E. coli cfae tip protein exhibits Anti-inflammatory properties for the treatment of autoimmunity
The CfaE subunit expressed by Lactococcus lactis, genetically engineered for targeted delivery, addresses the limitations of existing treatments by effectively reducing autoimmune disease symptoms through immune modulation.
Patent Information
- Application Number
- PCT/US2025/018538
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-05
- Filing Date
- 2025-03-05
- Publication Date
- 2025-09-11
AI Technical Summary
Existing vaccines and treatments for autoimmune diseases such as rheumatoid arthritis and Sjogren's syndrome are ineffective in modulating the immune response and often have harmful side effects, while the CFA/I fimbriae from Enterotoxigenic Escherichia coli have shown anti-inflammatory properties but require further refinement to be effective.
The CfaE subunit of the CFA/I fimbriae is expressed by a probiotic strain of Lactococcus lactis, genetically fused with a signal peptide and structural component to anchor to the cell wall, providing a targeted and controlled delivery mechanism for treating autoimmune diseases.
The recombinant Lactococcus lactis expressing CfaE subunit effectively reduces inflammation and autoimmune symptoms in animal models of rheumatoid arthritis and Sjogren's syndrome by promoting regulatory T cells and suppressing pro-inflammatory cytokines.
Smart Images

Figure US2025018538_12092025_PF_FP_ABST
Abstract
Description
E. coli CfaE Tip Protein Exhibits Anti-Inflammatory Properties for the Treatment of AutoimmunityGOVERNMENT SUPPORT CLAUSE
[0001] This invention was made with government support under Grant No. DE-026450 awarded by The National Institutes of Health. The government has certain rights in the invention.BACKGROUND
[0002] For bacteria to invade and colonize host tissues, they first adhere to the host tissues. Many Enterobacteriaceae possess fimbriae filaments on their surface to adhere to the surface of host body (e.g., skin, nose, ears, eyes, and respiratory, gastrointestinal, and urogenital tracts), especially to a specific receptor on the cells of the target tissues, i.e., specific sugars on the target cells.
[0003] Enterotoxigenic Escherichia coli (ETEC) is the bacteria responsible for the most common bacterial diarrheal disease of children in Latin America, Asia and Africa. For infection and subsequent colonization, ETEC needs fimbriae, referred to as colonization factor antigens (CFAs).
[0004] E. coli adheres to small intestinal epithelial cells via their fimbriae. CFA fimbriae are a heterogenous group of fimbrial adhesins. Although a specific natural receptor for CFA / I fimbriae has yet to be identified in the small intestine, some studies suggest that in eukaryotes a sialylated glycoprotein is the receptor (Tchesnokova V, 2010; Li YF, 2007), although others suggest that epithelial mannose-containing glycoproteins and / or glyco sphingolipids may also serve as receptors (Jansson L, 2006; Pascual DW 2007).
[0005] Because of its high virulence, there have been attempts to vaccinate humans against ETEC. However, oral vaccination of human volunteers with CFA / I or CFA / II fimbriae did not successfully protect humans against virulent ETEC. Since Salmonella strains are known for their ability to stimulate both mucosal and systemic immune compartments most likely via infection of Peyer's patches in the small intestine, which is followed by subsequent spread into systemic immune compartments, attenuated live Salmonella strains have been extensively used as a vector to vaccinate against salmonellosis and heterologous antigens (Galen JE, 2009; McGregor AC, 2013;Desin TS, 2013; Pasetti MF, 2003; Curtiss R, 2010; Mestecky J, 2008; Curtiss R, 2002). Such attenuated Salmonella strains have been shown to be effective in delivering heterologous antigens. Therefore, an ETEC vaccine was developed using an attenuated S'. Typhimurium vaccine carrying a plasmid encoding the CFA / I operon (Wu S, 1995; Yang X, 2012; Cao L, 2012). The expression of this fimbriae appears similar to those of wild-type ETEC. Upon oral immunization, Salmonella- CFA / I was quite adept in stimulating elevated mucosal IgA and serum IgG Abs to the fimbriae (Pascual DW, 1999). Interestingly, the CFA / I fimbriae stimulated atypical immune responses to Salmonella vaccines, without altering vaccine capacity to protect against wild-type Salmonella challenge (Walters N, 2005).
[0006] Given the highly proinflammatory nature of Salmonella, subsequent analyses assessed whether the CFA / I fimbriae interfered with the normal recognition of the bacilli. Upon infection of RAW264.7 or thioglycolate-induced macrophages with low infection ratios of Salmonella- CFA / I, minimal-to-no proinflammatory cytokines (interleukin (IL)-la, IL-10, IL-6 and tumor necrosis factor (TNF)-a) production was observed in contrast to its isogenic Salmonella vector strain eliciting all of these proinflammatory cytokines (Pascual DW, 2002).
[0007] Although the mechanism for the stealth-like qualities of Salmonella-CFAJ was not discerned, a possible explanation for these observations may be that the CFA / I fimbriae thwart innate immune responses by hindering detection by individual or a combination of pathogenrecognition receptors, including Toll-like receptor 4 (TLR4), TLR5, CD 14, MD2 and lipopolysaccharide-binding protein (Miller SI, 2005), which indicate Salmonella's, presence. Hence, it was hypothesized that the CFA / I protein may be an anti-inflammatory agent.SUMMARY
[0008] Originally conceived as a diarrheal vaccine for humans, colonization factor antigen I (CFA / I) from enterotoxigenic E. coll (ETEC) has been previously found to be potently effective in suppressing multiple sclerosis (Jun, S, 2005; Ochoa-Reparaz, J, 2007 & 2008), arthritis (Kochetkova I, 2008, 2011 & 2014; Maddaloni M, 2015), type 1 diabetes (Nelson AS, 2020 & 2021), and Sjogren’s Syndrome (SjS) (Akgul A, 2021 & 2023) in experimental animals. In addition, purified CFA / I fimbriae, given orally or nasally in lieu of live Salmonella-CE I\ as asource of fimbriae, effectively attenuated inflammation in animal arthritis model (Kochetkova I, 2014). In another study, the cfal opcron has been engineered into a Lactococcus lactis strain, referred to as L. lactis-CFAJI (LL-CFA / I). By retaining its inhibitory activity, oral administration of LL-CFA / I protected experimental animals against arthritis (Maddaloni M, 2015). Previous results also show that LL-CFA / I can attenuate genetically induced Sjogren’s syndrome via the stimulation / reactivation of diverse regulatory T cells (Tregs) producing TGF-P and IL- 10 (Akgul A, 2021 & 2023).
[0009] The majority of the immune regulatory activity of CFA / I protein is associated with CfaE, a tip protein of colonization factor antigen I (CFA / I) fimbriae, which is produced about 1000-fold less than the major subunit, CfaB (Li YF, 2009; Sakellaris H, 1996).
[0010] As shown by the data in the EXAMPLES section, it is demonstrated that only CfaE subunit is required for autoimmune disease treatment, in lieu of intact CFA / 1 fimbriae. As an example, CfaE expressed by Lactococcus lactis, a common probiotic strain, is shown to be able to dampen rheumatoid arthritis (RA) and Sjogren’s Syndrome (SjS) in animal models.
[0011] Therefore, in this disclosure, probiotic microbe expressing E. coli CfaE subunit for the treatment of inflammatory- or autoimmune disease is provided. For protein expression on the bacterial surface, the N-terminus of CfaE is fused to a structural component that anchors CfaE to the cell wall, and the N-terminus of the structural component is fused to a signal peptide. Although other structural proteins and signal peptides may be contemplated for the same purpose, here as examples, L. lactis peptidoglycan hydrolase (ACM) and L. lactis USP45 signal peptide are presented.
[0012] For probiotic microbe strain for CfaE expression, a strain can be selected from strains of Saccharomyces, Lacticaseibacillus, Lactiplantibacillus, Lactobacillus, Bifidobacterium, Enterococcus, Limosilactobacillus, Ligilactobacillus, Streptococcus, Bacillus, Leuconostoc, Pediococcus, Escherichia coli.
[0013] In addition, a nucleotide fragments comprising a nucleic acid sequence for CfaE or signal peptide-structural protein-CfaE fusion protein is provided as well as a recombinant vector comprising such nucleotide fragment, e.g., vector is plasmid, episome, bacteriophage, or virus,and a host cell comprising the nucleotide fragment, e.g., bacteria, yeast, insect cell, or mammalian cell.
[0014] Composition for the treatment of inflammatory- or autoimmune disease, which comprises probiotic microbe expressing E. coli CfaE subunit, is also provided, as a dosage form for oral administration.
[0015] Further, a use method for the composition above is provided to set dosage regimen (a daily dose and dosing times and period).
[0016] As examples of inflammatory- or autoimmune disease, rheumatoid arthritis and Sjogren’s syndrome are presented.BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1. CfaE, tip protein to CFA / I fimbriae, is active in suppressing collagen- induced arthritis (CIA). (A) The linear map depicts CfaE expression in L. lactis as a fusion with the structural component of the cell wall protein, peptidoglycan hydrolase (ACM) preceded by a USP45 secretion signal peptide. The fusion protein lacks enzymatic activity. (B) Flow cytometry analysis of L. lactis-CfaE (LL-CfaE) reveals surface expression of CfaE. An antiserum to rabbit anti-maltose binding protein-CfaE was generated, and a 1:200 dilution was used to stain LL-CfaE and LL vector (lacking CfaE). Bound rabbit antibody was detected with 1.0 pg / ml AF647-F(ab’)2 goat anti-rabbit IgG. (C, D) CIA (C) clinical scores and (D) incidence are shown in groups of B6 males (8 wk-old) induced with CIA on day 0, and treated with PBS (n=10) or 5xlO8CFUs of LL vector (n=6), LL-CFA / I (n=10), or LL-CfaE (n=10) weekly beginning on Day 14 post-CIA challenge. Mice were scored using a scale of 0-3 for each limb, for a maximal total score of 12: 0, no clinical signs; 1, mild redness of a paw or swelling of single digits; 2, significant swelling of ankle or wrist with erythema; 3, severe swelling and erythema of multiple joints. Study was terminated day 40; ***p < O.OOOlversus PBS-treated mice and ###P < 0.001 vs LL vector-treated mice.
[0018] Figure 2. LL-CfaE suppresses Sjogren’s Syndrome SjS. (A) At six weeks of age, all C57BL / 6.NOD-AecMec2 (SjS) mice were assessed for salivary flow rate (SFR; pl / g), and then separated into groups dosed with PBS (n=7), 5xl07CFUs LL vector (n=5), or 5xl07CFUs LL-CfaE (n=8) at 3-wk intervals. SFR measured at 28 wks of age revealed a significant reduction in PBS-doscd SjS mice. Treatment with LL vector did not preserve SFR as did LL-CfaE. (B) H&E histological samples of submandibular glands were evaluated for degree of inflammatory foci in treated SjS mouse groups, and (C) the number of foci quantified; ****P < 0.0001, **P < 0.01 versus PBS-dosed mice at 28 wks of age;nP < 0.01 vs. all mice at 6 wks of age; and#P < 0.05 vs LL vector-treated mice.
[0019] Figure 3. Oral treatment with Lactococcus lactis CfaE (LL-CfaE) reduces inflammatory cytokines and promotes stimulation of anti-inflammatory cytokines. Groups of C57BL / 6.NOD-Aec7Aec2 (SjS) female mice were orally dosed at 3-week intervals from six weeks of age with PBS, L. lactis (LL) vector, or LL-CfaE (same mice in Figure 1). Splenic mononuclear cells (106 / ml) were stimulated with plastic bound anti-CD3 (5 pg / ml) plus soluble (2.5 pg / ml) anti-CD28 mAbs for 48 hours at 37 °C. Cell culture supernatants were analyzed by ELISA for proinflammatory cytokines (A) ILN-y, (B) IL-6, and ( C) IL- 17, and for antiinflammatory cytokines (D) IL- 10 and (E) TGE-p. Depicted arc the means ± SEM of triplicate cultures from individual mice; ****P < 0.0002, **P = 0.014, *P < 0.05 versus PBS-treated mice; andm-p < 0.0001,##P < 0.015 versus LL vector-treated mice.DETAILED DESCRIPTION1. Definitions
[0020] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although various methods and materials similar' or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. However, the skilled artisan understands that the methods and materials used and described are examples and may not be the only ones suitable for use in the invention. Moreover, as measurements are subject to inherent variability, any temperature, weight, volume, time interval, pH, salinity, molarity or molality, range, concentration and any other measurements, quantities or numerical expressionsgiven herein are intended to be approximate and not exact or critical figures unless expressly stated to the contrary.
[0021] As used herein, the term “about” means plus or minus 20 percent of the recited value, so that, for example, “about 0.125” means 0.125 ±0.025, and “about 1.0” means 1.0 ±0.2.
[0022] As used herein, the term “fimbriae” refers to bacterial filaments protruding from the bacterial surface for attachment, either to host surfaces, to abiotic surfaces, or between bacterial cells. Generally, fimbriae are present in large numbers (100 to 1,000 filaments), however there are only one to three F pili (conjugation pili) per cell. Fimbrial filaments have a diameter of between 2 and 8 nm (thinner than flagellar filaments having a diameter of about 20 nm). Fimbriae are composed of proteins, fimbrial subunits or pilins, of which size ranges from 7 to 30 kDa. Fimbriae may be composed of a single protein, i.e., a major fimbrial subunit forms the filament for adherence. Alternatively, the major fimbrial subunit may form the filament, and additional proteins, minor fimbrial subunits, may function for the formation of branch points for fimbrial assembly, a tip fibrillum, and / or a tip adhesin. Fimbriae can be classified in various ways, and Table 1 shows the classification of E. coli fimbriae based on serological type.Table 1. Serological classification of E. coli fimbriae(Thanassi et al. Fimbriae: Classification and Biochemistry, EcoSal Plus. 2007)
[0023] Also, fimbriae can be classified into 6 classes based on amino acid sequences of the major fimbrial subunits. According to this classification method, CFA / I fimbria belongs to Class 5 characterized by the assembly through the alternate chaperone-usher pathway. (Thanassi DG,Nuccio SP, Shu Kin So S, Baumler Al. Fimbriae: Classification and Biochemistry. EcoSal Plus. 2007 Apr;2(2))
[0024] As used herein, the term “probiotics” refers to bacteria, yeasts, or mixtures of bacteria or yeasts that when ingested colonize and proliferate in the intestine, which rebalance the microbiome and help its function, c.g., enhancing digestion of food, modulating the individual’s innate and immune response, promoting and maintaining regular bowel function, improving tolerance to lactose, etc. Probiotics have been used to treat C. difficile-associated diarrhea and inflammatory bowel diseases, to provide protection from Salmonella and Helicobacter pylori disease, and as therapy for pediatric atopic dermatitis and autoimmune diseases. Probiotics are commonly gram-positive bacteria (e.g., Lactobacillus, Bifidobacterium) and yeasts (e.g., Saccharomyces). Many of these microbes can be formulated into digestible capsules for use as supplements or added to food (e.g., yogurt, kefir). The species, mixture of species, and dose and viability of the probiotic organisms within a probiotic formulation determines its potency, efficacy, and therapeutic potential, and can be used as an adjunct to medical therapy. (Murray PR, Rosenthal KS, and Pfaller MA Medical Microbiology 9thEd. 2021 by Elsevier Inc.) Examples of most often used microbial organisms in probiotic products are Saccharomyces, Lacticaseibacillus, Lactiplantibacillus, Lactobacillus, Bifidobacterium, Enterococcus, Limosilactobacillus, Ligilactobacillus, Streptococcus, Bacillus, Leuconostoc, Pediococcus, Escherichia coli,' for example, Saccharomyces boulardii, Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosus, Lactiplantibacillus plantarum, Lactobacillus acidophilus Lactobacillus johnsonii, Lactobacillus clelbrueckii subsp. Bulgarians, Lactobacillus brevis, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus fermentum ME-3, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium adolescentis, Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium longum, Enterococcus durans, Enterococcus f aecium, Limosilactobacillus reuteri, Limosilactobacillus fermentum, Ligilactobacillus salivarius, Streptococcus thermophilus, Streptococcus salivarius, Bacillus cereus, Bacillus coagulans, Leuconostoc mesenteroides, Pediococcus acidilactici. In addition, Lactococcus (e.g., L. lactis) is widely used in the manufacture of fermented dairy or meat products. L lactis has been selected as a new probiotic organism because of their safety when used in various fermented foods.
[0025] As used herein, the term “Tregs” (regulatory T cells) refers to a subset of CD4+ T cells whose main function is to suppress immune responses and essential for maintaining sclf-tolcrancc and preventing autoimmunity. CD4+ Tregs arc identified by high levels of IL-2 receptor a-chain (CD25) and the transcription factor FOX (forkhead box) P3 as well as low levels of IL-7 receptor (CD 127), and they use IL-2, but not IL-7, as their growth and survival factor. FOXP3+ Tregs also express high levels of CTLA-4 (cytotoxic T lymphocyte antigen-4), which is also required for their function. FOXP3+ Tregs are classified as thymic or peripheral based on their development site, or lymphoid or nonlymphoid (e.g., intestines, lungs, skin, and fat) based on their tissue residence. Tregs can also be classified into subsets of naive, activated, and memory Tregs according to their antigen response history.
[0026] Tregs suppress immune responses in various ways, for example, inhibiting antigen presenting cells (APCs) such as dendritic cells, macrophages, and B lymphocytes, and consequently suppressing T cell and B cell activation, and inhibiting the proliferation and differentiation of natural killer cells. Tregs also induce immune tolerance by secreting immunosuppressive cytokines IL- 10 and TGF-P, and consuming IL-2 by expressing high levels of IL-2 receptor, reducing availability of IL-2 for proliferation and differentiation of other IL-2 dependent cells. (Abbas A.K., Lichtman A.H., and Pillai S. Cellular and Molecular Immunology, 10thEd. 2022, by Elsevier Inc.)
[0027] As used herein, the term “hypersensitivity” refers to a pathologic immune response to antigen when a subject / patient is repeatedly exposed to the same antigen. A general mechanism that explains excessive immune responses is an imbalance between the effector mechanisms (e.g., CD4+ Thl, Th2, Thl7, CD8+ cytotoxic T lymphocytes (CTLs), and / or antibodies) of immune responses and the control mechanisms (Treg) that serve to normally limit such responses. Hypersensitivity diseases can be classified based on the immunologic reaction mechanisms that underlie the disease. Type I hypersensitivity (immediate hypersensitivity) is the immune response mediated by Th2 cells, IgE antibodies, and mast cells, which secret mediators that act on vascular vessels and smooth muscles, and pro-inflammatory cytokines for the recruitment of inflammatory cells. Examples of Type I hypersensitivity diseases are anaphylaxis, allergies, bronchial asthma (atopic forms). Type II hypersensitivity (antibody-mediated hypersensitivity) is mediated by secreted IgG and IgM, which bind to antigens on target cells or tissues, leading to phagocytosis orlysis (induced by activated complements or Fc receptors) to cause cell damage, recruitment of leukocytes, and promotion of inflammation to cause tissue damage. Also, antibodies may also interfere with cellular functions and cause a disease without tissue damage. Examples of Type II hypersensitivity diseases are autoimmune hemolytic anemia and Goodpasture syndrome. Type III hypersensitivity (immune complex-mediated hypersensitivity) is mediated by IgG and IgM that bind antigens usually in the circulation; the antigen-antibody complexes deposit in tissues and induce complement activation, and leukocyte recruitment. The leukocytes that are recruited (neutrophils and monocytes) release tissue damaging lysosomal enzymes and toxic free radicals, leading to inflammation. Examples of Type III hypersensitivity diseases are systemic lupus erythematosus, some forms of glomerulonephritis, serum sickness, and Arthus reaction. Type IV hypersensitivity (T cell-mediate hypersensitivity) is mediated by sensitized T cells (Thl, Thl7, and CTLs). Examples of Type IV hypersensitivity diseases are contact dermatitis, multiple sclerosis, type I diabetes, rheumatoid arthritis, inflammatory bowel disease, and tuberculosis.
[0028] T cell mediated hypersensitivity refers to hypersensitivity initiated by antigen- activated (sensitized) CD4+ T cells as well as CD8+ T cells. Many autoimmune diseases are known to be induced by inflammatory reactions caused by CD4+ T cells, including delay ed-type hypersensitivity (DTH) due to foreign antigens and chronic inflammatory reactions against selfantigens. Examples of T cell mediated hypersensitivity includes type 1 diabetes mellitus due to antigens against pancreatic islet cells causing insulitis (chronic inflammation in islets), destruction of P cells, diabetes; multiple sclerosis (protein antigens in CNS myelin) causing demyelination in CNS with perivascular inflammation, paralysis, ocular lesions; rheumatoid arthritis (unknown antigen in joint synovium (type II collagen) causing chronic arthritis with inflammation, destruction of articular cartilage and bone, Crohn disease caused by unknow antigen causing chronic intestinal inflammation and obstruction; peripheral neuropathy, Guillain-Barre syndrome (protein antigens of peripheral nerve myelin) causing neuritis and paralysis; and contact sensitivity (dermatitis) (various environment antigens, e.g., poison ivy) causing skin inflammation with blisters. (Kumar V., Abbas A.K., Fausto N., and Aster J.C. Robbins and Cotran: Pathologic Basis of Disease, 8thEd. 2010, by Saunders, Elsevier Inc.)
[0029] As used herein, the term “recombinantly expressed” relates to protein proteins that are biotechnologically produced in genetically modified organisms or cells. Methods forrecombinantly expressing proteins, are not particularly limited and are known in the art. Further details in this respect arc provided hereinafter for the second aspect of the present invention, relating to the cell lines of the present invention.
[0030] As used herein, the term "subject" refers to any animals, in particular mammals, and in more particular humans. A suitable subject for the invention is an animal or a human suspected of having, has been diagnosed as having, or is at risk of developing an inflammatory- or autoimmune disease described above that can be ameliorated, treated or prevented by compositions according to the embodiments of the invention. Preferred subjects are humans suffering from rheumatoid arthritis, Sjogren’s Syndrome, multiple sclerosis, type 1 diabetes, and other autoimmune diseases.
[0031] As used herein, the term "treatment," "treating," and the like, as used herein in the context of treating a disease or condition refer to obtaining a desired pharmacologic and / or physiologic effect. "Treatment," includes: inhibiting the condition or disease or symptom thereof, such as, arresting its development or progression and also includes relieving, alleviating or ameliorating the condition or disease or one or more symptoms thereof, such as, for example, causing relief of pain, inflammation.
[0032] As used herein, the term “composition” refers to a pharmaceutical composition, meaning a mixture of substances suitable for administering to an individual that includes one or more pharmaceutically active ingredients. For example, a pharmaceutical composition may comprise a therapeutic bacteria or virus as well as pharmaceutical excipients.
[0033] As used herein, the term “excipient”, in the context of pharmaceuticals, refer to any substances other than the active ingredient or agent, contained in pharmaceutical dosage forms. The excipients arc considered as inert substances, i.c., they do not have any active role in therapeutics, but they can be used to support the process to produce an effective product. Examples of excipients are active pharmaceutical ingredient excipients, binder excipients, capsule shell excipients, carrier excipients, coating systems excipients, controlled release excipients, diluent excipients, disintegrant excipients, effervescent system excipients, emulsifier excipients, film former excipients, flavor excipients, high-functionality excipients, lipid excipients, lubricant excipients, modified release excipients, penetration enhancer excipients, permeation enhancer excipients, pH modifier excipients, plasticizer excipients, preservative excipients, sachet filling excipients, solubilizer excipients, solvent excipients, surfactant excipients, sustained releaseexcipients, taste masking excipients, thickener excipients, viscosity modifier excipients, blending excipients, filler excipients, compaction excipients, direct compression excipients, dry granulation excipients, hot melt extrusion excipients, wet granulation excipients, rapid release agent excipients, film formation excipients, increased bioavailability excipients, dispersion excipients, solubility enhancement excipients, stabilizer excipients, capsule filling excipients, powder blends excipients, tablet compressibility excipients, etc.(https: / / www.americanpharmaceuticalreview.com / 25335-Pharmaceutical-Raw-Materials-and- APIs / 25283-Pharmaceutical-Excipients / )
[0034] As used herein, the term “dosage form” refers to a pharmaceutical preparation in which a specific mixture of active ingredients of a drug and inactive components (excipients) are formulated in a particular shape or form to facilitated administration and accurate delivery of active ingredients, and / or to be presented in the market. Solid dosage forms include powders, tablets, granules, capsules, cachets, pills, lozenges, gummies, suppositories. Semi-solid dosage forms include ointment, creams, paste, gels, poultices. Liquid dosage forms include collodions, droughts, elixirs, emulsions, suspension, enemas, gargles, linctuses, lotion, liniments, mouth washes, nasal drop, paints, solutions, syrups. Gaseous dosage forms include aerosols, inhalations, and sprays. (https: / / thepharmapedia.com / pharmaceutical-dosage-form-pharmaceutics / pharmacy-notes / )
[0035] As used herein, the term “nucleotide” refers to the basic building block moiety of nucleic acids (DNA or RNA or an analogue thereof) composed of a sugar molecule (either ribose in RNA or deoxyribose in DNA), one to three phosphate groups, and a nitrogen-containing base, as well as analogs of such moiety. Other functional groups (e.g., protecting groups) can be attached to the sugar group or nitrogen containing base group. The bases in DNA are adenine (A), cytosine (C), guanine (G) and thymine (T) (in RNA, uracil (U)), but also modified purine and pyrimidine bases and other heterocyclic bases which have been modified (these moieties are sometimes referred to herein, collectively, as “purine and pyrimidine bases and analogs thereof”) can be considered. Such modifications include, e.g., diaminopurine and its derivatives, inosine and its derivatives, alkylated purines or pyrimidines, acylated purines or pyrimidines thiolatcd purines or pyrimidines, and the like, or the addition of a protecting group such as acetyl, difluoroacetyl, trifluoroacetyl, isobutyryl, benzoyl, 9-fluorenylmethoxycarbonyl, phenoxyacetyl, dimethylformamidine, N,N- diphenyl carbamate, or the like. The purine or pyrimidine base may also be an analog of theforegoing; suitable analogs will be known to those skilled in the art and are described in pertinent texts and literature. Common analogs include, but arc not limited to, 1-mcthyladcninc, 2- methyladenine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentyladenine, N,N-dimethyladenine, 8-bromoadenine, 2-thiocytosine, 3-methylcytosine, 5-methylcytosine, 5- ethylcytosine, 4-acetylcytosine, 1-methylguanine, 2-methylguanine, 7-methylguanine, 2,2- dimethylguanine, 8-bromoguanine, 8-chloroguanine, 8-aminoguanine, 8-methylguanine, 8- thioguanine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, 5-ethyluracil, 5- propyluracil, 5 -methoxy uracil, 5-hydroxymethyluracil, 5-(carboxyhydroxymethyl)uracil, 5- (methylaminomethyl)uracil, 5-(carboxymethylaminomethyl)-uracil, 2-thiouracil, 5-methyl-2- thiouracil, 5-(2-bromovinyl)uracil, uracil-5-oxyacetic acid, uracil-5-oxyacetic acid methyl ester, pseudouracil, 1 -methylpseudo uracil, queuosine, inosine, 1 -methylinosine, hypoxanthine, xanthine, 2-aminopurine, 6-hydroxyaminopurine, 6-thiopurine, and 2,6-diaminopurine.
[0036] The terms “oligonucleotide,” “nucleotide sequence,” and “nucleic acid sequence” as used herein refer to any polyribonucleotide or polydeoxyribonucleotide that may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, nucleic acid sequence as used herein refers to, among others, single- and double-stranded DNA, DNA that is a mixture of single- and doublestranded regions, single- and double- stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions.
[0037] As used herein, the term “vector” refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked, usually a DNA molecule that is used as a vehicle to carry a particular foreign nucleic acid sequence - usually DNA - into a host / recipient cell where it can be replicated and / or expressed. The vector typically includes features to facilitate the manipulation of DNA as well as a genetic marker for their selective recognition. The most common vectors are DNA plasmids, viruses (e.g., adenovirus, vaccinia, retrovirus, baculovirus, etc.) and artificial chromosomes. Certain vectors are capable of autonomous replication in a host cell into which they arc introduced. In general, expression vectors of utility in recombinant DNA techniques arc often in the form of plasmids. Often “plasmid” and “vector” are used interchangeably as the plasmid is the most commonly used form of vector. The selection of vectors and methods to construct them are commonly known to persons of ordinary skill in the art and are described in general technicalreferences (see, in general, “Recombinant DNA Part D,” Methods in Enzymology, Vol. 153, Wu and Grossman, cds., Academic Press (1987)). Desirably, the vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA or RNA. Preferably, the vector comprises regulatory sequences that are specific to the genus of the host. Most preferably, the vector comprises regulatory sequences that are specific to the species of the host.
[0038] As used herein, the term “episome” refers to a genetic element inside some bacterial cells, e.g., DNA of some bacteriophages, that can replicate independently of the host or integrate into the bacterial chromosome at several different locations by recombination between homologous insertion sequences present on both the plasmid and the host chromosome. Episomes do not degrade, unlike standard plasmids, and can be designed so that they are not epigenetically silenced. The length of episomal retention is fairly variable between different genetic constructs and there are many known features in the sequence of an episome which will affect the length and stability of genetic expression of the carried transgene.
[0039] As used herein, the term “fused” refers to joining parts of two different genes and / or proteins. Here a nucleotide sequence encoding CfaE is linked at its 5 ’-terminus to the 3 ’-terminus of a nucleotide sequence encoding ACM, and the nucleotide sequence encoding ACM is linked at its 5 ’-terminus to the 3 ’-terminus of a nucleotide sequence encoding USP45 signal peptide.
[0040] As used herein, the term “recombinant” gene or protein refers to a gene or protein expressed from the gene, which is constructed in the laboratory using methods of cleaving a DNA fragment from a donor’s genomic DNA or genomic / cDNA library with restriction enzyme, and inserting the fragment into a vector (e.g., plasmids, bacteriophage). Sometimes, mutation can be introduced into the gene by PCR in the presence of mutation primers, or more than one gene is inserted into a vector to create a fusion gene. This new combination is cloned by introducing them into suitable cells for amplification, where they are copied by the DNA replication machinery of the host. In some vectors, the inserted genes can also be transcribed and translated for protein expression.2. Overview
[0041] It has been found that colonization factor antigen I (CFA / I) of enterotoxigenic E. colt (ETEC), given orally or nasally as purified protein or expressed by attenuated Salmonella vaccine vectors, are potently effective via bystander suppression in preventing and treating experimental models with multiple sclerosis, arthritis, type 1 diabetes, and Sjogren’s syndrome, suggesting that CFA / I can effectively attenuate inflammation of autoimmune diseases, which may be due to Treg subsets uniquely equipped to suppress inflammation. In addition, new findings indicate that the intact CFA / I fimbria is not required, and the anti-inflammatory activity can be limited to just a CfaE component.
[0042] Based the results reported herein demonstrating that CfaE expressed by Lactococcus lactis (LL-CfaE) is able to dampen autoimmunity, certain embodiments of the invention involve the engineering of probiotic microbe strains (e.g. L. lactis) to express CfaE and uses thereof for treating various inflammatory- and autoimmune diseases, including RA and SjS.
[0043] Colonization Factor Antigen I (CFA / I) fimbriae of the gram-negative Escherichia coli are encoded by an operon containing four genes, cfaABCE, in the following order: periplasmic chaperone cfaA, major fimbrial subunit cfaB, outer membrane usher protein cfaC, and minor fimbrial subunit cfaE. The products of these genes are all secreted and eventually assembled into polymerized fimbriae at the outer membrane. CFA / I fimbriae are heteropolymers composed of a tip protein, the minor adhesive subunit, CfaE, and a shaft of about -1000 major subunits, CfaB. Assembly is coordinated by CfaA, a periplasmic chaperone which directs the proper folding, polymerization, and delivery to the outer membrane usher protein. CfaC ushers the subunits and acts as a platform to enable proper assembly of the fimbriae into their helical structure.
[0044] Here is disclosed that the reengineered CfaE from gram-negative E. coli is expressed by gram-positive Lactococcus lactis using a combination of genetic engineering techniques and synthetic biology. A L. lactis line was generated from an episomal plasmid to chromosomally express the CfaE subunit independent of other structural components or chaperones associated with the cfal operon in order to solely measure the activity of CfaE. To facilitate surface expression and its secretion, CfaE was genetically fused to the structural component of L. lactis peptidoglycan hydrolase (ACM) (Fig. 1A), which normally anchors to the cell wall. The inclusion of L. lactis USP45 secretion signal peptide (20) mediates secretion of the ACM-CfaE fusion protein.
[0045] Chromosomal insertion of the cfaE increases stability of the line, as propagation no longer requires antibiotic selection, and relieves concerns regarding cpisomal transfer in vivo. CfaE expression on the lactococcal cells was detected using flow cytometry with rabbit anti-CfaE antibody (developed in-house) (Fig. IB).
[0046] The recombinant Lactococcus grown on either standard culture medium or in milk, were orally fed to mice with CIA (mouse model of human rheumatoid arthritis) or SjS, and in both instances, LL-CfaE remarkably ameliorated the symptoms in both diseases. These results suggest the use of LL-CfaE as clinical intervention for human rheumatoid arthritis or SjS as well as for other autoimmune diseases such as type I diabetes and multiple sclerosis as proven with CFA / I expressed in Lactococcus.
[0047] An interesting aspect of this disclosure is to treat autoimmune diseases using a probiotic bacterial strain based on the complex interactions between the host and its microbiota. It is generally believed that the association between the vertebrate hosts and the microbiota arose as symbiotic relationship based on mutual benefits that would simultaneously enhance host digestive efficiency and ensure a steady nutrient supply for the microbes. The immune system has evolved innate mechanisms to prevent microbes from invading the exposed epithelia of the mucosa and the skin. Understanding how to manipulate the host innate immune system with probiotics provides an alternative strategy to inflammatory diseases rather than reliance on traditional pharmacological interventions.
[0048] Historically, lactic acid bacteria (LAB) represent the core of probiotic-based interventions, and also proved to be valuable tools as novel therapeutic and prophylactic interventions. LABs are considered ideal vectors for oral or mucosal delivery since they are inherently nonpathogenic, and they can survive the harsh conditions of the gastric environment. While LABs are traditionally used for their probiotic properties, genetically engineered LABs have been designed to produce and deliver therapeutic heterologous proteins to the host mucosa. One commonly used application for LABs is their potential for vaccine delivery to protect against infectious diseases and toxins. Its second application is the delivery of immune therapeutics to treat inflammatory diseases. It is this latter property which is the emphasis of this disclosure. Thus, given its therapeutic impact, Lactococcus lactis expressing CfaE subunit (LL-CfaE) was developed to be tested on mice models of autoimmune diseases.
[0049] Use of L. lactis for delivery of biologies and CfaE subunit protein has several advantages: (1) oral dosing of targeted biological immunotherapy which traditionally require infusion or frequent injections; (2) controllable dosing as L. lactis does not colonize the human gastrointestinal tract, and the studies of this lab in mice confirm its transient presence in tissues for < 48 h; and (3) pharmacodynamically optimized delivery of constitutively expressed CfaE protein for engagement of microbiome-associated immune regulatory pathway. The fact that L. lactis does not colonize the gut is ideal for an immunotherapeutic as it enables a ‘tunable’ therapeutic strategy wherein identification of key mechanism-driving biomarkers, as discussed herein in the context of CfaE subunit protein, become critical for effective and efficient clinical development. Importantly, L. lactis, in the context of synthetic biology approaches to deliver CfaE, allows for utilization of precision targeting methods, not capable using natural commensal strain strategies.3. Rheumatoid Arthritis
[0050] Rheumatoid arthritis (RA) is a chronic, systemic inflammatory disease mediated by T cells, predominantly CD4+ T cells, affecting 1 in 4 U.S. adults (54.4 million people). While many organs are affected, the main sites of RA are the synovial joints, where tissue destruction occurs due to chronic inflammation. RA poses a substantial health-care burden, lessening the quality of life of these patients, and approximately half of the affected patients become disabled over the progression. Currently, treatments vary in nature. Non-pharmacological approaches, e.g., physical and nutritional therapies, are palliative and do not stop the progression of the disease, whereas pharmacological treatments relying on analgesia and anti-inflammatory drugs, including steroids and NSAIDs, have deleterious side-effect particularly in the long-term care. Hence, intervention strategies that redirect T cell responses may be more effective especially for the long-term
[0051] To create an animal model for human RA, collagen-induced arthritis (CIA) was inflicted upon mice by challenging the animals (here B6 male mice) with heterologous collagen type II (CII). CIA and RA share many critical features of pathogenesis, including CD4+ T cell mediated inflammation with extensive cartilage and bone damage, resulting in joint deformities. This similarity is commonly exploited to use CIA as a model for RA and as a tool to investigate approaches to prevent and treat RA. In EXAMPLES, in Cll-challenged mice, clinical score and disease incidence were remarkably reduced in L. lactis-CfaE and L. lactis-CFPJI treated mice compared with PBS or L. lactis vector treated mice (Figs. 1C and ID).
[0052] In earlier studies in which the therapeutic efficacy of CFA / I was tested in CIT-challenged mice, evaluation of CD4+ T cell responses revealed that mice treated with L. lactis-CFA / I fermented milk showed greatly reduced proinflammatory cytokines sch as IFN-y and IL- 17, elevated anti-inflammatory cytokines such as IL- 10 and TGF-P, and elicited regulatory T cells (Tregs) without prior knowledge of the auto-antigen, confirming L. lactis-CFA / I can suppress inflammation. These previous results as well as the results presented in this disclosure promote the novel concept that CfaE can be exploited as therapeutic means for the treatment of RA without prior knowledge of the causative auto-antigen, which may be enhanced by probiotics helping immune homeostasis to reduce autoimmunity.4. Sjogren’s syndrome
[0053] Sjogren’s syndrome (SjS) is an autoimmune chronic inflammatory disease affecting primarily the lacrimal and salivary glands. Major symptoms of SjS are dry mouth and dry eyes as a consequence of diminished salivary and lacrimal flow. SjS is classified as either primary Sjogren’s syndrome or secondary Sjogren’s Syndrome; the latter being the result of other autoimmune disorders, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and systemic sclerosis. SjS is a debilitating disease affecting 3.1 million individuals in the USA, with woman being nine times more likely to be afflicted than men. In addition to secretory dysfunction, SjS can also have systematic manifestations affecting the skin, gastrointestinal tract, lungs, blood vessels, liver, pancreas, kidneys, and peripheral and central nervous systems. SjS is characterized by lymphocyte infiltration into the glands. Both T cells and accompanied activated B cells have pathogenic roles in primary Sjogren’s syndrome immunopathology.
[0054] The development of therapeutics for SjS poses significant challenges, in part because of the heterogeneity of clinical disease. Few studies have addressed the critical issue of identifying interventions to stop or reverse the destructive autoimmune process. Currently, replacement therapies such as artificial saliva and eye lubricants and immunosuppressive agents are used to treat SjS patients. B cell-directed therapies, e.g., rituximab (anti-CD20 monoclonal Ab [mAb]), and immune gene therapy using IL-27 to suppress Thl7 cells can result in broad immunosuppression, making patients more susceptible to infections (Cornec D, 2012; Meiners PM, 2011; Perosa F, 2009; Lee BH, 2012). However, these interventions do not address the cause of SjS, and none redirects T cell responses to dampen the inflammatory response.
[0055] In the previous studies of this lab, when testing L. lactis strain chromosomally expressing the cfal opcron (LL 301) in a genetic model for SjS using C57BL / 6.NOD-Aec7Aec2 mice, the results showed that repeated dosing with LL 301 for prophylactic treatments proved effective in mitigating salivary flow loss and in reducing anti-nuclear antibodies (ANA) and inflammation in the submandibular glands (SMGs) in SjS females and in restoring salivary flow in diseased mice. Such changes from the diseased state were accomplished via the stimulation of Tregs and suppression of effector T (Teff) cells including Tfh cells and proinflammatory cytokines such as IFN-y, IL-6, IL-17, and IL-21. Such evidence points to the therapeutic capacity of CFA / I protein to suppress SjS disease and to have restorative properties in combating autoimmune disease.
[0056] These results are in line with the results presented here, which demonstrated that CfaE also reduced SjS symptoms in a mouse model, and together support the idea that CfaE can have antiinflammatory effect.5. Exemplary Embodiments
[0057] Based on the results presented above, E. coli CfaE subunit fusion protein, a new strain of probiotic microbe expressing E. coli CfaE subunit, a composition comprising the probiotic microbe, and a method of use with the probiotic microbe composition are disclosed here for the treatment of inflammatory- or autoimmune disease.
[0058] In a preferred embodiment, CfaE is a fusion protein for bacterial surface expression, wherein the N-terminus of CfaE is fused to a structural component that anchors CfaE to the cell wall, and the N-terminus of the structural component is fused to a signal peptide. The amino acid sequence of CfaE comprises SEQ ID NO:1 or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 1; and optionally, which is encoded by a nucleic acid sequence comprising SEQ ID NO:4 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 4. In one embodiment, the structural component is from L. lactis peptidoglycan hydrolase (ACM), wherein the amino acid sequence of ACM comprises SEQ ID NO:2, or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 2; and optionally, which is encoded by a nucleic acid sequence comprises SEQ ID NO:5 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 5.
[0059] Further, the signal peptide is USP45 signal peptide, wherein the amino acid sequence of the USP45 signal peptide comprises SEQ ID NO:3, or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 3; and optionally, which is encoded by a nucleic acid sequence comprises SEQ ID NO:6 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 6.
[0060] Although, as examples of a structural component and a signal peptide, L. lactis peptidoglycan hydrolase (ACM) and L. lactis USP45 signal peptide were selected to create signal peptide-ACM-CfaE fusion protein, many other structural proteins expressed on the bacterial surface and any signal peptides for the location of the protein on the membrane or secretion can be contemplated based on cloning convenience and host probiotic bacterial strain.
[0061] For the expression of CfaE subunit protein, a probiotic microbe strain can be selected from Saccharomyces boulardii, Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosus, Lactiplantibacillus plantarum, Lactobacillus acidophilus Lactobacillus johnsonii, Lactobacillus delbrueckii subsp. Bulgaricus, Lactobacillus brevis, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus fermentum ME-3, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium adolescentis, Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium longum, Enterococcus durans, Enterococcus faecium, Escherichia coli, Limosilactobacillus reuteri, Limosilactobacillus fermentum, Ligilactobacillus salivarius, Streptococcus thermophilus, Streptococcus salivarius, Bacillus cereus, Bacillus coagulans, Leuconostoc mesenteroides, Pediococcus acidilactici, and Lactococcus lactis, and in particular L. lactis.
[0062] The inflammatory- or autoimmune disease that can be treated with CfaE expressing probiotic microbe can be rheumatoid arthritis or Sjogren’s syndrome, but other inflammatory- or autoimmune diseases can be contemplated such as type I diabetes, multiple sclerosis and other hypersensitivity I, II, III and IV diseases / disorders listed above.
[0063] In this disclosure, a nucleotide fragment comprising a nucleic acid sequence of SEQ ID NO:4 or 7 or any nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 4 or 7 for the expression of CfaE fusion protein as well as a recombinant vector comprising the nucleotide fragment is provided, wherein the vector is plasmid, episome, bacteriophage, or virus for cloning and amplification of cDNA or expression of the CfaE fusion protein. In addition, anucleotide or vector comprising SEQ ID NO:4 or 7 can be introduced through transformation, transfection, or transduction into other types of host cells than probiotic microbial strains, such as bacteria, yeast, insect cell, or mammalian cell.
[0064] It is also contemplated that SEQ ID NO: 1 can be fused with a signal peptide for secretion without structural component, from which CfaE can be expressed to be secreted to the cell culture medium. Then, secreted CfaE can be purified for i.v. injection. Further, mRNA encoding CfaE can also be contemplated for the same purpose.
[0065] In other embodiments, a composition comprising probiotic microbe expressing E. coli CfaE subunit are provided. Optionally, the composition can be a solid dosage form for oral administration such as powder, granules, capsule, tablet, pill, and gummies. The effectiveness of CfaE is disease-dependent. As demonstrated in Figure 1, 5xl08CFUs proved protective against CIA, whereas in Figure 2, 5xl07CFUs was efficacious for SjS. In some embodiments, the composition can further comprise excipients.
[0066] In addition, a method is provided for the treatment of inflammatory- or autoimmune disease using the composition described above, wherein the composition is used as food supplement, added to food, or administered with other pharmaceutical, physical or surgical intervention for inflammatory- or autoimmune disease. In a specific embodiment, the administered dose of the composition is 5xl06- 5x 1010CFU, and, and the composition can be taken by / admini stored to the subject once a day, twice a day, thrice a day, once every two days, once every three days, once every four days, once every five days, once every six days, once a week, once every two weeks, once every three weeks, or once a month, for a month, two months, three months, four months, five months, six months, a year or longer period.
[0067] One aspect of using modified L. lactis species is its application in treating diseases when given to patients in a fermented dairy product. Since L. lactis is commonly used in fermented dairy products, L. lactis-CfaE fermented milk can be contemplated to treat RA or SjS in human subjects. For example, L. lactis-CfaE strains can be grown in pasteurized, fortified whole milk with bacterial growth densities similar to L. lactis strains grown in synthetic M17 glucose medium, to produce a semisolid, yogurt- like texture at a pH of 4.8 similar' to commercially prepared yogurts. Moreover, the lactococci are much more stable in the fermented milk unwavering in their viabilityfor at least two weeks unlike those lactococci grown in Ml 7 medium whose viability declined after 2 days (data not shown).EXAMPLESExample 1. Materials and Methods1.1 Generation of Lactococcus lactis-C E strain and culture conditions
[0068] LL-CfaE was generated using pMSP3535H3 vector. The USP45:ACM / A:cfaE portions were synthesized as a single fragment and ligated into the pMSP3535 vector. The resulting pBzMM159 plasmid remains episomal and contains a nisin-inducible promotor to facilitate nisin-dependent expression of the CfaE protein. An overnight culture in M17 broth plus erythromycin is split 1:12 and grown for 1 hour at 37 °C. The culture is then induced 1:100 nisin for 4 hours.1.2 Mice for collagen-induced arthritis (CIA) model
[0069] In B6 mice (8- to 10-wk old male), CIA was induced using 100 pg of chicken collagen 11 (CII; Chondrex, Redmond, WA USA) (Day 0). Each limb was evaluated using a scale of 0-3: 0, no clinical signs; 1, mild redness of a paw or swelling of single digits; 2, significant swelling of ankle or wrist with erythema; 3, severe swelling and erythema of multiple joints; maximum score per mouse is 12.
[0070] To neutralize gastric acid, CIA mice were orally gavaged with sterile 50% saturated sodium bicarbonate solution, then the CIA mice were treated orally with PBS (n=10) or 5xlO8CFUs of LL vector (n=6), LL-CFA / I (n=10), or LL-CfaE (n=10) weekly beginning on Day 14 post-CIA challenge. Study was terminated Day 40.1.3 Flow Cytometry
[0071] To measure surface expression of CfaE by Lactococcus lactis (LL), cultures of LL vector and LL-CfaE were washed in Dulbecco’s PBS (DPBS). Lactococci resuspended in DPBS + 10 fetal calf serum (FCS) were stained with 1:200 dilution of rabbit anti-maltose binding protein- CfaE (produced in-house) serum. Following washing of unbound rabbit IgG, l.pg / ml AF647-F(ab’)2 goat anti-rabbit IgG was incubated to detect bound rabbit IgG. Following wash step, stained lactococci were evaluated by flow cytometry to measure extent Cfa / E expression.1.4 Mice for SjS model
[0072] For an animal model for human SjS, genetically defined C57BL / 6.NOD-Aec7Aec (SjS) female mice were bred locally. Prior to oral administration of lactococcal strains, SjS mice were orally gavaged with sterile 10% sodium bicarbonate solution to neutralize stomach acid. After 5 min, mice were orally gavaged with sterile PBS or 5 * 107CFUs in PBS of LL- vector or LL- CfaE.1.5 Measurement of salivary flow rate (SFR)
[0073] To measure stimulated flow rates of the saliva, individual mice were weighed and given an intraperitoneal (IP) injection of 100 pl of a mixture containing isoproterenol (Sigma- Aldrich) (0.2 mg / l ml of PBS) and pilocarpine hydrochloride (Sigma-Aldrich) (0.05 mg / l ml in PBS). Saliva was collected for 10 min from the oral cavity of individual mice using a micropipette. The volume of each saliva sample was measured to calculate salivary flow rates.1.6 Histology
[0074] To assess the degree of inflammation, the salivary glands were fixed in 10% phosphate- buffered formalin (Leica Biosystems, Richmond, IL) for 24 h. Fixed tissues were embedded in paraffin and sectioned at a thickness of 5 pm. Paraffin-embedded sections were deparaffinized by immersing in xylene, followed by dehydration in ethanol, and tissue sections were stained with hematoxylin and eosin (H&E) dye (UF College of Veterinary Medicine Histology Tech Services, Gainesville, FL). To measure extent of leukocyte infiltrations in the salivary glands, a single histological section per gland per mouse was scanned using an Aperio ScanScope (Aperio, San Diego, CA) slide digitizer at x20 magnification. Sections containing leukocyte-infiltrated regions were identified and calculated using the Aperio ImageScope software.1.7 Statistics
[0075] For mouse SjS model analysis, a power analysis was conducted and found that 5 mice per group were needed to show a significant difference for at least a 20% change in SFR. All presented data are the mean ± standard error of the mean (SEM). Statistical significance was tested usingGraphPad Prism 8 (Prism, Trvine, CA). One-way ANOVA with Tukey’s multiple comparisons test was used to compare salivary flow rates. All results arc discerned to the 95% confidence interval.
[0076] For mouse arthritis model analysis, Mann-Whitney U test was applied to statistically analyze clinical scores. Difference in arthritis incidence between experimental groups was checked with Fisher’s exact probability test. One-way ANOVA was performed to analyze ELISA and flow cytometry results. Data were considered statistically significant, if -valuc was <0.05.Example 2, LL-CfaE suppressed collagen-induced arthritis (CIA).
[0077] A L. lactis construct was formulated to only express CfaE subunit independent of other structural components or chaperones associated with cfal operon. Thus, the activity of CfaE can be solely measured. To facilitate surface expression and its secretion, CfaE was genetically fused to the structural component of L. lactis peptidoglycan hydrolase (ACM) (Fig. 1A), which normally anchors to the cell wall. The inclusion of L. lactis USP45 secretion signal peptide (20) mediates secretion of the ACM-CfaE fusion protein.
[0078] Figure 1 A illustrates the linear map depicting CfaE expression in L. lactis as a fusion at its N-terminus with the structural component of the cell wall protein, peptidoglycan hydrolase (ACM) preceded by a USP45 secretion signal peptide. The fusion protein lacks enzymatic activity.
[0079] To detect CfaE presence on the lactococcal cells, flow cytometry analysis was performed using a rabbit anti-CfaE antibody (developed in-house). An antiserum to rabbit anti-maltose binding protein-CfaE was generated, and a 1 :200 dilution was used to stain LL-CfaE and LL vector (lacking CfaE). Bound rabbit antibody was detected with 1.0 p.g / ml AF647-F(ab’)2 goat anti-rabbit IgG. Figure IB shows flow cytometry analysis of L. lactis-CfaE (LL-CfaE) revealing surface expression of CfaE. Increased immunofluorescence associated with L. lac t is -CfaE expression relative to the L. lactis vector that lacked CfaE, was detected, which shows that L. lactis-CfaE does express CfaE on the lactococcal cell surface.
[0080] To test its effectiveness in suppressing autoimmune disease, collagen-induced arthritis (CIA) was induced in groups of B6 males. Groups of B6 male mice were challenged with chick collagen II emulsified in a complete Freund’s adjuvant, and beginning at day 14, which represents the onset of arthritis, groups were treated with PBS, LL vector, LL- CFA / I, or LL-CfaE weekly for a total of four doses. Clinical scores (Figures 1C) and incidence (Figure ID) show the results ofthe CIA test. All mice treated with PBS or LL vector developed the disease in contrast to LL- CFA / I- or LL-CfaE-trcatcd groups, in which only 20% of the CIA-challcngcd mice showed incidence of disease (Fig. ID). These results show that LL-CfaE is as effective as LL-CFA / I in reducing arthritis disease severity and disease incidence.Example 3. LL-CfaE suppressed Sjogren’s Syndrome,
[0081] Given its effectiveness on CIA, additional studies pursued testing the efficacy of LL-CfaE in limiting a chronic inflammatory disease of salivary glands known as Sjogren’s Syndrome (SjS). Because C57BL / 6.NOD-AecMec2 mouse model mimics many aspects of human SjS (21-23), groups of SjS females, which show a more pathogenic disease, were randomly assigned and all mice were evaluated for their baseline salivary flow rates (SFRs).
[0082] Treatment was initiated at 6 weeks of age, and additional treatments administered at three- week intervals (Fig. 2). At six weeks of age, all C57BL / 6.NOD-Aec7Aec2 (SjS) mice were assessed for salivary flow rate (SFR; ml / g) showing the expected elevated SFR capacity, and then separated into groups to be dosed with PBS (n=7), LL vector (n=5), or LL-CfaE (n=8) at 3-wk intervals. Individual SFRs were measured again at 28 weeks of age to assess the capacity of CfaE to maintain SFR, and CfaE-treated group was compared with PBS-dosed or LL vector-treated group at 28 weeks of age. Figure 2A shows a significant reduction in PBS-dosed SjS mice relative to their SFR capacity at 6 weeks of age. Treatment with LL vector did not restore SFR as did LL- CfaE. The SjS mice lose their capacity to produce saliva. At 6 wks of age, all mice resemble normal mice in their SFRs. Over time, the SjS mice gradually show reduced SFRs. As shown in Figure 2A, diseased mice at 28 wks of age have reduced SFRs. The measurements relate to a comparison to 28 wk PBS-treated mice. Thus, young SjS mice have elevated SFR capacity. Treatment with LL-CfaE retains SFR capacity as it approaches values obtained in nondiseased mice at 6 wks of age.
[0083] Histological analysis of H&E sections of individual submandibular glands from each mouse was performed to measure the extent of inflammatory foci induction. Mice treated with LL-CfaE showed a reduced number of inflammatory foci compared with PBS-dosed or LL vector- treated mice. The number of foci was quantified (Figure 2C).
[0084] These results demonstrate that CfaE subunit expressed in L. lactis without other subunits of CFA / I is effective in reducing autoimmune disease severity and incidence for both CIA and SjS diseases. In fact, for mice induced with arthritis, disease development was prevented in eight of ten mice treated with LL-CfaE. For SjS, salivary flow was improved in diseased mice over the course of 22 weeks of treatment, and the improved salivary flow was attributed to reduced pathology in the salivary glands.
[0085] To assess the types of cytokines elicited by oral LL-CfaE treatments, splenic mononuclear cells were restimulated with plate-bound anti-CD3 plus soluble anti-CD28 monoclonal antibodies (mAbs) for 2 days, and harvested cell culture supernatants were measured for proinflammatory cytokines, IFN-y, IL-6, and IL- 17, and for anti-inflammatory cytokines, IL- 10 and TGF-0 by cytokine-specific ELISAs. Fig. 3 shows the reduction of proinflammatory cytokines and the increase in anti-inflammatory cytokines by oral LL-CfaE treatments. This data demonstrates that the delivery of CfaE effectively mitigates Sjogren’s syndrome-like disease in C57BL / 6.NOD- AeclAec2 mice.Example 4: Related Sequence Information (modifications to sequences noted)SEQ ID NO:1 AMINO ACID SEQUENCE OF CFA / E:AUTHORS: Jordi,B.J., Willshaw,G.A., van der Zeijst,B.A. and Gaastra, W.TITLE: The complete nucleotide sequence of region 1 of the CFA / I fimbrial operon of human enterotoxigenic Escherichia coliJOURNAL DNA Seq 2 (4), 257-263 (1992)1 mnkilfiftl ffssgfftfa vsadknpgse nmtntigphd rggsspiyni Insyltayng61 shhlydrmsf Iclssqntln gacpssdapg tatidgetni tlqftekrsl ikrelqikgy121 kqflfknanc psklalnssh fqcnrcqasg atlslyipag clnklpfggv wnavlklnvk181 rrydttygty tinitvnltd kgniqiwlpq fksnarvdln Irptgggtyi grnsvdmcfy241 dgystnsssl eirfqddnsk sdgkfylkki nddskelvyt Islllagknl tptngqalni301 ntasletnwn ritavtmpei svpvlcwpgr Iqldakvknp eagqymgnik itftpssqtlSEQ ID NO:2 AMINO ACID SEQUENCE OF L. lactis PEPTIDOGLYCAN HYDROLASE (ACM):AUTHORS: Buist,G., Kok, J., Leenhouts,K.J., Dabrowska,M., Venema,G. andHaandrikman,A.J.TITLE: Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidaseneeded for cell separationJOURNAL: J. Bacterial. 177 (6), 1554-1563 (1995)1 mpvsrvkvkn rhl kkktkkp lafykpatkf agavliagtl ttthelllqq tspmvqaatn- 61 ssevfiesia asakpvadan glypsvmiaq ailesnwgss qlsrapyynl fgiqgtyqgk- 121 svvfktqeyl ngkwvtkdmp frvypsfnqs fqdnayvlkt tnfgngpyya kawranaaty- 181 qdataaltgr yatdpsygas Inriisqynl trfdgassag ntnsggsttt itnnnsgtns241 ssttytvksg dtlwgisqry gisvaqiqsa nnlkstiiyi gqklvltgsa sstnsggsnn301 sasttpttsv tpakptsqtt vkvksgdtlw alsvkyktsi aqlkswnhls sdtiyigqnl361 ivsqsaaasn pstgsgstat nnsnstssns nasihkvvkg dtlwglsqks gspiasikaw421 nhlssdtili gqylrikSEQ ID NO:3 AMINO ACID SEQUENCE OF USP45:AUTHORS: van Asseldonk,M., Rutten,G., Oteman,M., Siezen,R.J., de Vos,W.M. and Simons, G.TITLE: Cloning of usp45, a gene encoding a secreted protein from Lactococcus lactis subsp. lactis MG 1363JOURNAL: Gene 95 (1), 155-160 (1990)1MKKKIISAILMSTVILSAAAPLSGVYADTNSDIAKQDATISSAQSAKAQAQAQVDSLQSKVDSLQQKQTSTKAQIAKIESELKALNAQIATLNESIKERTKTLEAQARSAQVNSSATNYMDAVVNSKSLTDVIQKVTAIATVSSANKQILEQQEKEQKELSQKSETVKKNYNQFVSLSQSLDSQAQELTSQQAELKVATLNYQATIATAQDKKQALLDEKAAAEKAAQEAAKKQAAYEAQQKEAAQAQAASTAATAKAVEAATSSASASSSQAPQ ¥STSTDNTTSNASASNSSNSSSNSSSSSSSSSSSSSSSSNSNAGGNTNSGTSTGNTGGTTTGGSGINSSPIGNPYAGGGCTDYVWQYFAAQGIYIRNIMPGNGGQWASNGPAQGVLHVVGAAPGVIASSFSADFVGYANSPYGHVAIVKSVNSDGTITIKEGGYGTTWWGHERTV- SASGVTFLMPNSEQ ID NO:4 NUCLEIC ACID SEQUENCE OF CFA / E:67 GCAG ATAAAAATCC CGGAAGTGAA AACATGACTA ATACTATTGG TCCCCATGAC121 AGGGGGGGAT CTTCCCCCAT ATATAA'TATC TTAAATTCCT ATCTTACAGC ATACAATGGA161 AGCCATCATC TGTATGATAG GATGAGTTTT TTATGTTTGT CTTCTCAAAA TACACTGAAT241 GGAGCATGCC CAAGCAGTGA TGCCCCTGGC ACTGCTACAA TTGATGGCGA AACAAATATA301 ACATTACAAT TTACGGAAAA AAGAAGTCTA ATTAAAAGAG AACTGCAAAT TAAAGGCTAT361 AAACAATTTT TGTTCAAAA ATGCTAATTG CCCATCTAAA CTAGCACTTA ACTCATCTCAT421 GAATTAAATA AATTACCTTT TGGGGGGGTC TGGAATGCCG TTCTGAAGCT AAATGTAAAA541 AGACGATATGATACAACCTATGGGA.CTTACACTATAAACATCACAGTTAATTTAACTGAT601 AAGGGAAATATTCAGATATGGTTACCACAGTTCAAAAGTAACGCTCGTGTCGATCTTAAC661 TTGCGTCCAACTGGTGGTGGTF.CATATATCGGAAGAAATTCTGTTGATATGTGCTTTTAT721 GATGGATATAGTACTAACAGCAGCTCTTTGGAGATAAGATTTCAGGATGATAATTCTAAA781 TCTGATGGAAAATTTTATCTAAA GAAAATAAATGATGACTCCAAA.GA.ACTTGTATACACT841 TTGTCACTTCTCCTGGCAGGTAAAAATTTAACACCAACAAATGGACAGGCA.TTAAATATT901 AACACTGCTCTCTGGAAA.CAAACTGGAATAGAATTACAGCTGTCACCA'l’GCCAGAAATC961 AGTGTTCCGGTGTTGTGTTGGCCTGGACGTTTGCAATTGGATGCAAAAGTGAAAAA.TCCC1021 GAGGCTGGACAATATATGGGGAATATTAAAATTACTTTCACACCAAGTAGTCAAACACTCSEQ ID NO: 5 NUCLEIC ACID SEQUENCE OF L. lactis PEPTIDOGLYCAN HYDROLASE (ACM):177 atg181 ccagtatcac gtgttaaagt taaaaataga catttaaaaa agaaaactaa aaaaccactc241 gctttttata aaccagccac aaaatttgct ggcgctgttc ttattgccgg aacattgaca301 accacacatg aacttcttct tcaacagaca agtccaatgg ttcaagcagc gactaactca361 tcagaggttt ttattgaaag tattgccgca tcagcaaaac ctgtggcaga tgctaatggc421 ttatatcctt cggtcatgat tgcccaagct attttggaaa gcaactgggg ctcaagtcag481 ctttcacgag ctccctatta taatttattt ggtattcaag gtacttatca aggaaagagc541 gtcgtattta aaactcaaga gtatctcaat ggtaaatggg tgactaaaga tatgcccttt601 agggtctatc cttcctttaa tcaaagtttt caagacaatg cttatgttct aaaaacaaca661 aactttggga atggtcccta ttacgctaag gcttggcggg ccaatgctgc cacctatcaa721 gacgctactg ctgctttgac gggcagatat gctaccgacc caagttatgg cgcttcactg781 aatcgcatta tttctcaata taatttgact cgttttgacg gagcttcttc agctggaaat841 actaattctg gtggctcgac aaccacaatt acgaataata attctggaac caatagcagt901 tcaactactt ataccgtcaa atctggtgat actctttggg gaatctcaca aagatatgga961 attagtgtcg ctcaaattca aagtgcgaat aatcttaaaa gtaccattat ctacattggt1021 caaaaacttg tactgacagg ttcagcttct tctacaaatt caggtggttc aaacaattcc1081 gcaagcacta ctccaaccac ttctgtgaca cctgcaaaac caacttcaca aacaactgtt1141 aaggttaaat ccggagatac cctttgggcg ctatcagtaa aatataaaac tagtattgct1201 caattgaaaa gttggaatca tttaagttca gataccattt atattggtca aaatcttatt1261 gtttcacaat ctgctgctgc ttcaaatcct tcgacaggtt caggctcaac tgctaccaat1321 aactcaaact cgacttcttc taactcaaat gcctcaattc ataaggtcgt taaaggagat1381 actctctggg gactttcgca aaaatctggc agcccaattg cttcaatcaa ggcttggaat1441 catttatcta gcgatactat tttaattggt cagtatctac gaataaaaSEQ ID NO:6 NUCLEIC ACID SEQUENCE OF USP45:101 atgaaaaaaa agattatctc121 agctatttta atgtctacag tgatactttc tgctgcagcc ccgttgtcag gtgtttacgc181 tgacacaaac tcagatattg ctaaacaaga tgcgacaatt tcaagcgcgc aatctgctaa241 agcacaagca caagcacaag ttgatagctt gcaatcaaaa gttgacagct tacaacaaaaREFERENCES1. Jun, S., Gilmore, W, Callis, G., Rynda, A., Haddad, A., and Pascual, D.W. A live diarrheal vaccine imprints a Th2 cell bias and acts as an anti-inflammatory vaccine. J. Immunol. 175:6733-6740, 2005. doi: 10.4049 / jimmunol.175.10.67332. Ochoa-Reparaz, J., Riccardi, C., Rynda, A., Jun, S., Callis, G., and Pascual, D.W. Regulatory T cell vaccination without autoantigen protects against experimental autoimmune encephalomyelitis. J. Immunol. 178:1791-1799, 2007. doi: 10.4049 / jimmunol.178.3.17913. Ochoa-Reparaz, J., Rynda, A., Ascon, M.A., Yang, X., Kochetkova, I., Riccardi, C., Callis, G., Trunkle, T., and Pascual, D.W. IL- 13 production by regulatory T cells protects against experimental autoimmune encephalomyelitis independently of autoantigen. J. Immunol. 181:954-968, 2008. doi: 10.4049 / jimmunol.181.2.954Kochetkova, I., Trunkle, T., Callis, G., and Pascual, D.W. Vaccination without auto-antigen protects against collagen II- induced arthritis via immune deviation and regulatory T cells. J. Immunol. 181:2741-2452, 2008. doi: 10.4049 / jimmunol.l81.4.2741 Kochetkova, I., Crist, K., Callis, G., and Pascual, D. W. Segregated regulatory CD39+ CD4+ T cell function: TGF-P -producing Foxp3-and IL-10-producing Foxp3+cells are interdependent for protection against collagen-induced arthritis. J. Immunol. 187:4654-4666, 2011. doi: 10.4049 / jimmunol.1100530. Kochetkova, I., Thornburg, T., Callis, G., Holderness, K., Maddaloni, M., and Pascual, D.W. Oral Escherichia coli colonization factor antigen I (CFA / I) fimbriae ameliorate arthritis via IL- 35, not IL-27. J. Immunol. 192:804-816, 2014. doi: 10.4049 / jimmunol.1302018. Maddaloni, M., Kochetkova, I., Jun, S., Callis, G., Thornburg, T., and Pascual, D.W. Milkbased nutraceutical for treating autoimmune arthritis via the stimulation of IL- 10- and TGF-B- producing CD39+regulatory T cells. PLoS One 10: eO 117825, 2015. doi : 10.1371 / j ournal .pone.0117825. Nelson, A.S., Maddaloni, M., Abbott, J., Hoffman, C., Akgul, A., Ohland, C., Gharalbeh, R., Jobin, C., Brusko, T.M., and Pascual, D.W. Oral therapy with colonization factor antigen I prevents development of type 1 diabetes in Non-obese Diabetic mice. Scientific Rpts. 10:6156, 2020. doi: 10.1038 / s41598-020-62881-4. Nelson, A.S., Akgul, A., Maddaloni, M., Bhagyaraj, E., Hoffman, C., and Pascual, D.W. Oral probiotic promotes indoleamine 2,3-dioxygenase- and TGF-P -producing plasmacytoid dendritic cells to initiate protection against type 1 diabetes. Immunol. Lett. 239:12-19, 2021. doi: 10.1016 / j.imlet.2021.07.009. Akgul, A., Maddaloni, M., Jun, S.-M., Nelson, A.S., Aguilera Odreman, V, Hoffman, C., Bhagyaraj, E., Voigt, A., Abott, J.R., Nguyen, C.Q., and Pascual, D.W. Stimulation of regulatory T cells with Lactococcus lactis expressing enterotoxigenic E. coli colonization factor antigen 1 retains salivary flow in a genetic model of Sjogren’s Syndrome. Arthritis Research & Therapy 23:99, 2021. doi: 10.1371 / journal.ppat.1009465. Akgul, A., Furlan Freguia, C., Maddaloni, M., Hoffman, C., Voigt, A., Nguyen, C.Q., Fanger, N.A., Fanger, G.R., and Pascual, D.W. Treatment with a Lactococcus lactis that chromosomally express E. coli cfal mitigates salivary flow loss in Sjogren’s Syndrome-like disease. Scientific Rpts, 13:19489, 2023.. doi: 10.1038 / $41598-023-46557-3Li, Y.F., Poole, S., Nishio, K., Jang, K., Rasulova, F., McVeigh, A., Savarino, S.J., Xia, D., and Bullitt, E. Structure of CFA / I fimbriae from enterotoxigenic Escherichia coli. Proc. Natl. Acad. Sei. USA 106:10793-10798, 2009. doi: 10.1073 / pnas.0812843106. Sakellaris, H., Balding, D.P, and Scott, J.R. Assembly proteins of CS1 pili of enterotoxigenicEscherichia coli. Mol. Microbiol. 21:529-541, 1996. doi: 10.1111 / j.l365-2958.1996. tb02562.x Li, Y.F., Poole, S., Rasulova, F., McVeigh, A.L., Savarino, S.J., and Xia, D. A receptor-binding site as revealed by the crystal structure of CfaE, the colonization factor antigen I fimbrial adhesin of enterotoxigenic Escherichia coli. J. Biol. Chem. 282:23970-23980, 2007. doi: 10.1074 / jbc.M700921200 Pascual DW, Yang X, Holderness K, Jun S, Maddaloni M, Kochetkova I. Regulatory T-cell vaccination independent of auto-antigen. Exp Mol Med. 2014 Mar 14;46(3):e82. Liu, Y, Esser, L., Interlandi, G., Kisiela, D.I., Tchesnokova, V, Thomas, W.E., Sokurenko, E., Xia, D., and Savarino, S.J. Tight conformational coupling between the domains of the enterotoxigenic Escherichia coli fimbrial adhesin CfaE regulates binding state transition. J. Biol. Chem. 288:9993-10001, 2013. doi: 10.1074 / jbc.Ml 12.413534 Buist, G., Kok, J., Leenhouts, K.J., Dabrowska, M., Venema, G., and Haandrikman, A. J. Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase needed for cell separation. J. Bacteriol. 177:1554 1563, 1995. doi: 10.1128 / jb.177.6.1554-1563.1995 Leenhouts, K., Buist, G., and Kok, J. Anchoring of proteins to lactic acid bacteria. Antonie Van Leeuwenhoek. 76:367-376, 1999. Tarahomjoo, S., Katakuram Y, Satoh, E, and Shioya, S. Bidirectional cell-surface anchoring function of C-terminal repeat region of peptidoglycan hydrolase of Lactococcus lactis IL1403. J. Biosci. Bioeng. 105:116-121, 2008. doi: 10.1263 / jbb.105.116 van Asseldonk, M., Rutten, G., Oteman, M., Siezen, R.J., de Vos, W.M., and Simons, G. Cloning of usp45, a gene encoding a secreted protein from Laclococcus lactis subsp. Lactis MG1363. Gene. 95:155-160, 1990. doi: 10.1016 / 0378-1119(90)90428-1 Delaleu, N., Nguyen, C.Q., Peck, A.B., and Jonsson, R. Sjogren's syndrome: studying the disease in mice. Arthritis Res. Ther. 13:217, 2011. doi: 10.1186 / ar3313l. Cha, S., Nagashima, H., Brown, V.B., Peck, A.B., and Humphreys-Beher, M.G. Two NOD Idd- associatcd intervals contribute synergistically to the development of autoimmune exocrinopathy (Sjogren's syndrome) on a healthy murine background. Arthritis Rheum. 46:1390-1398, 2002. doi: 10.1002 / art.1025823. Nguyen, C.Q., Hu, M.H., Li, Y, Stewart, C., and Peck, A.B. Salivary gland tissue expression ofmterleukin-23 and interleukin- 17 in Sjogren's syndrome: findings in humans and mice. Arthritis Rheum. 58:734-743, 2008. doi: 10.1002 / art.2321424. Tchesnokova V, McVeigh AL, Kidd B, Yakovenko O, Thomas WE, Sokurenko EV, et al. Shear- enhanced binding of intestinal colonization factor antigen I of enterotoxigenic Escherichia coli. Mol Microbiol. 2010;76:489-502.25. Jansson L, Tobias J, Lebens M, Svennerholm AM, Teneberg S. The major subunit, CfaB, of colonization factor antigen I from enterotoxigenic Escherichia coli is a glyco sphingolipid binding protein. Infect Immun. 2006;74:3488-3497.26. Pascual DW, Ochoa-Reparaz J, Rynda A, Yang X. Tolerance in the absence of auto-antigen. Endocr Metab Immune Disord Drug Targets. 2007;7:203-210.27. Galen JE, Pasetti MF, Tennant S, Ruiz-Olvera P, Sztein MB, Levine MM. Salmonella enterica serovar Typhi live vector vaccines finally come of age. Immunol Cell Biol. 2009;87:400-412.28. McGregor AC, Waddington CS, Pollard AJ. Prospects for prevention of Salmonella infection in children through vaccination. Curr Opin Infect Dis. 2013;26:254-262.29. Desin TS, Koster W, Potter AA. Salmonella vaccines in poultry: past, present and future. Expert Rev Vaccines. 2013;12:87-96.30. Pasetti MF, Levine MM, Sztein MB. Animal models paving the way for clinical trials of attenuated Salmonella enterica serovar Typhi live oral vaccines and live vectors. Vaccine. 2003;21 :401-418.31. Curtiss R, 3rd, Xin W, Li Y, Kong W, Wanda SY, Gunn B, et al. New technologies in using recombinant attenuated Salmonella vaccine vectors. Crit Rev Immunol. 2010;30:255-270.32. Mestecky J, Nguyen H, Czerkinsky C, Kiyono H. Oral immunization: an update. Curr Opin Gastroenterol. 2008;24:713-719.33. Curtiss R., 3rd Bacterial infectious disease control by vaccine development. J Clin Invest. 2002;110: 1061-1066.34. Wu S, Pascual DW, VanCott JL, McGhee JR, Maneval DR, Jr, Levine MM, et al. Immune responses to novel Escherichia coli and Salmonella typhimurium vectors that express colonization factor antigen I (CFA / I) of enterotoxigenic E. coli in the absence of the CFA / I positive regulator cfaR. Infect Immun. 1995;63:4933^4938.35. Yang X, Suo Z, Thornburg T, Holdemess K, Walters N, Kellerman L, et al. Expression of Escherichia coli virulence usher protein attenuates wild-type Salmonella. Virulence. 2012;3:29-42.36. Cao L, Suo Z, Lim T, Jun S, Deliorman M, Riccardi C, et al. Role of overexpressed CFA / I fimbriae in bacterial swimming. Phys Biol. 2012;9:036005.37. Pascual DW, Hone DM, Hall S, van Ginkel FW, Yamamoto M, Walters N, et al. Expression of recombinant enterotoxigenic Escherichia coli colonization factor antigen I by Salmonella typhimurium elicits a biphasic T helper cell response. Infect Immun. 1999;67:6249-6256.38. Walters N, Trunkle T, Sura M, Pascual DW. Enhanced immunoglobulin A response and protection against Salmonella enterica serovar Typhimurium in the absence of the substance P receptor. Infect Immun. 2005;73:317-324.39. Pascual DW, Trunkle T, Sura J. Fimbriated Salmonella enterica serovar Typhimurium abates initial inflammatory responses by macrophages. Infect Immun. 2002;70:4273-4281.40. Miller SI, Ernst RK, Bader MW. LPS, TLR4 and infectious disease diversity. Nat Rev Microbiol. 2005;3:36-46.41. Ramos-Casals M, Brito-Zeron P, Sisd-Almirall A, Bosch X, Tzioufas AG. Topical and systemic medications for the treatment of primary Sjogren's syndrome. Nat. Rev. Rheumatol. 2012;8:399-411.42. Cornec D, Devauchelle-Pensec V, Tobon GJ, Pers JO, Jousse-Joulin S, Saraux A. B cells in Sjogren's syndrome: From pathophysiology to diagnosis and treatment. J. Autoimmun. 2012;39: 161-167.43. Meiners PM, Vissink A, Kallenberg CG, Kroese FG, Bootsma H. Treatment of primary Sjogren's syndrome with anti-CD20 therapy (rituximab). A feasible approach or just a starting point? Expert Opin. Biol. Ther. 2011;11 : 1381-2139.44. Perosa F, Prete M, Racanelli V, Dammacco F. CD20-depleting therapy in autoimmune diseases: From basic research to the clinic. J. Intern. Med. 2010;267:260-277.Fox RI, Fox CM, Gottenberg JE, Dbrner T. Treatment of Sjogren's syndrome: Current therapy and future directions. Rheumatology (Oxford) 2021;60:2066-2074. doi: 10.1093 / rheumatology / kezl42. Grigoriadou S, Chowdhury F, Pontarini E, Tappuni A, Bowman SJ, Bombardier! M. B cell depletion with rituximab in the treatment of primary Sjogren's syndrome: What have we learnt? Clin. Exp. Rheumatol. 2019;37:217-224. Bowman SJ, Everett CC, O'Dwyer JL, Emery P, Pitzalis C, Ng WF, Pease CT, Price EJ, Sutcliffe N, Gendi NST, Hall FC, Ruddock SP, Fernandez C, Reynolds C, Hulme CT, Davies KA, Edwards CJ, Lanyon PC, Moots RJ, Roussou E, Giles IP, Sharpies LD, Bombardier! M. Randomized controlled trial of rituximab and cost-effectiveness analysis in treating fatigue and oral dryness in primary Sjogren's syndrome. Arthritis Rheumatol. 2017; 69: 1440-1450. Devauchelle-Pensec V, Mariette X, Jousse-Joulin S, Berthelot JM, Perdriger A, Puechal X, Le Guem V, Sibilia J, Gottenberg JE, Chiche L, Hachulla E, Hatron PY, Goeb V, Hayem G, Morel J, Zamitsky C, Dubost JJ, Pers JO, Nowak E, Saraux A. Treatment of primary Sjogren syndrome with rituximab: A randomized trial. Ann. Intern. Med. 2014;160:233-242. Tsuboi, H., Matsumoto, I., Hagiwara, S., Hirota, T., Takahashi, H., Ebe, H., Yokosawa, M., Yagishita, M., Takahashi, H., Kurata, I., Ohyama, A., Honda, F., Asashima, H., Miki, H., Umeda, N., Kondo, Y, Hirata, S., Saito, K., Tanaka, Y, Horai, Y, Nakamura, H., Kawakami, A. & Sumida, T. Effectiveness of abatacept for patients with Sjogren's syndrome associated with rheumatoid arthritis. An open label, multicenter, one-year, prospective study: ROSE (Rheumatoid Arthritis with Orencia Trial toward Sjogren's syndrome Endocrinopathy) trial. Mod. Rheumatol. 26, 891-899 (2016). Adler S, Komer M, Forger F, Huscher D, Caversaccio MD, Villiger PM. Evaluation of histologic, serologic, and clinical changes in response to abatacept treatment of primary Sjogren’s syndrome: A pilot study. Arthritis Care Res. (Hoboken) 2013;65: 1862-1868. Chen W, Yang F, Xu G, Ma J, Lin J. Follicular helper T cells and follicular regulatory T cells in the immunopathology of primary Sjogren's syndrome. J. Leukoc. Biol. 2021;109:437-447. Verstappen GM, Meiners PM, Cometh OBJ, Visser A, Arends S, Abdulahad WH, Hendriks RW, Vissink A, Kroese FGM, Bootsma H. Attenuation of follicular helper T cell-dependent B cell hyperactivity by abatacept treatment in primary Sjogren's syndrome. Arthritis Rheumatol. 2017;69: 1850-1861.53. Tsuboi H, Toko H, Honda F, Abe S, Takahashi H, Yagishita M, Hagiwara S, Ohyama A, Kondo Y, Nakano K, Tanaka Y, Shimizu T, Nakamura H, Kawakami A, Fujicda Y, Atsumi T, Suzuki Y, Kawano M, Nishina N, Kaneko Y, Takeuchi T, Kobayashi H, Takei M, Ogasawara M, Tamura N, Takasaki Y, Yokota K, Akiyama Y, Mimura T, Murakami K, Mimori T, Ohshima S, Azuma N, Sano H, Nishiyama S, Matsumoto I, Sumida T. Abatacept ameliorates both glandular and extraglandular involvements in patients with Sjogren's syndrome associated with rheumatoid arthritis: Findings from an open-label, multicenter, 1-year, prospective study: The ROSE (Rheumatoid Arthritis with Orencia Trial Toward Sjogren's Syndrome Endocrinopathy) and ROSE II trials. Mod. Rheumatol. 2022;33: 160-168. 54. de Wolff L, van Nimwegen JF, Mossel E, van Zuiden GS, Stel AJ, Majoor KI, Olie L, Los LI,Vissink A, Spijkervet FKL, Verstappen GMPJ, Kroese FGM, Arends S, Bootsma H. Long-term abatacept treatment for 48 weeks in patients with primary Sjogren's syndrome: The open-label extension phase of the ASAP-III trial. Semin. Arthritis Rheum. 2022;53: 151955.
Claims
CLAIMSWhat is claimed is:
1. A probiotic microbe recombinantly expressing E. coli CfaE subunit for the treatment of inflammatory- or autoimmune disease, wherein the E. coli CfaE subunit has an amino acid sequence comprising SEQ ID NO:1 or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 1 ; and which is encoded by a nucleic acid sequence that comprises SEQ ID NO:4 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 4.
2. The probiotic microbe of claim 1 , wherein the N-terminus of CfaE is fused to a structural component that anchors CfaE to the cell wall, and the N-terminus of the structural component is fused to a signal peptide.
3. The probiotic microbe of claim 2, wherein the structural component is from L. lactis peptidoglycan hydrolase (ACM).
4. The probiotic microbe of claim 3, wherein the amino acid sequence of ACM comprises SEQ ID NO:2, or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 2; and which is encoded by a nucleic acid sequence that comprises SEQ ID NO:5 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 5.
5. The probiotic microbe of claim 2, wherein the signal peptide is L. lactis USP45 signal peptide,6. The probiotic microbe of claim 5, wherein the amino acid sequence of the USP45 signal peptide comprises SEQ ID NO:3, or an amino acid sequence with at least 80% sequence identity to the SEQ ID NO: 3; and which is encoded by a nucleic acid sequence that comprises SEQ ID NO:6 or a nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 6.
7. The probiotic microbe of claim 1, wherein the probiotic microbe strain is one selected from Saccharomyces boulardii, Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosits, Lactiplantibacillus plantarum, Lactobacillus acidophilus Lactobacillus johnsonii, Lactobacillus delbrueckii subsp. Bulgarians, Lactobacillusbrevis, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus fermentum ME-3, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium adolescentis, Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium longum, Enterococcus durans, Enterococcus faecium, Escherichia coli, Limosilactobacillus reuteri, Limosilactobacillus fermentum, Ligilactobacillus salivarius, Streptococcus thermophilus, Streptococcus salivarius, Bacillus cereus, Bacillus coagulans, Leuconostoc mesenteroides, Pediococcus acidilactici, and Lactococcus lactis, and in particular L. lactis.
8. The probiotic microbe of claim 1, wherein inflammatory- or autoimmune disease can be rheumatoid arthritis or Sjogren’s syndrome.
9. A nucleotide fragment comprising a nucleic acid sequence of SEQ ID NO:4 or SEQ ID NO:7 or any nucleic acid sequence with at least 80% sequence identity to the SEQ ID NO: 4 or 7.
10. A recombinant vector comprising the nucleotide fragment of claim 9, wherein the vector is plasmid, episome, bacteriophage, or virus.
11. A host cell comprising the nucleotide fragment of claim 9, wherein the host cell is bacteria, yeast, insect cell, or mammalian cell.
12. A composition for the treatment of inflammatory- or autoimmune disease, the composition comprising probiotic microbe recombinantly expressing E. coli CfaE subunit of claim 1 , wherein the probiotic microbe strain, optionally, is one or more strains selected from Saccharomyces boulardii, Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosus, Lactiplantibacillus plantarum, Lactobacillus acidophilus Lactobacillus johnsonii, Lactobacillus delbrueckii subsp. Bulgaricus, Lactobacillus brevis, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus crispatus, Lactobacillus fermentum ME-3, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium adolescentis, Bifidobacterium animalis, Bifidobacterium breve, Bifidobacterium bifidum, Bifidobacterium longum, Enterococcus durans, Enterococcus faecium, Escherichia coli, Limosilactobacillus reuteri, Limosilactobacillus fermentum, Ligilactobacillus salivarius, Streptococcus thermophilus, Streptococcus salivarius,Bacillus cereus, Bacillus coagulans, Leuconostoc mesenteroides, Pediococcus acidilactici, and / or Lactococcus lactis.
13. The composition of claim 12, wherein the composition is in a solid dosage form for oral administration selected from powder, granules, capsule, tablet, pill, and gummies.
14. The composition of claim 12 or 13, wherein the dose of one unit is 5xl06to 5xl012CFUs.
15. The composition of claim 12 or 13, wherein the composition further comprises excipients.
16. The composition of claim 12, wherein inflammatory- or autoimmune disease can be rheumatoid arthritis or Sjogren’s syndrome.
17. A method for the treatment of inflammatory- or autoimmune disease, the method comprising administering a composition of claim 12, wherein the composition is, optionally, in a form of a food or a food supplement, or administered with other pharmaceutical, physical or surgical intervention for inflammatory- or autoimmune disease.
18. The method of claim 17, wherein inflammatory- or autoimmune disease can be rheumatoid arthritis or Sjogren’s syndrome.
19. The method of claim 17, wherein the daily dose of the composition of claim 12 is 5xl06to 5x 1012CFUs, or 5x 107to 5x 109CFUs.
20. The method of claim 17, wherein the composition is administered according to a regimen of administering to the subject once a day, twice a day, thrice a day, once every two days, once every three days, once every four days, once every five days, once every six days, once a week, once every two weeks, once every three weeks, or once a month, for a month, two months, three months, four months, five months, six months, a year or longer period.
Citation Information
Patent Citations
Recombinant lactococcus lactis expressing escherichia coli colonization factor antigen i (CFA / i) fimbriae and their methods of use
US20140086950A1
Synthetic Antigen Constructs Against Campylobacter Jejuni
US20180177857A1