Peptide for preventing or treating chronic obstructive pulmonary disease (COPD) and use thereof

Abstract

The present invention relates to a peptide for preventing or treating chronic obstructive pulmonary disease (COPD) and a use thereof. Specifically, the peptide prepared according to the present invention reduces the production of chemokines and inflammatory cytokines involved in pulmonary dysfunction in a COPD animal model, decreases the expression of genes causing excessive mucus production and the secretion of airway resistance factors, and exhibits the effect of inhibiting an increase in neutrophils, which are key cells related to COPD pathogenesis. Thus, the peptide can be effectively used as an active ingredient in a composition for preventing or treating COPD.

Description

Peptides for preventing or treating chronic obstructive pulmonary disease (COPD) and their uses

[0001] The present invention relates to a peptide for preventing or treating chronic obstructive pulmonary disease (COPD) and its use.

[0002] Chronic obstructive pulmonary disease (COPD) is a common lung disease, along with asthma. However, it differs from asthma in that it causes irreversible airway obstruction. COPD has a prevalence of 7.8% among adults in Korea, making it the fourth leading cause of death worldwide. Due to the continued increase in the number of patients, it is projected to reach the third leading cause of death by 2020. While mortality rates for major chronic diseases, including coronary artery disease, stroke, and other cardiovascular diseases, are decreasing, COPD is the only disease with an increasing mortality rate. The direct and indirect costs and losses associated with COPD are a significant socioeconomic burden.

[0003] COPD is a disease caused by pathological changes in the bronchioles and lung parenchyma due to inflammation of the airways and lung parenchyma. It is characterized by chronic bronchitis and emphysema. Chronic bronchitis is further classified into chronic simple bronchitis, which does not involve airflow obstruction, and chronic asthmatic bronchitis and chronic obstructive bronchitis, depending on the reversibility of airflow obstruction.

[0004] Smoking is considered the most important cause of COPD. Smoking acts as a potent toxicant in lung tissue, stimulating the production of oxidants, proinflammatory factors, and chemotactic factors. This in turn promotes the excessive migration of inflammatory cells, such as neutrophils. Inflammatory cells that migrate into lung tissue secrete numerous inflammatory mediators, further exacerbating lung inflammation. TNF-α, MIP2, and CXCL-1 are known mediators that promote this inflammatory response, and they are used as important markers of smoke-induced inflammatory responses. Furthermore, excessive mucus production occurs in response to inflammatory signals. In chronic bronchitis, smoking, viral infection, bacterial infection, or inflammatory cell activation can trigger mucin gene transcription through activation of the epidermal growth factor receptor (EGFR). This mucus accumulation can lead to bronchial lumen obstruction, airway obstruction, and disease exacerbation.

[0005] Meanwhile, the exact pathogenesis of COPD is still largely unknown, and although various treatments are available, there is currently no drug that can fundamentally treat the onset and progression of the disease. However, mucolytic agents used to control mucus in COPD have been shown to reduce the frequency of acute exacerbations, suggesting their effectiveness in patients with frequent exacerbations or repeated hospitalizations. Furthermore, recent research on COPD has shown that chemotactic factors that promote the migration of inflammatory cells, such as MIP-2 and CXCL-1, play a crucial role in the onset and development of COPD. For example, in the progression of COPD, chemokines such as MIP-2 and CXCL-1 bind to receptors on airway epithelial cells, alveolar cells, and inflammatory cells to exert chemotactic effects, leading to excessive infiltration of inflammatory cells into inflamed areas within the lung tissue. In addition, chemokines activate inflammatory cells to produce pro-inflammatory factors such as TNF-α, IL-1β, IL-6, and IL-8. In particular, TNF-α activates inflammatory signaling systems such as NF-κB and MAPK, which further aggravates the inflammatory response. In addition to pro-inflammatory factors, chemokines produce various growth factors and reactive oxygen species that cause persistent inflammatory responses, damage to lung parenchyma, and fibrosis in lung tissue. This series of reactions causes a significant decline in lung function, which is the most notable characteristic of COPD patients. Therefore, inhibiting the production of chemokines such as MIP-2 and CXCL-1 is considered a very important method in the treatment of COPD.

[0006] Accordingly, the inventors of the present invention have made efforts to develop a substance that can more effectively prevent or treat COPD, and as a result, when a peptide manufactured according to the present invention is administered to a COPD animal model, the production of chemokines and inflammatory cytokines involved in lung function damage is reduced, the expression of genes that induce excessive mucus production and the secretion of airway resistance factors are reduced, and the increase of neutrophils, which are major related cells in the pathogenesis of COPD, is suppressed, and the present invention has been completed based on this.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] Republic of Korea Publication Patent No. 10-2015-0120880

[0010] Korean U.S. Patent No. 10-1901062

[0011] [Non-patent literature]

[0012] Park, K.O., General concept of chronic obstructive pulmonary disease (COPD), Tuberculosis and Respiratory Diseases 1994;41(3):205-214.

[0013] Barnes P.J. The cytokine network in asthma and chronic obstructive pulmonary disease. J Clin Invest 2008;118(11):3546-56.

[0014] Traves S, Culpitt S, Russell R, Barnes P, Donnelly L. Increased levels of the chemokines GROα and MCP-1 in sputum samples from patients with COPD. Thorax 2002;57(7):590-5.

[0015] Culpitt SV, Rogers DF, Shah P, De Matos C, Russell RE, Donnelly LE, et al. Impaired inhibition by dexamethasone of cytokine release by alveolar macrophages from patient swith chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2003;167(1):24-31.

[0016] The purpose of the present invention is to provide a peptide for preventing or treating chronic obstructive pulmonary disease (COPD) and its use.

[0017] In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease (COPD), comprising as an active ingredient a peptide consisting of an amino acid sequence represented by SEQ ID NO: 1 or 2, or a polynucleotide encoding the same; use of the peptide or the polynucleotide encoding the same for use as a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease; use of the peptide or the polynucleotide encoding the same for preparing a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease; and a method for treating chronic obstructive pulmonary disease, comprising administering to a subject the peptide or the polynucleotide encoding the same.

[0018] In addition, the present invention provides a health functional food for preventing or improving chronic obstructive pulmonary disease, comprising as an active ingredient a peptide consisting of an amino acid sequence represented by SEQ ID NO: 1 or 2, or a polynucleotide encoding the same; use of the peptide or the polynucleotide encoding the same for use as a health functional food composition for preventing or improving chronic obstructive pulmonary disease; use of the peptide or the polynucleotide encoding the same for producing a health functional food composition for preventing or improving chronic obstructive pulmonary disease; and a method for preventing or improving chronic obstructive pulmonary disease, comprising administering to a subject the peptide or the polynucleotide encoding the same.

[0019] In the present invention, in a chronic obstructive pulmonary disease (COPD) animal model, the peptide according to the present invention was found to have an effect of suppressing respiratory damage by reducing neutrophils in bronchoalveolar lavage fluid (BALF), the level of airway resistance factor SDMA (Symmetric dimethylarginine) in serum, the levels of chemokines CXCL-1 and MIP2 in BALF, the level of inflammatory cytokine TNF-α in BALF, and the level of expectorant-related gene MUC5AC in lung tissue. Therefore, the peptide according to the present invention can be usefully utilized as an active ingredient of a composition for preventing or treating COPD.

[0020] Figure 1 is a diagram confirming the effect of reducing the serum airway resistance factor SDMA (Symmetric dimethylarginine) by the synthetic peptides AES16-2M and AES16-2D of the present invention in a chronic obstructive pulmonary disease (COPD) animal model.

[0021] Figure 2 is a diagram confirming the effect of reducing the total cell count in bronchoalveolar lavage fluid (BALF) by the synthetic peptides AES16-2M and AES16-2D of the present invention in a COPD animal model.

[0022] Figure 3 is a diagram confirming the effect of reducing the number of neutrophils in BALF by the synthetic peptides AES16-2M and AES16-2D of the present invention in a COPD animal model.

[0023] Figure 4 is a diagram confirming the effect of reducing the levels of chemokines CXCL-1 and MIP2 and inflammatory cytokine TNF-α in BALF by synthetic peptides AES16-2M and AES16-2D of the present invention in a COPD animal model.

[0024] Figure 5 is a diagram confirming the effect of reducing the level of the MUC5AC gene related to expectoration in lung tissue by the synthetic peptides AES16-2M and AES16-2D of the present invention in a COPD animal model.

[0025] Hereinafter, the terms of the present invention are defined as follows.

[0026] In the present invention, not only the conventional one-letter and three-letter codes for naturally occurring amino acids are used, but also the generally accepted three-letter codes for other amino acids, such as Aib (α-aminoisobutyric acid) and Sar (N-methylglycine), are used. In addition, amino acids referred to by abbreviations herein are described according to the IUPAC-IUB nomenclature.

[0027] The "peptide" of the present invention refers to a polymer composed of two or more amino acids linked by an amide bond (or peptide bond), and for the purpose of the present invention, refers to a peptide having a therapeutic effect on chronic obstructive pulmonary disease (COPD).

[0028] In the present invention, “stability” means not only in vivo stability that protects the peptide of the present invention from attack by in vivo protein cleavage enzymes, but also storage stability (e.g., room temperature storage stability).

[0029] The "polynucleotide" of the present invention is a polymer in which nucleotides are combined, and serves to transmit genetic information.

[0030] In the present invention, “prevention” means any act of suppressing a disease or delaying its onset by administering a pharmaceutical composition according to the present invention.

[0031] In the present invention, “treatment” means any act in which the symptoms of a disease are improved or beneficially changed by administering a pharmaceutical composition according to the present invention.

[0032] In the present invention, the term "subject" means a subject requiring treatment of a disease, and more specifically, means a mammal such as a human or non-human primate, mouse, dog, cat, horse, or cow.

[0033] “Improvement” in the present invention means any action that at least reduces a parameter related to the condition being treated, for example, the severity of a symptom.

[0034] Hereinafter, the present invention will be described in more detail.

[0035] The present invention provides a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease (COPD), comprising as an active ingredient a peptide consisting of an amino acid sequence represented by SEQ ID NO: 1 or 2, or a polynucleotide encoding the same; use of the peptide or the polynucleotide encoding the same for use as a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease; use of the peptide or the polynucleotide encoding the same for preparing a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease; and a method for treating chronic obstructive pulmonary disease, comprising administering to a subject the peptide or the polynucleotide encoding the same.

[0036] In the present invention, the peptide can be obtained by various methods widely known in the art. For example, the peptide can be produced using polynucleotide recombination and protein expression systems, in vitro synthesis through chemical synthesis such as peptide synthesis, and cell-free protein synthesis.

[0037] In addition, a protecting group may be bonded to the N- or C-terminus of the peptide to obtain better chemical stability, enhanced pharmacological properties (half-life, absorbability, potency, efficacy, etc.), altered specificity (e.g., broad biological activity spectrum), and reduced antigenicity. Preferably, the protecting group is an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, or a polyethylene glycol (PEG), a methyl group, an amide group, an albumin group, a polysialic acid group, a hydroxyethyl starch (HES), or a C 12 -C 18 It may be a fatty acid group, but it may be included without limitation if it is a component that can improve the modification of the peptide, especially the stability of the peptide.

[0038] In addition, the peptides of the present invention may also include functional variants. Such functional variants include biological equivalents of the peptide sequence described herein (SEQ ID NO: 1 or 2). For example, additional changes may be made to the amino acid or polynucleotide sequence of the peptide to further improve the binding affinity and / or other biological properties of the peptide. Such modifications include deletions, insertions, and / or substitutions of amino acid sequence residues of the peptide, and are made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, and charge size. Analysis of the size, shape, and type of amino acid side chain substituents reveals that arginine, lysine, and histidine are all positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; Alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine are biologically functional equivalents.

[0039] Additionally, the peptide exhibits the following activities to inhibit respiratory damage in chronic obstructive pulmonary disease:

[0040] (a) Inhibition of SDMA (Symmetric dimethylarginine) production;

[0041] (b) Decreased number of neutrophils around the bronchi;

[0042] (c) inhibition of production of CXCL-1 and MIP2; or

[0043] (d) Inhibition of MUC5AC production.

[0044] In the present invention, the chronic obstructive pulmonary disease may be chronic bronchitis or emphysema, and the chronic bronchitis may be specifically simple chronic bronchitis, chronic obstructive bronchitis, chronic asthmatic bronchitis, or chronic bronchiolitis, and the emphysema may be specifically centrilobular emphysema, panlobular emphysema, or paraseptal emphysema, but is not limited thereto.

[0045] According to one embodiment of the present invention, two types of peptides (AES16-2M and AES16-2D) were prepared. In addition, when the peptides were administered to an animal model of chronic obstructive pulmonary disease (COPD), the neutrophils in bronchoalveolar lavage fluid (BALF) were reduced, and the levels of airway resistance factor SDMA in the serum, chemokines CXCL-1 and MIP2 in the BALF, inflammatory cytokine TNF-α in the BALF, and the expectorant-related gene MUC5AC in the lung tissue were reduced, thereby confirming the effect of suppressing respiratory damage. Therefore, the peptide according to the present invention can be usefully utilized as an active ingredient of a composition for preventing or treating COPD.

[0046] Meanwhile, the peptide of the present invention or the polynucleotide encoding the same may be delivered using a pharmaceutically acceptable carrier such as a colloidal suspension, powder, saline solution, lipid, liposome, microsphere, or nano-sphere particle. They may form a complex with or be associated with a delivery vehicle, and may be delivered in vivo using a delivery system known in the art such as lipid, liposome, microparticle, gold, nanoparticle, polymer, condensation agent, polysaccharide, polyamino acid, dendrimer, saponin, adsorption enhancing agent, or fatty acid.

[0047] In addition, pharmaceutically acceptable carriers may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil, which are commonly used in formulations. In addition, lubricants, wetting agents, sweetening agents, flavoring agents, emulsifiers, suspending agents, preservatives, and the like may be further included in addition to the above ingredients.

[0048] The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intramuscularly, intravenously, intraperitoneally, subcutaneously, intradermally, or topically) depending on the intended method, and the dosage varies depending on the patient's condition and weight, the degree of disease, the drug form, the route of administration, and the time of administration, but can be appropriately selected by those skilled in the art.

[0049] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level may be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered simultaneously, separately, or sequentially with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0050] Specifically, the dosage of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption rate of the active ingredient in the body, inactivation rate, excretion rate, disease type, and concomitantly administered drug, and may increase or decrease depending on the route of administration, severity of obesity, sex, weight, age, etc. In general, 0.001 mg to 100 mg per kg of body weight, specifically 0.01 mg to 50 mg, and more specifically 0.1 to 20 mg may be administered daily or every other day, or once a day or divided into several times, but the above dosage does not limit the scope of the present invention in any way.

[0051] In addition, the present invention provides a health functional food for preventing or improving chronic obstructive pulmonary disease, comprising as an active ingredient a peptide consisting of an amino acid sequence represented by SEQ ID NO: 1 or 2, or a polynucleotide encoding the same; use of the peptide or the polynucleotide encoding the same for use as a health functional food composition for preventing or improving chronic obstructive pulmonary disease; use of the peptide or the polynucleotide encoding the same for producing a health functional food composition for preventing or improving chronic obstructive pulmonary disease; and a method for preventing or improving chronic obstructive pulmonary disease, comprising administering to a subject the peptide or the polynucleotide encoding the same.

[0052] In the present invention, the peptide, polynucleotide, and chronic obstructive pulmonary disease are as described above.

[0053] In addition, the present inventors confirmed that the peptide according to the present invention has an effect of suppressing respiratory damage in a chronic obstructive pulmonary disease (COPD) animal model by reducing neutrophils in BALF, and reducing the level of airway resistance factor SDMA in serum, the level of chemokines CXCL-1 and MIP2 in BALF, the level of inflammatory cytokine TNF-α in BALF, and the level of expectorant-related gene MUC5AC in lung tissue. Therefore, the peptide according to the present invention can be usefully utilized as an effective ingredient of a health functional food for preventing or improving COPD.

[0054] In the health functional food of the present invention, the active ingredient may be added directly to the food or used in combination with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient mixed may be appropriately determined depending on the intended use (prevention or improvement). Generally, when manufacturing a food or beverage, the composition of the present invention may be added in an amount of preferably 15% by weight or less, and preferably 10% by weight or less, relative to the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

[0055] The health functional food of the present invention, in addition to containing the above-mentioned effective ingredient, may contain other ingredients as essential ingredients without special limitations. For example, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. Examples of the above-mentioned natural carbohydrates may include conventional sugars such as monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as dextrin, cyclodextrin, etc.; and sugar alcohols, such as xylitol, sorbitol, erythritol, etc. In addition to the above-mentioned flavoring agents, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of the above-mentioned natural carbohydrates can be appropriately determined by those skilled in the art.

[0056] In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used independently or in combination, and the ratio of these additives may also be appropriately selected by those skilled in the art.

[0057] Hereinafter, the present invention will be described in detail by examples.

[0058] However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0059] <Example 1> Preparation of peptides

[0060] In this example, the peptides shown in [Table 1] below were prepared. Subsequently, the synthesized peptides were purified using high-performance liquid chromatography (SHIMADZU Prominence HPLC), and the column used was a Shiseido capcell pak C18 Column (4.6 × 50 mm). In addition, the mass of the synthesized peptides was confirmed using a mass spectrometer (HP 1100 series LC / MSD).

[0061] Peptide amino acid sequence AES16-2MREGRT (SEQ ID NO: 1) AES16-2DREGRTREGRT (SEQ ID NO: 2)

[0062] <Example 2> Creation of an animal model of chronic obstructive pulmonary disease (COPD) and peptide administration

[0063] <2-1> Manufacturing of standard tobacco extract (Cigarette Smoking Extract; CSE)

[0064] To create an animal model of chronic obstructive pulmonary disease (COPD), a standard cigarette smoking extract (CSE) was prepared as follows.

[0065] Specifically, to produce a standard cigarette smoking extract (CSE), 60 standard cigarettes CM7 (Coresta Monitering Cigarette 7, Heinr Borgwaldt, Germany) and isopropanol (Isopropanol), ethanol (Ethanol, Merck, Germany), and n-heptadecane (n-heptadecane, Sigma-Aldrich, USA) were used, and the experimental equipment used was an automatic smoking machine (ISO 3308 standard product, model: RM20, Heinr Borgwaldt).

[0066] First, the collection of smoke condensate from a standard cigarette CM7 (Coresta Monitering Cigarette 7, Heinr Borgwaldt, Germany) was performed in a smoking room (temperature 22±2℃, relative humidity 60±5%) according to the ISO 3402 standard, and according to the ISO 3308 standard, a RM20 automatic smoking device (ISO 3308 standard product) was used to burn the cigarette using the ISO standard smoking method with a smoking volume of 35.0±0.3 ml, a smoking cycle of 60±0.5 sec, a smoking time of 2.00±0.02 sec, and a tip paper length of + 3 mm (Overwrap + 3 mm), and the cigarette smoke condensate (Total Particulate Matter, TPM) was collected using a 92 mm Cambridge filter (ISO 3308 standard product) (ISO 3308, 2000).

[0067] The Cambridge filters containing the above cigarette smoke condensates were separated from the cigarette holder and placed in 100 ml Erlenmeyer flasks, 50 ml of isopropanol as an extraction solvent was added to each, shaken well, and then left at room temperature for more than 8 hours to extract. After extraction, the mixture was filtered and concentrated using a vacuum filtration concentrator, and the concentrates in the three Erlenmeyer flasks were collected in scintillation vials and completely concentrated using nitrogen gas.

[0068] Meanwhile, the weight measurement of TPM and calculation of the TPM content in the mainstream tobacco of standard cigarettes were performed as follows. Before smoking, the weight of the cigarette pipe containing the Cambridge filter before combustion was measured according to the ISO4387 standard, and the weight of the cigarette pipe with the tobacco smoke captured by the Cambridge filter after combustion was measured, and the TPM content was calculated using the following [Mathematical Formula 1] (ISO4387, 2000). The standard cigarettes were burned three times, and the contents were 16.0621 mg for 19 cigarettes, 15.9135 mg for 20 cigarettes, and 15.5380 mg / cig for 20 cigarettes. The total number of standard cigarette samples was 59, and the TPM was 47.5136 mg.

[0069] [Mathematical Formula 1]

[0070] ,

[0071] Here TPM: Tobacco Smoke Condensate; W FHA : Weight of the pipe after smoking; W FHB : Weight of the pipe before smoking; and N: Number of cigarettes smoked per trap (cig).

[0072] <2-2> Creation of an animal model of chronic obstructive pulmonary disease (COPD) and peptide administration

[0073] In order to determine the effect of the peptide prepared in <Example 1> above in COPD, a COPD-induced animal model was created as follows, and the peptide prepared in <Example 1> above was administered.

[0074] Specifically, 7-week-old male SPF (Specific Pathogen-Free) BALB / c mice (18–20 g) were supplied by Orient Bio (Korea). The animals were provided with sufficient solid feed (antibiotic-free, Samyang Feed Co.) and water until the day of the experiment, and were acclimated for 1 week in an environment with a temperature of 22±2°C, a humidity of 55±15%, and a 12-h light-dark cycle before being used in the experiment.

[0075] In addition, as shown in [Table 2] below, (i) untreated normal group (Normal), (ii) COPD-induced group treated with LPS + CSE and administered saline (CSE_CTL), (iii) experimental group intraperitoneally administered dexamethasone (Dexamethasone, 3 mg / kg, ip) 1 hour before LPS + CSE treatment (CSE_Dexa 3 mg / kg), (iv) experimental group subcutaneously administered 1, 10, 20 mg / kg of AES16-2M (Peptide A, sc) prepared in the above <Example 1> 1 hour before LPS + CSE treatment (CSE_Peptide A 1, 10, 20 mg / kg), (v) 1, The subjects were divided into experimental groups (CSE_Peptide B 1, 10, 20 mg / kg) administered subcutaneously at 10 and 20 mg / kg.

[0076] Group Administration Substance Untreated Normal Group (Balb / c Normal) - COPD Induced Group (CSE_CTL) LPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ Positive Control Group (CSE_Dexa 3 mg / kg) LPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + Dexamethasone 3 mg / kg AES16-2M Administration Group (CSE_Peptide A) 1 mg / kg LPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2M 1 mg / kg 10 mg / kg LPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2M 10 mg / kg 20 mg / kg LPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2M 20 mg / kg AES16-2D Administration Group (CSE_Peptide B) 1 mg / kgLPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2D 1 mg / kg10 mg / kgLPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2D 10 mg / kg20 mg / kgLPS 100 ㎍ / ㎖ + CSE 4 mg / ㎖ + AES16-2D 20mg / kg

[0077] Next, to induce COPD, 7-week-old BALB / c male mice were anesthetized with Ketamine / Rumpun and then 100 μl of LPS + CSE (1:1 mixture of 100 μg / ml of LPS and 4 mg / ml of CSE prepared in Example <2-1> above) was inhaled into the nose once a week for 3 weeks using the INT (Intra-Nasal-Trachea) injection method to create a COPD model. That is, after slightly anesthetizing the LPS + CSE mixture, the mice were fixed with a rubber band on their front teeth when they were still, and 50 μl of INT was inhaled into the nose and mouth respectively, for a total of 100 μl. In addition, AES16-2M (1, 10, 20 mg / kg) and AES16-2D (1, 10, 20 mg / kg) were administered by subcutaneous injection (sc) 1 hour before LPS + CSE treatment, and then administered by subcutaneous injection daily for 2 weeks. At this time, AES16-2M and AES16-2D were easily dissolved in water, so they were dissolved using saline for injection. In addition, as a positive control, dexamethasone 3 mg / kg was administered intraperitoneally (ip) 1 hour before LPS + CSE treatment, and then administered intraperitoneally daily for 2 weeks. After the experiment, the blood, lung lavage fluid, and lung tissue of the mice in each group were separated and used in the experiment.

[0078] <Example 3> Analysis of bronchial pulmonary function indicator (SDMA)

[0079] In order to determine the respiratory damage suppression effect of administering the peptide prepared in <Example 1> in a COPD animal model, the airway resistance factor SDMA (Symmetric dimethylarginine) was measured in the serum of a COPD-induced animal model.

[0080] Specifically, COPD was induced by the method described in the above Example <2-2>, and peptide or dexamethasone was administered. After the experiment was completed, 20 μl of 50 IU heparin (APU8AF, Jungwoo Pharmaceutical) was placed in a 3 ml syringe, and the mice were anesthetized with ethyl ether. 800 to 1,000 μl of blood was collected by cardiac puncture. 500 μl of the collected blood was placed in 9.5 ml of ACK solution and left for 5 minutes to lyse red blood cells. PBMCs were separated by centrifugation at 1,200 rpm for 5 minutes, stained with 0.04% Trypan blue, and the total cell count ( / ml) was measured. In addition, SDMA in the serum was measured by ELISA.

[0081] As a result, as shown in Fig. 1, it was confirmed that the SDMA level significantly increased by more than 1.5 times in the COPD-induced group (CSE_CTL) compared to the normal group (Balb / c Normal). In addition, it was confirmed that the positive control group (CSE_Dexa 3 mg / kg) showed a level similar to the COPD-induced group. On the other hand, it was confirmed that the SDMA level in the AES16-2M administration group (CSE_Peptide A) significantly decreased compared to the COPD-induced group. It was also confirmed that the SDMA level in the AES16-2M administration group (CSE_Peptide B) significantly decreased, similar to the AES16-2M administration group.

[0082] Through the above results, it was confirmed that the peptides AES16-2M and AES16-2D according to the present invention reduce the increased SDMA secretion in COPD.

[0083] <Example 4> Bronchoalveolar lavage fluid (BALF) separation and cell count analysis in BALF

[0084] It is known that the increase in activated neutrophils in COPD patients is closely related to the rate of progression of airflow limitation and lung function decline, and plays an important role in the chronic inflammation-related pathogenesis of COPD. Therefore, in order to investigate the respiratory damage suppression effect of administration of the peptide prepared in <Example 1> in a COPD animal model, the total cell count and neutrophil count were measured in the bronchoalveolar lavage fluid (BALF) of the COPD animal model.

[0085] Specifically, COPD was induced by the method described in Example <2-2>, and peptides or dexamethasone were administered, and blood was collected after the experiment was completed. Then, after dissecting, a syringe containing 1 ml of FBS-free / DMEM culture medium was injected into the trachea, tied with a string, and circulated three times to isolate bronchoalveolar lavage fluid (BALF). After that, red blood cells were lysed by treating with ACK solution at 37°C for 5 minutes, and washed again with FBS-free / DMEM culture medium, stained with 0.04% trypan blue, and the total cell count was measured. In addition, after performing BALF cell cytospin, the sedimented blood cells were separated, Diff-Quik staining was performed, and neutrophils were counted at 400x magnification using an optical microscope.

[0086] As a result, as shown in Fig. 2, it was confirmed that the total cell count in BALF showed a significant increase in the COPD-induced group (CSE_CTL) compared to the normal group (Balb / c_Normal). On the other hand, it was confirmed that the positive control group (CSE_Dexa 3 mg / kg), AES16-2M administration group (CSE_Peptide A), and AES16-2D administration group (CSE_Peptide B) showed a decrease compared to the COPD-induced group. In particular, it was confirmed that the positive control group and AES16-2M 20 mg / kg administration group (CSE_Peptide A 20 mg / kg) showed a significant decrease in the BAL cell count compared to the COPD-induced group.

[0087] In addition, as shown in Fig. 3, it was confirmed that neutrophils in BALF showed a significantly significant increase in the COPD-induced group (CSE_CTL) compared to the normal group (Balb / c_Normal). On the other hand, it was confirmed that the positive control group (CSE_Dexa 3 mg / kg), AES16-2M administration group (CSE_Peptide A), and AES16-2D administration group (CSE_Peptide B) showed a significant decrease compared to the COPD-induced group. In particular, it was confirmed that the AES16-2M administration group (CSE_Peptide A) and AES16-2D administration group (CSE_Peptide B) showed a significantly more significant decrease than the positive control group.

[0088] Through the above results, it was confirmed that the peptides AES16-2M and AES16-2D manufactured in the present invention act to regulate the increase of neutrophils, which are major related cells in the pathogenesis of COPD.

[0089] <Example 5> Analysis of chemokines and cytokines in BALF

[0090] CXCL-1 is observed to increase in the sputum of COPD patients, and CXCL-1 and MIP2 are known to act as chemokines, mainly secreted from macrophages, and to cause inflammatory cells such as neutrophils to gather to the lesion. In addition, TNF-α, IL-1β, etc. are known to be major pro-inflammatory cytokines that activate macrophages in COPD patients and cause them to secrete chemokines such as MMP9. Therefore, in order to determine the effect of suppressing respiratory damage by administering the peptide prepared in <Example 1> in a COPD animal model, the levels of CXCL-1, MIP2, and TNF-α in the BALF of the COPD animal model were measured.

[0091] Specifically, after separating BALF using the method described in <Example 4> above, ELISA analysis was performed on the levels of CXCL-1, MIP2, and TNF-α in BALF using an ELISA kit (R&D system, USA) according to the manufacturer's procedure.

[0092] As a result, as shown in Fig. 4, it was confirmed that the chemokines CXCL-1 and MIP2 in BALF, and the inflammatory cytokine TNF-α showed a significant increase in the COPD-induced group (CSE_CTL) compared to the normal group (Balb / c_Normal). On the other hand, it was confirmed that the positive control group (CSE_Dexa 3 mg / kg), AES16-2M administration group (CSE_Peptide A), and AES16-2D administration group (CSE_Peptide B) decreased compared to the COPD-induced group.

[0093] In particular, for CXCL-1, it was confirmed that a significant decrease was observed in the positive control group, AES16-2M 10 mg / kg administration group (CSE_Peptide A 10 mg / kg), AES16-2M 20 mg / kg administration group (CSE_Peptide A 20 mg / kg), AES16-2D 1 mg / kg administration group (CSE_Peptide B 1 mg / kg), and AES16-2D 20 mg / kg administration group (CSE_Peptide B 20 mg / kg). In the case of MIP2, it was confirmed that there was a significant decrease in the positive control group, AES16-2M 10 mg / kg administration group (CSE_Peptide A 10 mg / kg), AES16-2M 20 mg / kg administration group (CSE_Peptide A 20 mg / kg), AES16-2D 1 mg / kg administration group (CSE_Peptide B 1 mg / kg), AES16-2D 10 mg / kg administration group (CSE_Peptide B 10 mg / kg), and AES16-2D 20 mg / kg administration group (CSE_Peptide B 20 mg / kg). In the case of TNF-α, a significant decrease was observed in the positive control group, AES16-2M 1 mg / kg administration group (CSE_Peptide A 1 mg / kg), AES16-2M 10 mg / kg administration group (CSE_Peptide A 10 mg / kg), AES16-2M 20 mg / kg administration group (CSE_Peptide A 20 mg / kg), AES16-2D 10 mg / kg administration group (CSE_Peptide B 10 mg / kg), and AES16-2D 20 mg / kg administration group (CSE_Peptide B 20 mg / kg).

[0094] Through the above results, it was confirmed that the peptides AES16-2M and AES16-2D manufactured in the present invention can suppress the production of inflammatory cytokines and chemokines involved in COPD, thereby preventing inflammatory cells from entering the airways and controlling inflammation in COPD, thereby suppressing the decline in lung function.

[0095] <Example 6> Analysis of genes related to expectoration in lung tissue

[0096] MUC5AC is a gene associated with expectoration, and its overexpression is known to induce excessive mucus production in the airways in COPD patients, worsening small airway obstruction. Therefore, to investigate the respiratory damage suppression effect of administration of the peptide prepared in <Example 1> in a COPD animal model, MUC5AC gene expression was analyzed in the lung tissue of a COPD animal model.

[0097] Specifically, COPD was induced by the method described in Example <2-2> above, and peptides or dexamethasone were administered, and lung tissue was extracted after the experiment was completed. RNAzol was added to the extracted lungs. B (CS-105B, Tel-Test) 500 ㎖ was added and ground until dissolved. 50 ㎖ of chloroform (CHCl3) was added to this mixed suspension and mixed again for 15 seconds. After leaving it on ice for 15 minutes, centrifugation was performed at 13,000 rpm. Approximately 200 ㎖ of the supernatant was collected, mixed with an equal volume of 200 ㎖ of 2-propanol, gently shaken, and left on ice for 15 minutes. After centrifugation again at 13,000 rpm, it was washed with 80% EtOH and dried in a vacuum pump for 3 minutes to extract RNA. The extracted RNA was dissolved in 20 ㎖ of distilled water treated with DEPC (Diethyl pyrocarbonate, IBS-BW1004, Intron), inactivated at 75 ℃, and then used for cDNA synthesis.

[0098] The reverse transcription reaction was performed by reacting 2 μg of the prepared RNA with 2 U / tube of DNase I ((M610A, Promega) 10 U / mL) in a 37°C heating block for 30 minutes, then denaturing at 75°C for 10 minutes, and adding 2.5 ml of 10 mM dNTPs mix, 1 ml of random sequence hexanucleotides ((11034731001, Roche) 25 pmole / 25 ml), 1 ml of RNase inhibitor ((2313A, TaKaRa) 20 U / mL as RNA inhibitor), 1 ml of 100 mM DTT, 4.5 ml of 5×RT buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), and then adding 1 ml of M-MLV RT (200 U / mL (M1705, Promega)) was added again and the final volume was made 20 mL with DEPC-treated distilled water. This 20 mL reaction mixture was mixed well, centrifuged at 2,000 rpm for 5 seconds, and reacted in a 37℃ heating block for 60 minutes to synthesize first-strand cDNA. Then, it was left at 95℃ for 5 minutes to inactivate M-MLV RT and then cDNA synthesis was completed.

[0099] The synthesized cDNA was subjected to real-time quantitative PCR using an Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems, USA) according to the method described in Galli SJ. Allergy, Curr. Biol., 10:R93-95, 2006. In addition, a probe for mouse G3PDH (Glyceraldehyde-3-phosphate dehydrogenase) was used as a control. The primers and probes used for real-time quantitative PCR are shown in [Table 3] below.

[0100] Primer sequence (5'→3') MUC5AC forwardAGAATATCTTTCAGGACCCCTGCT (SEQ ID NO: 3) reverseACACCAGTGCTGAGCATACTTTT (SEQ ID NO: 4) G3PDHVICCATGTTCCAGTATGACTCCACTCACG (SEQ ID NO: 5)

[0101] As a result, as shown in Fig. 5, it was confirmed that the expression of the MUC5AC gene in lung tissue significantly increased in the COPD-induced group (CSE_CTL) compared to the normal group (Balb / c_Normal). On the other hand, it was confirmed that the positive control group (CSE_Dexa 3 mg / kg), AES16-2M administration group (CSE_Peptide A), and AES16-2D administration group (CSE_Peptide B) decreased compared to the COPD-induced group. In particular, it was confirmed that a significant decrease was shown in the positive control group, AES16-2M 20 mg / kg administration group (CSE_Peptide A 20 mg / kg), and AES16-2D 20 mg / kg administration group (CSE_Peptide B 20 mg / kg). Through the above results, it was confirmed that the peptides AES16-2M and AES16-2D manufactured in the present invention can prevent excessive mucus production that occurs in COPD by inhibiting the expression of MUC5AC.

[0102] The peptide of the present invention exhibits the effect of reducing the production of chemokines and inflammatory cytokines involved in lung function impairment in a COPD animal model, reducing the expression of genes that induce excessive mucus production and the secretion of airway resistance factors, and suppressing the increase of neutrophils, which are major related cells in the pathogenesis of COPD, and therefore can be usefully utilized as an active ingredient of a composition for preventing or treating COPD.

Claims

1. A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease (COPD), comprising as an active ingredient a peptide consisting of an amino acid sequence represented by sequence number 1 or 2, or a polynucleotide encoding the same.

2. In the first paragraph, the N- or C-terminus of the peptide is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG), a methyl group, an amide group, an albumin group, a polysialic acid group, a hydroxyethyl starch (HES), and C 12 -C 18 A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, wherein the composition is combined with a protecting group selected from a group consisting of fatty acid groups.

3. A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, wherein the peptide exhibits the following activity in paragraph 1: (a) Inhibition of SDMA (Symmetric dimethylarginine) production; (b) Decreased number of neutrophils around the bronchi; (c) inhibition of production of CXCL-1 and MIP2; or (d) Inhibition of MUC5AC production.

4. A pharmaceutical composition for the prevention or treatment of chronic obstructive pulmonary disease, wherein the chronic obstructive pulmonary disease in paragraph 1 is chronic bronchitis or emphysema.

5. A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, wherein the chronic bronchitis in paragraph 4 is simple chronic bronchitis, chronic obstructive bronchitis, chronic asthmatic bronchitis, or chronic bronchiolitis.

6. A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, wherein the emphysema in paragraph 4 is centrilobular emphysema, panlobular emphysema, or paraseptal emphysema.

7. A pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease, wherein the composition further comprises a pharmaceutically acceptable carrier in the first paragraph.

8. A health functional food for preventing or improving chronic obstructive pulmonary disease, containing as an active ingredient a peptide consisting of an amino acid sequence represented by sequence number 1 or 2, or a polynucleotide encoding the same.

9. A method for treating chronic obstructive pulmonary disease, comprising administering to a subject a peptide composed of an amino acid represented by sequence number 1 or 2, or a polynucleotide encoding the same.

10. A method for preventing or improving chronic obstructive pulmonary disease, comprising administering to a subject a peptide composed of an amino acid represented by sequence number 1 or 2, or a polynucleotide encoding the same.

11. Use of a peptide consisting of an amino acid represented by sequence number 1 or 2, or a polynucleotide encoding the same, for use as a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease.

12. Use of a peptide composed of an amino acid represented by sequence number 1 or 2, or a polynucleotide encoding the same, for use as a health functional food composition for preventing or improving chronic obstructive pulmonary disease.

13. Use of a peptide comprising an amino acid represented by SEQ ID NO: 1 or 2, or a polynucleotide encoding the same, for producing a pharmaceutical composition for preventing or treating chronic obstructive pulmonary disease.

14. Use of a peptide composed of an amino acid represented by sequence number 1 or 2, or a polynucleotide encoding the same, for manufacturing a health functional food composition for preventing or improving chronic obstructive pulmonary disease.

Images