results from aberrant activation of a complement pathway cascade.

[0037] In another aspect, the disclosure features another method of treating an inflammatory condition or disorder in a subject in need thereof. This method comprises reducing the binding of GZMK to the surface of a cell in the subject.

[0038] BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0040] Fig. 1 shows that Granzyme K (GZMK) is expressed by CD8+T cells, NK cells and innate- like T cells in blood and tissues, a, Representative flow cytometry plots showing intracellular GZMK and Granzyme B (GZMB) staining of the indicated T cell or natural killer (NK) cell subset in healthy peripheral blood, b, Frequency of GZMK expression by the indicated T cell or NK cell subset in peripheral blood from healthy controls, c, Among all GZMK+ lymphocytes in blood, percentage belonging to each T cell or NK cell subset. In panels b and c, n = 10 for CD4+T cells; n = 15 for all other populations, d, e, Representative flow plots and aggregate data showing expression of GZMK protein, as measured by intracellular flow cytometry of unstimulated CD4+or CD8+T cells from synovial tissue collected from patients with RA (n = 10). f, Representative image showing immunofluorescent staining of RA synovial tissue is shown. Arrowheads indicate examples of GZMK+ T cells. Data are representative of at least three independent experiments, g, Uniform Manifold Approximation and Projection (UMAP) plots displaying single-cell RNA-seq profiles from 94,056 T cells and 8,497 NK cells from synovial tissue from patients with RA (n = 70) or OA (n = 9) shaded by expression of the indicated protein marker or gene transcript, h, UMAP plot of Louvain clustering of 85,522 integrated single-cell RNA-seq profiles from T cells and NK cells from healthy or diseased tissues from RA synovium, Crohn’s disease (CD) ileum, ulcerative colitis colon, lupus nephritis (SLE) kidney, and COVID-19 BALF. Expression patterns of selected genes are shown for the integrative dataset in UMAP space, i, Percentage of cells in CD4+T cell clusters (gray columns) or CD8+T cell clusters (blue columns) with detectable GZMK gene expression, stratified by tissue and disease source, (b, c ,e) Data are mean ± standard deviation (s.d.).

[0041] Fig. 2 shows that GZMK cleaves the complement components C4 and C2 to generate a C3 convertase that cleaves C3 into C3a and C3b. a, Bulk CD8+T cells were MACS sorted from peripheral blood of two donors and either left unstimulated or stimulated with anti-CD3 / CD28 dynabeads for 6, 24, or 48 hours. Precipitated supernatants and lysates were analyzed by immunoblot using antibodies against GZMK and GZMB. b, Increasing concentrations of active GZMK or Granzyme A (GZMA) were incubated with serum-purified C4 for 4 hours and cleavage products were analyzed by immunoblot. Active C1s was used as a positive control for C4 cleavage into C4b. Purified C4b was used to confirm the size of the C4b fragment generated by C1 s and GZMK. c, Active GZMK was incubated with C2 for 4 hours in the presence or absence of increasing concentrations of C4 and cleavage products were analyzed by immunoblot. Active C1s was used as a positive control for C2 cleavage into C2b. d, e, Increasing concentrations of active GZMK or GZMA were incubated with C2 + C3 + C4 and cleavage products were analyzed by immunoblot. Active C1s was used as a positive control for generation of a C3 convertase that cleaves C3 into (d) C3a and (e) C3b. Serum-purified C3a and C3b were used to confirm the identity of the fragments generated by C1 s and GZMK, while purified iC3b was used to determine whether GZMK generates inactive C3b. Schematic representation of the assays are shown for b-e. Data are representative of at least four independent experiments.

[0042] Fig. 3 shows that synovial fibroblasts are major producers of tissue-derived complement proteins that are substrates for GZMK. a, Expression of complement C2, C3, C4A and C4B in T cells, B cells, monocytes and fibroblasts sorted from disaggregated synovial tissue from patients with rheumatoid arthritis (RA) (N = 33) or osteoarthritis (N = 12), measured by low-input RNA-seq using data from the AMP RA / SLE network46. Data are mean ± s.d. b, Representative image showing immunoflourescence staining of RA synovial tissue stained with antibodies against complement C3 / C3d (yellow) and PDPN (magenta) and Hoechst nuclear stain (blue). Scale bar is 40 microns, c, Synovial fibroblasts were left untreated or stimulated with interferon gamma (IFNG) or tumor necrosis factor (TNF) for 24 hours and the supernatants were precipitated and immunoblotted against C2, C3 or C4. Serum- purified C2, C3, C3b, C4 and C4b were run as controls to identify the proper bands, d, Synovial fibroblasts were left untreated or stimulated with IFNG, TNF, or IFNG + TNF for 24 hours and supernatants were assayed for the presence of C2, C3, or C4 by ELISA. Data are mean ± s.d of three technical replicates, e, Synovial fibroblasts were stimulated for 24 hours with IFNG + TNF after which the cell-free supernatants were left untreated or were incubated with C1s, GZMK or GZMA and cleavage products were analyzed by immunoblot for generation of C3a and C3b. Serum-purified C3a and C3b were used to confirm the identity of the fragments generated by C1s and GZMK. (b-e) Data are representative of at least three independent experiments. Schematic representation of the assay is shown for e.

[0043] Fig. 4 shows that GZMK activates the entire complement cascade, a, Degranulation of LAD2 mast cells was assessed by flow cytometry as measured by surface LAMP-1 staining, b, GZMK surface binding was measured by flow cytometry on human umbilical vein endothelial cells (HUVECs), synovial fibroblasts or THP-1 monocytes, c, Surface C3b deposition on HUVECs as measured by flow cytometry. Normal human serum (NHS) was used as a positive control, d, GZMK surface binding (left) and C3b deposition (right) on HUVECs as assessed by flow cytometry, e, GZMK either pre-bound to the surface of HUVECs or in solution without HUVECs was incubated with C2 + C3 + C4 and the supernatants were analyzed by immunoblot for generation of C4a, C2a and C3a. f, C5a generation was assessed by ELISA in the supernatants of HUVECs incubated with GZMK and C2 + C3 + C4 + C5. g, Calcium flux was assessed by flow cytometric analysis of Fluo-5f-labeled C5aR1 -expressing Chem-1 cells incubated with supernatants generated in (f). h, Terminal complement complex (TCC) formation was assessed by flow cytometric analysis of HUVECs incubated with GZMK + C2 - C9. C5b,6-9 was used as a positive control. Histograms depict representative data, i, Surface deposition of C3b (left) and C4d (middle), and TCC formation (right) on HUVECs after incubation with C1q-depleted serum and increasing concentrations of GZMK, as measured by flow cytometry. Data in a-i are representative of at least 3 independent experiments. Rvalues were calculated using (c, f-i) one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons tests or (d) a two-way ANOVA with Sidak’s multiple comparisons tests. NS = not significant. Data are mean ± s.d. of (c, d , f, h) three or (i) five independent experiments or (g) three technical replicates from a representative of three independent experiments, (b) Data are representative of three independent experiments.

[0044] Fig. 5 shows that GZMK drives complement activation and inflammatory disease in mouse models of arthritis and psoriasis, a, Representative image showing immunofluorescence staining of RA synovial tissue against C3d (yellow, top composite), C5a (yellow, bottom composite) and GZMK (red) as well as Hoechst nuclear stain (blue). Scale bar represents 50 pm. b, GzmK1- mice have less swelling in mBSA-treated wrists, c, Quantification of C3d and C4d deposition in wrist synovium at day 3. Graphs show regions of interest from 3 mice per genotype. Dashed lines represent the median and dotted lines represent the 25th and 75th quartiles, d, Representative H&E and immunofluorescence images of Gzmk+,+(top) and Gzmk-'- (bottom) against C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) at day 3 synovium. Scale bar represents 50 pm. e-f, Gzmk-'- mice have (e) less severe psoriasiform dermatitis, (f) erythema, scaling and thickness compared to Gzmk+,+animals, g, Quantification of C3d and C4d deposition in the dermis at day 5 of imiquimod (IMQ) treatment. Graphs shown are based on regions of interest from 3 mice per genotype. Dashed lines represent the median and dotted lines represent the 25th and 75th quartiles, h, Representative hematoxylin and eosin (H&E) and immunofluorescence images of Gzmk (top) and Gzmk1- (bottom) against C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) at day 5 of IMQ treatment. Scale bar represents 50 pm. (a) Data are representative of 3 independent experiments, (b, e, f) Data are mean ± s.e.m (standard error of the mean) of 6 mice per genotype and are representative of two independent experiments, (d, h) Data are representative of 3 mice per genotype, p values were calculated by (b) area under the curve analysis, (c, g) two-tailed t-test with Welch’s correction and (e, f) multiple two-sided t-tests with false discovery rate of 5% using the method of Benjamini, Krieger and Yekutieli. NS = not significant.

[0045] Fig. 6 shows that GZMK is expressed by CD8+T cells in many different inflamed and noninflamed tissues, a, Expression of T cell subset markers CCR7 and CD45RA by GZMK+ CD4+and CD8+T cells, respectively. Data are mean ± s.d. b, Expression of selected markers in UMAP space for the integrative dataset presented in Fig. 1g. c, Contribution of each of the six publicly available single-cell RNA-seq datasets to the integrated dataset of CD4+, CD8+, and NK cell profiles, d, Expression levels of selected genes by cell profiles the integrative dataset in UMAP space, e, Percentage of cells in all CD4+T cell clusters (gray columns) or all CD8+T cell clusters (blue columns) with detectable GZMB gene expression, stratified by tissue and disease source, f, Aggregate data showing frequency of intracellular GZMK and GZMB staining among purified primary human CD8+T cells cultured either in media alone (unstimulated) or with anti-CD3 / CD28 antibody-coated beads for four days. Data in f show mean ± s.d. of four donors from a representative out of four independent experiments.

[0046] Fig. 7 shows that GZMK is highly homologous to complement factor D, C1s, and MASP1 but does not cleave factor B. a, Results of a protein blast comparing the protein sequence of GZMK to all human protein sequences, b, d, e, Structural alignments showing the structural similarity between GZMK (cyan) and (b) complement factor D (CFD) (gray), (d) C1s (yellow, catalytic domain) and (e) Mannan-binding lectin serine protease 1 (MASP1 ) (green, catalytic domain). Alignments on the bottom show a close up of the catalytic triad residues in the active site of GZMK, CFD, C1s and MASP1 . The catalytic residues in GZMK (H67, D116, S214) are labeled, while the corresponding catalytic triad residues in CFD (H66, D14, S208), C1s (H475, D529, S632) and MASP1 (H490, D552, S646) are shown but not labeled. Note that the catalytic serine in the structures of GZMK and CFD is mutated to alanine, c, Serum-purified complement factor B (CFB) was incubated with either CFD or increasing concentrations of GZMK in the presence or absence of C3b and cleavage products were analyzed by immunoblot. Serum- purified Bb was used as a control to identify cleavage of CFB into Bb. (c) Data are representative of three independent experiments.

[0047] Fig. 8 shows that GZMK cleaves C4 and C2 into C4b and C2b but does not directly cleave C3. a, Densitometric analysis of the immunoblot shown in Fig. 2b depicts a dose-dependent increase in the cleavage of C4 into C4b as more GZMK is incubated with C4. b, Densitometric analysis of the immunoblot shown in Fig. 2c depicts a dose-dependent increase in the cleavage of C2 into C2b as more C4 is incubated with GZMK and C2. c, d, Densitometric analysis of the immunoblots shown in Fig. 2d and Fig. 2e showing a dose-dependent increase in the generation of (c) C3a and (d) C3b as more GZMK is incubated with C2 + C3 + C4. e, Serum-purified C3 was incubated with increasing concentrations of GZMK and cleavage products were assessed by immunoblot. As a positive control for C3 cleavage, C3 was incubated with C3b + CFB + CFD in the presence of increasing concentrations of properdin. Serum- purified C3b was used to confirm the presence of the C3b cleaved fragment, (a-e) Data are representative of at least three independent experiments.

[0048] Fig. 9 shows that GZMK binds plasma membranes to trigger formation of membranebound C3 convertases. a, HUVEC cells, synovial fibroblasts and THP-1 monocytes were left untreated or were treated with an isotype control or a cell-type specific sensitizing antibody (anti-HLA-A,B,C for fibroblasts, anti-CD31 for HUVEC and THP-1 cells). Cells were then incubated with either C1s or the C1 complex and surface C1s was measured by flow cytometry, b, HUVEC cells were incubated for 4 hours with serum-purified C2 + C3 + C4 alone or in combination with GZMK or GZMA, and C3b deposition was measured by flow cytometry. Histograms depict representative data. Aggregate data is shown in Fig. 4c. c, Association plots of the geometric mean fluorescence intensity of surface staining of anti-heparan sulfate and anti-granzyme K antibodies from three HUVEC donors and cell subsets from four PBMC donors. Graph on the right shows PBMC cell subsets only. Statistics by Spearman correlation, d, Histograms of anti-heparan sulfate (left) and anti-granzyme K (right) antibody binding to the surfaces of unfixed, live cells of the indicated subset from a representative donor. Gray histograms depict cells in media; red histograms depict cells incubated with exogenous recombinant GZMK. e, HUVEC cells were incubated for 4 hours with serum-purified C2 + C3 + C4 alone or in combination with GZMK in the presence or absence of heparin and surface-bound GZMK and C3b were measured by flow cytometry. Aggregate data is shown in Fig. 4d. f, Densitometric analysis of the immunoblots shown in Fig. 4e depicting that GZMK is more efficient at cleaving C4, C2 and eliciting the generation of C3a when it is bound to membranes than when it is in the fluid phase, (a, b, e, f) Data are representative of at least three independent experiments.

[0049] Fig. 10 shows that GZMK triggers formation of C5 convertases that generate bioactive C5a and the terminal complement complex (TCC). a, C5aR1 -expressing Chem-1 reporter cells labeled with Fluo-5F were incubated with C5, C5a or the supernatants obtained after incubating HUVEC cells with C2 + C3 + C4 + C5 with or without GZMA or GZMK. Calcium flux was immediately assessed by flow cytometry. Aggregate data is shown in Fig. 4g. b, HUVEC cells were incubated with serum-purified C2 + C3 + C4 + C5 + C6 + C7 + C8 + C9 with increasing amounts of GZMK or GZMA in the presence of dynasore to inhibit endocytosis. C5b,6-9 was used as the positive control. Terminal complement complex formation (TCC) was then measured by flow cytometry. Data are mean ± s.d of three independent experiments. Rvalues were calculated using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons tests. NS = not significant, c, Surface deposition of C3b (left), C4d (middle) and TCC formation (right) on HUVEC cells after incubation with C1q-depleted serum and increasing concentrations of GZMK, as measured by flow cytometry. NHS was used as a positive control. Histograms depict representative data. Aggregate data is shown in Fig. 4i. All data are representative of at least three independent experiments.

[0050] Fig. 11 shows that in RA synovial tissue, complement activation products are abundant in areas rich in GZMK. a, Representative image showing immunofluorescence staining of RA synovial tissue with antibodies against C3d (clone C3D / 2891 , yellow in top composite), C5a (clone 2952, yellow in bottom composite), and GZMK (red) as well as Hoechst nuclear stain (blue). The area inside the dashed box is shown enlarged in Fig. 5. Scale bar is 50 microns, b, Representative image showing immunofluorescence staining of RA synovial tissue with antibodies against GZMK (red) and C3d (clone 7C10, yellow) as well as Hoechst nuclear stain (blue). Scale bar is 50 microns, c, Enlarged view of area inside box in panel a. Scale bar is 25 microns, d, Representative image showing immunofluorescence staining of RA synovial tissue with antibodies against GZMK (red) and C5a (clone 2942, yellow) as well as Hoechst nuclear stain (blue). Scale bar is 50 microns, e, Enlarged view of area inside box in panel a. Scale bar is 25 microns. All images in this panel are tiled images collected on a confocal microscope. Data are representative of (a-c) three and (d, e) two independent experiments.

[0051] Fig. 12 shows that Gzmfc-deficient mice have reduced swelling and complement activation in the wrists following induction of arthritis, a, Littermate Gzmk+ / - animals have less severe wrist swelling following treatment with methylated bovine serum albumin (mBSA) than Gzmk1- animals, b, Representative entire wrist joint H&E and immunofluorescence images with antibody staining for C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) of Gzmk+I+(top) or Gzmk1- (bottom) wrist synovium at day 3 post intra-articular mBSA injection. White and yellow boxes depict enlarged images shown in (Fig. 5d). ROIs (regions of interest) for quantification of C3d and C4d were made by outlining synovium and surrounding inflammation on the Hoechst channel and overlaying a grid before being applied to corresponding C3d and C4d channels. Scale bar represents 500um. (a) Data are mean ± of 7 mice per genotype and are representative of 3 independent experiments with significance calculated by area under the curve analysis, (b) Data are representative of 3 mice per genotype.

[0052] Fig. 13 shows that Gzmk-deficient mice have reduced swelling and complement activation in the knees following induction of arthritis, a, Gzmk+I+mice have more severe swelling in mBSA- treated knees than Gzmk'- mice, b, Quantification of C3d and C4d deposition in knee synovium at day 3 post intra-articular mBSA injection, c, Representative enlarged H&E and immunofluorescence images with antibody staining for C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) of Gzm (top) or Gzmk-1- (bottom) knee synovium at day 3 post intra-articular mBSA injection. Scale bar represents 50um. d, Representative entire knee joint H&E and immunofluorescence images with antibody staining for C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) of Gzmk+I+(top) or Gzmk1- (bottom) knee synovium at day 3 post intra-articular mBSA injection. White and yellow boxes depict enlarged images shown in (c). ROIs for quantification of C3d and C4d were made by outlining synovium and surrounding inflammation on the Hoechst channel and overlaying a grid before being applied to corresponding C3d and C4d channels. Scale bar represents 500pm. (a) Data are mean ± s.e.m of 6 mice per genotype and are representative of two independent experiments. Significance was calculated using area under the curve analysis, (b) Data are the combination of 3 mice per genotype, with the dashed line depicting the median and dotted lines representing the 25th and 75th quartiles. Significance was calculated using a two-way t test with Welch’s correction, (c, d) Data are representative of 3 mice per genotype, ns = not significant.

[0053] Fig. 14 shows that Gzmk-deficient mice are protected from IMQ-induced dermatitis and complement activation, a, Littermate IMQ-treated Gzmk1- mice have less severe total clinical scores, erythema, scaling, and thickness scores, and decreased thickening of back skin as measured by caliper compared to IMQ-treated Gzmk- mice, b, Representative skin H&E and immunofluorescence images with antibody staining for C3d (magenta), C4d (yellow) and Hoechst nuclear stain (blue) of Gzmk+,+(top) or Gzmk'- (bottom) after 5 daily applications of IMQ. White and yellow boxes represent enlarged images shown in Fig. 5h. ROIs for quantification of C3d and C4d were made by outlining the skin, overlaying a grid, and selecting squares that contained dermal-epidermal junction based on the Hoechst channel before being applied to corresponding C3d and C4d channels. Scale bars represent 500pm. (a) Data shown are mean ± s.e.m. and are representative of 4 independent experiments. Significance was calculated by multiple two-tailed t-tests with a false discovery rate of 5% using the method of Benjamini, Krieger and Yekutiel. (b) Data are representative of 3 mice per genotype.

[0054] Fig. 15 shows that GZMK activates the entire complement cascade, a, A schematic of a nonlimiting model of GZMK-mediated complement activation. CD8+T cells constitutively release GZMK in the absence of TCR stimulation. GZMK binds plasma membranes through interactions with heparan sulfate glycosaminoglycans, where it cleaves C4 and C2 to produce C4b and C2b. Due to its close proximity to the membrane, newly-cleaved C4b molecules can covalently bind membranes through their exposed thioester, associate with C2b, and form membrane-bound C3 convertases. These C3 convertases can cleave C3 into C3a and C3b. Nascent C3b molecules can opsonize target cells or associate with membrane-bound C3 convertases to form C5 convertases that can cleave C5 into C5a and C5b. C5b molecules associate with C6, C7, C8 and C9 to form a terminal complement complex (TCC). b, Comparison between the alternative, classical, lectin and GZMK-mediated complement activation pathways. Activation of the classical and lectin pathways unfolds in three major steps: recognition, initiation and execution. Soluble pattern recognition receptors like C1 q and mannose-binding lectin spearhead this process by recognizing danger signals on a surface. This recognition triggers the activation of initiator proteases. Including C1 s and MASP1 , that cleave C4 and C2, enabling assembly of C3 and C5 convertases. These convertases act as the executioners of the pathway, cleaving C3 and C5 to generate all the effector molecules of the complement cascade. In contrast to the initiator proteases of the classical and lectin pathways, GZMK independently mediates the recognition and initiation phases. GZMK can direct complement activation to surfaces independently of soluble pattern recognition receptors due to its intrinsic ability to bind heparan sulfate glycosaminoglycans (HSGAGs). Like C1 s and MASP1 / 2, GZMK acts as an initiator protease that cleaves C4 and C2 into C4b and C2b, generating C3 and C5 convertases that generate the effector molecules of the cascade. Additionally, this process enables recruitment of the alternative pathway for amplification of the cascade.

[0055] Fig. 16 shows that GZMK-specific monoclonal antibodies block GZMK-mediated C3b opsonization. HUVEC cells were incubated with complement C2 + C3 + C4 in the presence of recombinant GZMK and either an isotype control antibody or monoclonal antibodies that bind GZMK. Percent of C3b-opsonized HUVECs was assessed by flow cytometry.

[0056] Fig. 17 shows that the majority of GZMK+ T cells express SIRPG on their surface. Healthy peripheral blood mononuclear cells (PBMCs, top row) and inflamed synovial fluid mononuclear cells (bottom row) were analyzed by flow cytometry. The CD8+T cells are shown. It is shown that the majority of GZMK-expressing CD8+T cells express SIRPG (third column, c).

[0057] DEFINITIONS

[0058] As used herein, the term "antibody" includes an immunoglobulin having a combination of two heavy and two light chains which have significant specific immuno-reactive activity to an antigen of interest. Antibodies comprise light and heavy chains, with or without an interchain covalent linkage between them. An antigen-binding fragment of an antibody includes peptide fragments that exhibit specific immuno-reactive activity to the same antigen as the antibody. Examples of antigen-binding fragments include: a Fab fragment; a F(ab’)2 fragment; an Fd fragment; or an Fv fragment. Fragments can be obtained, for example, by chemical or enzymatic treatment of an intact or complete antibody or antibody chain, or by recombinant means. In some embodiments, the antibody is a full-length antibody or a functional fragment of a full-length antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is clone GM26E7, clone GM6C3, clone GM-24C3, clone EPR24601 -178, or clone EPR24601 -14.

[0059] As used herein, the term “inhibitory nucleic acid molecule” refers to a nucleic acid molecule that has sufficient complementarity to bind to a target nucleic acid molecule to inhibit expression of protein encoded by the target nucleic acid molecule. Exemplary inhibitory nucleic acid molecules are anti-sense oligonucleotides (ASOs), small interfering RNA (siRNAs), short hairpin RNA (shRNAs), double stranded RNAs (dsRNAs), and microRNA (miRNAs). Inhibitory nucleic acid molecules may reduce target protein expression by 10% or more (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99% or more).

[0060] As used herein “modified” refers to a changed state or structure of a nucleic acid molecule described herein. Molecules may be modified in many ways including chemically, structurally, and functionally.

[0061] As used herein, “myeloid cells” refer to bone marrow cells which can give rise to red blood cells, white blood cells, and platelets. They include macrophages, monocytes, dendritic cells, granulocytes, and mast cells. Myeloid cells form a significant part of the immune system and are involved in tissue repair, tissue homeostasis, inflammation, wound healing, phagocytosis, and pathogen defense.

[0062] DETAILED DESCRIPTION

[0063] The disclosure is directed towards the use of inhibitors of GZMK activity or expression in the treatment of inflammation related disorders and regulation of complement activation.

[0064] Granzymes are a family of serine proteases mainly expressed by CD8+T cells, natural killer cells, and innate-like lymphocytes1. The data described herein show that GZMK can activate the complement cascade by cleaving C2 and C4. The nascent C4b and C2b fragments form a C3 convertase that cleaves C3, enabling assembly of a C5 convertase that cleaves C5. The resulting convertases generate all the effector molecules of the complement cascade: the anaphylatoxins C3a and C5a, the opsonins C4b and C3b, and the membrane attack complex. In rheumatoid arthritis (RA) synovium, GZMK is enriched in regions with abundant complement activation, and fibroblasts are the major producers of complement proteins that serve as substrates for GZMK-mediated complement activation. Further, Gzmk-deficient mice have less severe arthritis and dermatitis with concomitant decreases in complement activation. These findings support the discovery of a previously unidentified mechanism of complement activation that is entirely driven by lymphocyte-derived GZMK.

[0065] In some embodiments, the inflammatory condition or disorder is an autoimmune condition or disorder.

[0066] In some embodiments, the inflammatory condition or disorder is rejection of a transplanted organ, atherosclerosis, type 1 diabetes, type 2 diabetes, acute respiratory distress syndrome, osteoarthritis, cancer, a neurodegenerative disorder, a fibrosing disorder, a cardiovascular disease, an age-related disease, an autoimmune disease, arthritis, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, inflammatory arthritis, COVID-19, psoriasis, ulcerative colitis, Crohn’s disease, Sjogren’s syndrome, multiple sclerosis, psoriasiform dermatitis, psoriatic arthritis, lupus, glomerulonephritis, and inflammatory bowel disease. In some embodiments, the neurodegenerative disorder is Alzheimer’s disease. In some embodiments, the fibrosing disorder is interstitial lung disease. In some embodiments, the acute respiratory distress syndrome is due to a viral infection.

[0067] In some embodiments, the inflammatory condition or disorder is associated with a viral infection. In some embodiments, the viral infection is acute. In some embodiments, the viral infection is a coronavirus infection. In some embodiments, the coronavirus infection is a SARS-CoV-2 infection. In some embodiments, the viral infection is chronic. In some embodiments, the viral infection is a hepatitis B virus infection, a hepatitis C virus infection, an Epstein Barr virus infection, a cytomegalovirus infection, or a human immunodeficiency virus infection.

[0068] The complement system was first identified in the late 19thcentury as a heat-labile component of serum that “complements” the antimicrobial activity of antibodies. Since then, it has become clear that this ancient immune-surveillance system has additional functions that regulate innate and adaptive immunity and maintain tissue homeostasis3. To exert its broad, multifaceted roles, the complement system has evolved three major mechanisms of activation - the classical, lectin, and alternative pathways. While each pathway is activated by different triggers, all three proteolytic cascades converge to generate the same effector molecules: the anaphylatoxins C3a and C5a, which trigger a range of pro-inflammatory and chemotactic responses; the opsonins C4b and C3b, which label targets for clearance by phagocytosis and enhance B cell activation; and the C5b-9 membrane attack complex (MAC), which lyses target cells. These pathways are triggered into action by soluble pattern recognition receptors that survey the environment for foreign and host-derived danger signals. Upon recognition of these signals, these recognition molecules trigger the activation of distinct initiator proteases that unleash the complement cascade. While the complement system plays a central role in many protective immune responses and homeostasis, excessive complement activation triggers and / or sustains tissue damage in many age- related, inflammatory, and autoimmune diseases, such as rheumatoid arthritis (RA)4’5. However, for many of these diseases, the specific pathways that drive complement activation remain unclear.

[0069] Recently, the inventors discovered that CD8+T cells expressing high levels of granzyme K (GZMK) are the predominant subset of CD8+T cells in many inflamed tissues, including RA synovium, ulcerative colitis and Crohn’s disease gut, and others. GZMK is also expressed by other lymphocytes predominantly found in tissues, including CD56brightnatural killer (NK) cells, yb T cells, mucosal- associated invariant T (MAIT) cells, and invariant natural killer T cells (iNKT) cells26.

[0070] Granzymes are serine proteases stored within the secretory granules of cytotoxic lymphocytes1. While the roles of GZMA and GZMB have been well characterized, much less is known about the functions of other granzymes. The present disclosure shows that GZMK is an initiator protease that independently activates the entire complement cascade. By cleaving C4 and C2 into C4b and C2b, GZMK triggers formation of C3 and C5 convertases that cleave C3 and C5. Together, the active convertases generate the anaphylatoxins C3a and C5a, the opsonins C4b and C3b, and the MAC or terminal complement complex (TCC). By analyzing human RA synovium and mouse models of inflammatory arthritis and psoriasiform dermatitis, the present inventors demonstrate that GZMK- mediated complement activation occurs in vivo and contributes to disease pathogenesis.

[0071] In one aspect, the disclosure features a method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent that reduces expression of or inhibits an activity of Granzyme K (GZMK). In some embodiments, the agent is a full-length antibody or functional fragment thereof, a small molecule, or an inhibitory RNA molecule. Each of these modalities is described further below.

[0072] Antibodies Inhibiting GZMK

[0073] In some embodiments, the agent that reduces expression of or inhibits an activity of GZMK is a full-length antibody or functional fragment of a full-length antibody.

[0074] In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is clone GM26E7, clone GM6C3, clone GM-24C3, clone EPR24601 -178, or clone EPR24601 - 14. Exemplary anti-Granzyme K antibodies of the disclosure as follows:

[0075] Anti-hGZMK mAb, clone GM26E7, mouse IgG 1 (Biolegend catalog # 37052)

[0076] Anti-hGZMK mAb, clone GM6C3, mouse lgG2b (SantaCruz catalog # sc56125)

[0077] Anti-hGZMK mAb, clone GM-24C3, mouse lgG2b (Abeam catalog # AB3771 )

[0078] Anti-hGZMK mAb, clone EPR24601 -178, rabbit IgG (Abeam catalog # AB313710)

[0079] Anti-hGZMK mAb, clone EPR24601 -14, rabbit IgG (Abeam catalog # AB313711 )

[0080] Inhibitory Nucleic Acid Molecules Inhibiting GZMK

[0081] In some embodiments, the agent that reduces expression of or inhibits an activity of GZMK is an inhibitory RNA molecule.

[0082] In some embodiments, the inhibitory RNA molecule is a small interfering RNA (siRNA), an antisense oligonucleotide (ASO), a short hairpin RNA (shRNA), a double-stranded RNA (dsRNA), or a microRNA (miRNA). The inhibitory nucleic acid molecules (e.g., a siRNA, a dsRNA, an ASO, a miRNA, or a shRNA), or compositions thereof, described herein may be used in methods for reducing expression of GZMK.

[0083] Exemplary inhibitory nucleic acid molecules of the disclosure are siRNAs, dsRNAs, ASOs, miRNAs, and shRNAs; however, any nucleic acid molecule capable of reducing GZMK mRNA and / or protein expression is envisioned for use of the methods described herein. In some instances, the inhibitory nucleic acid molecules of the disclosure may be referred to as RNA inhibitory (RNAi) molecules.

[0084] In some embodiments, the inhibitory nucleic acid is an siRNA targeting GZMk. In some embodiments, the inhibitory nucleic acid is a dsRNA targeting GZMK. In some embodiments, the inhibitory nucleic acid is an ASO targeting GZMK. In some embodiments, the inhibitory nucleic acid is a miRNA targeting GZMK. In some embodiments, the inhibitory nucleic acid is a shRNA targeting GZMK. Each of these modalities is described further below. small interfering RNA (siRNA) siRNAs of the disclosure are single-stranded (ss) or double-stranded (ds) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once an siRNA molecule enters a cell, it is incorporated into an RNA-induced silencing complex (RISC). Upon siRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0085] In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 15-30 or 15-25 (e.g., 15, 19, 21 , 24, or 25) nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 15 nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 19 nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 21 nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 24 nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 25 nucleotides set forth within the sequence of SEQ ID NO: 1 . In some embodiments, the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 30 nucleotides set forth within the sequence of SEQ ID NO: 1 .

[0086] The GZMK mRNA comprises the sequence (NM_002104.3, Homo sapiens granzyme K (GZMK), mRNA):

[0087] AGAATCTTCTTCCTTCATCACAGGATCAACACATTTCATCTGGGCTTCTTAAATCTAAATCTTTAAAAT GACTAAGTTTTCTTCCTTTTCTCTGTTTTTCCTAATAGTTGGGGCTTATATGACTCATGTGTGTTTCAAT ATGGAAATTATTGGAGGGAAAGAAGTGTCACCTCATTCCAGGCCATTTATGGCCTCCATCCAGTATG GCGGACATCACGTTTGTGGAGGTGTTCTGATTGATCCACAGTGGGTGCTGACAGCAGCCCACTGCC AATATCGGTTTACCAAAGGCCAGTCTCCCACTGTGGTTTTAGGCGCACACTCTCTCTCAAAGAATGA GGCCTCCAAACAAACACTGGAGATCAAAAAATTTATACCATTCTCAAGAGTTACATCAGATCCTCAAT CAAATGATATCATGCTGGTTAAGCTTCAAACAGCCGCAAAACTCAATAAACATGTCAAGATGCTCCAC ATAAGATCCAAAACCTCTCTTAGATCTGGAACCAAATGCAAGGTTACTGGCTGGGGAGCCACCGATC CAGATTCATTAAGACCTTCTGACACCCTGCGAGAAGTCACTGTTACTGTCCTAAGTCGAAAACTTTGC AACAGCCAAAGTTACTACAACGGCGACCCTTTTATCACCAAAGACATGGTCTGTGCAGGAGATGCCA AAGGCCAGAAGGATTCCTGTAAGGGTGACTCAGGGGGCCCCTTGATCTGTAAAGGTGTCTTCCACG CTATAGTCTCTGGAGGTCATGAATGTGGTGTTGCCACAAAGCCTGGAATCTACACCCTGTTAACCAA GAAATACCAGACTTGGATCAAAAGCAACCTTGTCCCGCCTCATACAAATTAAGTTACAAATAATTTTAT TGGATGCACTTGCTTCTTTTTTCCTAATATGCTCGCAGGTTAGAGTTGGGTGTAAGTAAAGCAGAGCA CATATGGGGTCCATTTTTGCACTTGTAAGTCATTTTATTAAGGAATCAAGTTCTTTTTCACTTGTATCA CTGATGTATTTCTACCATGCTGGTTTTATTCTAAATAAAATTTAGAAGACTCTCTGTTTGTCTTTTATCA CATGAAGTAATATCTGCCCCCATTGCACCCACACTCGCCAAAGGGCAATAAGGTCACTGAATAAAAC AGTAATGGTACCACCTTCAACTAGGTGTAACTTCTGCTGGATCATCCTAAGTTGTTGGGTTGTTTTCT TTTCATTGTTGTGATAACATTGAACATGAGATAGGCCCTTGCAACAAATGTTTAAGGGTATGATACATT ATTGTTAACTATAGGCATGATCTTGCAGTGCAGATCTCTAGAACTGCTTCATCTCATATAAATGAAACT TTATGCCAGTTGAATAGCAGCTCTCTATTTCCCCACCACCCCCATCCTCTGGCAACCCCATTCTACTC TAAGCTTCTATGAGTTTGTATTTTTTAAATATAAATCATAAATATAAATATCCTAATTCAAGCAAGCAGC TTATACAAA (SEQ ID NO: 1 ).

[0088] In some embodiments, the siRNA contains 3’ overhangs. In some embodiments, the siRNAs described herein have 0-7 nucleotide 3’ overhangs or 0-4 nucleotide 5’ overhangs. In some embodiments, the siRNA molecule has a single uracil (e.g., U) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a double uracil (e.g., UU) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a single thymine (e.g., T) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a double thymine (e.g., TT) overhang at each 3’ end of the siRNA. In some embodiments, the siRNA molecule has a cytosine and thymine (e.g., CT) overhang at each 3’ end of the siRNA.

[0089] In some embodiments, the siRNA comprises or consists of the sequence CAACCTTGTCCCGCCTCATACAAAT (SEQ ID NO: 2), CCGCCTCATACAAATTAAGTTACAA (SEQ ID NO: 3), CAGGTTAGAGTTGGGTGTAAGTAAA (SEQ ID NO: 4), CAAAGGGCAATAAGGTCACTGAATA (SEQ ID NO: 5), or CCACCTTCAACTAGGTGTAACTTCT (SEQ ID NO: 6).

[0090] Double-stranded RNA (dsRNA) dsRNAs of the disclosure are ds nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Typically, dsRNAs are longer than an siRNA and are processed within a cell to form a siRNA molecule. The siRNA is then incorporated into an RNA-induced silencing complex (RISC). Upon siRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0091] The nucleotide sequence of a dsRNA of the disclosure may contain sufficient complementarity to a portion of a target gene of interest (e.g., Gzmk) such that the dsRNA can hybridize with the target gene of interest. In some embodiments, the dsRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. In some embodiments, the dsRNA is complementary to the target gene of interest (e.g., Gzmk), or a portion thereof.

[0092] Anti-Sense Oligonucleotide (ASO)

[0093] ASOs of the disclosure are single (ss) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Upon hybridization to a target mRNA, RNase H will degrade the mRNA by hydrolyzation, resulting in reduced mRNA and protein levels of the target.

[0094] The nucleotide sequence of the ASO may contain sufficient complementary to a portion of a target gene of interest (e.g., Gzmk) such that the ASO can hybridize with the target gene of interest. In some embodiments, the ASO is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. In some embodiments, the ASO is complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. micro RNA (miRNA) miRNAs of the disclosure are single stranded (ss) nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once a miRNA molecule enters a cell, it is incorporated into a RNA-induced silencing complex (RISC). Upon miRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0095] The nucleotide sequence of the miRNA may contain sufficient complementary to a portion of a target gene of interest (e.g., Gzmk) such that the miRNA can hybridize with the target gene of interest. In some embodiments, the miRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. In some embodiments, the miRNA is complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. short hairpin RNA (sh NA) shRNAs of the disclosure are ss or ds nucleic acid molecules made of DNA, RNA, or both DNA and RNA (e.g., a chimeric) that are complementary to a target gene of interest and prevent translation of the target’s mRNA into a protein. Once a shRNA molecule enters a cell, it is incorporated into a RNA- induced silencing complex (RISC). Upon shRNA hybridization to a target mRNA, the RISC complex will cleave the target mRNA, thereby inactivating the target mRNA, resulting in reduced mRNA and protein levels of the target.

[0096] The nucleotide sequence of the shRNA may contain sufficient complementary to a portion of a target gene of interest (e.g., Gzmk) such that the shRNA can hybridize with the target gene of interest. In some embodiments, the shRNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to the target gene of interest (e.g., Gzmk), or a portion thereof. In some embodiments, the shRNA is complementary to the target gene of interest (e.g., Gzmk), or a portion thereof.

[0097] Modifications to the Inhibitory Nucleic Acid Molecules

[0098] In some embodiments, the inhibitory nucleic acid molecule (e.g., an siRNA, shRNA, dsRNA, ASO, or miRNA) comprises a non-natural or modified nucleoside or nucleotide.

[0099] It is contemplated that any of the inhibitory nucleic acid molecules disclosed herein may be used in the methods disclosed herein in an unmodified or in a modified form. Unmodified inhibitory nucleic acid molecules contain nucleobases that include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid molecules are described in more detail below.

[0100] Modifications may be achieved by systematically adding or removing linked nucleosides to generate longer or shorter sequences.

[0101] Modifications may be achieved by incorporating, for example, one or more alternative nucleosides, alternative 2’ sugar moieties, and / or alternative internucleoside linkages, which are described further below. Typically, these types of modifications are introduced to optimize the molecule’s efficacy or biophysical properties (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, reduce immunogenicity, and / or targeting to a particular location or cell type).

[0102] Modification may further be achieved by covalently or non-covalently conjugating a moiety (e.g., a targeting moiety, a hydrophobic moiety, a cell penetrating peptide, or a polymer) to the 5’ end and / or 3’ end of the inhibitory nucleic acid molecule, as described in more detail below.

[0103] Nucleoside Modifications

[0104] Modification of the inhibitory nucleic acid molecules described herein include one or more of the following nucleoside modifications: 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F- adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and / or 3-deazaguanine and 3-deazaadenine. The inhibitory nucleic acid molecules may also include nucleobases in which the purine or pyrimidine base is replaced with other heterocycles, for example 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and / or 2-pyridone. Further modification of the inhibitory nucleic acid molecules described herein may include nucleobases disclosed in US 3,687,808; Kroschwitz, J. I., ed. The Concise Encyclopedia of Polymer Science and Engineering, New York, John Wiley & Sons, 1990, pp. 858-859; Englisch et al., Angewandte Chemie, International Edition 30:613, 1991 ; and Sanghvi, Y.S., Chapter 16, Antisense Research and Applications, CRC Press, Gait, M.J. ed., 1993, pp. 289-302.

[0105] Sugar Modifications

[0106] Modifications of the inhibitory nucleic acid molecules described herein may also include one or more of the following 2’ sugar modifications: 2’-O-methyl (2’-O-Me), 2'-methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE), 2'-dimethylaminooxyethoxy, i.e. , a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, and / or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylamino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2OCH2N(CH3)2. Other possible 2'-modifications that can modify the inhibitory nucleic acid molecules described herein include all possible orientations of OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O- alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Other potential sugar substituent groups include, e.g., aminopropoxy (- OCH2CH2CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-O-CH2-CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. In some embodiments, the 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the interfering RNA molecule, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0107] Internucleoside Linkage Modifications

[0108] Modifications of the inhibitory nucleic acid molecules described herein may include one or more of the following internucleoside modifications: phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.

[0109] Conjugates

[0110] Any of the inhibitory nucleic acid molecules described herein may be modified via the addition of an auxiliary moiety, e.g., a cell penetrating peptide (CPP), a polymer, a hydrophobic moiety, or a targeting moiety. The auxiliary moiety may be present as a 5’ terminal modification (e.g., covalently bonded to a 5’- terminal nucleoside), a 3’ terminal modification (e.g., covalently bonded to a 3’-terminal nucleoside), or an internucleoside linkage (e.g., covalently bonded to phosphate or phosphorothioate in an internucleoside linkage).

[0111] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51 ). Specific examples of CPPs are provided in WO2011157713, which is incorporated herein by reference in its entirety.

[0112] Inhibitory nucleic acid molecules of the disclosure may include covalently attached neutral polymer-based auxiliary moieties. Neutral polymers include poly(C1 -6 alkylene oxide), e.g., polyethylene glycol) and polypropylene glycol) and copolymers thereof, e.g., di- and triblock copolymers.

[0113] An inhibitory nucleic acid molecule containing a hydrophobic moiety may exhibit superior cellular uptake, as compared to an inhibitory nucleic acid molecule lacking the hydrophobic moiety. A hydrophobic moiety is a monovalent group (e.g., a bile acid (e.g., cholic acid, taurocholic acid, deoxycholic acid, oleyl lithocholic acid, or oleoyl cholenic acid), glycolipid, phospholipid, sphingolipid, isoprenoid, vitamin, saturated fatty acid, unsaturated fatty acid, fatty acid ester, triglyceride, pyrene, porphyrine, texaphyrine, adamantine, acridine, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butydimethylsilyl, t-butyldiphenylsilyl, cyanine dye (e.g., Cy3 or Cy5), Hoechst 33258 dye, psoralen, or ibuprofen) covalently linked to the nucleic acid backbone (e.g., 5’- terminus) of the inhibitory nucleic acid molecule.

[0114] A targeting moiety is selected based on its ability to target oligonucleotides of the invention to a desired or selected cell population that expresses the corresponding binding partner (e.g., either the corresponding receptor or ligand) for the selected targeting moiety. For example, an oligonucleotide of the invention could be targeted to hepatocytes expressing asialoglycoprotein receptor (ASGP-R) by selecting a targeting moiety containing N-acetylgalactosamine (GalNAc). A targeting moiety may include one or more ligands (e.g., 1 to 9 ligands, 1 to 6 ligands, 1 to 3 ligands, 3 ligands, or 1 ligand). The ligand may target a cell expressing asialoglycoprotein receptor (ASGP-R), IgA receptor, HDL receptor, LDL receptor, or transferrin receptor. Non-limiting examples of the ligands include N-acetylgalactosamine (e.g., a triantennary N-acetylgalactosamine), glycyrrhetinic acid, glycyrrhizin, lactobionic acid, lactoferrin, IgA, or a bile acid (e.g., lithocholyltaurine or taurocholic acid).

[0115] The ligand may be a small molecule, e.g., a small molecule targeting a cell expressing asialoglycoprotein receptor (ASGP-R). A non-limiting example of a small molecule targeting an asialoglycoprotein receptor is N-acetylgalactosamine. Alternatively, the ligand can be an antibody or an antigen-binding fragment or an engineered derivative thereof (e.g., Fcab or a fusion protein (e.g., scFv)).

[0116] Small Molecules Inhibiting GZMK

[0117] In some embodiments, the agent that reduces expression of or inhibits an activity of GZMK is a small molecule.

[0118] In some embodiments, the small molecule is Compound A

[0119] (FPR-CMK);

[0120] Glu-Gly-Arg-chloromethyl ketone (EGR-CMK);

[0121] D-Phe-Pro-Lys-chloromethyl ketone;

[0122] Phenylmethylsulfonyl fluoride (PMSF); or 4-(2-Aminoethyl)-benzolsulfonylfluorid-hydrochloride (AEBSF hydrochloride).

[0123] Compound A and Compound B are covalent GZMK inhibitors. AEBSF hydrochloride is a pan protease inhibitor.

[0124] In some embodiments, the small molecule is Compound A as described in Jackson, D. S. et al J. Med Chem 1998, 41 , 2289. In some embodiments, the small molecule is Compound B (FPR-CMK) as described in Wilharm, E. et al. J Biol Chem 1999, 274, 27331 . In some embodiments, the small molecule is EGR-CMK as described in Wilharm, E. et al. J Biol Chem 1999, 274, 27331 . In some embodiments, the small molecule is Phenylmethylsulfonyl fluoride (PMSF) as described in Wilharm, E. et al. J Biol Chem 1999, 274, 27331. In some embodiments, the small molecule is 4-(2-Aminoethyl)-benzolsulfonylfluorid- hydrochloride (PefablocSC / AEBSF) as described in Wilharm, E. et al. J Biol Chem 1999, 274, 27331 .

[0125] In some embodiments, the small molecule is D-Phe-Pro-Arg-chloromethyl ketone (FPR-CMK, also referred to as PPACK) as described in Lan et al., Nature, 638, 490 - 498 (2025). PPACK is a synthetic drug that inhibits both human and mouse GZMK activity and significantly reduces eosinophil infiltration to the airway in asthmatic mice. PPACK also decreases goblet cell hyperplasia and improves lung function in asthmatic mice.

[0126] Reducing GZMK positive cell populations

[0127] The disclosure features methods of treating an inflammatory condition or disorder in a subject in need thereof by reducing the number of cells expressing GZMK in the subject or reducing the production of GZMK in a cell in the subject. In some embodiments, the cell is a myeloid cell. In other embodiments, the cell is a lymphocyte (e.g., a CD8+T cell, a CD4+T cell, a natural killer (NK) T cell, a NK cell, a mucosal-associated invariant T (MAIT) cell, an innate-like lymphocyte, or a yb T cell).

[0128] In these methods, a surface marker on the cell may be targeted. In some embodiments, the surface marker is SIRPG or a chemokine receptor.

[0129] In some embodiments, the chemokine receptor is CCR2, CCR5, CXCR3 or CX3CR1 . In some embodiments, the GZMK positive T cell expresses CCR2, CCR5, and CXCR3 (see Jonsson et al., Sci. Transl. Med. 14, eabo0686 (15 June 2022).

[0130] EXAMPLES

[0131] The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used and evaluated and is intended to be purely exemplary and is not intended to limit the scope of the disclosure.

[0132] Example 1. Investigation of the role of granzyme K (GZMK) in inflammation and complement activation.

[0133] The role of GZMK in inflammation and complement activation was investigated.

[0134] METHODS

[0135] Cell lines

[0136] Synovial fibroblast cell lines were derived from RA patients. LAD2 cells were provided by Brigham and Women’s Hospital and the National Institutes of Health / National Institute of Allergy and Infectious Diseases. THP-1 cells were provided by the American Type Culture Collection (ATCC). HUVEC cells were provided by Lonza. All cells were cultured in a humified, 5% CO2 incubator at 37 °C. Fibroblasts were grown in DMEM supplemented with 2 mM L-glutamine, 100 U / ml penicillin, 100 pg / ml streptomycin, essential and non-essential amino acids (Gibco), 50 pM p-mercaptoethanol (Sigma), and 10% FBS (Gemini). LAD2 cells were maintained in StemPro-34 serum-free media supplemented with StemPro-34 nutrient supplement (Gibco), 100 ng / ml SCF (Peprotech), 2 mM L-glutamine, 100 U / ml penicillin, and 100 pg / ml streptomycin (LAD2 cell media). THP-1 cells were grown in RPMI 1640 (Gibco) supplemented with 2 mM L-glutamine, 100 U / ml penicillin, 100 pg / ml streptomycin, 20 mM HEPES, 50 pM p-mercaptoethanol (Sigma) and 10% FBS. HUVEC cells were grown in EGM Plus media supplemented with EGM Plus SingleQuots (Lonza). Cell lines were not authenticated or tested for mycobacterial contamination.

[0137] Animals

[0138] Gzmk1- animals were generated by fertilizing C57BL / 6 ova with cryopreserved Gz mkm1a K0M msisperm (Centre national de la recherche scientifique (CNRS)). The resulting mice were subsequently crossed to the germline SOX2-Cre to generate total Gzmk1- animals. The SOX2-Cre was bred out of animals before use in experiments. Gzmk+I+mice (Jax) were co-housed in the same cage with Gzmk1- mice for 2-3 weeks prior to the start of experiments and remained co-housed for the entirety of the experiment. Gzmk+ / - animals are littermates of Gzmk1- mice. Both male and female mice were used in all studies and ranged between 10 and 14 weeks of age. All animal studies were performed with approval by the institutional animal care and use committee (IACUC) of the Brigham and Women’s Hospital. All animals were housed in AAALAC-accredited animal facilities at Brigham and Women's Hospital. Mice were kept in pathogen-free housing with 12-hour day / night cycles in 30-70% humidity and 20-23°C temperature controlled rooms. Animals were closely monitored by veterinary staff for well-being.

[0139] For experiments, at least 6 animals were included in each treatment / experimental group and at least 3 animals of each genotype were included in control groups. Experiments shown are representative of 2 to 4 independent experiments. Age and sex-matched animals were randomly assigned to different groups in each experiment. Researchers were blinded during experiments for collection of clinical data points.

[0140] Human Research Participants

[0141] Human participants providing transcriptomic data from published studies were consented according to the protocols listed in the respective publications. Functional assays utilizing human blood were obtained from discarded specimens and received ethical approval by the Institutional Review Board at Brigham and Women’s Hospital.

[0142] Flow cytometry of peripheral blood

[0143] Peripheral blood samples from healthy individuals were processed by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare) to isolate mononuclear cells, which were then cryopreserved. Thawed mononuclear cells were stained with Fixable Viability Dye eFluor 455UV (Thermo Fisher Scientific). The cells were incubated with MR1 tetramers (NIH Tetramer core) at room temperature for 20 minutes followed by the remainder of surface markers including CD3e (UCHT1 , 1 :75), CD8a (RPA- T8, 1 :75), CD14 (M5E2, 1 :50), CD16 (3G8, 1 :75), CD56 (5.1 H11 , 1 :25), and V52 (B6, 1 :75) from Biolegend and CD4 (SK3, eBioscience / ThermoFisher, 1 :50), for 20 minutes on ice. Cells were then fixed, permeabilized, and stained for intracellular markers GZMK (GM26E7, Biolegend, 1 :25) and GZMB (GB11 , eBioscience / ThermoFisher, 1 :25), using True-Nuclear Transcription Factor Fixation Buffer Set (BioLegend). Data were acquired on a BD Fortessa analyzer using FACSDiva software. Compensation and analysis were performed using FlowJo 10.7.1 . Gating of blood cell populations is shown in Fig. 6a. Disaggregation and flow cytometry of synovial tissue

[0144] Synovial tissue from arthroplasty or synovectomy samples were cryopreserved in 1 to 5 millimeter fragments for batch processing. Thawed synovial tissues were disaggregated into single-cell suspensions by mincing and digesting with 100 micrograms per milliliter LiberaseTL (Roche) and 100 micrograms per milliliter DNasel (Roche) in RPMI-1640 (Gibco) for 15 minutes, inverting every 5 minutes51. Cells were passed through a 70 micron cell strainer and washed prior to antibody staining using the same protocol described for blood and the same antibodies and clones in addition to antibodies against CD45 (HI30, Biolegend, 1 :50). Gating of synovial cell populations is shown in Fig. 6c.

[0145] Synovial tissue single-cell RNA-seq analysis

[0146] To inspect GZMK and GZMB gene expression in single-cell transcriptomic data, a published synovial tissue CITE-seq dataset from patients with RA and OA7(n = 79) was used. Based on a low- resolution clustering of the data, a cluster of T cells (CD3+) and a cluster of NK cells and innate lymphoid cells (CD45+CD3 CD19 CD14 were subsetted. Because the original study used CITE-seq, this dataset contained measurements of whole-transcriptome single-cell RNA expression and a panel of 58 surface proteins. Quality control and normalization of the RNA and protein data as described in the original paper were conducted. To identify proteins with the most cell-state-specific expression, the subsetted data based on RNA expression was coarsely clustered, and for each protein, the Kullback-Leibler (K-L) divergence of cells was measured with high expression of that protein (i.e., normalized expression > 85thpercentile) compared to the null distribution of all cells. Then, proteins were scaled with high K-L divergence (n = 25) and highly variable genes to have mean = 0 and variance = 1 , and were used for canonical correlation analysis. This strategy projects the cells into a low-dimensional embedding based on both RNA and protein expression. Batch effects were removed from this embedding with Harmony52and a UMAP53with the first 20 canonical variates was made.

[0147] Integration of multiple scRNA-seq datasets focusing on T cells and innate lymphocytes

[0148] To integrate T cells and innate lymphocytes from multiple diseased tissues, the raw FASTQ files and raw count matrices were obtained from the following publicly available scRNA-seq datasets: RA synovial cells from dbGaP13(phs001457.v1 ,p1 ), dbGaP10(phs001529.v1 ,p1 ), GEO2(GSE202375), and Synapse7(syn26710600); SLE kidney cells from dbGaP12(phs001457.v1 ,p1 ); UC colon cells from Single Cell Portal8(SCP259); CD ileum cells from GEO9(GSE134809); and COVID-19 and healthy bronchoalveolar lavage fluid (BALF) cells from GEO11(GSE145926). For the FASTQs that were obtained, Kallisto was used to map the raw reads to the same kallisto index generated from GRCh38 Ensembl v100 FASTA files. FASTQ files were pseudo-aligned to this reference, barcodes were corrected, BUS files were sorted, and unique molecular identifiers (UMIs) were counted to generate UMI-count matrices. All the cells were aggregated into one matrix and T cells and innate lymphocytes were further identified using graph-based clustering and canonical cell lineage gene signatures (Fig. 6). Consistent QC was performed to remove the cells that expressed fewer than 500 genes or with more than 20% of the number of UMIs mapping to the mitochondrial genes. One unified cross-tissue integrative strategy54was applied to identify functionally meaningful clusters. Specifically, each cell was normalized to 10,000 reads and log- transformed the normalized data. Then the top 1 ,000 most highly variable genes based on dispersion within each donor sample were selected and these genes were combined to form a variable gene set. Based on the pooled highly variable genes, the aggregated data matrix was scaled to have mean 0 and variance 1 . The expression matrix was normalized using the L2 norm. To minimize the effect of multiple datasets with different cell numbers during an unbiased scRNA-seq data integration, weighted principal component analysis (PCA) was performed and the first 20 weighted PCs were used for follow-up analysis. The summation of the weights for cells from each separate single-cell dataset is equal so that each dataset contributed equally to the analysis. For all cell-type integration, batch effects were corrected on three different levels (sequencing technology, tissue source, and donor sample) simultaneously using Harmony52. Default parameters were used and theta = 2 for each batch variable, max. iter. cluster = 30, and max. iter. harmony = 20 was also specified. For Harmony batch correction, the same weights were used from the weighted PCA. Then unbiased graph-based clustering was applied on the top 20 batch- corrected PCs. Then, dimensionality reduction was performed using UMAP53.

[0149] Immunoblotting

[0150] Cell lysates were prepared by lysing cells for 1 h at 4 °C in RIPA buffer supplemented with complete protease inhibitor cocktail (Roche). The cell lysate concentrations were quantified using a BCA protein assay kit (ThermoFisher). Cell-free culture supernatants were precipitated by incubating them with 10% trichloroacetic acid (TCA, Sigma) for 1 h at 4 °C. Cell lysates and precipitated supernatants were separated by SDS-PAGE on 12% or 7.5% Mini-PROTEAN TGX or Criterion TGX gels (Bio-Rad) and transferred onto 0.2 pM PVDF membranes using a Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked with 5% nonfat dry milk containing 0.1 % Tween 20 (Bio-Rad) in TBST for 1 h at room temperature, and then incubated with primary antibodies overnight at 4 °C. Membranes were developed using Clarity Western ECL (Bio-Rad) and imaged using a ChemiDoc Touch MP (Bio-Rad).

[0151] Densitometry

[0152] Densitometric analysis of representative immunoblots were performed using Image Lab 6.1 from Bio-Rad. Data are shown as fold change of untreated control.

[0153] Isolation of primary human CD8+T cells for assessment of intracellular and secreted GZMK and GZMB by immunoblot

[0154] To isolate human CD8+T cells, peripheral blood mononuclear cells were isolated from healthy donors using Ficoll-Paque Plus density gradient centrifugation followed by magnetic-activated cell sorting using the human CD8+T cell isolation kit (Miltenyi). For assays, CD8+T cells were cultured in RPMI 1640 supplemented with 2 mM L-glutamine, 100 U / ml penicillin, 100 pg / ml streptomycin, 20 mM HEPES, 1 mM sodium pyruvate, essential and non-essential amino acids (Gibco), 50 pM p-mercaptoethanol (Sigma), 5% human AB serum (Gemini) and 30 IU ml’1recombinant human IL-2 (Peprotech). Primary human CD8+T cells were left unstimulated or were stimulated with anti-CD3 / CD28 dynabeads (ThermoFisher) at a 1 :1 bead-to-cell ratio for 6, 24 and 48 hours. Supernatants were depleted of albumin, immunoglobulins, and other abundant proteins in human serum before precipitation. Cell lysates and precipitated supernatants were immunoblotted against GZMK (EPR24601 -164, Abeam, 1 :1 ,000), GZMB (EPR8260, Abeam, 1 :1 ,000), and actin (AC-15, Millipore Sigma, 1 :2,000). Assessment of GZMK and GZMB expression by stimulated versus unstimulated human CD8+T cells by intracellular flow cytometry

[0155] Primary CD8+T cells were purified from cryopreserved human peripheral blood mononuclear cells (N=4) using magnetic bead negative selection (Miltenyi). 150,000 CD8+T cells were cultured in each well of a flat-bottom 96-well tissue culture plate in RPMI with 10% fetal calf serum with or without anti- CD3 / CD28 dynabeads at a 1 :1 bead-to-cell ratio for up to 4 days. Each day, cells from technical replicate wells were harvested and stained for surface and intracellular markers to measure GZMK and GZMB expression. The flow cytometry panel included Fixable Viability Dye UV455 (eBioscience) and antibodies against CD3 (UCHT1 . 1 :25), CD4 (RPA-T4, 1 :50), CD8 (RPA-T8, 1 :50), CD14 (M5E2, 1 :25) on the cell surface and GZMK (GM26E7, 1 :50), and GZMB (GB1 1 , 1 :100) intracellularly, all from BioLegend. MR1 tetramers (NIH Tetramer core, 1 :500) were also included to exclude mucosal-associated invariant T (MAIT) cells from analysis. Data were collected on a BD Fortessa flow cytometer and analyzed using FlowJo 10.7.1 software.

[0156] Structural alignment of GZMK and CFD, C1s and MASP1

[0157] The crystal structure of GZMK (PDB code 1 MZA) was aligned to that of CFD (PDB code 2XW9), C1 s (PDB code 1 ELV) or MASP1 (PDB code 4IGD) using the cealign command in Pymol 3.0.3. For C1 s and MASP1 , only the catalytic domains are shown. The side chains of the catalytic triad residues in GZMK (H67, D1 16, S214), CFD (H66, D1 14, S208), C1 s (H475, D529, S632) and MASP1 (H490, D552, S646) are shown. The catalytic serine in both structures is mutated to alanine.

[0158] CFB cleavage assays

[0159] To assess CFB cleavage, serum-purified human CFB (Complement Technology, 100 nM) was incubated with CFD (Complement Technology, 100 nM) or increasing concentrations (125 nM, 250 nM, 500 nM, 1000 nM) of recombinant, active human GZMK (Enzo) in the presence or absence of C3b (Complement Technology, 10 nM) in reaction buffer (50 mM Tris-HCI pH 8.0, 150 mM NaCI and 2 mM Mg2+and Ca2+) for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels, and cleavage of CFB into Bb was assessed by immunoblot using an anti-CFB antibody (A235, Complement Technology, 1 :4,000). The Bb fragment was identified by comparison to the band corresponding to serum-purified Bb (Complement Technology, 15 nM).

[0160] Fluid-phase complement C2, C3 and C4 cleavage assays

[0161] To assess C4 cleavage, serum-purified human C4 (Complement Technology, 100 nM) was incubated with increasing concentrations (125 nM, 250 nM, 500 nM) of either recombinant, active human GZMK, recombinant, active human GZMA (Enzo), or serum-purified active human C1 s (Complement Technology) in reaction buffer for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels, and cleavage of C4 was assessed by immunoblot using an anti-C4 antibody (22233-1 -AP, Proteintech, 1 :1 ,000). The C4b fragment was identified by comparison to the band corresponding to serum-purified C4b (Complement Technology, 30 nM). To assess C2 cleavage, serum-purified C2 (Complement Technology, 100 nM) was incubated with increasing concentrations (25 nM, 50 nM, 100 nM, 200 nM) of C4 and either GZMK (250 nM) or C1s (250 nM) in reaction buffer for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels and C2 cleavage was assessed by immunoblot using an anti-C2 antibody (A212, Complement Technology, 1 :4,000).

[0162] To assess whether GZMK can directly cleave C3, serum-purified human C3 (Complement Technology, 100 nM) was incubated with increasing concentrations (125 nM, 250 nM, 500 nM, 1000 nM) of GZMK in reaction buffer for 4 h at 37 °C. As a positive control for generation of C3b, CFB (100 nM) was incubated with C3b (Complement Technology, 10 nM) and CFD (100 nM) along with increasing concentrations (12.5 nM, 25 nM, 50 nM, 100 nM) of properdin (Complement Technology) in reaction buffer for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels and C3 cleavage was assessed by immunoblot with an anti-C3 antibody (A213, Complement Technology, 1 :32,000). The C3b band was identified by comparing the cleaved fragments to the band corresponding to serum-purified C3b (15 nM).

[0163] To detect C3 convertase formation as assessed by the generation of C3a and C3b, serum- purified C3 (Complement Technology, 100 nM) was incubated with C4 (400 nM) + C2 (400 nM), and either increasing concentrations (125 nM, 250 nM, 500 nM, 1000 nM) of GZMK or GZMA, or 125 nM C1s in reaction buffer for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels and cleavage of C3 into C3a and C3b was assessed by immunoblot using anti-C3 (204869, Millipore Sigma, 1 :5,000, for C3b) and anti-C3a (A218, Complement Technology, 1 :5,000, for C3a) antibodies. The C3a and C3b bands were identified by comparing the cleaved fragments to the bands corresponding to serum-purified C3a (Complement Technology, 100 nM), C3b (40 nM), and iC3b (Complement Technology, 50 nM).

[0164] Quantitation of complement gene expression in bulk RNA-seq from synovial tissue cells

[0165] To quantify local expression of complement genes C2, C3, C4A, and C4B, a published bulk RNA- seq data from T cells (n = 47), B cells (n = 29), macrophages (n = 46), and fibroblasts (n = 45) sorted from disaggregated synovial tissue from patients with RA or osteoarthritis7was analyzed.

[0166] Assessment of complement C2, C3 and C4 secretion by synovial fibroblasts

[0167] To assess for complement C2, C3 and C4 secretion, primary RA synovial fibroblasts were stimulated with 100 ng / ml recombinant IFNG (Peprotech), 1 ng / ml TNF (Peprotech), or both cytokines together for 24 h in fibroblast growth medium containing reduced serum (1% FBS). To detect C2, C3, and C4 secretion by immunoblot, cell culture supernatants were TCA-precipitated and immunoblotted using anti-C2 (E-7, Santa Cruz Biotechnology, 1 :50), anti-C3 (204869, Millipore Sigma, 1 :5,000), and anti-C4 (JM88-13, Novus Biologicals, 1 :1 ,000 for alpha chain, and A205, Complement Technology, 1 :32,000 for beta chain). The C2, C3, and C4 bands were identified by comparison to the bands corresponding to serum-purified C2, C3, C3b, C4 and C4b (50 nM). To detect C2, C3, and C4 secretion by ELISA, cell culture supernatants were analyzed using C2 (ab254501 , Abeam), C3 (ab108823, Abeam), and C4 (ab108825, Abeam) ELISA kits.

[0168] Assessment of cleavage of synovial fibroblast-derived complement C3 To detect formation of C3 convertases from fibroblast-derived complement proteins, cell-free supernatants from fibroblasts stimulated for 24 h at 37 °C with a combination of IFNG (100 ng / ml) and TNF (1 ng / ml) in serum-free fibroblast medium were incubated with either GZMK (500 nM), GZMA (500 nM), or C1s (500 nM) for 4 h at 37 °C. The reaction products were run on SDS-PAGE gels and cleavage of C3 into C3a and C3b was assessed by immunoblot using anti-C3 (204869, Millipore Sigma, 1 :5,000, for C3b) and anti-C3a (A218, Complement Technology, 1 :5,000, for C3a) antibodies. The C3a and C3b bands were identified by comparing the cleaved fragments to the bands corresponding to serum-purified C3a (100 nM) and C3b (40 nM).

[0169] Immunofluorescence microscopy of human tissues

[0170] Formalin-fixed, paraffin-embedded human synovial tissue sections were obtained from the Dana- Farber / Harvard Cancer Center Specialized Histopathology core facility. The paraffin was removed with heat and xylene and antigen retrieval was performed in Tris buffer pH 9 in a steamer for 20 minutes. Slides were blocked with 5% bovine serum albumin (BSA) supplemented with bovine, donkey, and human immunoglobulins (Jackson ImmunoResearch) instead of serum, in order to avoid contamination with external complement components. Slides were then incubated overnight with primary antibodies against GZMK (EPR24601 -164, Abeam, 1 :500); C3 / C3d (C3D / 2891 , Neo-Biotechnologies, 1 :100, or 7C10, Abeam, 1 :10); C5a / C5a des Arg (2942, Abeam 1 :20, or 2952, Abeam, 1 :50); podoplanin (NZ13, ThermoFisher, 1 :150); or CD3 (CD3-12, Abeam, 1 :100). Secondary antibodies (Jackson ImmunoResearch) were added at 1 :200 dilution. Slides were then treated with Sudan Black B (Sigma) for 15 minutes to diminish autofluorescence. Slides were then stained with Hoechst 33342 nuclear stain (ThermoFisher) and mounted with SlowFade Glass Soft-set Antifade Mountant (ThermoFisher). Images were collected using a Zeiss LSM800 confocal microscope (Confocal Microscopy Core, Brigham and Women’s Hospital) using Zen 2.6 software and analyzed using Fiji (lmageJ2 2.9.0 / 1 .53t).

[0171] LAD2 mast cell degranulation

[0172] For degranulation assays, C2 (400 nM) + C3 (100 nM) + C4 (400 nM) were incubated with either GZMK (500 nM) or C1s (500 nM) in LAD2 cell media for 4 h at 37 °C. Then, LAD2 cells were washed and incubated with the reaction products or serum-purified C3 or C3a (100 nM) along with a PE-conjugated anti-LAMP1 antibody (H4A3, Biolegend, 1 :100 for 1 h at 37 °C. Cells were washed twice and further stained with an APC-conjugated anti-CD117 antibody (104D2, Biolegend, 1 :50) to gate on mast cells. After two washes, cells were analyzed on a BD Fortessa FACS analyzer using FACSDiva software for surface LAMP1 . Analysis was performed using FlowJo 10.7.1 .

[0173] Complement C3b and C4d opsonization assay

[0174] Opsonization assays were modified from previously described55. Briefly, human umbilical vein endothelial cells (HUVEC, ATCC) were incubated with serum-purified complement components C2 (5nM) + C3 (100nM) + C4 (50nM) with GZMK or GZMA (12.5nM, 25nM, 50nM, or 100 nM) or C1s (100nM) for 4 h at 37 °C in EGM Plus media containing no serum or heparin. In experiments where complete serum was used as a source of complement, HUVEC were incubated with 2% human C1q-depleted serum (Complement Technology) in the presence of GZMK (50 nM, 100 nM, 200 nM, 400 nM) for 2 h at 37 °C. Normal human serum (NHS, Complement Technology) was added to a final concentration of 20% as a positive control. Heparin, when present, was used at a concentration of 0.75 U / mL (Lonza). Cells were analyzed for the presence of surface C3b (3E7 / C3b, Biolegend, 1 :25), and / or C4d (12D11 , Hycult, 1 :100), and / or GZMK (GM26E7, Biolegend, 1 :100) on a BD Fortessa FACS analyzer using FACSDiva software. Analysis was performed using FlowJo 10.7.1 .

[0175] Measurement of surface-bound GZMK and C1s by flow cytometry

[0176] To detect binding of GZMK or C1s to the surface of cells, synovial fibroblasts, HUVEC, and THP- 1 cells were incubated with GZMK (50 nM) or C1s (50 nM) for 1 h on ice at 4 °C in HBSS with Ca2+and Mg2+(Gibco) containing 10 mM HEPES and 0.5% BSA (Millipore Sigma). Cells were then washed twice and stained with antibodies against GZMK and C1 s (M81 , Hycult Biotech, 1 :10) followed by a PE- conjugated anti-mouse lgG1 secondary antibody (RMG1 -1 , Biolegend). To detect binding of C1s to the cell surface following addition of the C1 complex, cells were sensitized with mouse lgG2a cell-type specific antibodies (HUVEC and THP-1 : CD31 , HEC7, Invitrogen, 2 pg; Fibroblasts: HLA-A,B,C, W6 / 32, Biolegend, 2 pg) or a mouse lgG2a isotype control (MG2a-53, Biolegend) for 15 minutes at room temperature. Cells were then washed twice and incubated with purified C1 complex (Complement Technology, 100 nM) or C1 s (200 nM) for 30 minutes at 37 °C. Cells were washed twice and stained for C1s followed by a PE-conjugated anti-mouse IgG 1 secondary antibody. Cells were analyzed for the presence of surface GZMK or C1s on a BD Fortessa FACS analyzer using FACSDiva software. Analysis was performed using FlowJo 10.7.1.

[0177] Measurement of surface-bound GZMK and surface heparan sulfate density on PBMCs and HUVECs

[0178] To detect surface binding of GZMK and heparan sulfate density on the plasma membrane of blood leukocyte populations and HUVECs, PBMCs and HUVECs were incubated with GZMK (1 ug / mL, 37.5nM) for 1 hour on ice at 4 °C in HBSS with Ca2+ and Mg2+ (Gibco) containing 0.5% BSA (Millipore Sigma). Cells were then washed once and stained with Zombie UV viability dye (Biolegend) followed by surface staining with anti-GzmK-FITC (GM26E7, Biolegend, 1 :25), biotinylated anti-heparan sulfate antibodies (clone F58-10E4, AMSBio, 1 :25), anti-CD3 BV510 (UCHT1 , Biolegend, 1 :25), anti-CD4 PE Cy7 (RPA-T4, Biolegend, 1 :25), anti-CD8A Spark Blue 500 (SK1 , Biolegend), 1 :25, anti-CD14 BV785 (M5E2, Biolegend, 1 :25), anti-CD19 Alexa Fluor 700 (HIB19, Biolegend, 1 :25), and anti-CD34 APC- Fire750 (clone 581 , Biolegend, 1 :25) antibodies. Lastly, cells were stained with streptavidin-Alexa Fluor 647 (Biolegend, 1 :100) to detect the anti-heparan sulfate antibodies. Cells were analyzed on a Cytek Aurora spectral flow cytometer using SpectroFlo v3.3.0, and data analysis was performed using FlowJo 10.10.0.

[0179] Comparison of complement activation by fluid phase vs. membrane phase GZMK

[0180] To assess how efficient membrane-bound GZMK is at activating complement, HUVEC cells were incubated with GZMK (200 nM) on ice at 4 °C for 30 minutes to allow GZMK to bind their membrane. Media was then removed, and the cells were incubated with C2 (5 nM) + C3 (100 nM) + C4 (50 nM) for 2 h at 37 °C after which the cell-free supernatants were precipitated with TCA, run on SDS-PAGE gels, and immunoblotted for C2b, C3a, and C4a (the complement activation products that do not associate with surfaces) using anti-C2 (A212, Complement Technology, 1 :4,000), anti-C3a (A218, Complement Technology, 1 :5,000), and anti-C4a (A206, Complement Technology, 1 :1000) antibodies. The C2b, C3a, and C4a bands were identified by comparing the cleaved fragments to the bands corresponding to serum-purified C2b (Complement Technology, 5 nM), C3a (150 nM), and C4a (Complement Technology, 50 nM). For fluid phase reactions, GZMK (200 nM) was incubated with C2 (5 nM) + C3 (100 nM) + C4 (50 nM) for 2 h at 37 °C in the absence of HUVEC cells, and the reactions were precipitated with TCA, run on SDS PAGE and immunoblotted for C2b, C3a, and C4a as above.

[0181] Measurement of C5a generation and bioactivity

[0182] To assess generation of C5a, HUVEC cells were cultured with serum-purified C2 (5 nM) + C3 (100 nM) + C4 (200 nM) + C5 (Complement Technology, 50 nM) and increasing concentrations (100 nM, 200 nM, 400 nM) of either GZMK or GZMA in EGM-Plus media containing no serum or heparin for 3 h at 37 °C. Cell culture supernatants were assayed for the presence of C5a by ELISA (BD Biosciences). To assess bioactivity of C5a, Chem-1 cells stably expressing C5aR1 (Eurofins) were labeled with the cell- permeable calcium binding dye Fluo-5F AM (Invitrogen, 2 pM) in the presence of probenecid (Invitrogen, 2.5 mM). Fluo-5F AM-labeled C5aR1 -expressing Chem-1 cells were then incubated with the cell-free supernatants from HUVEC cells cultured as above and the cells were immediately analyzed for calcium flux on a BD Fortessa FACS analyzer using FACSDiva software. Analysis was performed using FlowJo 10.7.1 . The average mean fluorescence intensity values obtained from the untreated, Fluo-5F-labeled Chem-1 cells were subtracted from the mean fluorescence intensity values of all other samples.

[0183] Terminal Complement Complex detection

[0184] HUVEC cells were incubated with serum-purified C2 (5 nM) + C3 (400 nM) + C4 (200 nM) + C5 (50nM) + C6 (Complement Technology, 50 nM) + C7 (Complement Technology, 50 nM) or C5b,6 (Complement Technology, 8.3nM) in the presence of GZMK or GZMA (25 nM, 100 nM) for 4 h at 37 °C followed by addition of C8 (Complement Technology, 66.7nM) + C9 (Complement Technology, 200nM) for an additional hour. Dynasore (Abeam, 80 pM), when used, was added 4 hours prior to addition of C8 and C9. In experiments where serum was used as a source of complement, HUVEC cells were incubated with 2% human C1q-depleted serum in the presence of GZMK (50 nM, 100 nM, 200 nM, 400 nM) for 2 h at 37 °C. Incubations were performed in EGM Plus media containing no serum or heparin. Cells were evaluated by flow cytometry for surface expression of the TCC using an anti-TCC antibody (aE11 , Hycult BioTech, 1 :100) followed by an anti-mouse lgG2a-PE secondary antibody (Jackson ImmunoResearch, 1 :400) using a BD Fortessa FACS analyzer with FACSDiva software. Analysis was performed using FlowJo 10.7.1 .

[0185] Antigen-induced arthritis (AIA)

[0186] AlA was induced as previously described37. Briefly, methylated bovine serum albumin (mBSA, Sigma) was emulsified in complete Freund’s adjuvant (Chondrex) and a total of 200 ug mBSA was injected subcutaneously into flanks of mice at day -21 . Mice also received 200 ng of pertussis toxin (Sigma) intraperitoneally. On day -14, mice received a booster of 100 ug mBSA emulsified in incomplete Freund’s adjuvant in the low back. On Day 0, wrists, ankles and / or knees were injected intra-articularly with 60 ug of mBSA or PBS control. Each animal served as its own internal control with one side of joints receiving mBSA and the other side of joints receiving PBS. Joint swelling was measured using calipers.

[0187] Imiquimod dermatitis

[0188] Imiquimod (IMQ) dermatitis was induced as previously described56. Briefly, the backs of mice were shaved followed by a one-minute treatment with Nair to remove hair two days prior to IMQ or control treatment. Mice received daily application of 62.5 mg IMQ (3M Pharmaceuticals) or control cream (CeraVe) to their backs. Erythema, scaling and thickness were measured on a scale of 0-4 daily as previously described (0 = none, 1 = mild, 2 = moderate, 3 = marked, 4 = maximal)56. Double-fold thickness of back skin was measured daily with calipers.

[0189] Immunofluorescence microscopy of mouse tissues

[0190] For AIA, mice were euthanized at day 3 post intra-articular injections. Knee and wrist joints were harvested, fixed overnight in 4% paraformaldehyde, and followed by decalcification in 10% EDTA for 3 weeks at 4C with twice weekly changes into fresh EDTA. Joints were rehydrated and embedded into paraffin blocks. For IMQ dermatitis, 8 mm punch biopsies of the affected skin were taken and fixed overnight in 4% paraformaldehyde. Skin samples were embedded in paraffin and sectioned by iHisto histopathology services (iHisto).

[0191] Antigen retrieval was performed in a citrate pH 6.0 buffer (Sigma) for 20 minutes at either 85 C (hybridization oven, joint tissue) or 100 C (vegetable steamer, skin). Slides were blocked with 5% normal donkey serum (Jackson ImmunoResearch) in PBS for 1 hour at room temperature followed by overnight incubation at 4 C with primary antibodies against C3d (AF2655, R&D Systems 1 :100) and C4d (HP8033, HycultBiotech, 1 :100). Secondary antibodies (Jackson ImmunoResearch) were added at 1 :200. Slides were then treated with Sudan Black B (Sigma) for 15 minutes to diminish autofluorescence, followed by staining with Hoechst 33342 nuclear stain (ThermoFisher) and mounting with SlowFade Glass Soft-set Antifade Mountant. Images were collected on a EVOS M700 microscope (ThermoFisher) to allow for whole tissue analysis and analyzed using Fiji (Image J2, 2.14.0 / 1 .54f). For analysis of images, the background was subtracted. Areas of synovium and / or adjacent soft tissue with inflammation were outlined based on adjacent H&E images, and a grid was overlaid over the entire tissue. ROIs were made for each image based on the overlap of the grid squares and defined areas of interest (synovium for AIA, and the dermal-epidermal junction for IMQ). A threshold was applied to each image using the moments automatic thresholding program.

[0192] Statistics

[0193] Statistical analysis was performed using Graph Pad Prism 9.5. Rvalues were calculated using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons tests or a two-way ANOVA with Sidak’s multiple comparisons tests when more than two groups were analyzed. P values were calculated using two-way t-tests for experiments comparing two groups. Data are mean ± s.d. unless otherwise indicated. Data availability

[0194] CITE-seq and RNA-seq single-cell expression matrices were obtained from the following publicly available datasets: RA synovial cells from dbGaP13(phs001457.v1 ,p1 ), dbGaP10(phs001529.v1 ,p1 ), GEO2(GSE202375), and Synapse7(synapse. org / Synapse:syn26710600 / datasets / , syn26710600); SLE kidney cells from dbGaP12(phs001457.v1 .p1 ); UC colon cells from Broad Institute Single Cell Portal8(singlecell.broadinstitute.org / single_cell / study / SCP259, SCP259); CD ileum cells from GEO9(GSE134809); and COVID-19 and healthy bronchoalveolar lavage fluid (BALF) cells from GEO11(GSE145926). The bulk RNA-seq data from sorted synovial cell types are available at ImmPort13) (immport.org / shared / study / SDY998, SDY998, EXP20840).

[0195] RESULTS

[0196] GZMK is expressed by CD8+T cells

[0197] To determine which cells in human blood and tissues express GZMK, flow cytometry was performed and publicly available RNA-seq datasets were analyzed. In human peripheral blood, GZMK protein was expressed by 38.4 ± 13.9% (mean ± standard deviation (SD)) of CD8+T cells, as well as the majority of mucosal-associated invariant T (MAIT) cells, Vb2 yb T cells, and CD56brightCD16- NK cells (Fig. 1 a,b). A smaller fraction of CD4+T cells mainly consisting of effector memory T cells (Tem), and CD56dimCD16+NK cells also expressed GZMK (Fig. 1 a,b and Fig. 6b). Thus, many different lymphocytes in human blood express GZMK, about half of which are effector memory CD8+T cells (Fig. 1 c and Fig. 6a).

[0198] Next, GZMK expression was assessed in synovial tissue from patients with RA, a chronic autoimmune disease characterized by infiltration by T cells and other lymphocytes into affected synovial tissues. At the protein level, GZMK was expressed by half of all synovial CD8+T cells in both RA and osteoarthritis (OA) (42.8 ± 26.8% vs 51 .1 ± 19.1 %, respectively (mean ± SD)) and about 10% of synovial CD4+ T cells (Fig. 1 d,e). Immunofluorescence staining confirmed GZMK-expressing T cells were abundantly present in inflamed RA synovial tissue (Fig. 1 f). For higher granularity, GZMK mRNA expression was analyzed in a large single-cell RNA-seq dataset collected by the Accelerating Medicines Partnership: Rheumatoid Arthritis / Systemic Lupus Erythematosus (AMP RA / SLE) Network7. GZMK was expressed among a much larger number of CD8+T cells than GZMB (Fig. 1 g). Additionally, GZMK was also detected among CD4+T cells, NK cells, and yb T cells (Fig. 1 g and Fig. 6b). Thus, GZMKis expressed by a large proportion of CD8+T, NK and innate-like T cells in OA and RA synovial tissues.

[0199] To investigate the expression of GZMK among cells in tissues beyond the synovium, single-cell RNA-seq data from several publicly available datasets of tissue cells collected from patients with RA, lupus nephritis, ulcerative colitis, Crohn’s disease, COVID-19, and healthy controls was integrated27“13(Fig. 1 h and Fig. 6c, d). In these data, GZMK was detected in 20-60% of CD8+T cells and up to 30% of CD4+T cells, depending on the disease state, consistent with previously reported results3(Fig. 1 h,i and Fig. 6e). In contrast, GZMB was detected in roughly 10-50% of CD8+T cells in all tissues and fewer than 20% of CD4+T cells. Collectively, these findings indicated that the GZMK+lymphocytes are highly abundant and make up the majority of CD8+T in some tissues and disease settings.

[0200] CD8+T cells constitutively secrete GZMK Next, how GZMK production and release are regulated was examined by comparing the ability of peripheral blood CD8+T cells to synthesize and secrete GZMK in the presence or absence of T cell receptor (TCR) stimulation. Strikingly, unstimulated CD8+T cells constitutively secreted GZMK (Fig. 2a). The accumulation of GZMK in the supernatants of untreated cells was not accompanied by a concomitant decrease in intracellular levels over time, indicating that CD8+T cells continuously synthesize GZMK (Fig. 2a and Fig. 6f). TCR stimulation did not significantly enhance GZMK but instead led to a decrease in intracellular GZMK (Fig. 2a and Fig. 6f), indicating TCR signaling inhibits constitutive GZMK synthesis. Unlike GZMK, GZMB was not released constitutively; instead, it was synthesized and secreted solely in response to TCR stimulation (Fig. 2a). Collectively, these data demonstrated that GZMK is constitutively synthesized and released by CD8+T cells in the absence of TCR stimulation.

[0201] GZMK cleaves C4 and C2 to form C3 convertases

[0202] The abundance of GZMK-expressing lymphocytes across different tissues and disease states indicates that GZMK contributes to inflammation. Its constitutive release indicates that GZMK has continuous access to extracellular substrates, enabling it to exert functional effects on cells and tissues surrounding GZMK+ CD8+T cells at all times. To identify new substrates for GZMK, a protein BLAST14was performed and human proteins with high sequence similarity to GZMK were identified (Fig. 7a). As expected, GZMK was most closely related to its closest homolog, GZMA. The next most homologous protein was complement factor D (CFD), the initiator protease that activates the alternative complement pathway. Structural alignment of GZMK and CFD revealed a striking similarity in their overall structures and active sites (Fig. 7b). In the alternative pathway, C3b molecules associate with complement factor B (CFB), inducing a conformational change in the latter that allows CFD to cleave CFB into a proteolytically active Bb fragment3. Based on the results of the protein BLAST, it was investigated whether GZMK might also cleave CFB. Serum-purified complement components were used to assess whether activation of the alternative pathway could be recapitulated. While CFD generated the Bb fragment when incubated with CFB and C3b, active GZMK failed to generate any Bb under the same conditions (Fig. 7c).

[0203] The initiator proteases that activate the classical, lectin, and alternative complement pathways — including C1s, the mannose-binding lectin-associated serine proteases-1 and -2 (MASP-1 and MASP-2), and CFD — share a key feature with GZMK: they are tryptase-like proteases that cleave substrates after arginine or lysine15-17. GZMK also shares striking structural similarity with C1s and MASP-1 (Fig. 7d,e). Therefore, whether GZMK cleaves proteins involved in the classical and lectin complement pathways was investigated next. While both the classical and lectin pathways deploy a C3 convertase composed of C4b and C2b (C4bC2b), they each rely on distinct initiator proteases for its formation. To form this convertase, the classical pathway employs C1s to cleave C4 and C2 and generate C4b and C2b. Therefore, if GZMK can cleave C4 and C2 was tested, using active C1s as a positive control. Surprisingly, GZMK independently cleaved C4 into C4b (Fig. 2b, Fig. 8a). As a specificity control, C4 was incubated with active GZMA, the only other human granzyme that can cleave peptide bonds after basic residues, but it did not generate C4b.

[0204] Next, it was investigated whether GZMK can cleave C2 into C2b, the active enzymatic component- or the executioner protease- of the classical and lectin pathway C3 and C5 convertases. In those pathways, following cleavage of C4, C4b molecules associate with the zymogen C2 and promote its cleavage into the active form, C2b5. It was found that incubation of C2 with GZMK in the presence of C4 resulted in cleavage of C2 into C2b (Fig. 2c, Fig. 8b) identical to the cleavage product generated by C1s. Although GZMK was not as efficient as C1s in cleaving C2, C2b is known to be a highly active protease even in extremely low amounts18. Next, it was asked whether the C4b and C2b cleavage fragments generated by GZMK assemble into a C3 convertase that can cleave C3 into C3a and C3b. To test this, either C1 s, GZMK or GZMA was incubated with a mixture of C4 + C2 + C3. Like C1 s, GZMK induced the generation of C3a and C3b, while GZMA did not (Fig. 2d,e, Fig. 8c, d). GZMK did not directly cleave C3 (Fig. 8e) or induce generation of iC3b, the inactive form of C3b (Fig. 2e). These results indicate that GZMK can elicit formation of enzymatically active C3 convertases by cleaving C4 and C2 into C4b and C2b.

[0205] Fibroblasts produce complement components

[0206] Multiple lines of evidence indicate that substantial production and activation of complement occurs in RA synovial tissue and fluid19-22. To identify cell populations that could locally produce C2, C3 and C4 in RA synovium, a publicly available bulk RNA-seq data set of T cells, B cells, monocytes and fibroblasts from 51 samples of synovial tissue from patients with RA or OA13was analyzed. While monocytes expressed C2 and C3, fibroblasts were the largest producers of complement C2, C3 and C4A / B transcripts in RA synovium (Fig. 3a). Fibroblasts in RA synovial tissue also expressed C3 protein (Fig. 3b). By examining supernatants of cultured RA synovial fibroblasts, it was found that resting fibroblasts secrete C2 and C3 at modest levels but not C4 (Fig. 3c, d). Given that GZMK+CD8+T cells can produce abundant IFNG and TNF3, whether these cytokines regulate the secretion of C2, C3 and C4 by synovial fibroblasts was investigated next. IFNG and TNF each induced C2 and C3 release, while only IFNG stimulated C4 release (Fig. 3c, d). Combined stimulation with IFNG and TNF resulted in a dramatic increase in C3 secretion as compared to either cytokine alone, a synergistic effect not observed for C2 or C4 (Fig. 3d). Thus, fibroblasts were major producers of C2, C3 and C4 in RA synovium, especially in response to the T cell-derived cytokines IFNG and TNF.

[0207] Next, it was tested whether active GZMK can trigger formation of an active C3 convertase from complement components secreted by synovial fibroblasts. To this end, synovial fibroblasts were stimulated in vitro with a combination of IFNG and TNF, the supernatants were isolated, and incubated with C1s, GZMK or GZMA. The addition of C1s or GZMK, but not GZMA, resulted in generation of C3a and C3b (Fig. 3e) from fibroblast-derived complement components. Together, these results indicated that GZMK can elicit formation of a C3 convertase by cleaving complement proteins produced by synovial fibroblasts.

[0208] GZMK triggers generation of active C3a

[0209] To assess the bioactivity of C3a produced by the C3 convertases generated by GZMK, its ability to trigger mast cell degranulation, a hallmark effect of C3a23was tested. C1s or GZMK were incubated with serum-purified C2 + C3 + C4 and the reaction products were transferred to human mast cells in the presence of an anti-LAMP-1 antibody to detect degranulation. While the addition of C3 alone did not elicit mast cell degranulation, reactions containing C2 + C3 + C4 and either C1s or GZMK induced strong mast cell degranulation, comparable to that induced by serum purified C3a, as evidenced by LAMP-1 translocation to the cell surface (Fig. 4a).

[0210] GZMK binds surfaces to drive opsonization

[0211] Opsonization, a fundamental effector function of the complement cascade, depends on the covalent attachment of C4b and C3b molecules to a target surface. Following cleavage of C4 and C3, newly processed C4b and C3b fragments undergo a conformational change that unveils a highly reactive thioester, previously concealed within the intact molecules. This thioester forms covalent bonds with nearby hydroxyl or amino groups on a target surface, enabling its opsonization3. However, if C4 or C3 are cleaved in the fluid phase- distant from reactive surface groups- the exposed thioester in C4b and C3b is rapidly inactivated by water hydrolysis, rendering these fragments incapable of opsonizing a surface. Therefore, efficient C4b- and C3b-mediated opsonization requires that the initiator proteases of the cascade are bound to the target surface, ensuring that complement activation occurs in close proximity to reactive sites.

[0212] To test whether GZMK can readily bind cell surfaces, human endothelial cells (HUVECs), human synovial fibroblasts and THP-1 monocytes were incubated with GZMK on ice, the cells were washed and surface GZMK staining was assessed by flow cytometry. Indeed, abundant GZMK was found on the surface of nearly 100% of the cells (Fig. 4b). In contrast, C1 s was not able to bind cell membranes, except when the entire C1 complex, containing C1 q, C1 r and C1 s, was added to cells that were sensitized with cell type-specific antibodies that can be bound by the soluble pattern recognition receptor, C1 q (Fig. 9a). To determine if GZMK can elicit C3b-mediated opsonization, its ability to induce C3b deposition on the plasma membrane of HUVECs was assessed. Incubation of HUVECs with serum- purified C2 + C3 + C4 in the presence of GZMK, but not GZMA, resulted in cell-surface C3b deposition (Fig. 4c and Fig. 9b). In contrast, C1 s was not capable of triggering C3b deposition on HUVECs (Fig. 4c) at concentrations at which it induced generation of C3a and C3b in the fluid phase (Fig. 2d,e and Fig. 4a). Therefore, in contrast to C1 s, GZMK directly binds to plasma membranes to trigger formation of membrane-bound C3 convertases and to elicit efficient opsonization of target surfaces.

[0213] GZMK binds heparan sulfate glycosaminoglycans

[0214] All human granzymes are highly cationic, with isoelectric points of about 101. GZMB has been demonstrated to bind plasma membranes through ionic interactions with negatively charged molecules including heparan sulfate glycosaminoglycans24-27. Like GZMB27, GZMK has a heparin binding region28. To investigate whether GZMK associates with cell membranes via interactions with heparin sulfate glycosaminoglycans, whether cell types with higher levels of surface heparan sulfate exhibit greater capacity to bind GZMK on their plasma membranes was first examined. Indeed, a strong correlation was found between surface heparan sulfate abundance and the ability to bind exogenous GZMK among endothelial cells, B cells, T cells and monocytes (Fig. 9c, d). To test whether GZMK surface binding is mediated by heparin binding moieties, HUVECs were incubated with GZMK + C2 + C3 + C4. The addition of soluble heparin effectively inhibited GZMK binding to the cell surface, thereby abrogating its ability to induce C3b-mediated opsonization of HUVECs (Fig. 4d and Fig. 9e). To determine whether GZMK’s strong affinity for membranes enhances its ability to activate complement, its efficiency in the membrane-bound state was compared versus the fluid phase. To do this, GZMK was incubated with C2 + C3 + C4 in the presence or absence of HUVECs, and the generation of C4a, C2a and C3a by immunoblot was assessed. While GZMK cleaved C4 with similar efficiency in both phases at early time points, membrane-bound GZMK generated significantly more C4a by the end of the reactions (Fig. 4e, Fig. 9f). Furthermore, membrane-bound GZMK was superior at cleaving C2 and triggered the generation of significantly more C3a over time than it did in solution. Collectively, these findings demonstrated that, unlike C1s, GZMK does not require a soluble pattern recognition receptor to localize to a surface. Instead, GZMK directly binds membranes, where it exhibits greater catalytic efficiency than in the fluid phase, effectively cleaving C4 and C2 to assemble membrane-bound C3 convertases that generate bioactive C3a and C3b.

[0215] GZMK elicits formation of C5 convertases

[0216] Formation of a C5 convertase, the final enzymatic step in the complement cascade, requires addition of C3b molecules to a membrane-localized C3 convertase29-33. Once C3b molecules associate with C4bC2b, the convertase shifts its substrate specificity, enabling cleavage of C5 into two products: C5a, a potent anaphylatoxin, and C5b33. The C5b fragment subsequently recruits C6, C7, C8 and C9 molecules to form the MAC, also known as the TCC, on the plasma membrane of the target cell3. To determine whether GZMK can elicit formation of a C5 convertase, HUVECs were incubated with GZMK and C2 + C3 + C4 + C5 and the generation of C5a was assessed by ELISA. GZMK, but not GZMA, induced C5a production in a dose-dependent manner (Fig. 4f). The C5a produced was bioactive, as supernatants from HUVECs incubated with GZMK and C2 + C3 + C4 + C5 triggered calcium flux in C5aR1 -expressing cells (Fig. 4g and Fig. 10a). To assess whether GZMK can drive TCC formation, HUVECs were incubated with GZMK and C2 + C3 + C4 + C5 + C6 + C7 + C8 + C9 and the presence of membrane TCCs by flow cytometry was evaluated. GZMK, but not GZMA, induced a dose-dependent increase in TCC formation on the membrane of HUVECs (Fig. 4h). This effect was comparable to the positive control, where purified C5b,6 was added to cells along with C7, C8 and C9. GZMK-dependent TCC formation was further enhanced when HUVECs were treated with dynasore (Fig. 10b), an inhibitor of dynamin-dependent endocytosis, which has been reported to increase TCC formation on cell membranes34’35.

[0217] The findings demonstrate that GZMK can activate the complement cascade when incubated with complement proteins purified from serum or present in the supernatants of cytokine-stimulated fibroblasts. To extend these observations, whether GZMK could similarly activate complement when incubated with whole serum was investigated. Incubation of HUVECs with GZMK in the presence of C1 q- depleted serum (devoid of antibody-mediated activation of the classical pathway) resulted in deposition of C3b and C4d (a breakdown product of C4b), as well as TCC formation, on the surface of the cells (Fig. 4i, Fig. 10c). Together, these observations demonstrated that GZMK can activate the entire complement cascade, beginning with cleavage of C4 and C2, progressing to the assembly of C3 and C5 convertases, and culminating in the production of the anaphylatoxins C3a and C5a, the opsonin C3b, and the TCC.

[0218] GZMK and complement co-localize in RA To find evidence that GZMK induces complement activation in tissues, immunofluorescence microscopy was performed on synovial tissue sections from patients with RA. Specifically, it was examined whether regions with C3b deposition and C5a production overlapped with areas rich in GZMK. Using an antibody against C3d, a stable breakdown product of C3b, complement deposition in regions with abundant GZMK was detected (Fig. 5a and Fig. 11 a-c). Further, C5a was also present in the same GZMK-enriched regions (Fig. 5a and Fig. 11 a,d,e). These findings were confirmed using a second set of antibodies against C3d and C5a (Fig. 11 b-e). Thus, these results provide evidence that complement activation occurs prominently in GZMK-rich areas within inflamed RA tissues, supporting a role for GZMK in driving local complement-mediated inflammation.

[0219] GZMK drives complement activation and disease

[0220] To further define the role of the GZMK-complement pathway in vivo, mice deficient in GZMK (Gzmk1) were utilized in two models of human diseases characterized by a high prevalence of GZMK+cells: RA and psoriasis36. For RA, the T cell-dependent antigen-induced arthritis (AIA) model was used, which employs methylated bovine serum albumin as the antigen37. Strikingly, Gzmk1- mice exhibited significantly reduced swelling in mBSA-injected wrist joints compared to both Gzmk+ +and Gzmk+- mice (Fig. 5b and Fig. 12a).

[0221] Next, it was evaluated whether the loss of Gzmk resulted in reduced complement activation in the AIA model, which may explain the observed decrease in clinical joint swelling. To assess this, joints from affected animals were harvested and decalcified and immunofluorescence microscopy was performed to detect the complement cleavage products C3d and C4d. Joints from mBSA-treated Gzmk-1- mice exhibited significantly lower levels of C3d and C4d staining in the synovium and surrounding soft tissues in the wrist compared to Gzmk+ +controls (Fig. 5c, d and Fig. 12b). Similarly, the knees of mBSA-treated Gzmk-1- mice displayed decreased swelling and reduced C3d and C4d deposition when compared to Gzmk+,+mice (Fig. 13a-d). Together, these findings demonstrated that GZMK is a key driver of complement activation and joint inflammation in a murine model of inflammatory arthritis. Next, whether GZMK drives inflammatory pathology and complement activation in a second mouse model of inflammatory disease: imiquimod (IMQ)-induced dermatitis, a model of human psoriasis was investigated. Human psoriatic skin is enriched in GZMK+T-cells36, and C3-deficient mice exhibit less severe IMQ dermatitis38. However, the specific pathway driving complement activation in human psoriasis and IMQ- induced dermatitis remains unknown. Gzmk1- mice treated with IMQ developed significantly less severe psoriasiform dermatitis, as evidenced by decreased erythema, scaling and skin thickness when compared to Gzmk+I+or Gzmk+ / - mice (Fig 5e,f and Fig. 14a). Immunofluorescence microscopy further revealed a profound reduction in complement activation in the dermis of Gzmk1- mice, in contrast to the abundant C4d and C3d found in the Gzmk+,+controls (Fig. 5g, h and Fig.14b). Interestingly, significant C3d accumulation in subcutaneous tissues exclusively in Gzmk+I+mice was also observed (Fig. 14b). Collectively, these findings in two independent animal models highlight GZMK as a critical mediator of inflammatory pathology and complement activation in tissues.

[0222] SUMMARY Akin to C1 s and MASP-1 and MASP-2, the proteases that catalyze activation of the classical and lectin pathways, GZMK is an initiator protease that directly cleaves C4 and C2 into C4b and C2b. While the GZMK pathway generates the same C3 and C5 convertases as the classical and lectin pathways, it exhibits distinct mechanistic features that set it apart (Fig. 15a, b). Activation of the classical and lectin pathways occurs in three sequential steps: recognition, initiation and execution. The initial recognition step is mediated by soluble pattern recognition receptors, such as C1 q, which detect specific danger- associated signals on a target surface3. This recognition event triggers the activation of initiator proteases that are non-covalently associated with these recognition molecules, positioning the enzymes on a surface where they can direct activation of the complement cascade. During the initiation phase, the activated initiator proteases cleave the first substrates of the proteolytic cascade, C4 and C2, leading to the assembly of enzymatic complexes known as C3 and C5 convertases3. These convertases act as the executioners of the pathway, cleaving C3 and C5 to generate all the effector molecules of the complement cascade. In contrast to the initiator proteases of the classical and lectin pathways, GZMK independently mediates the first two steps: recognition and initiation. Its capacity to 1 ) bind heparan sulfate glycosaminoglycans and 2) cleave C2 and C4 enables GZMK to orchestrate the assembly of membrane-bound C3 and C5 convertases to trigger activation of the entire complement cascade. Further, unlike some of the proteases involved in the contact, coagulation and fibrinolysis cascades that have been reported to cleave C3 and / or C5 and generate bioactive fragments3940, GZMK does not directly cleave C3 or C5. Instead, by acting at the earliest stage of complement activation, GZMK independently orchestrates every step of the proteolytic cascade while also amplifying its activation by recruiting the alternative pathway amplification loop.

[0223] The results described herein demonstrate that GZMK-mediated complement activation contributes to disease pathogenesis in vivo. In human RA synovium, evidence of complement activation in regions where GZMK+ cells were prevalent was found. Additionally, Gzmk-deficient mice displayed reduced disease severity and complement activation in two separate models of inflammatory disease: a model of arthritis and a model of psoriasiform dermatitis. These findings indicate that GZMK activates the complement cascade in vivo, driving inflammatory pathology in disease.

[0224] In disease, GZMK-expressing T cells are significantly more abundant, emerging as the predominant CD8+T cell phenotype across inflamed tissues in various autoimmune diseases, including RA, Crohn’s disease, Sjogren’s syndrome41and multiple sclerosis42. Beyond autoimmune diseases, GZMK+ CD8+T cells are found in high numbers in many tissues in aged humans and mice43. This accumulation is linked to inflammaging, a hallmark of aging characterized by chronic, low-grade systemic inflammation in the absence of infection. Inflammaging is associated with increased susceptibility to age- related diseases where GZMK+ T cells also accumulate, such as osteoarthritis, cancer44, neurodegenerative disorders45and cardiovascular disease46- conditions in which the complement system plays an important role47-50. Therefore, the widespread presence of GZMK+ T cells across various tissues and contexts indicates that GZMK-mediated complement activation may have important roles in maintaining tissue homeostasis, contributing to disease pathology and shaping the inflammatory landscape in aging. In summary, GZMK has been identified as an initiator protease that can independently activate the entire complement cascade. This work highlights GZMK as a promising target to inhibit complement activation across multiple diseases where GZMK-expressing lymphocytes are enriched.

[0225] Example 2. Investigation of the role of GZMK-specific monoclonal antibodies on GZMK function.

[0226] The role of GZMK-specific monoclonal antibodies on GZMK function was investigated.

[0227] Fig. 16 shows GZMK-specific monoclonal antibodies block GZMK-mediated C3b opsonization. HUVEC cells were incubated with complement C2 + C3 + C4 in the presence of recombinant GZMK and either an isotype control antibody or monoclonal antibodies that bind GZMK. Percent of C3b-opsonized HUVECs was assessed by flow cytometry.

[0228] The names and sources of the anti-Granzyme K antibodies tested in Fig. 16 are as follows:

[0229] Anti-hGZMK mAb, clone GM26E7, mouse IgG 1 (Biolegend, cat# 37052)

[0230] Anti-hGZMK mAb, clone GM6C3, mouse lgG2b (SantaCruz, cat# sc56125)

[0231] Anti-hGZMK mAb, clone GM-24C3, mouse lgG2b (Abeam, cat# AB3771 )

[0232] Anti-hGZMK mAb, clone EPR24601 -178, rabbit IgG (Abeam, cat# AB313710)

[0233] Anti-hGZMK mAb, clone EPR24601 -14, rabbit IgG (Abeam, cat# AB31371 1 )

[0234] Such antibodies could be used to inhibit GZMK activity.

[0235] Example 3. Investigation of SIRPG as a potential marker that enriches GZMK+ CD8+ T cells.

[0236] Signal Regulatory Protein Gamma (SIRPG) was investigated as a potential marker that is enriched GZMK+ CD8+ T cells.

[0237] Fig. 17 shows that the majority of GZMK+ T cells express SIRPG on their surface. Healthy peripheral blood mononuclear cells (PBMCs, top row) and inflamed synovial fluid mononuclear cells (bottom row) were analyzed by flow cytometry. The CD8+T cells are shown. It is shown that the majority of GZMK-expressing CD8+T cells express SIRPG (third column, c). This figure shows that SIRPG can act as a potential marker for GZMK+ CD8+ T cells and could be targeted to deplete these cells.

[0238] REFERENCES

[0239] 1 . Anthony, D. A., Andrews, D. M., Watt, S. V., Trapani, J. A. & Smyth, M. J. Functional dissection of the granzyme family: cell death and inflammation. Immunol. Rev. 235, 73-92 (2010).

[0240] 2. Jonsson, A. H. et al. Granzyme K+ CD8 T cells form a core population in inflamed human tissue.

[0241] Sci. Transl. Med. 14, eabo0686 (2022).

[0242] 3. Ricklin, D., Hajishengall is, G., Yang, K. & Lambris, J. D. Complement: a key system for immune surveillance and homeostasis. Nat. Immunol. 11 , 785-797 (2010).

[0243] 4. Holers, V. M. & Banda, N. K. Complement in the initiation and evolution of rheumatoid arthritis. Front. Immunol. 9, 1057 (2018).

[0244] 5. Ricklin, D., Reis, E. S. & Lambris, J. D. Complement in disease: a defense system turning offensive. Nat. Rev. Nephrol. 12, 383-401 (2016).

[0245] 6. Gutierrez-Arcelus, M. et al. Lymphocyte innateness defined by transcriptional states reflects a balance between proliferation and effector functions. Nat. Common. 10, 687 (2019). 7. Zhang, F. et al. Deconstruction of rheumatoid arthritis synovium defines inflammatory subtypes. Nature 623, 616-624 (2023).

[0246] 8. Smillie, C. S. etal. Intra- and inter-cellular rewiring of the human colon during ulcerative colitis. Cell 178, 714-730. e22 (2019).

[0247] 9. Martin, J. C. etal. Single-cell analysis of Crohn’s disease lesions identifies a pathogenic cellular module associated with resistance to anti-TNF therapy. Ce / / 178, 1493-1508. e20 (2019).

[0248] 10. Stephenson, W. etal. Single-cell RNA-seq of rheumatoid arthritis synovial tissue using low-cost microfluidic instrumentation. Nat. Commun. 9, 791 (2018).

[0249] 11 . Liao, M. et al. Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19. Nat. Med. 26, 842-844 (2020).

[0250] 12. Arazi, A. etal. The immune cell landscape in kidneys of patients with lupus nephritis. Nat. Immunol. 20, 902-914 (2019).

[0251] 13. Zhang, F. et al. Defining inflammatory cell states in rheumatoid arthritis joint synovial tissues by integrating single-cell transcriptomics and mass cytometry. Nat. Immunol. 20, 928-942 (2019).

[0252] 14. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403-410 (1990).

[0253] 15. Cooper, N. R. The classical complement pathway: activation and regulation of the first complement component. Adv. Immunol. 37, 151-216 (1985).

[0254] 16. Lesavre, P. H. & Muller-Eberhard, H. J. Mechanism of action of factor D of the alternative complement pathway. J. Exp. Med. 148, 1498-1509 (1978).

[0255] 17. Ambrus, G. et al. Natural substrates and inhibitors of mannan-binding lectin-associated serine protease-1 and -2: a study on recombinant catalytic fragments. J. Immunol. 170, 1374-1382 (2003).

[0256] 18. Opferkuch, W., Rapp, H. J., Colten, H. R. & Borsos, T. Immune hemolysis and the functional properties of the second (C2) and fourth (C4) components of complement. 3. The hemolytic efficiency of human and guinea pig C2 and C4. J. Immunol. 106, 927-931 (1971 ).

[0257] 19. Ruddy, S. & Colten, H. R. Rheumatoid arthritis. Biosynthesis of complement proteins by synovial tissues. N. Engl. J. Med. 290, 1284-1288 (1974).

[0258] 20. Brodeur, J. P., Ruddy, S., Schwartz, L. B. & Moxley, G. Synovial fluid levels of complement SC5b-9 and fragment Bb are elevated in patients with rheumatoid arthritis. Arthritis Rheum. 34, 1531-1537 (1991 ).

[0259] 21 . Konttinen, Y. T. et al. Complement in acute and chronic arthritis: assessment of C3c, C9, and protectin (CD59) in synovial membrane. Ann. Rheum. Dis. 55, 888-894 (1996).

[0260] 22. Happonen, K. E., Heinegard, D., Saxne, T. & Blom, A. M. Interactions of the complement system with molecules of extracellular matrix: relevance for joint diseases. Immunobiology 217 , 1088-1096 (2012).

[0261] 23. Elieh Ali Komi, D., Shafaghat, F., Kovanen, P. T. & Meri, S. Mast cells and complement system: Ancient interactions between components of innate immunity. Allergy 75, 2818-2828 (2020).

[0262] 24. Shi, L. et al. Granzyme B binds to target cells mostly by charge and must be added at the same time as perforin to trigger apoptosis. J. Immunol. 174, 5456-5461 (2005).

[0263] 25. Raja, S. M. et al. A novel mechanism for protein delivery: granzyme B undergoes electrostatic exchange from serglycin to target cells. J. Biol. Chem. 280, 20752-20761 (2005). 26. Kurschus, F. C., Bruno, R., Fellows, E., Falk, C. S. & Jenne, D. E. Membrane receptors are not required to deliver granzyme B during killer cell attack. Blood 105, 2049-2058 (2005).

[0264] 27. Bird, C. H. et al. Cationic sites on granzyme B contribute to cytotoxicity by promoting its uptake into target cells. Mol. Cell. Biol. 25, 7854-7867 (2005).

[0265] 28. Hink-Schauer, C. et al. The 2.2-A crystal structure of human pro-granzyme K reveals a rigid zymogen with unusual features. J. Biol. Chem. 277, 50923-50933 (2002).

[0266] 29. Berends, E. T. M. et al. Molecular insights into the surface-specific arrangement of complement C5 convertase enzymes. BMC Biol. 13, 93 (2015).

[0267] 30. Rawal, N. & Pangburn, M. K. Formation of high affinity C5 convertase of the classical pathway of complement. J. Biol. Chem. 278, 38476-38483 (2003).

[0268] 31 . Rawal, N., Rajagopalan, R. & Salvi, V. P. Activation of complement component C5: comparison of C5 convertases of the lectin pathway and the classical pathway of complement. J. Biol. Chem. 283, 7853-7863 (2008).

[0269] 32. Rawal, N. & Pangburn, M. Formation of high-affinity C5 convertases of the alternative pathway of complement. J. Immunol. 166, 2635-2642 (2001 ).

[0270] 33. Pangburn, M. K. & Rawal, N. Structure and function of complement C5 convertase enzymes. Biochem. Soc. Trans. 30, 1006-1010 (2002).

[0271] 34. Georgiannakis, A. et al. Retinal pigment epithelial cells mitigate the effects of complement attack by endocytosis of C5b-9. J. Immunol. 195, 3382-3389 (2015).

[0272] 35. Moskovich, O., Herzog, L.-O., Ehrlich, M. & Fishelson, Z. Caveolin-1 and dynamin-2 are essential for removal of the complement C5b-9 complex via endocytosis. J. Biol. Chem. 287, 19904-19915 (2012).

[0273] 36. Liu, J. et al. Single-cell RNA sequencing of psoriatic skin identifies pathogenic Tc17 cell subsets and reveals distinctions between CD8+ T cells in autoimmunity and cancer. J. Allergy Clin. Immunol. 147, 2370-2380 (2021 ).

[0274] 37. van den Berg, W. B., Joosten, L. A. B. & van Lent, P. L. E. M. Murine antigen-induced arthritis. Methods Mol. Med. 136, 243-253 (2007).

[0275] 38. Giacomassi, C. etal. Complement C3 exacerbates imiquimod-induced skin inflammation and psoriasiform dermatitis. J. Invest. Dermatol. 137, 760-763 (2017).

[0276] 39. Amara, U. et al. Molecular intercommunication between the complement and coagulation systems. J. Immunol. 185, 5628-5636 (2010).

[0277] 40. Irmscher, S. etal. Kallikrein cleaves C3 and activates complement. J. Innate Immun. 10, 94-105 (2018).

[0278] 41 . Xu, T. et al. Single-cell profiling reveals pathogenic role and differentiation trajectory of granzyme K+CD8+ T cells in primary Sjogren’s syndrome. JCI Insights, (2023).

[0279] 42. Koetzier, S. C. etal. Distinct effector programs of brain-homing CD8+ T cells in multiple sclerosis. Cells 11 , 1634 (2022).

[0280] 43. Mogilenko, D. A. et al. Comprehensive profiling of an aging immune system reveals clonal GZMK+ CD8+ T cells as conserved hallmark of inflammaging. Immunity 54, 99-115.e12 (2021 ). 44. Tiberti, S. et al. GZMKhigh CD8+ T effector memory cells are associated with CD15high neutrophil abundance in non-metastatic colorectal tumors and predict poor clinical outcome. Nat. Commun. 13, 6752 (2022).

[0281] 45. Duan T., Chu J. & Hu F. Identification of peripheral blood GZMK + CD8 + T cells as biomarkers of Alzheimer’s disease based on single-cell transcriptome. Sichuan Da Xue Xue Bao Yi Xue Ban 54, 863-873 (2023).

[0282] 46. Fernandez, D. M. et al. Single-cell immune landscape of human atherosclerotic plaques. Nat. Med. 25, 1576-1588 (2019).

[0283] 47. Kiss, M. G. & Binder, C. J. The multifaceted impact of complement on atherosclerosis. Atherosclerosis 351 , 29-40 (2022).

[0284] 48. Dalakas, M. C., Alexopoulos, H. & Spaeth, P. J. Complement in neurological disorders and emerging complement-targeted therapeutics. Nat. Rev. Neurol. 16, 601-617 (2020).

[0285] 49. Roumenina, L. T., Daugan, M. V., Petitprez, F., Sautes-Fridman, C. & Fridman, W. H. Context- dependent roles of complement in cancer. Nat. Rev. Cancer 19, 698-715 (2019).

[0286] 50. Wang, Q. et al. Identification of a central role for complement in osteoarthritis. Nat. Med. 17, 1674- 1679 (2011 ).

[0287] 51 . Donlin, L. T. etal. Methods for high-dimensional analysis of cells dissociated from cryopreserved synovial tissue. Arthritis Res. Ther. 20, 139 (2018).

[0288] 52. Korsunsky, I. et al. Fast, sensitive and accurate integration of single-cell data with Harmony. Nat. Methods 16, 1289-1296 (2019).

[0289] 53. Mclnnes, L., Healy, J. & Melville, J. UMAP: Uniform Manifold Approximation and Projection for Dimension Reduction. arXiv [stat.ML] (2018).

[0290] 54. Zhang, F. et al. IFN-y and TNF-a drive a CXCL10+ CCL2+ macrophage phenotype expanded in severe COVID-19 lungs and inflammatory diseases with tissue inflammation. Genome Med. 13, 64 (2021 ).

[0291] 55. Boudhabhay, I., Grunenwald, A. & Roumenina, L. T. Complement C3 deposition on endothelial cells revealed by flow cytometry. Methods Mol. Biol. 2227, 97-105 (2021 ).

[0292] 56. van der Fits, L. et al. Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23 / IL-17 axis. J. Immunol. 182, 5836-5845 (2009).

[0293] Numbered embodiments

[0294] 1 . A method for treating an inflammatory disease or condition in a patient comprised of administering to said patient one or multiple therapeutically effective doses or amounts of an agent that blocks, inhibits or reduces the expression / activity of Granzyme K (GZMK).

[0295] 2. A method for treating an inflammatory disease or condition in a patient comprised of an intervention step that (i) depletes one or more populations of cells that express GZMK or (ii) modifies the production of GZMK by said population of cells.

[0296] 3. The method of embodiment 2 wherein the population of said cells are GZMK+ lymphocytes.

[0297] 4. The method of embodiment 3 wherein the GZMK+ lymphocyte cell population includes CD8 T cells, NKT cells, NK cells, MAIT cells, or y5T cells.

[0298] 5. The method of embodiment 1 wherein the agent is a monoclonal antibody, Fc-fusion protein or other recombinant protein that targets GZMK.

[0299] 6. The method of embodiment 1 wherein the agent is a small molecule that inhibits GZMK or blocks / inhibits the binding of GZMK to Complement components.

[0300] 7. The method of embodiment 1 wherein the agent is an siRNA that inhibits GZMK gene expression.

[0301] 8. The method of embodiment 1 wherein the agent is a cytokine or other modulatory factor what alters GZMK expression in lymphocytes.

[0302] 9. The method of embodiment 2 or 3 wherein the intervention step is the depletion of GZMK+ CD8 T cells, locally or systemically, by targeting of surrogate surface markers

[0303] 10. The method of embodiment 2 or 3 wherein the intervention step is the blockade of GZMK+ cell migration by targeting chemokine receptors or integrins.

[0304] 11 . The method of embodiment 1 or 2 wherein the inflammatory disease or condition of is one in which GZMK+ cells accumulate in the affected tissues and / or the inflammatory disease or condition is one for which the Complement cascade pathway is known to play a role.

[0305] 12. The method of embodiment 1 or 2 wherein the inflammatory disease or condition is autoimmune.

[0306] 13. The method of embodiment 12 wherein the autoimmune disease or condition is selected from, but not limited to, Rheumatoid Arthritis, Psoriatic Arthritis, Osteoarthritis, Lupus, Glomerulonephritis, and Inflammatory Bowel Disease.

[0307] 14. The method of embodiment 1 or 2 wherein the inflammatory disease or condition is non-autoimmune.

[0308] 15. The method of embodiment 14 wherein the non-autoimmune disease or condition is selected from, but not limited to: (i) rejection of transplanted organs; (ii) atherosclerosis; (iii) diabetes (type 1 and type 2); (iv) Acute Respiratory Distress Syndrome (ARDS) due to viral infections and (v) ARDS due to other conditions.

[0309] 16. The method of embodiment 1 or 2 wherein the inflammatory disease or condition is associated with viral infection or infectious disease.

[0310] 17. The method of embodiment 16 wherein the viral infection is acute.

[0311] 18. The method of embodiment 17 wherein the acute viral infection is selected from, but not limited to,

[0312] COVID-19 or another Coronavirus.

[0313] 19. The method of embodiment 16 wherein the viral infection is chronic.

[0314] 20. The method of embodiment 19 wherein the chronic viral infection is selected from, but not limited to, hepatitis B, hepatitis C, EBV, CMV, and HIV.

[0315] 21 . A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent that reduces expression of or inhibits an activity of GZMK.

[0316] 22. The method of embodiment 21 , wherein the agent is a full-length antibody or functional fragment thereof, a small molecule, or an inhibitory RNA molecule.

[0317] 23. The method of embodiment 22, wherein the antibody is a monoclonal antibody.

[0318] 24. The method of embodiment 22, wherein the antibody is clone GM26E7, clone GM6C3, clone GM- 24C3, clone EPR24601 -178, or clone EPR24601 -14.

[0319] 25. The method of embodiment 22, wherein the inhibitory RNA molecule is a small interfering RNA (siRNA), an anti-sense oligonucleotide, a short hairpin RNA, a double-stranded RNA, or a microRNA. 26. The method of embodiment 25, wherein the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 15, 19, 21 , or 25 nucleotides set forth within the sequence of SEQ ID NO: 1 .

[0320] 27. The method of embodiment 26, wherein the siRNA contains 3’ overhangs.

[0321] 28. The method of embodiment 26 or 27, wherein the siRNA comprises a non-natural or modified nucleoside or nucleotide.

[0322] 29. The method of any one of embodiments 26-28, wherein the siRNA comprises the sequence CAACCTTGTCCCGCCTCATACAAAT (SEQ ID NO: 2), CCGCCTCATACAAATTAAGTTACAA (SEQ ID NO: 3), CAGGTTAGAGTTGGGTGTAAGTAAA (SEQ ID NO: 4), CAAAGGGCAATAAGGTCACTGAATA (SEQ ID NO: 5), or CCACCTTCAACTAGGTGTAACTTCT (SEQ ID NO: 6).

[0323] 30. The method of embodiment 22, wherein the small molecule is Compound A

[0324] (FPR-CMK);

[0325] Glu-Gly-Arg-chloromethyl ketone (EGR-CMK);

[0326] D-Phe-Pro-Lys-chloromethyl ketone;

[0327] Phenylmethylsulfonyl fluoride (PMSF); or 4-(2-Aminoethyl)-benzolsulfonylfluorid-hydrochloride.

[0328] 31 . The method of embodiment 20, wherein the agent inhibits GzmK gene expression.

[0329] 32. The method of embodiment 20, wherein the agent inhibits an activity of GzmK.

[0330] 33. The method of embodiment 32, wherein the activity is inhibiting binding to a complement pathway component or inhibiting a proteolytic activity.

[0331] 34. The method of embodiment 20, wherein the agent is a cytokine or a modulatory factor that alters GZMK expression in a myeloid cell or a lymphocyte.

[0332] 35. A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising reducing the number of cells expressing GZMK in the subject or reducing the production of GZMK in a cell in the subject.

[0333] 36. The method of embodiment 35, wherein the cell is a myeloid cell.

[0334] 37. The method of embodiment 35, wherein the cell is a lymphocyte. 38. The method of embodiment 37, wherein the lymphocyte is a CD8+T cell, a CD4+T cell, a natural killer (NK) T cell, a NK cell, a mucosal-associated invariant T (MAIT) cell, an innate-like lymphocyte, or a y5 T cell.

[0335] 39. The method of embodiment 35, wherein the reducing comprises targeting a surface marker on the cell.

[0336] 40. The method of embodiment 39, wherein the surface marker is SIRPG or a chemokine receptor.

[0337] 41 . The method of embodiment 35, wherein migration of the cell is inhibited by targeting a chemokine receptor or an integrin.

[0338] 42. The method of any one of embodiments 20-41 , wherein the inflammatory condition or disorder is an autoimmune condition or disorder.

[0339] 43. The method of any one of embodiments 20-41 , wherein the inflammatory condition or disorder is associated with a viral infection.

[0340] 44. The method of embodiment 43, wherein the viral infection is acute.

[0341] 45. The method of embodiment 44, wherein the viral infection is a coronavirus infection.

[0342] 46. The method of embodiment 45, wherein the coronavirus infection is a SARS-CoV-2 infection.

[0343] 47. The method of embodiment 43, wherein the viral infection is chronic.

[0344] 48. The method of embodiment 47, wherein the viral infection is a hepatitis B virus infection, a hepatitis C virus infection, an Epstein Barr virus infection, a cytomegalovirus infection, or a human immunodeficiency virus infection.

[0345] 49. The method of any one of embodiments 20-41 , wherein the inflammatory condition or disorder is rejection of a transplanted organ, atherosclerosis, type 1 diabetes, type 2 diabetes, acute respiratory distress syndrome, osteoarthritis, cancer, a neurodegenerative disorder, a fibrosing disorder, a cardiovascular disease, an age-related disease, psoriatic arthritis, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, inflammatory arthritis, COVID-19, psoriasis, ulcerative colitis, Crohn’s disease, Sjogren’s syndrome, multiple sclerosis, glomerulonephritis, inflammatory bowel disease, psoriasis, and psoriasiform dermatitis.

[0346] 50. The method of embodiment 49, wherein the neurodegenerative disorder is Alzheimer’s disease.

[0347] 51 . The method of embodiment 49, wherein the fibrosing disorder is interstitial lung disease.

[0348] 52. The method of embodiment 49, wherein the acute respiratory distress syndrome is due to a viral infection.

[0349] 53. The method of any one of embodiments 20-41 , wherein the inflammatory condition or disorder results in the accumulation of GZMK positive cells in a tissue.

[0350] 54. The method of any one of embodiments 20-41 , wherein the inflammatory condition or disorder results from aberrant activation of a complement pathway cascade.

[0351] 55. A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising reducing the binding of GZMK to the surface of a cell in the subject.

[0352] 56. Use of an agent that reduces expression of or inhibits an activity of GZMK for treating an inflammatory condition or disorder in a subject in need thereof, wherein a therapeutically effective amount of the agent is to be administered to the subject. 57. An agent that reduces expression of or inhibits an activity of GZMK for use in treating an inflammatory condition or disorder in a subject in need thereof, wherein a therapeutically effective amount of the agent is to be administered to the subject.

[0353] 58. The use of embodiment 56, or the agent for use of embodiment 57, wherein the binding of GZMK to the surface of a cell in the subject is reduced.

[0354] 59. Reducing the number of cells expressing GZMK in a subject or reducing the production of GZMK in a cell in the subject for use in treating an inflammatory condition or disorder in the subject in need thereof.

[0355] 60. The method of embodiment 40, wherein the chemokine receptor is chemokine receptor 2 (CCR2), CCR5, CXCR3, or CX3CR1 .

[0356] 61 . The method of embodiment 40, wherein the surface markers expressed by the cell comprise CCR2, CCR5, and CXCR3.

[0357] Additional embodiments

[0358] All references cited in this specification, including, database-accessioned information (e.g., in GENBANK, UNIPROT, PUBMED), are herein incorporated by reference as though each reference was specifically and individually indicated to be incorporated by reference. The citation of any reference is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such reference by virtue of prior invention.

[0359] It will be understood that each of the elements described above, or two or more together may also find a useful application in other types of methods differing from the type described above. Without further analysis, the foregoing will so fully reveal the gist of the present disclosure that others can, by applying current knowledge, readily adapt it for various applications without omitting features that, from the standpoint of prior art, fairly constitute essential characteristics of the generic or specific aspects of this disclosure set forth in the appended claims. The foregoing embodiments are presented by way of example only.

Claims

CLAIMSWhat is claimed is:1 . A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent that reduces expression of or inhibits an activity of Granzyme K (GZMK).

2. The method of claim 1 , wherein the agent is a full-length antibody or functional fragment thereof, a small molecule, or an inhibitory RNA molecule.

3. The method of claim 2, wherein the antibody is a monoclonal antibody.

4. The method of claim 2, wherein the antibody is clone GM26E7, clone GM6C3, clone GM-24C3, clone EPR24601 -178, or clone EPR24601 -14.

5. The method of claim 2, wherein the inhibitory RNA molecule is a small interfering RNA (siRNA), an anti-sense oligonucleotide, a short hairpin RNA, a double-stranded RNA, or a microRNA.

6. The method of claim 5, wherein the inhibitory RNA molecule is an siRNA molecule and the siRNA molecule comprises a sequence that is complementary to at least 15, 19, 21 , or 25 nucleotides set forth within the sequence of SEQ ID NO: 1 .

7. The method of claim 6, wherein the siRNA contains 3’ overhangs.

8. The method of claim 6 or 7, wherein the siRNA comprises a non-natural or modified nucleoside or nucleotide.

9. The method of claims 6, wherein the siRNA comprises the sequence CAACCTTGTCCCGCCTCATACAAAT (SEQ ID NO: 2), CCGCCTCATACAAATTAAGTTACAA (SEQ ID NO: 3), CAGGTTAGAGTTGGGTGTAAGTAAA (SEQ ID NO: 4), CAAAGGGCAATAAGGTCACTGAATA (SEQ ID NO: 5), or CCACCTTCAACTAGGTGTAACTTCT (SEQ ID NO: 6).

10. The method of claim 2, wherein the small molecule is Compound A(FPR-CMK);Glu-Gly-Arg-chloromethyl ketone (EGR-CMK); D-Phe-Pro-Lys-chloromethyl ketone;Phenylmethylsulfonyl fluoride (PMSF); or 4-(2-Aminoethyl)-benzolsulfonylfluorid-hydrochloride.1 1 . The method of claim 1 , wherein the agent inhibits GZMK gene expression.

12. The method of claim 1 , wherein the agent inhibits an activity of GZMK.

13. The method of claim 12, wherein the activity is inhibiting binding to a complement pathway component or inhibiting a proteolytic activity.

14. The method of claim 1 , wherein the agent is a cytokine or a modulatory factor that alters GZMK expression in a myeloid cell or a lymphocyte.

15. A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising reducing the number of cells expressing GZMK in the subject or reducing the production of GZMK in a cell in the subject.

16. The method of claim 15, wherein the cell is a myeloid cell.

17. The method of claim 15, wherein the cell is a lymphocyte.

18. The method of claim 17, wherein the lymphocyte is a CD8+T cell, a CD4+T cell, a natural killer (NK) T cell, a NK cell, a mucosal-associated invariant T (MAIT) cell, an innate-like lymphocyte, or a yb T cell.

19. The method of claim 15, wherein the reducing comprises targeting a surface marker on the cell.

20. The method of claim 19, wherein the surface marker is SIRPG or a chemokine receptor.21 . The method of claim 15, wherein migration of the cell is inhibited by targeting a chemokine receptor or an integrin.

22. The method of claim 1 , wherein the inflammatory condition or disorder is an autoimmune condition or disorder.

23. The method of claim 1 , wherein the inflammatory condition or disorder is associated with a viral infection.

24. The method of claim 23, wherein the viral infection is acute.

25. The method of claim 24, wherein the viral infection is a coronavirus infection.

26. The method of claim 25, wherein the coronavirus infection is a SARS-CoV-2 infection.

27. The method of claim 23, wherein the viral infection is chronic.

28. The method of claim 27, wherein the viral infection is a hepatitis B virus infection, a hepatitis C virus infection, an Epstein Barr virus infection, a cytomegalovirus infection, or a human immunodeficiency virus infection.

29. The method of claim 1 , wherein the inflammatory condition or disorder is rejection of a transplanted organ, atherosclerosis, type 1 diabetes, type 2 diabetes, acute respiratory distress syndrome, osteoarthritis, cancer, a neurodegenerative disorder, a fibrosing disorder, a cardiovascular disease, an age-related disease, psoriatic arthritis, rheumatoid arthritis, systemic lupus erythematosus, lupus nephritis, inflammatory arthritis, COVID-19, psoriasis, ulcerative colitis, Crohn’s disease, Sjogren’s syndrome, multiple sclerosis, glomerulonephritis, inflammatory bowel disease, psoriasis, and psoriasiform dermatitis.

30. The method of claim 29, wherein the neurodegenerative disorder is Alzheimer’s disease.31 . The method of claim 29, wherein the fibrosing disorder is interstitial lung disease.

32. The method of claim 29, wherein the acute respiratory distress syndrome is due to a viral infection.

33. The method of claim 1 , wherein the inflammatory condition or disorder results in the accumulation ofGZMK positive cells in a tissue.

34. The method of claim 1 , wherein the inflammatory condition or disorder results from aberrant activation of a complement pathway cascade.

35. A method of treating an inflammatory condition or disorder in a subject in need thereof, the method comprising reducing the binding of GZMK to the surface of a cell in the subject.