Outer membrane vesicle vaccines for the prevention of n. gonorrhoeae and methods of making and using thereof

Abstract

The present disclosure provides novel outer membrane vesicles (OMVs) comprising selective bacterial antigens (e.g., glycan antigens and / or protein antigens), use of such OMVs as vaccines (e.g., vaccines against N. gonorrhoeae) to protect against infectious diseases, and methods of making the same. The present disclosure also provides genetically engineered Escherichia coli for producing the OMVs and methods of making the same.

Description

Attorney Docket No.14197-021-228 OUTER MEMBRANE VESICLE VACCINES AND METHODS OF MAKING AND USING THEREOF GOVERNMENT LICENSE RIGHTS

[0001] This invention was made with U.S. Government support under Agreement Number 75A50122C00028, awarded by the U.S. Department of Health and Human Services. The U.S. Government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No.63 / 568,920, filed March 22, 2024, and U.S. Provisional Patent Application No.63 / 663,894, filed June 25, 2024, the contents of each of which are incorporated by reference herein in their entireties. SEQUENCE LISTING

[0003] This application contains an electronic Sequence Listing which has been submitted in XML file format with this application, the entire content of which is incorporated by reference herein in its entirety. The Sequence Listing XML file submitted with this application is entitled “14197-021- 228_SEQLISTING.xml”, was created on March 18, 2025, and is 118,285 bytes in size. 1. FIELD

[0004] The present disclosure provides novel outer membrane vesicles (OMVs) comprising selective bacterial antigens (e.g., glycan antigens and / or protein antigens), use of such OMVs as vaccines (e.g., vaccines against Neisseria gonorrhoeae) to protect against infectious diseases, and methods of making the same. The present disclosure also provides genetically engineered Escherichia coli for producing the OMVs and methods of making the same. 2. BACKGROUND

[0005] Neisseria gonorrhoeae (N. gonorrhoeae) is an urgent threat for antimicrobial resistance (AMR), with resistance documented in almost all antimicrobial treatments. Effective gonococcal vaccine is urgently needed to mitigate AMR risks and to protect vulnerable populations. However, there is currently no licensed vaccine against N. gonorrhoeae. NAI-5000113424v1 1

[0006] Vaccine approaches based on OMVs derived from N. gonorrhoeae have not been successful. One reason is that N. gonorrhoeae infections do not elicit protective immunity. As such, OMVs derived from N. gonorrhoeae, which resemble N. gonorrhoeae closely, bear the same risk as N. gonorrhoeae of not eliciting sufficient protective immunity. In particular, the array of phase- and antigenically variable proteins present on the surface of N. gonorrhoeae may elicit non- protective antibody responses, which contribute to the immune evasion and suppression mechanisms of N. gonorrhoeae. For example, gonococcal lipooligosaccharide (LOS) can bind and inactivate complement cascade components and prevent the formation of membrane-attack complex. In addition, the immune suppression mechanisms of N. gonorrhoeae can block the production of proinflammatory cytokines and inhibit protective Th1 and Th2 responses.

[0007] Similarly, vaccine approaches using heat-killed bacteria and pilus protein also fail to elicit protective immunity because these approaches induce immune suppression mechanisms utilized by N. gonorrhoeae.

[0008] Thus, there remains a need for effective gonococcal vaccines that have low cost, simple production process, and high immunogenicity, but without any of the immune evasion and suppression exhibited by N. gonorrhoeae. 3. SUMMARY

[0009] In one aspect, the present disclosure provides an Escherichia coli (E. coli)-derived outer membrane vesicle (OMV) comprising a glycan antigen and a protein antigen of N. gonorrhoeae. In certain embodiments, the OMV further comprises a modified lipid A.

[0010] In one aspect, the present disclosure provides an Escherichia coli (E. coli)-derived outer membrane vesicle (OMV) comprising a glycan antigen and a protein antigen of a pathogen, and a modified lipid A. In certain embodiments, the pathogen is N. gonorrhoeae.

[0011] In certain embodiments, the modified lipid A is produced by at least one lipid A modification enzyme selected from the group consisting of msbB, pagL, lpxE, pagP, and combinations thereof. In certain embodiments, the msbB, pagL, and / or lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV. In certain embodiments, the E. coli comprises genetic disruption of msbB, eptA, and / or lpxT genes. In certain embodiments, the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

[0012] In certain embodiments, the modified lipid A is produced by at least one lipid A modification enzyme selected from the group consisting of pagL, lpxE, pagP, and combinations NAI-5000113424v1 2thereof. In certain embodiments, the pagL and / or lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV. In certain embodiments, the E. coli comprises genetic disruption of eptA and / or lpxT genes. In certain embodiments, the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

[0013] In certain embodiments, the modified lipid A comprises a mixture of heterogeneous lipid A species having different chemical structures.

[0014] In certain embodiments, the modified lipid A comprises at least one lipid A species comprising only one phosphate group. In certain embodiments, the modified lipid A comprises at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone. In certain embodiments, at least 60% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone. In certain embodiments, between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone.

[0015] In certain embodiments, the modified lipid A comprises at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone. In certain embodiments, at least 60% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone. In certain embodiments, between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone.

[0016] In certain embodiments, the modified lipid A comprises at least one lipid A species that is 3- O-desacyl-4’-monophosphoryl lipid A. In certain embodiments, at least 50% of the amount of the modified lipid A is 3-O-desacyl-4’-monophosphoryl lipid A. In certain embodiments, between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’-monophosphoryl lipid A.

[0017] In certain embodiments, the modified lipid A comprises at least one lipid A species comprising at least three C14-3OH acyl chains. In certain embodiments, at least 60% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains. In certain embodiments, between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains.

[0018] In certain embodiments, the modified lipid A comprises at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. In certain embodiments, at least 30% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. In certain embodiments, between 40% and 50% of the amount of the modified lipid A NAI-5000113424v1 3comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone.

[0019] In certain embodiments, the modified lipid A comprises at least one lipid A species comprising a C12 acyl chain. In certain embodiments, at least 60% of the amount of the modified lipid A comprises a C12 acyl chain. In certain embodiments, between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

[0020] In certain embodiments, the protein antigen and glycan antigen are associated with the outer membrane of the OMV.

[0021] In certain embodiments, the protein antigen comprises a MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the MsrA / B polypeptide comprises the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the N-terminus of the MsrA / B polypeptide is fused to the C-terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 14.

[0022] In certain embodiments, the protein antigen comprises a MetQ polypeptide. In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7.

[0023] In certain embodiments, the protein antigen comprises an AniA polypeptide. In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4.

[0024] In certain embodiments, the protein antigen comprises a NHBA polypeptide. In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the N-terminus of the NHBA polypeptide is fused to the C-terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, the NHBA-MetQ NAI-5000113424v1 4fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21.

[0025] In one aspect, the present disclosure provides an E. coli-derived OMV comprising an AniA polypeptide that is associated with the outer membrane of the OMV, optionally the OMV comprises a glycan antigen. In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4.

[0026] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a MetQ polypeptide and a glycan antigen of a pathogen, wherein the MetQ polypeptide and the glycan antigen are associated with the outer membrane of the OMV. In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7.

[0027] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a NHBA polypeptide and a glycan antigen of a pathogen, wherein the NHBA polypeptide and the glycan antigen are associated with the outer membrane of the OMV. In certain embodiments, the N- terminus of the NHBA polypeptide is fused to the C-terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine.

[0028] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a NHBA polypeptide that is associated with the outer membrane of the OMV, wherein the N-terminus of the NHBA polypeptide is fused to the C-terminus of a lipidated MetQ polypeptide to form a NHBA- MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21.

[0029] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a MsrA / B polypeptide and a glycan antigen of a pathogen, wherein the MsrA / B polypeptide and glycan NAI-5000113424v1 5antigen are associated with the outer membrane of the OMV. In certain embodiments, the N- terminus of the MsrA / B polypeptide is fused to the C-terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine.

[0030] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a MsrA / B polypeptide that is associated with the outer membrane of the OMV, wherein the N-terminus of the MsrA / B polypeptide is fused to the C-terminus of a lipidated AniA polypeptide to form a MsrA / B- AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments MsrA / B polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the MsrA / B polypeptide comprises the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 14.

[0031] In certain embodiments, the glycan antigen comprises keto-deoxyoctulosonate (KDO) as a terminal saccharide unit. In certain embodiments, the glycan antigen comprises KDOα(2→3)Gal as the terminal saccharide unit. In certain embodiments, the glycan antigen comprises KDOα(2→3)Galβ(1→4)GlcNac as the terminal saccharide unit.

[0032] In certain embodiments, the glycan antigen comprises a 2C7 epitope having the structure within the broken line square of the following structure, and is shown in FIG. 32A:square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- NAI-5000113424v1 6heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0033] In certain embodiments, the glycan antigen is covalently conjugated to the modified lipid A.

[0034] In certain embodiments, the glycan antigen has the following structure, and is shown in FIG. 32B:white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0035] In one aspect, the present disclosure provides an E. coli-derived OMV comprising: (a) a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; (b) a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, (c) an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, (d) a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (e) a glycan antigen has the following structure and is linked to a modified lipid A as follows, and is shown in FIG. 32B: NAI-5000113424v1 7e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of msbB, pagL, lpxE, and pagP; wherein the msbB, pagL, and / or lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of msbB, eptA, and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

[0036] In one aspect, the present disclosure provides an E. coli-derived OMV comprising: (a) a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; (b) a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, (c) an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, (d) a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (e) a glycan antigen has the following structure and is linked to a modified lipid A as follows, and is shown in FIG. 32B: NAI-5000113424v1 8e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of pagL, lpxE, and pagP; wherein each of the pagL and lpxE is encoded by an exogenous polynucleotide of an E. coli that produces the OMV, wherein the E. coli comprises genetic disruption of eptA and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

[0037] In one aspect, the present disclosure provides an E. coli-derived OMV comprising: (a) a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; (b) a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, (c) an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, (d) a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (e) a glycan antigen has the following structure and is linked to a modified lipid A as follows, and is shown in FIG. 32B: NAI-5000113424v1 9e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) at least one lipid A species comprising a C12 acyl chain.

[0038] In one aspect, the present disclosure provides an E. coli-derived OMV comprising: (a) a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; (b) a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, (c) an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, (d) a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (e) a glycan antigen has the following structure and is linked to a modified lipid A as follows, and is shown in FIG. 32B: NAI-5000113424v1 10e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; and (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone, (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone, (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A, (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains, (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone, and (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

[0039] In certain embodiments, the KDO can be recognized by antibody 6E4.

[0040] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a modified lipid A, wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH NAI-5000113424v1 11acyl chain at 2 position of the disaccharide backbone; and / or (vi) at least one lipid A species comprising a C12 acyl chain.

[0041] In one aspect, the present disclosure provides an E. coli-derived OMV comprising a modified lipid A, wherein: (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone; (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A; (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains; (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and / or (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

[0042] In one aspect, the present disclosure provides composition comprising an OMV disclosed herein.

[0043] In one aspect, the present disclosure provides a pharmaceutical composition comprising an OMV disclosed herein, and a pharmaceutically acceptable carrier.

[0044] In one aspect, the present disclosure provides an Escherichia coli engineered to produce an OMV disclosed herein.

[0045] In certain embodiments, the E. coli comprises one or more genetic modifications to express the protein antigen. In certain embodiments, the E. coli comprises: a. an exogenous polynucleotide encoding the MsrA / B polypeptide, optionally wherein the E. coli comprises an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, further optionally wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; b. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, optionally wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; c. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, optionally wherein the AniA signal polypeptide comprises the amino acid sequence of NAI-5000113424v1 12SEQ ID NO: 3; and / or d. an exogenous polynucleotide encoding the NHBA polypeptide, optionally wherein the E. coli comprises an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, further optionally wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6.

[0046] In certain embodiments, the E. coli comprises one or more genetic modifications to produce the modified lipid A. In certain embodiments, the E. coli comprises: a. an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and / or an exogenous polynucleotide encoding lpxE; b. genetic disruption of msbB, eptA, and / or lpxT genes; and / or c. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0047] In certain embodiments, the E. coli comprises one or more genetic modifications to produce the modified lipid A. In certain embodiments, the E. coli comprises: a. an exogenous polynucleotide encoding pagL and / or an exogenous polynucleotide encoding lpxE; b. genetic disruption of eptA and / or lpxT genes; and / or c. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0048] In certain embodiments, the E. coli comprises one or more genetic modifications to produce the glycan antigen. In certain embodiments, the E. coli comprises: a. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB; b. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes; c. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes; and / or d. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes.

[0049] In certain embodiments, the E. coli comprises one or more genetic modifications to produce the glycan antigen. In certain embodiments, the E. coli comprises: NAI-5000113424v1 13a. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding lgtB, at least one exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB; b. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes; c. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes; and / or d. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes. In certain embodiments, the E. coli comprises two exogenous polynucleotides each encoding lgtE, two exogenous polynucleotides each encoding lst, three exogenous polynucleotides each encoding lgtA, and / or three exogenous polynucleotides each encoding lgtB.

[0050] In certain embodiments, the E. coli further comprises one or more genetic modifications to increase vesiculation. In certain embodiments, the E. coli further comprises: a. genetic disruption of ompA gene; b. genetic disruption of lpp gene; and / or c. an exogenous polynucleotide encoding lpp.

[0051] In certain embodiments, the exogenous polynucleotide encoding lpp is inserted at the attλ site of the genome of the E. coli under the promoter Para.

[0052] In certain embodiments, the E. coli further comprises genetic disruption of fliC gene.

[0053] In certain embodiments, the E. coli further comprises genetic disruption of fim gene cluster. In certain embodiments, the fim gene cluster comprises fimHGFDCIA genes.

[0054] In one aspect, the present disclosure provides an Escherichia coli (E. coli) engineered to produce an OMV disclosed herein, wherein the E. coli comprises: a. genetic modifications to express the protein antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; ii. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of NAI-5000113424v1 14SEQ ID NO: 6; iii. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and iii. an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; b. genetic modifications to produce the modified lipid A, wherein the E. coli comprises: i. an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and an exogenous polynucleotide encoding lpxE; ii. genetic disruption of msbB, eptA, and lpxT genes; and iii. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; c. genetic modifications to produce the glycan antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB; ii. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; iii. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; and iv. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; d. genetic modifications to increase vesiculation, wherein the E. coli comprises: i. genetic disruption of ompA and lpp genes; ii. an exogenous polynucleotide encoding lpp, optionally wherein the exogenous polynucleotide encoding lpp is inserted at the attλ site of the genome of the E. coli under the promoter Para; e. genetic disruption of fliC gene; and NAI-5000113424v1 15f. genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0055] In one aspect, the present disclosure provides an Escherichia coli (E. coli) engineered to produce an OMV disclosed herein, wherein the E. coli comprises: a. genetic modifications to express the protein antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; ii. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; iii. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and iii. an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; b. genetic modifications to produce the modified lipid A, wherein the E. coli comprises: i. an exogenous polynucleotide encoding pagL and an exogenous polynucleotide encoding lpxE; ii. genetic disruption of eptA and lpxT genes; and iii. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; c. genetic modifications to produce the glycan antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding lgtB, at least one exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB; ii. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; iii. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, NAI-5000113424v1 16wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; and iv. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; d. genetic modifications to increase vesiculation, wherein the E. coli comprises: i. genetic disruption of ompA and lpp genes; ii. an exogenous polynucleotide encoding lpp; e. genetic disruption of fliC gene; and f. genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, two exogenous polynucleotides each encoding lgtE, two exogenous polynucleotides each encoding lst, three exogenous polynucleotides each encoding lgtA, three exogenous polynucleotides each encoding lgtB, and an exogenous polynucleotide encoding kdsB.

[0056] In certain embodiments, the exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide, the exogenous polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide, the exogenous polynucleotide encoding the AniA polypeptide and the AniA signal polypeptide, the exogenous polynucleotide encoding the NHBA- MetQ fusion polypeptide and the MetQ signal polypeptide, and the exogenous polynucleotide encoding KdsB are expressed from a first vector.

[0057] In certain embodiments, the exogenous polynucleotide encoding lst is expressed from a second vector, wherein the expression of lst is constitutively under control of lambda phage promoter PL in the second vector.

[0058] In certain embodiments, the exogenous polynucleotide encoding msbB, the exogenous polynucleotide encoding pagL, the exogenous polynucleotide encoding lpxE, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, the exogenous polynucleotide encoding lgtE, the exogenous polynucleotide encoding lgtA, the exogenous polynucleotide encoding lgtB, the exogenous polynucleotide encoding lst, the exogenous polynucleotide encoding lpp are incorporated into the genome of the E. coli.

[0059] In certain embodiments, the exogenous polynucleotide encoding pagL, the exogenous polynucleotide encoding lpxE, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous NAI-5000113424v1 17polynucleotide encoding lgtG, the at least one exogenous polynucleotide encoding lgtE, the at least one exogenous polynucleotide encoding lgtA, the at least one exogenous polynucleotide encoding lgtB, the at least one exogenous polynucleotide encoding lst, the exogenous polynucleotide encoding lpp are incorporated into the genome of the E. coli. In certain embodiments, one of the two exogenous polynucleotides encoding lst is expressed from a second vector; and the other one of the two exogenous polynucleotides encoding lst is incorporated into the genome of the E. coli.

[0060] In one aspect, the present disclosure provides a method of producing a plurality of OMVs, comprising (i) culturing an Escherichia coli disclosed herein under conditions suitable for producing OMVs, and (ii) purifying the OMVs produced from the Escherichia coli.

[0061] In one aspect, the present disclosure provides a method of inducing an immune response in a subject comprising administering to the subject an effective amount of an OMV disclosed herein or a composition disclosed herein. 4. BRIEF DESCRIPTION OF THE FIGURES

[0062] FIGS.1A & 1B. Plasmid maps of the expression vectors pLTPro231 (FIG.1A) and pLTPro302 (FIG.1B) encoding the MsrA / B-AniA fusion polypeptide, MetQ polypeptide, AniA polypeptide, NHBA-MetQ fusion polypeptide, and KdsB.

[0063] FIGS.2A & 2B. The nucleotide sequences of the expression vectors of FIGS.1A & 1B. FIG.2A depicts the nucleotide sequence of the expression vector pLTPro231 of FIG.1A (SEQ ID NO: 66). Tac promoter is indicated by bold letters. Lac operator is indicated by bold italic letters. Ribosome binding site (RBS) is indicated by italic letters. Polynucleotide encoding MsrA / B-AniA is indicated by underlined letters. Polynucleotide encoding KdsB is indicated by wavy underlined letters. Polynucleotide encoding MetQ is indicated by dashed underlined letters. Polynucleotide encoding AniA is indicated by double underlined letters. Polynucleotide encoding NHBA-MetQ is indicated by underlined italic letters. MB T2 terminator is indicated by white letters in black background. Kanamycin resistance cassette is indicated by wavy underlined italic letters. Ori is indicated by dashed underlined italic letters. LacIq promoter is indicated by underlined bold letters. Polynucleotide encoding LacI is indicated by double underlined italic letters. FIG.2B depicts the nucleotide sequence of the expression vector pLTPro302 of FIG.1B (SEQ ID NO: 67). J23105 promoter is indicated by white letters in black background. Tac promoter is indicated by bold letters. Lac operator is indicated by bold italic letters. Ribosome binding site (RBS) is indicated by italic letters. Polynucleotide encoding MsrA / B-AniA is indicated by underlined letters. NAI-5000113424v1 18Polynucleotide encoding KdsB is indicated by wavy underlined letters. Polynucleotide encoding MetQ is indicated by dashed underlined letters. Polynucleotide encoding AniA is indicated by double underlined letters. Polynucleotide encoding NHBA-MetQ is indicated by underlined italic letters. Kanamycin resistance cassette is indicated by wavy underlined italic letters. Ori is indicated by dashed underlined italic letters. LacIq promoter is indicated by underlined bold letters. Polynucleotide encoding LacI is indicated by double underlined italic letters.

[0064] FIGS.3A-3D. Chemical structures of various lipid A species. FIG.3A shows chemical structures of exemplary modified lipid A species disclosed herein. FIG.3B shows the approximate percentage of the amount of each species of an exemplary modified lipid A (lipid A structure A of Examples 20 and 22) disclosed herein. FIG.3C shows the approximate percentage of the amount of each species of the lipid A in the MPL® of GSK. Species in the same box could not be discriminated for quantification. Relative amount value refers to the sum of all the species in the same box. FIG.3D shows the chemical structure of the wildtype E coli. lipid A.

[0065] FIG.4. Scheme representing the genetic modifications and their roles for the production of the lead candidate vaccine.

[0066] FIGS.5A-5E. Analysis of TFF purification steps. Supernatant samples from the bioreactor culturing of the lead candidate strain expressing all antigens (FIGS.5A-5D, lanes 2) and from different steps of the subsequent TFF purification procedure (FIGS.5A-5D, lane 3 – 7). FIG.5A, SDS PAGE; FIG.5B, immunoblot carried out with a mix of anti-single protein antigens antisera; FIG.5C, anti-2C7 immunoblot; FIG.5D, anti-KDO immunoblot carried out with the monoclonal antibody 6E4. Only a subset of Coomassie-stainable band is enriched in TFF (FIG.5A lanes 2, 5, 6, 7), while another subset is washed away (FIG.5A lanes 3 and 4), indicating the enrichment in OMV proteins. Protein and glycan antigens co-localize with retained fraction and they are not lost during the purification process (FIG.5B, FIG.5C, and FIG.5D). FIG.5E shows the annotations and samples of each lane in FIGS.5A-5D.

[0067] FIGS.6A-6F. Analysis of SEC purification. FIG.6A, chromatogram of SEC purification; FIG.6B, SDS PAGE analysis of the fractions; FIGS.6C-6E immunoblot analysis of the fractions via anti-multi proteins immunoblot (FIG.6C), anti-2C7 immunoblot (FIG.6D), and anti-KDO immunoblot (FIG.6E). All the proteins and the antigen co-elute in the same peak, indicating the OMV nature of the analyte. FIG.6F shows the samples of each lane in FIGS.6B-6E.

[0068] FIGS.7A & 7B. Analysis of OMV purity, radius and morphology, FIG.7A: SEC-HPLC profiles of OMV samples after the three purification steps (TFF1, SEC, TFF2). The peak at a NAI-5000113424v1 19retention time of appr.8.3 min is the OMV containing fraction, other indicated peaks are impurities. FIG.7B: negative stain electron microscopy image of a purified OMV sample.

[0069] FIGS.8A & 8B. Silver staining of the LOS from the lead candidate. FIG.8A shows the bands of the LOS from the lead candidate and from a “rough” E. coli control, with the structures depicted nearby. FIG.8B shows the expected banding pattern for complete LOS or for a “rough”- type LOS, with the structures depicted nearby. M: protein ladder used for reference; molecular weights reported.

[0070] FIGS.9A & 9B. Graphs of the m / z values (x axis) over signal intensity (y axis) retrieved from the MALDI-MS measurement of the whole LOS. All the major peaks had a mass which correspond to the expected mass of LOS with the whole glycan devoid of the terminal KDO and different lipid A species. The corresponding species are schematized in the inlets. The lipid A structure is simplified: the two ovals represent the two glucosamine residues, the “P” on the left represents the phosphate group in position 4’, and the possible acyl chains are represented by the gray curved lines.

[0071] FIGS.10A & 10B. Graphs of the m / z values (x axis) over signal intensity (y axis) retrieved from the MALDI-MS measurement of the extracted lipid A. The distribution of species was analogous to what was observed in FIGS.9A & 9B.

[0072] FIGS.11A & 11B. Mice immunization study. FIG.11A: mice immunization scheme; FIG.11B: anti-protein antigens IgG titres found in sera from animals treated with the four vaccine candidates A (lead), B, C, D before immunization and after the third immunization, samples as indicated by the legend in the figure. Each circle represents a single animal. Bars indicate Geometric Mean Concentration (GMC) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA.

[0073] FIGS.12A & 12B. Functional assays. FIG.12A, Luminescent serum bactericidal assay (L-SBA) of sera from the four vaccine candidates A (lead), B, C, D as indicated by the legend compared before and after third immunization, bactericidal titer was calculated as the last dilution showing 50% killing for sera from each mouse individually. Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA. FIG.12B, Gonococcal adherence assay, percentage of adherent bacteria to epithelial cells (after third immunization) relative to non- treated adhesion (pre immunization), samples as indicated by the legend in the figure.

[0074] FIG.13. MsrA / B substrate binding inhibition assay. Percentage of blocking mediated by the antibodies after the third immunization compared to sera before immunization for the four vaccine candidates A, B, C, D, samples as indicated by the legend in the figure. NAI-5000113424v1 20

[0075] FIGS.14A & 14B. Rabbit immunization studies for tolerability. FIG.14A, rabbit immunization scheme; FIG.14B: maximum temperature increase of individual animals after each of the three injections with respective vaccine candidates and vaccines.

[0076] FIG.15. Monocyte activation test (MAT). IL-6 concentration measured by ELISA for increasing concentrations of the four vaccine candidates as well as commercially available OMV InvivoFit™ containing wildtype lipid A.

[0077] FIGS.16A-16C. MetQ and NHBA fragments and fusion proteins investigated as gonococcal vaccine antigens. FIG.16A: the full length metQ gene is shown (light grey arrow), as well as the MetQ (mature protein lacking the signal peptide), Met1 (N-terminal fragment of MetQ) and Met2 (C-terminal fragment of MetQ) antigens. FIG.16B: the full length nhba gene is shown (dark gray arrow), as well as the cNHBA (C-terminal fragment of NHBA lacking the signal peptide) antigen. FIG.16C: the fusions of MetQ, Met1 and Met2 (light gray) with cNHBA (dark gray) are shown. The Gly-Gly-Gly-Gly (SEQ ID NO: 68) linker used between the fused proteins is shown as an empty box.

[0078] FIGS.17A & 17B. Structure prediction of the MetQ and NHBA antigens. FIG.17A: alignment of the modelled N. gonorrhoeae cNHBA (dark grey) with the C-terminal domain of N. meningitidis NHBA (PDB 6CUJ crystal structure; light grey), and the model of N. gonorrhoeae MetQ, Met1 and Met2 (dark grey) with N. meningitidis MetQ (PDB 3GXA crystal structure; light grey). FIG.17B: predicted structures of the cNHBA fusions with MetQ, Met1 or Met2 (cNHBA in light shades, fusion partners in dark shades).

[0079] FIGS.18A & 18B. Blocking of adherence to genital tract epithelial cells by antibodies raised to the MetQ and NHBA antigens. FIG.18A: blocking of adherence of N. gonorrhoeae strain 1291 to human male urethral epithelial cells in the presence of 1 / 25 dilution of sera from immunised mice, measured as % adherence relative to sera from unimmunised mice. FIG.18B: blocking of adherence of N. gonorrhoeae strain 1291 to cervical epithelial cells in the presence of 1 / 25 dilution of sera from immunised mice, measured as % adherence relative to sera from unimmunised mice.0 is the untreated (no sera) control. Student t-test p-value: * <0.5, ** <0.01, *** <0.001.

[0080] FIG.19. ELISA titres of mouse sera raised against MetQ and NHBA fragments and fusion proteins, tested against N. gonorrhoeae whole cell bacteria and recombinant MetQ and NHBA proteins.

[0081] FIG.20. Rabbit immunization study for tolerability: anti-protein antigens IgG from animals treated with low dose (LD), high dose (HD), and high dose in absence of adjuvant (HD no Alum) of the lead candidate (Lead) before immunization, after the second immunization, and after the third NAI-5000113424v1 21immunization. Each circle represents a single animal. Bars indicate Geometric Mean Concentration (GMC) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA.

[0082] FIGS.21A & 21B. Mice immunization study. FIG.21A: mice immunization scheme; FIG.21B: anti-protein antigens IgG titres from animals treated with two batches of the lead candidate (Lead 1 and Lead 2), with a batch of the lead candidate without alum (Lead 2 no alum), with OMV expressing only glycan epitopes 2C7 and KDO (OMV-glyc), with OMV devoid of gonococcal antigens (OMV no Ag), and with buffer and alum (Ctrl) before immunization, after the second immunization, and after the third immunization. Each circle represents pools of two animals for post-II sera and a single animal for pre- and post-III. Bars indicate Geometric Mean Concentration (GMC) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA.

[0083] FIG.22. Mice immunization study. Anti-glycan antigens IgG titres from animals treated with two batches of the lead candidate (Lead 1 and Lead 2), with a batch of the lead candidate without alum (Lead 2 no alum), with OMV expressing only glycan epitopes 2C7 and KDO (OMV- glyc), with OMV devoid of gonococcal antigens (OMV no Ag), and with buffer and alum (Ctrl) before immunization, after the second immunization, and after the third immunization. Coating LOS is reported on top of each graph. Each circle represents a single animal. Bars indicate Geometric Mean Concentration (GMC) + / -95% confidence interval. ****: p≤ 0.0001, ***: p≤ 0.001, **: p≤ 0.01, *: p≤ 0.05, one-way ANOVA.

[0084] FIG 23. Luminescent serum bactericidal assay (L-SBA) of the same sera after third immunization. Ability of the sera to enable complement-mediated killing of gonococcal strains FA1090 and WHO-R was tested. Bactericidal titer was calculated as the last dilution showing 50% killing for sera from pools of two mice. Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p≤ 0.0001, ***: p≤ 0.001, **: p≤ 0.01, *: p≤ 0.05, one-way ANOVA.

[0085] FIG.24. Immunization scheme of mice immunization study with single-antigen expressing OMV.

[0086] FIG.25. Anti-proteins Ig titres from animals treated with buffer and alum (Alum only), OMV devoid of antigens (Empty OMV), OMV carrying one protein antigen (as indicated), or soluble version of the antigen (named “control” in each protein-specific scheme). Pool of 10 animals’ sera. Endpoint titres are reported.

[0087] FIG.26. Binding of live Neisseria gonorrhoeae by raised rabbit sera. Median count of cells bound by IgG from pools of post-III sera raised by immunizing rabbits with lead candidate standard dose (Lead) and middle dose (Lead-MD), OMV devoid of gonococcal antigens (OMV no Ag), and Bexsero. Rb2C7 indicates positive control monoclonal antibody used instead of raised NAI-5000113424v1 22serum. Negative controls: gonococcal cells only (Cells), gonococcal cells and secondary antibody (Cells + 2nd Ab), sham immunization pre-immune sera (Control-pre), sham immunization post- immune sera (Control-post). Strain name is indicated for each scheme, WHO strains provided by WHO; 1263546 and 1087092 provided by JMI Labs. Measured as median fluorescent intensity.

[0088] FIGS.27A-27C. Chemical structures of lipid A species in lipid A structure B (FIG.27A), lipid A structure C (FIG.27B), and lipid A structure D (FIG.27C) of Examples 20 and 22.

[0089] FIG.28. Negative stain electron microscopy image of a purified OMV sample.

[0090] FIGS.29A-29C. Blocking of MetQ substrate binding elicited by anti-lead candidate rabbit antisera. FIG.29A depicts the blocking of methionine binding to MetQ by lead candidate pre- immune and post-immune rabbit sera. Negative controls included methionine (Met only), sham immunization pre-immune sera (Control pre), and sham immunization post-immune rabbit sera (Control post). FIG.29B depicts the bocking of selenomethionine binding to MetQ by lead candidate pre-immune and post-immune rabbit sera. Negative controls included selenomethionine (Met only); sham immunization pre-immune sera (Control pre), sham immunization post-immune rabbit sera (Control post). FIG.29C depicts chemical structures of methionine and selenomethionine.

[0091] FIGS.30A & 30B. Blocking of MsrA / B substrate binding elicited by anti-lead candidate rabbit antisera. FIG.30A depicts the blocking value of methionine sulfoxide (MetSO) binding to MsrA / B by lead candidate pre-immune and post-immune rabbit sera. FIG.30B depicts the blocking value of oxidized peptide (Pep-O) binding to MsrA / B by lead candidate pre-immune and post-immune rabbit sera.

[0092] FIGS.31A-31D. Blocking of N. gonorrhoeae adherence to human cervical epithelial cells (ME180), human pharyngeal epithelial cells (FaDu), and human urethral epithelial cells (tUEC), mediated by anti-lead candidate rabbit antisera. FIG.31A depicts the blocking of adherence of Neisseria gonorrhoeae strain 1291 (Ng 1291) or N. gonorrhoeae ∆NHBA (where NHBA had been knocked out) to ME180 by immunization post-immune rabbit sera of lead vaccine candidate and OMV containing only NHBA antigen. FIG.31B depicts the blocking of adherence of Ng 1291 to FaDu by immunization post-immune rabbit sera of lead vaccine candidate, OMV containing only NHBA antigen, and OMV containing only NgLOS antigen. FIG.31C depicts the blocking of adherence of N. gonorrhoeae ∆NHBA to FaDu by immunization post-immune rabbit sera of lead vaccine candidate and OMV containing only NHBA antigen. FIG.31D depicts the blocking of adherence of Ng 1291 to tUEC by immunization post-immune rabbit sera of lead vaccine candidate, OMV containing only NHBA antigen, and OMV containing only NgLOS antigen. NAI-5000113424v1 23

[0093] FIGS.32A-32C. Exemplary structures of glycan antigens disclosed herein. The 2C7 epitope comprises a structure within the broken line square of the structure shown in FIG.32A. In FIGS.32A-32C, the hexagon represents a KDO, the white circle represents a galactose (Gal), the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0094] FIG.33 depicts the blocking of the binding of AccA peptide to AniA by post-immune sera of rabbits immunized with the lead vaccine candidate and OMV containing only AniA antigen.

[0095] FIGS.34A-34C. Serum immunogenicity and functionality of mice vaccinated with Lead candidate vaccine (Lead batch 1, consistency batch 1 (CB1) and consistency batch 2 (CB2)), single- antigen expressing OMV (as indicated in the figures), or control buffer. All groups were immunized with Alum as an adsorbent. FIG.34A depicts IgG titres (arbitrary units, AU) against protein antigens (AniA, MetQ, NHBA and MsrA / B) measured by ECLIA in pre-immunization sera (“pre”), and in terminal bleed sera (“post-III”). Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA. FIG.34B depicts IgG titres (arbitrary units, AU) against NgLOS measured by ELISA in pre-immunization sera (“pre”), and in terminal bleed sera (“post-III”). Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA. FIG.34C depicts luminescent serum bactericidal titers of Lead vaccine candidate and single antigen expressing OMVs. Bactericidal titer was calculated as the last dilution showing 50% killing for sera from pools of 2 mice. Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, **: p<0.01, one-way ANOVA.

[0096] FIG.35. Serum immunogenicity of rabbits vaccinated with Lead candidate vaccine (consistency batch 1 (CB1) and consistency batch 2 (CB2)), single-antigen expressing OMV (as indicated) or with control buffer. All groups were immunized with Alum as adsorbent. IgG titres (arbitrary units, AU) against protein antigens (AniA, MetQ, NHBA and MsrA / B) were measured by ECLIA in pre-immunization sera (“pre”), in sera drawn after the second immunization (“post-II”), and in terminal bleed sera (“post-III”). IgG titres (arbitrary units, AU) against NgLOS were measured by ELISA in pre-immunization sera (“pre”), and in terminal bleed sera (“post-III”). Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA.

[0097] FIG.36. Serum immunogenicity of rats vaccinated with Lead candidate vaccine, Lead consistency batch 2 (CB2), or with control buffer. All groups were immunized with Alum as adsorbent. IgG titres (arbitrary units, AU) against protein antigens (AniA, MetQ, NHBA and MsrA / B) and NgLOS were measured by ELISA in pre-immunization sera (“pre”), in sera drawn NAI-5000113424v1 24after the second immunization (“post-II”), and in terminal bleed sera (“post-III”). Bars indicate Geometric Mean (GM) + / -95% confidence interval. ****: p<0.0001, one-way ANOVA. 5. DETAILED DESCRIPTION

[0098] The present disclosure provides novel vaccines based on outer membrane vesicles (OMVs) derived from engineered Escherichia coli (E. coli). In certain embodiments, the OMVs are secreted from engineered Escherichia coli (E. coli). In certain embodiments, the E. coli is engineered to express on its outer membrane selective heterologous antigens of a pathogen (e.g., N. gonorrhoeae), where the heterologous antigens are incorporated into the OMVs secreted from the E. coli. In certain embodiments, the heterologous antigens are associated with the outer membrane of the OMV produced by the engineered E. coli. In certain embodiments, the heterologous antigens are associated with the outer membrane of the OMV and are exposed on the surface of the OMVs produced by the engineered E. coli. In certain embodiments, the heterologous antigens are associated with the outer membrane of the OMV but are not exposed on the surface of the OMVs produced by the engineered E. coli. In certain embodiments, the heterologous antigens comprise glycan and / or protein antigens (e.g., conserved antigens such as AniA, MetQ, MsrA / B, NHBA, KDO, and / or 2C7 epitope) of the pathogen, which can elicit broad and effective protective immunity against the pathogen regardless of its resistance profile. In certain embodiments, the E. coli and the OMVs derived therefrom further comprise a modified lipid A, which reduces the toxicity and improves the safety of the OMV vaccines.

[0099] As such, the presently disclosed OMVs exhibit the desirable features of eliciting broad, effective, and lasting protective immunity against the pathogens (e.g., N. gonorrhoeae) and have superior safety profile for clinical uses. Moreover, as the OMVs are produced from E. coli, the OMVs do not carry various antigenic factors or protein antigens of the pathogens, and thus do not elicit immune evasion and / or suppression mechanisms of the pathogens that can reduce the protective efficacy of the OMV vaccine.

[0100] In certain embodiments, the present disclosure provides an E. coli-derived OMV (e.g., an OMV of Section 5.1) comprising (i) at least one glycan antigen (e.g., at least one glycan of Section 5.1.1), (ii) at least one protein agent (e.g., at least one protein agent of Section 5.1.2), and / or (iii) a modified lipid A (e.g., a modified lipid A of Section 5.1.3), wherein the at least one glycan antigen and / or the at least one protein antigen are antigens of a pathogen (e.g., N. gonorrhoeae). In certain embodiments, the protein antigen and / or the glycan antigen is associated with the outer NAI-5000113424v1 25membrane of the OMV. In certain embodiments, the protein antigen and / or the glycan antigen is associated with the outer membrane of the OMV and is exposed on the surface of the OMV. In certain embodiments, the protein antigen is associated with the outer membrane of the OMV but is not exposed on the surface of the OMV. In certain embodiments, the protein antigen comprises a lipidated N-terminal cysteine. In certain embodiments, the protein antigen is fused to a polypeptide comprising a lipidated N-terminal cysteine. In certain embodiments, the lipidated N-terminal cysteine assists the association of the protein antigen with the outer membrane of the OMV. In certain embodiments, the lipidated N-terminal cysteine assists the exposure of the protein antigen on the surface of the OMV. In certain embodiments, the lipidated N-terminal cysteine assists the association of the protein antigen with the outer membrane of the OMV but not the exposure of the protein antigen on the surface of the OMV. In certain embodiments, the glycan antigen is covalently conjugated to the modified lipid A that is associated with the outer membrane of the OMV.

[0101] In certain embodiments, the present disclosure further provides an engineered E. coli engineered to produce the presently disclosed OMV. In certain embodiments, the E. coli comprises (i) genetic modifications to produce at least one glycan antigen (e.g., genetic modifications of Section 5.2.1), (ii) genetic modifications to produce at least one protein antigen (e.g., genetic modifications of Section 5.2.2), and / or (iii) genetic modifications to produce a modified lipid A (e.g., genetic modifications of Section 5.2.3). In certain embodiments, the E. coli further comprises genetic modifications to increase vesiculation and / or genetic disruption of fliC gene. In certain embodiments, the E. coli further comprises genetic disruption of fim gene cluster. In certain embodiments, the fim gene cluster comprises fimHGFDCIA genes.

[0102] In certain embodiments, the present disclosure further provides a pharmaceutical composition comprising a presently disclosed OMV or E. coli (e.g., a pharmaceutical composition of Section 5.3). In certain embodiments, the present disclosure further provides a method of making a presently disclosed OMV or E. coli (e.g., a method making of Section 5.4). In certain embodiments, the present disclosure further provides a method of using a presently disclosed OMV for eliciting an immunogenic response in a subject (e.g., a method using of Section 5.5). In certain embodiments, the present disclosure further provides a kit comprising a presently disclosed OMV or E. coli (e.g., a kit of Section 5.6).

[0103] As used herein, an “antigen of a pathogen” refers to a molecule that, when administered to a subject (e.g., a human or a non-human animal), can elicit a specific humoral and / or cellular immune response. In certain embodiments, the antigen is a naturally occurring NAI-5000113424v1 26molecule of the pathogen. In certain embodiments, the antigen is derived from a naturally occurring molecule of the pathogen, for example, a mutant or a fragment of the naturally occurring molecule. In certain embodiments, the antigen is a polypeptide, a protein, a polysaccharide, a carbohydrate, a lipid, or a combination thereof. Not all antigens of a pathogen can induce a protective immunity. In certain embodiments, an antigen may induce an immune response, which is not related to the protection against the pathogen. For examples, a vaccine based on heat-killed N. gonorrhoeae is immunogenic and can induce an immune response. However, such immune response does not offer any protection against N. gonorrhoeae, e.g., resisting infection or reinfection or attenuating gonorrhea or its clinical presentations.

[0104] As used herein, “protective immunity” refers to the immune system’s ability to resist infection or reinfection or attenuate an infectious disease or its clinical presentation. The protective immunity can be provided by lymphocytes (e.g., T cells and / or B cells) that can recognize and quickly launch attack to the pathogen after being re-exposed to the pathogen or being exposed to the pathogen for the first time after the administration of the vaccine. The protective immunity can last for months or years.

[0105] As used herein, the term “about” mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, or less variation of a given value or range.

[0106] The term “between” as used in a phrase as such “between A and B” or “between A- B” refers to a range including both A and B.

[0107] As used in the present disclosure and claims, the singular forms “a”, “an” and “the” include plural forms unless the context clearly dictates otherwise. 5.1 Outer Membrane Vesicles (OMVs)

[0108] The present disclosure provides OMVs comprising (i) at least one glycan antigen (e.g., at least one glycan of Section 5.1.1), (ii) at least one protein agent (e.g., at least one protein agent of Section 5.1.2), and / or (iii) a modified lipid A (e.g., a modified lipid A of Section 5.1.3 ). In certain embodiments, the OMVs are derived from E. coli. In certain embodiments, the at least one glycan antigen and / or the at least one protein antigen are antigens of a pathogen that is not E. coli (e.g., N. gonorrhoeae). In certain embodiments, the at least one glycan antigen and / or the at least one protein antigen are associated with the outer membrane of the OMV.

[0109] In certain embodiments, the at least one glycan antigen and / or the at least one protein antigen can induce a protective immunity against the pathogen in a subject after the subject being administered the OMV. In certain embodiments, the protective immunity confers the subject the NAI-5000113424v1 27ability to resist infection or reinfection of the pathogen. In certain embodiments, the protective immunity attenuates an infectious disease associated with the pathogen or its clinical presentations in the subject. In certain embodiments, the protective immunity lasts for at least about 3 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 1 year, at least about 18 months, at least about 2 years, at least 3 years, at least 4 years, or at least 5 years.

[0110] In certain embodiments, the pathogen is an agent that can cause an infectious disease. In certain embodiments, the pathogen is a virus, a bacterium, a fungus, or a parasite. In certain embodiments, the pathogen is a bacterium. 5.1.1 Glycan Antigens

[0111] In certain embodiments, an OMV disclosed herein comprises at least one glycan antigen. As used herein, a glycan antigen can be an epitope of lipooligosaccharides (LOS). In certain embodiments, the glycan antigen is an antigen of a pathogen (e.g., N. gonorrhoeae). In certain embodiments, the OMV comprises a KDO epitope. In certain embodiments, the OMV comprises a 2C7 epitope. In certain embodiments, the OMV comprises a KDO epitope and a 2C7 epitope. In certain embodiments, the at least one glycan antigen is associated with the outer membrane of the OMV. In certain embodiments, the glycan antigen is associated with the outer membrane of the OMV and is exposed on the surface of the OMV. In certain embodiments, the at least one glycan antigen is associated with the outer membrane of the OMV by covalently conjugated to a lipid A (e.g., a modified lipid A of Section 5.1.3), which locates on the outer membrane of the OMV.

[0112] In certain embodiments, the presently disclosed glycan antigen is produced by an engineered E. coli disclosed herein (e.g., E. coli of Sections 5.2.1 and 5.2.6), where the E. coli is genetically modified to knock out and knock in a number of genes relating to the synthesis of the glycan antigen (e.g., genetically modifications disclosed in Sections 5.2.1 and 5.2.6), where the knock-in genes are incorporated into the genome of the E. coli and / or one or more vectors (e.g., plasmids) transformed into the E. coli. In certain embodiments, the glycan antigen produced by the E. coli is located to and associated with the outer membrane of the E. coli, for example, by covalently conjugated to a lipid A associated with the outer membrane. Under suitable conditions, the E. coli produces and releases OMVs, where part of the outer membrane of the E. coli becomes the outer membrane of the OMVs, and thus the glycan antigen associated with the outer membrane of the E. coli is incorporated into the OMVs.

[0113] As used herein, α(2→3) represents the α-2,3-glycosidic linkage between two sugar molecules; α(2→4) represents the α-2,4-glycosidic linkage between two sugar molecules, α(1→5) NAI-5000113424v1 28represents the α-1,5-glycosidic linkage between two sugar molecules, α(1→2) represents the α-1,2- glycosidic linkage between two sugar molecules, β(1→3) represents the β-1,3-glycosidic linkage between two sugar molecules, and β(1→4) represents the β-1,4-glycosidic linkage between two sugar molecules. (a) KDO

[0114] In certain embodiments, a glycan antigen disclosed herein comprises a keto- deoxyoctulosonate (KDO), also known as 3-deoxy-D- manno-2-octulosonic acid, as a terminal saccharide unit.

[0115] In certain embodiments of the glycan antigen disclosed herein, the KDO further is attached to a galactose (Gal). In certain embodiments, the KDO is attached to the Gal via an α(2→3) linkage. In certain embodiments, the glycan antigen comprises KDOα(2→3)Gal.

[0116] An exemplary structure of KDOα (2→3)Gal is provided below:wherein the hexagon represents a KDO, and the white circle represents a galactose (Gal).

[0117] In certain embodiments of the glycan antigen disclosed herein, KDOα(2→3)Gal is further attached to a N-acetylglucosamine (GlcNac). In certain embodiments, KDOα(2→3)Gal is attached to a GlcNac via a β(1→4) linkage. In certain embodiments, the glycan antigen comprises KDOα(2→3)Galβ(1→4)GlcNac.

[0118] An exemplary structure of KDOα(2→3)Galβ(1→4)GlcNac is provided below:wherein the hexagon represents a KDO, the white circle represents a galactose (Gal), and the white square represents a N- acetylglucosamine (GlcNac).

[0119] In certain embodiments, the glycan antigen comprises KDOα(2→3)Gal as the terminal saccharide unit. In certain embodiments, the glycan antigen comprises KDOα(2→3)Galβ(1→4)GlcNac as the terminal saccharide unit.

[0120] In certain embodiments, the glycan antigen comprising KDO as a terminal saccharide unit further comprises a 2C7 epitope N. gonorrhoeae. In certain embodiments, the glycan antigen comprising KDOα(2→3)Gal as a terminal saccharide unit further comprises a 2C7 epitope N. NAI-5000113424v1 29gonorrhoeae. In certain embodiments, the glycan antigen comprising KDOα(2→3)Galβ(1→4)GlcNac as a terminal saccharide unit further comprises a 2C7 epitope N. gonorrhoeae. Exemplary 2C7 epitope is provided in the Section 5.1.1 (b) below.

[0121] In certain embodiments, the glycan antigen comprising a KDO epitope and a 2C7 epitope is covalently conjugated to the modified lipid A. In certain embodiments, the glycan antigen comprising KDOα(2→3)Gal and a 2C7 epitope is covalently conjugated to the modified lipid A. In certain embodiments, the glycan antigen comprising KDOα(2→3)Galβ(1→4)GlcNac and a 2C7 epitope is covalently conjugated to the modified lipid A. Exemplary modified lipid A is provided in the Section 5.1.3 below.

[0122] In certain embodiments, the KDO can be recognized by antibody 6E4 (see Jen FE et al., mBio, 2021;12(2):e03666-20) (b) 2C7

[0123] In certain embodiments, a glycan antigen disclosed herein comprises a 2C7 epitope. In certain embodiments, the glycan antigen comprises a 2C7 epitope of N. gonorrhoeae.

[0124] 2C7 epitope is a conserved oligosaccharide (OS) structure, a part of lipooligosaccharide (LOS) on N. gonorrhoeae. This structure is recognized by a murine monoclonal antibody called 2C7. Human antibodies against the 2C7 epitope mediate complement-dependent bacterial killing and opsonophagocytosis. See Gulati et al, PLOS Pathogens (2013);8:e1003559 for a detailed discussion of the 2C7 epitope, the content of which is incorporated by reference herein.

[0125] In certain embodiments of the glycan antigen disclosed herein, the 2C7 epitope comprises two lactose branches, wherein each lactose branch comprises a galactose (Gal) and a glucose (Glc). In certain embodiments, the Gal is attached to the Glc. In certain embodiments, the Gal is attached to the Glc via a β(1→4) linkage. In certain embodiments, the 2C7 epitope comprises a first Galβ(1→4)Glc and a second Galβ(1→4)Glc. In certain embodiments, the 2C7 epitope comprises a structure within the broken line square of the structure provided below, and is shown in FIG.32A: NAI-5000113424v1 30wherein th , the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0126] In certain embodiments of the 2C7 epitope disclosed herein, the first Galβ(1→4)Glc is further attached to a first L-glycero-D-manno-heptose (Hep1). In certain embodiments of the 2C7 epitope disclosed herein, the first Galβ(1→4)Glc is further attached to Hep1 via a β(1→4) linkage as Galβ(1→4)Glcβ(1→4)Hep1. In certain embodiments of the 2C7 epitope disclosed herein, the second Galβ(1→4)Glc is further attached to a second L-glycero-D-manno-heptose (Hep2). In certain embodiments of the 2C7 epitope disclosed herein, the second Galβ(1→4)Glc is further attached to Hep2 via an α(1→3) linkage as Galβ(1→4)Glcα(1→3)Hep2. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises Galβ(1→4)Glcβ(1→4)Hep1 and Galβ(1→4)Glcα(1→3)Hep2, wherein Hep1 is attached to Hep2 via an α(1→3) linkage. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises an exemplary structure provided below:wherein the white circle a , circle represents a glucose (Glc), and the heptagon represents a L-glycero-D-manno-heptose (Hep).

[0127] In certain embodiments of the 2C7 epitope disclosed herein, the second L-glycero-D- manno-heptose (Hep2) is further attached to a N- acetylglucosamine (GlcNac). In certain NAI-5000113424v1 31embodiments, Hep2 is further attached to a GlcNac via an α(1→2) linkage. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises Galβ(1→4)Glcβ(1→4)Hep1 and Galβ(1→4)Glcα(1→3)Hep2, wherein Hep1 is attached to Hep2 via an α(1→3) linkage, and Hep2 is further attached to GlcNac via an α(1→2) linkage. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises an exemplary structure provided below: wherein the white circlecircle represents a glucose (Glc), the heptagon represents a L-glycero-D-manno-heptose (Hep), and the white square represents a N- acetylglucosamine (GlcNac).

[0128] In certain embodiments of the 2C7 epitope disclosed herein, the second L-glycero-D- manno-heptose (Hep2) is further attached to a phosphoethanolamine (PEtN). In certain embodiments of the 2C7 epitope disclosed herein, the second L-glycero-D-manno-heptose (Hep2) is further attached to a N-acetylglucosamine (GlcNac) and a PEtN. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises Galβ(1→4)Glcβ(1→4)Hep1 and Galβ(1→4)Glcα(1→3)Hep2, wherein Hep1 is attached to Hep2 via an α(1→3) linkage, and Hep2 is further attached to GlcNac via an α(1→2) linkage and a PEtN. In certain embodiments, a glycan antigen comprising the 2C7 epitope disclosed herein comprises an exemplary structure provided below: wherein the white circlecircle represents a glucose (Glc), the heptagon represents a L-glycero-D-manno-heptose (Hep), the white square represents a N- acetylglucosamine (GlcNac), and the PEtN represents a phosphoethanolamine. NAI-5000113424v1 32

[0129] In certain embodiments, the 2C7 epitope is further attached to the KDO as provided in the Section 5.1.1(a) above. In certain embodiments, the 2C7 epitope is further attached to the terminal saccharide unit as provided in the Section 5.1.1(a) above. In certain embodiments of the glycan antigen disclosed herein, the 2C7 epitope is further attached to KDOα(2→3)Galβ(1→4)GlcNac as provided in the Section 5.1.1(a) above. In certain embodiments of the glycan antigen disclosed herein, the first Galβ(1→4)Glc of the 2C7 epitope is further attached to KDOα(2→3)Galβ(1→4)GlcNac as provided in the Section 5.1.1(a) above. In certain embodiments, KDOα(2→3)Galβ(1→4)GlcNac is attached to the first Galβ(1→4)Glc of the 2C7 epitope via a β(1→3) linkage. In certain embodiments, the glycan antigen comprises KDOα(2→3)Galβ(1→4)GlcNac as the terminal saccharide unit and a 2C7 epitope. In certain embodiments, the glycan antigen comprises an exemplary structure provided below, and is shown in FIG. 32C: wherein, the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0130] In certain embodiments, KDOα(2→3)Galβ(1→4)GlcNac and the 2C7 epitope is further attached to a second KDO via an α(1→5) linkage. In certain embodiments, the second KDO is further attached to a third KDO via an α(2→4) linkage. In certain embodiments, the third KDO is further attached to PEtN.

[0131] In certain embodiments, the glycan antigen comprises a KDOα(2→3)Galβ(1→4)GlcNac, a 2C7 epitope, a second KDO, and a third KDO. In certain embodiments, a glycan antigen disclosed herein comprises an exemplary structure provided below, and is shown in FIG. 32A: NAI-5000113424v1 33wherein the he Gal), the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

[0132] In certain embodiments, the glycan antigen is further covalently conjugated to a modified lipid A. In certain embodiments, the glycan antigen comprises an exemplary structure is provided below, and is shown in FIG. 32B: wherein the, the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine. 5.1.2 Protein Antigens

[0133] In certain embodiments, an OMV disclosed herein comprises at least one protein antigen. In certain embodiments, the protein antigen is an antigen of a pathogen (e.g., N. gonorrhoeae). In certain embodiments, the OMV comprises an AniA polypeptide, a MetQ polypeptide, a MsrA / B polypeptide, and / or a NHBA polypeptide. In certain embodiments, the protein antigen is associated with the outer membrane of the OMV. In certain embodiments, the protein antigen is associated with the outer membrane of the OMV and is exposed on the surface of NAI-5000113424v1 34the OMV. In certain embodiments, the protein antigen is associated with the outer membrane of the OMV but is not exposed on the surface of the OMV. In certain embodiments, the protein antigen comprises a lipidated N-terminal cysteine. In certain embodiments, the protein antigen is fused to a polypeptide comprising a lipidated N-terminal cysteine. In certain embodiments, the lipidated N- terminal cysteine assists the association of the protein antigen with the outer membrane of the OMV. In certain embodiments, the lipidated N-terminal cysteine assists the exposure of the protein antigen on the surface of the OMV. In certain embodiments, the lipidated N-terminal cysteine assists the association of the protein antigen with the outer membrane of the OMV but not the exposure of the protein antigen on the surface of the OMV.

[0134] In certain embodiments, the presently disclosed protein antigen is produced by an engineered E. coli disclosed herein (e.g., E. coli of Sections 5.2.2 and 5.2.6), where the E. coli is genetically modified and transformed with one or more vectors (e.g., plasmids) that express the protein antigen (e.g., genetically modifications disclosed in Sections 5.2.2 and 5.2.6). In certain embodiments, the protein antigen produced by the E. coli is located to and associated with the outer membrane of the E. coli, for example, through lipidated N-terminal cysteine. Under suitable conditions, the E. coli produces and releases OMVs, where part of the outer membrane of the E. coli becomes the outer membrane of the OMVs, and thus the protein antigen associated with the outer membrane of the E. coli is incorporated into the OMVs. (a) AniA Polypeptides

[0135] In certain embodiments, an OMV disclosed herein comprises a Neisseria nitrite reductase (AniA) polypeptide. Exemplary AniA polypeptides are described in International Patent Publication WO2010022462, the contents of which are incorporated by reference herein in their entireties.

[0136] AniA is a nitrate reductase essential for anaerobic growth and biofilm formation. AniA is glycosylated in the carboxy terminal region. AniA is known to be an immunogenic outer membrane protein, and glycosylation of this protein with the same phase variable structure that is found on pilin may serve an immune-evasion role. Removal or modification of the glycan or the glycosylated region may lead to a non-native, protective immune response.

[0137] In certain embodiments, provided are AniA polypeptides, which can be used as described herein in compositions, methods and uses for eliciting an immune response to N. gonorrhoeae in a subject, for immunizing a subject against N. gonorrhoeae, and for the prevention and treatment of an infection and / or disease caused by N. gonorrhoeae. NAI-5000113424v1 35

[0138] In certain embodiments, the AniA polypeptide is derived from a wild-type full length AniA polypeptide from N. gonorrhoeae. The amino acid sequence of an exemplary full length AniA polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 1 (with signal peptide). The amino acid sequence of an exemplary full length AniA polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 50 (without signal peptide).

[0139] In certain embodiments, the AniA polypeptide comprises a fragment of the full length AniA polypeptide. In certain embodiments, the AniA polypeptide comprises a fragment of the full length AniA polypeptide, including those truncated at the C-terminus and / or N-terminus of the full length AniA polypeptide. In certain embodiments, the AniA polypeptide lacks at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more amino acids at the C-terminus and / or N-terminus compared to the full length AniA polypeptide.

[0140] In certain embodiments, the AniA polypeptide comprises a fragment lacking the C- terminal region of the full length AniA polypeptide. In certain embodiments, the AniA polypeptide lacks 56 amino acids at the C-terminus compared to the full length AniA polypeptide. In certain embodiments, the AniA polypeptide comprises amino acids 1- 346 of SEQ ID NO: 1.

[0141] In certain embodiments, the AniA polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 2. In certain embodiments, the AniA polypeptide disclosed herein comprises an AniA signal peptide. In certain embodiments, the AniA signal peptide comprises the amino acid sequence of SEQ ID NO: 3.

[0142] In certain embodiments, the AniA signal peptide is removed during post-translational modifications. In certain embodiments, the AniA polypeptide lacks all or a portion of the AniA signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the AniA polypeptide comprises amino acids 19-346 of SEQ ID NO: 1. In certain embodiments, the AniA polypeptide comprises amino acids 19-346 of SEQ ID NO: 2. In certain embodiments, the AniA polypeptide lacks the AniA signal peptide. In certain embodiments, the AniA polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 4 (without signal peptide).

[0143] In certain embodiments, the AniA polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, removal of the signal peptide is coupled with the lipidation process. In certain embodiments, removal of the signal peptide and the lipidation process are carried out by E. coli SEC-SPII pathway. In certain embodiments, the lipidation process is coupled with the export of the protein and results in the anchoring of the protein in E. coli outer membrane. NAI-5000113424v1 36An exemplary lipidation process is described in Nakayama et al., FEBS J (2012);279(23):4247-68, the content of which is incorporated by reference in its entirety. In certain embodiments, the anchoring of the AniA polypeptide in E. coli outer membrane results in the incorporation of the AniA polypeptide in the OMV outer membrane through the releasing of the OMV from the E. coli.

[0144] In certain embodiments, the AniA polypeptide comprises amino acid substitutions or deletions, which do not change the immunogenic activity of the AniA polypeptide. In certain embodiments, the AniA polypeptide comprises amino acid substitutions or deletions, which improve the immunogenic activity of the AniA polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 2, or SEQ ID NO: 4 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 2, or SEQ ID NO: 4. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 2, or SEQ ID NO: 4 may be modified (e.g., by amino acid substitution, deletion) so that the variant improves the immunogenicity of SEQ ID NO: 1, SEQ ID NO: 50, SEQ ID NO: 2, or SEQ ID NO: 4.

[0145] In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 1. In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 50. In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 2. In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 4. NAI-5000113424v1 37

[0146] In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 38. In certain embodiments, the AniA polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 38.

[0147] In certain embodiments, the AniA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence as set forth in SEQ ID NO: 44. In certain embodiments, the AniA polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 44. (b) MetQ Polypeptides

[0148] In certain embodiments, an OMV disclosed herein comprises a methionine ABC transporter substrate-binding lipoprotein (MetQ) polypeptide.

[0149] MetQ is a multifunctional lipoprotein on the bacterial surface that is involved in methionine transport and N. gonorrhoeae adhesion to cervical epithelial cells and monocytes. In certain embodiments, provided are MetQ polypeptides, which can be used as described herein in compositions, methods and uses for eliciting an immune response to N. gonorrhoeae in a subject, for immunizing a subject against N. gonorrhoeae, and for the prevention and treatment of an infection and / or disease caused by N. gonorrhoeae.

[0150] In certain embodiments, a MetQ polypeptide disclosed herein is derived from a wild- type full length MetQ polypeptide from N. gonorrhoeae. The amino acid sequence of an exemplary full length MetQ polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 5 (with signal peptide). The amino acid sequence of an exemplary full length MetQ polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 7 (without signal peptide).

[0151] In certain embodiments, the MetQ polypeptide comprises a fragment of the full length MetQ polypeptide. In certain embodiments, the MetQ polypeptide comprises a fragment of the full length MetQ polypeptide, including those truncated at the C-terminus and / or N-terminus of the full length MetQ polypeptide. In certain embodiments, the MetQ polypeptide lacks at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, NAI-5000113424v1 3832, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more amino acids at the C-terminus and / or N-terminus compared to the full length MetQ polypeptide.

[0152] In certain embodiments, the MetQ polypeptide comprises the full length MetQ polypeptide. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 5. In certain embodiments, the MetQ polypeptide comprises a MetQ signal peptide. In certain embodiments, the MetQ signal peptide comprises the amino acid sequence of SEQ ID NO: 6.

[0153] In certain embodiments, the MetQ signal peptide is removed during post-translational modifications. In certain embodiments, the MetQ polypeptide lacks all or a portion of the MetQ signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the MetQ polypeptide comprises amino acids 20-288 SEQ ID NO: 5.

[0154] In certain embodiments, the MetQ polypeptide lacking the MetQ signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 7.

[0155] In certain embodiments, the MetQ polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, removal of the signal peptide is coupled with the lipidation process. In certain embodiments, removal of the signal peptide and the lipidation process are carried out by E. coli SEC-SPII pathway. In certain embodiments, the lipidation process is coupled with the export of the protein and results in the anchoring of the protein in E. coli outer membrane. An exemplary lipidation process is described in Nakayama et al., FEBS J (2012);279(23):4247-68, the content of which is incorporated by reference in its entirety. In certain embodiments, the anchoring of the MetQ polypeptide in E. coli outer membrane results in the incorporation of the MetQ polypeptide in the OMV outer membrane through the releasing of the OMV from the E. coli.

[0156] In certain embodiments, the MetQ polypeptide comprises amino acid substitutions or deletions, which do not change the immunogenic activity of the MetQ polypeptide. In certain embodiments, the MetQ polypeptide comprises amino acids substitutions or deletions, which improve the immunogenic activity of the MetQ polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 5, or SEQ ID NO: 7 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 5, or SEQ ID NO: 7. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 5, or SEQ ID NO: 7 may be modified (e.g., by amino acid substitution, deletion) so that the variant improves the immunogenicity of SEQ ID NO: 5, or SEQ ID NO: 7. NAI-5000113424v1 39

[0157] In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 5. In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 7.

[0158] In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 39. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 39.

[0159] In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence as set forth in SEQ ID NO: 45. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 45.

[0160] In certain embodiments, the MetQ polypeptide is a N-terminal amino acid fragment of the full length MetQ polypeptide. In certain embodiments, the MetQ polypeptide is an N-terminal, 100-110 amino acid fragment of the full length MetQ polypeptide (not including the signal peptide, e.g., of SEQ ID NO: 7). In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the NAI-5000113424v1 40MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the MetQ polypeptide is designated as “Met1”.

[0161] In certain embodiments, the MetQ polypeptide is a C-terminal amino acid fragment of the full length MetQ polypeptide. In certain embodiments, the MetQ polypeptide is a C-terminal, 160-170 amino acid fragment of the full length MetQ polypeptide (not including the signal peptide, e.g., of SEQ ID NO: 7). In certain embodiments, the MetQ polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 58. In certain embodiments, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 58. In certain embodiments, the MetQ polypeptide is designated as “Met2”.

[0162] In certain embodiments, the MetQ polypeptide disclosed herein is fused to a NHBA polypeptide to form a NHBA-MetQ fusion polypeptide. In certain embodiments, the NHBA polypeptide is a NHBA polypeptide disclosed in Section 5.1.2(d). In certain embodiments, the NHBA-MetQ fusion polypeptide is a NHBA-MetQ fusion polypeptide disclosed in Section 5.1.2(d). (c) MsrA / B Polypeptides

[0163] In certain embodiments, an OMV disclosed herein comprises a methionine sulfoxide reductases (MsrA / B) polypeptide. Exemplary MsrA / B polypeptides are described in International Patent Publication WO2020124159, the contents of which are incorporated by reference herein in their entireties.

[0164] MsrA / B plays an important role in protecting N. gonorrhoeae from oxidative damage (Skaar et ai, 2002, Proc Natl Acad Sci U S A 99(15), 10108-10113), by catalyzing the reduction of methionine sulfoxide residues Met(O) back to methionine (Met) (Lowther et al., 2002, Nat Struct Biol 9(5), 348- 352; and Brot et al., 2006, J Biol Chem 281(43), 32668-32675). MsrA / B from N. gonorrhoeae is present, highly conserved and expressed in all N. gonorrhoeae strains investigated in the present studies and is immunogenic.

[0165] In certain embodiments, provided are MsrA / B polypeptides, which can be used as described herein in compositions, methods and uses for eliciting an immune response to N. gonorrhoeae in a subject, for immunizing a subject against N. gonorrhoeae, and for the prevention and treatment of an infection and / or disease caused by N. gonorrhoeae. NAI-5000113424v1 41

[0166] In certain embodiments, the MsrA / B polypeptide is derived from a wild-type full length MsrA / B polypeptide from N. gonorrhoeae. The amino acid sequence of an exemplary full length MsrA / B polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 8 (with signal peptide). The amino acid sequence of an exemplary full length MsrA / B polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 51 (without signal peptide).

[0167] In certain embodiments, the MsrA / B polypeptide comprises a fragment of the full length MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide comprises a fragment of the full length MsrA / B polypeptide, including those truncated at the N-terminus of the full length MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide lacks at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more amino acids at the N-terminus compared to the full length MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide lacks 34 amino acids at the N-terminus compared to the full length MsrA / B polypeptide.

[0168] In certain embodiments, the MsrA / B polypeptide comprises a fragment of the full length MsrA / B polypeptide, including those truncated at the C-terminus of the full length MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide lacks at least about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340 or more amino acids at the N-terminus compared to the full length MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide lacks 340 amino acids at the C-terminus compared to the full length MsrA / B polypeptide.

[0169] In certain embodiments, the MsrA / B polypeptide comprises an immunogenic fragment of the full length MsrA / B polypeptide, including those that comprise all or a portion of the thioredoxin domain. In certain embodiments, the MsrA / B polypeptide comprises amino acid 35- 182 of SEQ ID NO: 8. In certain embodiments, the MsrA / B polypeptide disclosed herein comprises the amino acid sequence set forth in SEQ ID NO: 9.

[0170] In certain embodiments, the MsrA / B polypeptide comprises amino acid substitutions or deletions, which do not change the immunogenic activity of the MsrA / B polypeptide. In certain embodiments, the MsrA / B polypeptide comprises amino acid substitutions or deletions, which improve the immunogenic activity of the MsrA / B polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 8, SEQ ID NO: 51, or SEQ ID NO: 9 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 8, SEQ ID NO: 51, or SEQ ID NO: 9. In certain embodiments, one or more of the amino NAI-5000113424v1 42acid residues of SEQ ID NO: 8, SEQ ID NO: 51, or SEQ ID NO: 9 may be modified (e.g., by amino acid substitution, deletion) so that the variant improves the immunogenicity of SEQ ID NO: 8, SEQ ID NO: 51, or SEQ ID NO: 9.

[0171] In certain embodiments, the MsrA / B polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 8. In certain embodiments, the MsrA / B polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 51. In certain embodiments, the MsrA / B polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 9.

[0172] In certain embodiments, the MsrA / B polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 46. In certain embodiments, the MsrA / B polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 46.

[0173] In certain embodiments, the MsrA / B polypeptide is fused to an AniA polypeptide to form a MsrA / B-AniA fusion polypeptide. In certain embodiments, the N-terminus of the MsrA / B polypeptide is fused to the C-terminus of an AniA polypeptide to form a MsrA / B-AniA fusion polypeptide. In certain embodiments, the N-terminus of the MsrA / B polypeptide is fused to the C- terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide. In certain embodiments, the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine. In certain embodiments, the lipidated AniA assists the association of the MsrA / B polypeptide to the outer membrane of the OMV. In certain embodiments, the lipidated AniA assists the exposure of the MsrA / B polypeptide to surface of the OMV. In certain embodiments, the lipidated AniA assists the NAI-5000113424v1 43association of the MsrA / B polypeptide to the outer membrane of the OMV but not the exposure of the MsrA / B polypeptide to surface of the OMV.

[0174] In certain embodiments of the MsrA / B-AniA fusion polypeptide provided herein, the MsrA / B polypeptide comprises the amino acid sequence of SEQ ID NO: 9.

[0175] In certain embodiments of the MsrA / B-AniA fusion polypeptide provided herein, the AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 10.

[0176] In certain embodiments of the MsrA / B-AniA fusion polypeptide provided herein, the AniA polypeptide comprises an AniA signal peptide. In some embodiment, the AniA signal peptide comprises the amino acid sequence of SEQ ID NO: 3. In certain embodiments of the MsrA / B-AniA fusion polypeptide provided herein, the AniA polypeptide fused to the MsrA / B polypeptide lacks all or a portion of the AniA signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the AniA polypeptide lacking the AniA signal peptide disclosed herein comprises the amino acid sequence of SEQ ID NO: 12.

[0177] In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 13. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an AniA signal peptide. In some embodiment, the AniA signal peptide comprises the amino acid sequence of SEQ ID NO: 3.

[0178] In certain embodiments, the AniA signal peptide is removed during post-translational modifications. In certain embodiments, the MsrA / B-AniA fusion polypeptide provided herein lacks all or a portion of the AniA signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the MsrA / B-AniA fusion polypeptide provided herein comprises amino acids 19-199 of SEQ ID NO: 13. In certain embodiments, the MsrA / B-AniA fusion polypeptide lacking the AniA signal peptide disclosed herein comprises the amino acid sequence set forth in SEQ ID NO: 14.

[0179] In certain embodiments of the MsrA / B-AniA fusion polypeptide provided herein, the cysteine at the N-terminal of the MsrA / B-AniA fusion polypeptide is lipidated. In certain embodiments, the signal peptide removal is coupled with the lipidation process. In certain embodiments, the signal peptide removal and the lipidation process are carried out by E. coli SEC- SPII pathway. In certain embodiments, the lipidation process is as well coupled with the export of the protein and results in the anchoring of the protein in E. coli outer membrane. An exemplary lipidation process is described in Nakayama et al., FEBS J (2012);279(23):4247-68, the content of which is incorporated by reference in its entirety. In certain embodiments, the anchoring of the MsrA / B-AniA fusion polypeptide in E. coli outer membrane results in the incorporation of the NAI-5000113424v1 44MsrA / B-AniA fusion polypeptide in the OMV outer membrane through the releasing of the OMV from the E. coli.

[0180] In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises amino acid substitutions or deletions, which do not change the immunogenic activity of the MsrA / B-AniA fusion polypeptide. In certain embodiments the MsrA / B-AniA fusion polypeptide comprises amino acid substitutions or deletions, which improve the immunogenic activity of the MsrA / B-AniA fusion polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 13 or SEQ ID NO: 14 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 13 or SEQ ID NO: 14. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 13 or SEQ ID NO: 14 may be modified (e.g., by amino acid substitution or deletion) so that the variant improves the immunogenicity of SEQ ID NO: 13 or SEQ ID NO: 14.

[0181] In certain embodiments of the MsrA / B-AniA fusion comprises the MsrA / B polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 9, and the AniA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 10. In certain embodiments of the MsrA / B-AniA fusion comprises the MsrA / B polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 9, and the AniA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 12.

[0182] In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at NAI-5000113424v1 45least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 13. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 14.

[0183] In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 40. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 40.

[0184] In certain embodiments, the MsrA / B-AniA fusion comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence as set forth in SEQ ID NO: 47. In certain embodiments, the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 47. (d) NHBA Polypeptides

[0185] In certain embodiments, an OMV disclosed herein comprises a Neisserial heparin binding antigen (NHBA) polypeptide. Exemplary NHBA polypeptides are described in International Patent Publication WO2021102505, the contents of which are incorporated by reference herein in their entireties.

[0186] NHBA is a lipoprotein that binds to heparin and chondroitin sulfate and is highly conserved in N. gonorrhoeae strains (97%-100% identity), and may be involved in adhesion of gonococcus to host epithelial cells.

[0187] In certain embodiments, provided are NHBA polypeptides, which can be used as described herein in compositions, methods and uses for eliciting an immune response to N. NAI-5000113424v1 46gonorrhoeae in a subject, for immunizing a subject against N. gonorrhoeae, and for the prevention and treatment of an infection and / or disease caused by N. gonorrhoeae.

[0188] In certain embodiments, the NHBA polypeptide disclosed herein is derived from a wild- type full length NHBA polypeptide. An exemplary full length NHBA polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 15. The amino acid sequence of an exemplary full length NHBA polypeptide from N. gonorrhoeae is set forth in SEQ ID NO: 52 (without signal peptide).

[0189] In certain embodiments, the NHBA polypeptide disclosed herein comprises a fragment of the full length NHBA polypeptide from N. gonorrhoeae. In certain embodiments, the NHBA polypeptide disclosed herein comprises a fragment of a full length NHBA polypeptide, including those truncated at the N-terminus of the full length NHBA polypeptide. In certain embodiments, the NHBA polypeptide lacks at least about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,170, 180, 190, 200, 210, 220, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 270 or more amino acids at the N-terminus compared to a full length NHBA polypeptide. In certain embodiments, the NHBA polypeptide lacks 243 amino acids at the N-terminus compared to a full length NHBA polypeptide.

[0190] In certain embodiments, the NHBA polypeptide disclosed herein comprises amino acids corresponding to amino acid 244-426 of SEQ ID NO: 15. In certain embodiments, the NHBA polypeptide disclosed herein comprises the amino acid sequence set forth in SEQ ID NO: 16.

[0191] In certain embodiments of the NHBA polypeptide comprises amino acid substitutions or deletions, which do not change immunogenic activity of the NHBA polypeptide. In certain embodiments, the NHBA polypeptide comprises amino acid substitutions or deletions, which improve the immunogenic activity of the NHBA polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 15, SEQ ID NO: 52, or SEQ ID NO: 16 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 15, SEQ ID NO: 52, or SEQ ID NO: 16. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 15, SEQ ID NO: 52, or SEQ ID NO: 16 may be modified (e.g., by amino acid substitution, deletion) so that the variant improves the immunogenicity of SEQ ID NO: 15, SEQ ID NO: 52, or SEQ ID NO: 16.

[0192] In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence NAI-5000113424v1 47identity with the amino acid sequence of SEQ ID NO: 15. In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the amino acid sequence of SEQ ID NO: 52. In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the amino acid sequence of SEQ ID NO: 16.

[0193] In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence as set forth in SEQ ID NO: 48. In certain embodiments, the NHBA polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 48.

[0194] In certain embodiments, the NHBA polypeptide is a C-terminal amino acid fragment of the full length NHBA polypeptide. In certain embodiments, the NHBA polypeptide is a C-terminal, 178-188 amino acid fragment of the full length NHBA polypeptide (e.g., of SEQ ID NO: 15). In certain embodiments, the NHBA polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity with the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO: 16. In certain embodiments, the NHBA polypeptide is designated as “cNHBA”.

[0195] In certain embodiments, the NHBA polypeptide disclosed herein is fused to a MetQ polypeptide to form a NHBA-MetQ fusion polypeptide. In certain embodiments, the N-terminus of the NHBA polypeptide disclosed herein is fused to the C-terminus of a MetQ polypeptide to form a NHBA-MetQ fusion polypeptide. In certain embodiments, the N-terminus of the NHBA polypeptide is fused to the C-terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal NAI-5000113424v1 48cysteine. In certain embodiments, the N-terminus of the MetQ polypeptide is fused to the C- terminus of the NHBA polypeptide to form a NHBA-MetQ fusion polypeptide.

[0196] In certain embodiments, the NHBA-MetQ fusion polypeptide further comprises a linker between the MetQ polypeptide and the NHBA polypeptide. In certain embodiments, the linker is a glycine-rich linker. In certain embodiments, the linker comprises the amino acid sequence GGGG (SEQ ID NO: 68).

[0197] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO: 16.

[0198] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 17.

[0199]

[0200] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 57.

[0201] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 58.

[0202] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7.

[0203] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide comprises a MetQ signal peptide. In certain embodiments, the MetQ signal peptide comprises the amino acid sequence of SEQ ID NO: 6. In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the MetQ polypeptide lack all or a portion of the MetQ signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the MetQ polypeptide lacking the MetQ signal peptide disclosed herein comprises the amino acid sequence of SEQ ID NO: 19.

[0204] In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 20. In certain embodiments, the NHBA-MetQ fusion polypeptide provided herein comprises a MetQ signal peptide. In some embodiment, the MetQ signal peptide comprises the amino acid sequence of SEQ ID NO: 6.

[0205] In certain embodiments, the NHBA-MetQ fusion polypeptide disclosed herein further comprises a MetQ signal peptide. In certain embodiments, the MetQ signal peptide comprises the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the NHBA-MetQ fusion polypeptide lacks all or a portion of the MetQ signal sequence. NAI-5000113424v1 49

[0206] In certain embodiments, the MetQ signal peptide is removed during post-translational modifications. In certain embodiments, the NHBA-MetQ fusion polypeptide provided herein lack all or a portion of the MetQ signal sequence, i.e., truncated at the N-terminus. In certain embodiments, the NHBA-MetQ fusion polypeptide provided herein comprises amino acids 19-199 corresponding to amino acids of SEQ ID NO: 20. In certain embodiments, the NHBA-MetQ fusion polypeptide lacking the MetQ signal peptide disclosed herein comprises the amino acid sequence set forth in SEQ ID NO: 21.

[0207] In certain embodiments of the NHBA-MetQ fusion polypeptide provided herein, the cysteine at the N-terminal of the NHBA-MetQ fusion polypeptide is lipidated. In certain embodiments, the signal peptide removal is coupled with the lipidation process. In certain embodiments, the signal peptide removal and the lipidation process are carried out by E. coli SEC- SPII pathway. In certain embodiments, the lipidation process is as well coupled with the export of the protein and results in the anchoring of the protein in E. coli outer membrane. An exemplary lipidation process is described in Nakayama et al., FEBS J (2012);279(23):4247-68, the content of which is incorporated by reference in its entirety. In certain embodiments, the anchoring of the NHBA-MetQ fusion polypeptide in E. coli outer membrane results in the incorporation of the NHBA-MetQ fusion polypeptide in the OMV outer membrane through the releasing of the OMV from the E. coli.

[0208] In certain embodiments of the NHBA-MetQ fusion polypeptide comprises amino acid substitutions or deletions, which do not change the immunogenic activity of the NHBA-MetQ fusion polypeptide. In certain embodiments of the NHBA-MetQ fusion comprises amino acid substitutions or deletions, which improve the immunogenic activity of the NHBA-MetQ fusion polypeptide. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NOs: 60-65 may be modified (e.g., by amino acid substitution or deletion) so that the variant retains the immunogenicity of SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NOs: 60-65. In certain embodiments, one or more of the amino acid residues of SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NOs: 60-65 may be modified (e.g., by amino acid substitution or deletion) so that the variant improves the immunogenicity of SEQ ID NO: 20, SEQ ID NO: 21, or SEQ ID NOs: 60-65.

[0209] In certain embodiments of the NHBA-MetQ fusion polypeptide comprises the NHBA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at NAI-5000113424v1 50least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 16, and the MetQ polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 17. In certain embodiments of the NHBA-MetQ fusion polypeptide comprises the NHBA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 16, and the MetQ polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 19.

[0210] In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 20. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 21.

[0211] In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 41. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 41. NAI-5000113424v1 51

[0212] In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence encoded by the nucleotide sequence as set forth in SEQ ID NO: 49. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 49.

[0213] In certain embodiments of the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 16, and a MetQ polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising the amino acid sequence of SEQ ID NO: 16 and a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the N-terminus of the NHBA polypeptide is fused to the C-terminus of the MetQ polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 60. In certain embodiments, the N-terminus of the MetQ polypeptide is fused to the C-terminus of the NHBA polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 63. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 60. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 63. NAI-5000113424v1 52

[0214] In certain embodiments of the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 16, and a MetQ polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 58. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising the amino acid sequence of SEQ ID NO: 16 and a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 58. In certain embodiments, the N-terminus of the NHBA polypeptide is fused to the C-terminus of the MetQ polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 61. In certain embodiments, the N-terminus of the MetQ polypeptide is fused to the C-terminus of the NHBA polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 64. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 61. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 64.

[0215] In certain embodiments of the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 16, and a MetQ polypeptide comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least NAI-5000113424v1 53about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises a NHBA polypeptide comprising the amino acid sequence of SEQ ID NO: 16 and a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the N- terminus of the NHBA polypeptide is fused to the C-terminus of the MetQ polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 62. In certain embodiments, the N-terminus of the MetQ polypeptide is fused to the C- terminus of the NHBA polypeptide. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 65. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 62. In certain embodiments, the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% sequence identity to the amino acid sequence of SEQ ID NO: 65. 5.1.3 Modified Lipid A

[0216] The presently disclosure also provides an OMV comprising a modified lipid A. In certain embodiments, the modified lipid A has the benefit of enhancing immune responses against the pathogen while minimizing toxicity of the OMV vaccine.

[0217] In certain embodiments, the modified lipid A is covalently linked to a glycan antigen (e.g., a glycan antigen disclosed in Section 5.1.1). In certain embodiments, the modified lipid A is linked to the glycan antigen via a co-localization in an outer membrane of an E. coli that produces the OMV.

[0218] In certain embodiments, the E. coli that produces the OMV comprises genetic modifications to produce the modified lipid A (e.g. the genetic modifications disclosed in Section 5.2.3). In certain embodiments, the E. coli comprises at least one lipid A modification enzyme that produces the modified lipid A. In certain embodiments, the at least one lipid A modification enzyme is selected from the group consisting of msbB, pagL, lpxE, pagP, and combinations thereof. In certain embodiments, the msbB, pagL, and / or lpxE is encoded by at least one exogenous NAI-5000113424v1 54polynucleotide of the E. coli that produces the OMV. In certain embodiments, the E. coli further comprises genetic disruption of msbB, eptA, and / or lpxT genes. In certain embodiments, the at least one lipid A modification enzyme is selected from the group consisting of pagL, lpxE, pagP, and combinations thereof. In certain embodiments, the pagL and / or lpxE is encoded by at least one exogenous polynucleotide of the E. coli that produces the OMV. In certain embodiments, the E. coli further comprises genetic disruption of eptA, and / or lpxT genes. In certain embodiments, the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

[0219] In certain embodiments, the modified lipid A is produced by a combination of msbB, pagL, lpxE, and pagP, the genetic disruption of msbB, eptA, and lpxT genes, and a lambda PL promoter that replaces the promoter of pagP gene, wherein the msbB, pagL, and lpxE are encoded by at least one exogenous polynucleotide of the E. coli that produces the OMV.

[0220] In certain embodiments, the genetic disruption and then reinsertion of the msbB gene is functionally equivalent to making no genetic modification of the msbB gene. Thus, in certain embodiments, no genetic disruption of the msbB gene or reinsertion of the exogenous msbB gene is made in the E. coli. In certain embodiments, the modified lipid A is produced by a combination of pagL, lpxE, and pagP, the genetic disruption of eptA, and lpxT genes, and a lambda PL promoter that replaces the promoter of pagP gene, wherein each of the pagL and lpxE is encoded by an exogenous polynucleotide of the E. coli that produces the OMV.

[0221] MPL (i.e., monophosphorylated lipid A) as used herein refers to a heterogeneous mixture of lipid A species from Salmonella minnesota R595 that has been chemically detoxified by successive acid and base hydrolysis. Description of MPL can be found in Needham et al., Proc Natl Acad Sci U S A, 2013;110(4):1464-1469; Wang et al., Front Immunol, 2020;11:577823; Hagen et al., J Chromatogr A.1997;767(1-2):53-61, and the content of each of which is incorporated by reference herein. MPL produced by different methods might include different species and with different relative abundance. MPL® exclusively manufactured by GSK (see Wang et al., Front Immunol, 2020;11:577823; Hagen et al., J Chromatogr A.1997;767(1-2):53-61; Ulrich et al., Pharm Biotechnol., 1995:6:495-524) is a licensed vaccine component, used as a standalone adjuvant in Bexsero, and is a component of AS04 adjuvant system (present in Cervarix and Fendrix) and AS01B adjuvant system (used in Shingrix). FIG.3C shows the approximate percentage of the amount of each species of the lipid A in the MPL® of GSK. FIG.3D shows the chemical structure of the wildtype E coli. lipid A.

[0222] 3-O-desacyl-4′-monophosphoryl lipid A as used herein refers to a particular chemical structure among the structures found in MPL, where the 3-O-desacyl-4′-monophosphoryl lipid A NAI-5000113424v1 55species contain only one phosphate group at the 4’ position and lacks an acyl chain at the 3 position. An exemplary chemical structure of a 3-O-desacyl-4′-monophosphoryl lipid A species is as follows:

[0223] In certainA produced by the engineered E. coli strains is heterogeneous. In certain embodiments, the modified lipid A produced by the engineered E. coli strains is a mixture of heterogeneous lipid A species having different chemical structures. In certain embodiments, the modified lipid A produced by the engineered E. coli strains have heterogeneous structures but some common features, such as every structure contains at least two C14-3OH acyl chains, and / or every structure contains one C12 acyl chain. Exemplary modified lipid A structures are provided in FIG. 3A. In certain embodiments, at least one structure of modified lipid A produced by the engineered E. coli strains contains a C16 chain.

[0224] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species comprising only one phosphate group. In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone. In certain embodiments, at least 60% (e.g., about 60%, about 70%, about 80%, or about 90%) of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone. In certain embodiments, between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone. In certain embodiments, about 73% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone.

[0225] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone. In certain NAI-5000113424v1 56embodiments, at least 60% (e.g., about 60%, about 70%, about 80%, or about 90%) of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone. In certain embodiments, between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone. In certain embodiments, about 89% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone.

[0226] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A. In certain embodiments, at least 50% (e.g., about 50%, about 60%, about 70%, about 80%, or about 90%) of the amount of the modified lipid A is 3-O-desacyl-4’-monophosphoryl lipid A. In certain embodiments, between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’-monophosphoryl lipid A. In certain embodiments, about 64% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A.

[0227] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species comprising at least three (e.g., three, or four) C14-3OH acyl chains. In certain embodiments, at least 60% (e.g., about 60%, about 70%, about 80%, about 90%, about 95%, or about 99%) of the amount of the modified lipid A comprises at least three C14-3OH acyl chains. In certain embodiments, between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains. In certain embodiments, about 98% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains.

[0228] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. In certain embodiments, at least 30% (e.g., about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90%) of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. In certain embodiments, between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. In certain embodiments, about 43% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone.

[0229] In certain embodiments, the modified lipid A disclosed herein comprises at least one lipid A species comprising a C12 acyl chain. In certain embodiments, at least 60% (e.g., about 60%, about 70%, about 80%, about 90%, about 95%, or about 99%) of the amount of the modified lipid A comprises a C12 acyl chain. In certain embodiments, between 90% and 100% of the NAI-5000113424v1 57amount of the modified lipid A comprises a C12 acyl chain. In certain embodiments, about 98% of the amount of the modified lipid A comprises a C12 acyl chain.

[0230] In certain embodiments, the modified lipid A disclosed herein comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) at least one lipid A species comprising a C12 acyl chain.

[0231] In certain embodiments, (i) at least 60% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone, (ii) at least 60% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone, (iii) at least 50% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A, (iv) at least 60% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains, (v) at least 30% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone, and (vi) at least 60% of the amount of the modified lipid A comprises a C12 acyl chain.

[0232] In certain embodiments, (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone, (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone, (iii) between 60% and 70% of the amount of the modified lipid A is 3- O-desacyl-4’-monophosphoryl lipid A, (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains, (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone, and (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

[0233] Exemplary chemical structures of the species of the presently disclosed modified lipid A are provided in FIG.3A. Approximate percentage of the amount of each species of an exemplary modified lipid A disclosed herein is provided in FIG.3B.

[0234] In certain embodiments, the modified lipid A comprises different structures with potentially different TLR-4 binding activities and a safe profile. The modified lipid A disclosed herein has a superior ability in activating TLR-4 (e.g., inducing proinflammatory cytokines) and at NAI-5000113424v1 58the same time retaining a safe profile (see Example 21). For example, OMVs carrying the modified lipid A disclosed herein do not cause temperature increase in a subject receiving the OMVs.

[0235] In certain embodiments, the modified lipid A are analogous to the structure of MPL from Salmonella enterica Minnesota. 5.1.4 Exemplary OMVs

[0236] In certain embodiments, provided herein is an E. coli-derived OMV comprising (i) protein antigens comprising an AniA polypeptide (e.g., an AniA polypeptide disclosed in Section 5.1.2(a)), a MetQ polypeptide (e.g., a MetQ polypeptide disclosed in Section 5.1.2(b)), a MsrA / B polypeptide (e.g., a MsrA / B polypeptide disclosed in Section 5.1.2(c)), and a NHBA polypeptide (e.g., a NHBA polypeptide disclosed in Section 5.1.2(d)); (ii) a glycan antigen comprising a KDO (e.g., a KDO disclosed in Section 5.1.1(a)) and a 2C7 epitope (e.g., a 2C7 epitope disclosed in Section 5.1.1(b)), and (iii) a modified lipid A (e.g., a modified lipid A of Section 5.1.3), wherein the glycan antigen is covalently linked to the modified lipid A. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0237] In certain embodiments, provided herein is an E. coli-derived OMV comprising (i) protein antigens comprising an AniA polypeptide (e.g., an AniA polypeptide disclosed in Section 5.1.2(a)), a MetQ polypeptide (e.g., a MetQ polypeptide disclosed in Section 5.1.2(b)), a MsrA / B- AniA fusion polypeptide (e.g., a MsrA / B-AniA polypeptide disclosed in Section 5.1.2(c)), and a NHBA-MetQ fusion polypeptide (e.g., a NHBA-MetQ fusion polypeptide disclosed in Section 5.1.2(d)); (ii) a glycan antigen comprising a KDO (e.g., a KDO disclosed in Section 5.1.1(a)) and a 2C7 epitope (e.g., a 2C7 epitope disclosed in Section 5.1.1(b)), and (iii) a modified lipid A (e.g., a modified lipid A of Section 5.1.3), wherein the glycan antigen is covalently linked to the modified lipid A. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0238] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14, a MetQ NAI-5000113424v1 59polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is covalently linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of msbB, pagL, lpxE, and pagP, wherein the msbB, pagL, and lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of msbB, eptA, and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0239] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 14, a MetQ polypeptide comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises an amino acid sequence having at NAI-5000113424v1 60least 90% sequence identity to the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is covalently linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:wherein the hexagon represents a KDO, the white circle represents a galactose (Gal), the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of pagL, lpxE, and pagP, wherein each of the pagL and lpxE is encoded by an exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of eptA and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0240] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14, a MetQ polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4, and a NAI-5000113424v1 61NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is covalently linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:wherein the hexagon represents a KDO, the white circle represents a galactose (Gal), the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) at least one lipid A species comprising a C12 acyl chain. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0241] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14, a MetQ NAI-5000113424v1 62polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is covalently linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:wherein the hexagon represents a KDO, the white circle represents a galactose (Gal), the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; and wherein (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone, (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone, (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A, (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains, (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone, and (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but NAI-5000113424v1 63are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0242] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 14, a MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of msbB, pagL, lpxE, and pagP, wherein the msbB, pagL, and lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of msbB, eptA, and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0243] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises the amino acid sequence NAI-5000113424v1 64of SEQ ID NO: 14, a MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the following structure and is linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of pagL, lpxE, and pagP, wherein each of the pagL and lpxE is encoded by an exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of eptA and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0244] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 14, a MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the NAI-5000113424v1 65following structure and is linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) at least one lipid A species comprising a C12 acyl chain. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0245] In certain embodiments, provided herein is an E. coli-derived OMV comprising: (i) protein antigens comprising a MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 14, a MetQ polypeptide comprises the amino acid sequence of SEQ ID NO: 7, an AniA polypeptide comprises the amino acid sequence of SEQ ID NO: 4, and a NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO: 21, and (ii) a glycan antigen has the NAI-5000113424v1 66following structure and is linked to a modified lipid A of the OMV as follows, and is shown in FIG. 32B:white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; and wherein (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone, (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone, (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A, (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains, (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone, and (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain. In certain embodiments, the protein antigens and glycan antigen are associated with the outer membrane of the OMV and are exposed to the surface of the OMV. In certain embodiments, the protein antigens are associated with the outer membrane of the OMV but are not exposed to the surface of the OMV. In certain embodiments, the KDO can be recognized by antibody 6E4.

[0246] In certain embodiments, the expression of protein antigens on the OMVs are assessed, e.g., by immunoblots or ELISAs. In certain embodiments, the expression of glycan antigens on the OMVs are assessed, e.g., by immunoblots or ELISAs. NAI-5000113424v1 675.1.5 Additional Features of OMVs Derived From E. coli

[0247] OMVs disclosed herein are produced from E. coli, and thus are essentially free of any antigenic factors or protein antigens of N. gonorrhoeae, except the protein and glycan antigens disclosed herein (e.g., protein antigens of Section 5.1.2, glycan antigens of Section 5.1.1). As such, OMVs disclosed herein do not elicit immune evasion and / or suppression mechanisms of N. gonorrhoeae that can reduce the protective efficacy of the OMV vaccine. In certain embodiments, the OMV does not comprise a N. gonorrhoeae protein selected from the group consisting of reduction modifiable protein (rmp), type IV pili protein (T4P), opacity-associated protein (Opa), HpuA, and HpuB of N. gonorrhoeae.

[0248] In certain embodiments, the proportions of specific glycolipids and / or phospholipids, including phosphatidylethanolamine, phosphatidylglycerol, and / or cardiolipin in the OMVs disclosed herein are different from OMVs produced from N. gonorrhoeae. In certain embodiments, OMVs disclosed herein have overall low to inexistent level of homology to the OMVs produced from N. gonorrhoeae.

[0249] In the outer membrane of E. coli and OMVs produced and derived thereof, the lipid A component, which is the hydrophobic anchor of lipopolysaccharide (LPS), constitutes almost 100% of the outer leaflet. As disclosed herein, in certain embodiments, the E. coli-derived OMVs disclosed herein comprise a modified lipid A (e.g., modified lipid A disclosed in Section 5.1.3), whereas the lipid A of N. gonorrhoeae- derived OMVs has a different structure from the modified lipid A disclosed herein.

[0250] In certain embodiments, the present disclosure provides a composition comprising a plurality of OMVs disclosed herein. In certain embodiments, the purity of the OMVs in the composition is at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 99%, where the purity is calculated as the percentage of the area under the OMV containing peak compared to the area under the entire chromatogram as measured by SEC-HPLC. In certain embodiments, the purity of the OMVs in the composition is at least 99%, where the purity is calculated as the percentage of the area under the OMV containing peak compared to the area under the entire chromatogram as measured by SEC-HPLC. In certain embodiments, the OMVs in the composition do not aggregate as assessed by SEC-HPLC.

[0251] In certain embodiments, the composition comprising the plurality of OMVs disclosed herein is essentially free of DNA from E coli. In certain embodiments, the composition comprises less than 5 ng, less than 4 ng, less than 3 ng, less than 1 ng, less than 100 pg, less than 50 pg, less than 25 pg, less than 10 pg, less than 5 pg, or less than 1.5 pg, DNA from E coli / μg total protein as NAI-5000113424v1 68measure by qPCR. In certain embodiments, the composition comprising the plurality of OMVs disclosed herein comprises less than 1.5 pg DNA from E coli / μg total protein as measure by qPCR.

[0252] In certain embodiments, the diameter of the OMVs in the presently disclosed composition is between 20 nm and 80 nm, between 30 nm and 70 nm, between 40 nm and 60 nm, or between 50 nm and 60 nm, as measured by DLS. In certain embodiments, the diameter of the OMV disclosed herein, as measured by DLS, is about 30 nm, about 35 nm, about 40 nm, about 45 mg (e.g., 44.5 nm), about 50 nm, about 55 nm, or about 60 nm.

[0253] In certain embodiments, no significant degradation of OMVs in the presently disclosed composition is observed after being stored at 2°C - 8°C for at least about 4 week, at least about 8 week, at least about 12 week, at least about 16 week, at least about 20 week, at least about 24 week, at least about 28 week, at least about 32 week, at least about 36 week, at least about 40 week, at least about 44 week, at least about 48 week, at least about 52 week, at least about 56 week, at least about 1 year, or more. 5.2 Engineered Escherichia Coli for Producing OMVs

[0254] In certain embodiments, the present disclosure further provides an engineered E. coli for producing an OMV disclosed herein, wherein the E. coli comprises (i) at least one glycan antigen (e.g., at least one glycan of Section 5.1.1), (ii) at least one protein antigen (e.g., at least one protein agent of Section 5.1.2), and / or (iii) a modified lipid A (e.g., a modified lipid A of Section 5.1.3). In certain embodiments, the at least one glycan antigen and / or the at least one protein antigen are antigens of a pathogen (e.g., N. gonorrhoeae).

[0255] In certain embodiments, the E. coli comprises (i) one or more genetic modifications for producing the at least one glycan antigen (e.g., one or more genetic modifications of Section 5.2.1); (ii) one or more genetic modifications for producing the at least one protein antigen (e.g., one or more genetic modifications of Section 5.2.2); (iii) one or more genetic modifications for producing the modified lipid A (e.g., one or more genetic modifications of Section 5.2.3); (iv) one or more additional genetic modifications (e.g., one or more additional genetic modifications of Section 5.2.4). In certain embodiments, the E. coli produces an OMV as described herein (e.g., OMVs of Section 5.1). 5.2.1 Genetic Modifications for Expressing Glycan Antigens

[0256] In certain embodiments, the present disclosure provides an engineered E. coli comprising at least one glycan antigen (e.g., at least one glycan of Section 5.1.1). In certain embodiments, the at least one glycan antigen is associated with the outer membrane of the E. coli, for example, by covalently conjugated to a lipid A associated with the outer membrane. Under NAI-5000113424v1 69suitable conditions, the E. coli produces and releases OMVs, where part of the outer membrane of the E. coli becomes the outer membrane of the OMVs, and thus the at least one glycan antigen associated with the outer membrane of the E. coli is incorporated into the OMVs. In certain embodiments, the E. coli comprises genetic modifications for generating the at least one glycan antigen. In certain embodiments, the E. coli produces an OMV comprising the at least one glycan antigen (e.g., at least one glycan of Section 5.1.1).

[0257] In certain embodiments, the E. coli is derived from E. coli C600 strain.

[0258] In certain embodiments, the E. coli comprises one or more or all of the following genetic modifications to be able to biosynthesize at least one glycan antigen disclosed herein: (i) clusters for the biosynthesis of E. coli K12 LPS core waaQGPSBORYZU (GenBank NZ_CP031214 position 117,878 to 127,774), which was replaced by an artificial operon containing genes for the biosynthesis of the LOS lgtA (N. gonorrhoeae 1291, GenBank ID AAF14358), lgtB (N. mengitidis MC58, GenBank ID AAF42257), lgtE (N. gonorrhoeae 1291, GenBank ID AAF14363), lpt3 (N. mengitidis C311, GenBank ID QXZ29326), lgtF (N. mengitidis MC58, GenBank ID AAF42052), rfaK (N. mengitidis MC58, GenBank ID AAF42053), lgtG (N. mengitidis M22790, GenBank ID AOA42063), controlled by the existing genomic promoter; (ii) the genomic locus wza-wbbL (GenBank NZ_CP031214 position 1,786,050 to 1,822,024), including the colanic acid cluster wca, galF, and the O antigen cluster rfb, which was replaced by lst from Neisseria gonorrhoeae 1291 (GenBank AAY41933) and further copies of lgtB, lgtA and lgtE, under the control of the constitutive promoter of E. coli’s rfb cluster which has been reinserted; (iii) enterobacterial common antigen (ECA) cluster (wecA – rffM, GenBank NZ_CP031214 position 4,557,910 - 4,545,870) which was replaced by further copies of lgtB and lgtA; (iv) an additional copy of the lst (SEQ ID NO: 37) from Neisseria gonorrhoeae (GenBank CP078119: 2,138,146 - 2,139,282) is introduced into a pBAD-derived plasmid under constitutive phage promoter; (v) 3-deoxy-manno-octulosonate cytidylyltransferase kdsB (SEQ ID NO.53) from E. coli (GenBank NZ_CP031214 position 2,949,898 to 2,950,644) is introduced on a pEXT20 expression plasmid (e.g., pLTPro231 or pLTPro302) under an IPTG-inducible promoter or a J23105 promoter via standard cloning techniques.

[0259] In certain embodiments, the E. coli comprises genetic disruption of LOS gene cluster. In certain embodiments, the LOS gene cluster comprises waa genes. In certain embodiments, the LOS gene cluster comprises waaQGPSBORYZU (GenBank NZ_CP031214 position 117,878 to 127,774). NAI-5000113424v1 70In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaZ, waaY, and / or waaU genes. In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaZ, waaY, and waaU genes.

[0260] In certain embodiments, the E. coli comprises genetic disruption of the genomic locus wza-wbbL (GenBank NZ_CP031214 position 1,786,050 to 1,822,024), including the colanic acid cluster wca, galF, and the O antigen cluster rfb.

[0261] In certain embodiments, the E. coli comprises genetic disruption of colanic acid biosynthesis gene cluster. In certain embodiments, the E. coli comprises genetic disruption of wca genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, and / or wcaM genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, and wcaM genes.

[0262] In certain embodiments, the E. coli comprises genetic disruption of O antigen biosysthesis gene cluster. In certain embodiments, the E. coli comprises genetic disruption of rfb genes. In certain embodiments, the E. coli comprises genetic disruption of rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes.

[0263] In certain embodiments, the E. coli comprises genetic disruption of galF gene which is located in between of colanic acid cluster (wca) and O antigen cluster (rfb).

[0264] In certain embodiments, the E. coli comprises genetic disruption of ECA (enterobacterial common antigen) gene cluster. In certain embodiments, the ECA cluster comprises wecA – wecG, (GenBank NZ_CP031214 position 4,557,910 - 4,545,870). In certain embodiments, the E. coli comprises genetic disruption of wec genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes. Alternative names of wec genes are as follows: wecA is also known as rfe; wecB is also known as rffE; wecC is also known as rffD; rmlB is also known as rffG; rmlA is also known as rffH, wecC is also known as rffC; wecW is also known as rffA; wecF is also known as rffT; wecG is also known as rffM. NAI-5000113424v1 71

[0265] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB. In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, the exogenous polynucleotide encoding lgtE, the exogenous polynucleotide encoding lgtA, the exogenous polynucleotide encoding lgtB, the exogenous polynucleotide encoding lst are incorporated into the genome of the E. coli. In certain embodiments, the exogenous polynucleotide encoding lst is expressed from a vector. In certain embodiments, the expression of lst is constitutively under control of lambda phage promoter PL in the vector. In certain embodiments, the exogenous polynucleotide encoding kdsB is expressed from a vector.

[0266] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding lgtB, at least one exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, two exogenous polynucleotides each encoding lgtE, three exogenous polynucleotides each encoding lgtA, three exogenous polynucleotides each encoding lgtB, two exogenous polynucleotides each encoding lst, and / or an exogenous polynucleotide encoding kdsB.

[0267] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding NAI-5000113424v1 72lgtB, at least one exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, two exogenous polynucleotides each encoding lgtE, three exogenous polynucleotides each encoding lgtA, three exogenous polynucleotides each encoding lgtB, two exogenous polynucleotides each encoding lst, and an exogenous polynucleotide encoding kdsB.

[0268] In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, one of the at least one exogenous polynucleotide encoding lst, the at least one exogenous polynucleotide encoding lgtE, the at least one exogenous polynucleotide encoding lgtA, and the at least one exogenous polynucleotide encoding lgtB are incorporated into the genome of the E. coli. In certain embodiments, one of the at least one exogenous polynucleotide encoding lst is expressed from a vector. In certain embodiments, the expression of lst is constitutively under control of lambda phage promoter PL in the vector. In certain embodiments, the exogenous polynucleotide encoding kdsB is expressed from a vector.

[0269] In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, one of the two exogenous polynucleotides encoding lst, the two exogenous polynucleotides encoding lgtE, the three exogenous polynucleotides encoding lgtA, and the three exogenous polynucleotides encoding lgtB are incorporated into the genome of the E. coli. In certain embodiments, one of the two exogenous polynucleotides encoding lst is expressed from a vector. In certain embodiments, the expression of lst is constitutively under control of lambda phage promoter PL in the vector. In certain embodiments, the exogenous polynucleotide encoding kdsB is expressed from a vector.

[0270] In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB; genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes; genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, NAI-5000113424v1 73wbbJ, wbbL’, intS, and / or ’wbbL; and / or genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes. In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB; genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; and genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes.

[0271] In certain embodiments, the exogenous polynucleotides encoding lgtA, lgtB, lgtE, lpt3, lgtF, rfaK and / or lgtG are incorporated into the genome of the E. coli. In certain embodiments of the E. coli provided herein, waa genes (waaQ-U genes) has been replaced with exogenous polynucleotides encoding lgtA, lgtB, lgtE, lpt3, lgtF, rfaK and / or lgtG. In certain embodiments of the E. coli provided herein, waa genes (waaQ-U genes) has been replaced with exogenous polynucleotides encoding lgtA, lgtB, lgtE, lpt3, lgtF, rfaK and lgtG. In certain embodiments of the E. coli provided herein, waa genes (waaQ-U genes) has been replaced with exogenous polynucleotides encoding one copy of each of lgtA, lgtB, lgtE, lpt3, lgtF, rfaK and lgtG. Waa genes cluster include a set of genes involved in the synthesis, modification, and transport of LOS molecules. In certain embodiments, waa genes include waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes.

[0272] In certain embodiments, the exogenous polynucleotides encoding lst, lgtB, lgtA, and / or lgtE are incorporated into the genome of the E. coli. In certain embodiments of the E. coli provided herein, adjacent gene cluster for colanic acid and O antigen biosynthesis (wca-rfb genes) have been replaced with exogenous polynucleotides encoding lst, lgtB, lgtA, and / or lgtE. In certain embodiments of the E. coli provided herein, adjacent gene cluster for colanic acid and O antigen biosynthesis (wca-rfb genes) have been replaced with exogenous polynucleotides encoding lst, lgtB, lgtA, and lgtE. In certain embodiments of the E. coli provided herein, adjacent gene cluster for colanic acid and O antigen biosynthesis (wca-rfb genes) have been replaced with exogenous polynucleotides encoding one copy of each of lst, lgtB, lgtA, and lgtE. In certain embodiments, the constitutive promoter naturally driving the O antigen expression has been re-inserted to drive the NAI-5000113424v1 74expression of exogenous polynucleotides encoding lst, lgtB, lgtA, and / or lgtE. An exemplary sequence comprises the sequence of O antigen promoter is provided as SEQ ID NO: 56. In certain embodiments, the constitutive promoter naturally driving the O antigen expression has been re- inserted to drive the expression of exogenous polynucleotides encoding lst, lgtB, lgtA, and lgtE. Colanic acid biosynthesis gene cluster include a set of genes involved in the synthesis of colanic acid. In certain embodiments, colanic acid biosynthesis gene cluster include wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, and wcaM genes. O antigen biosynthesis gene cluster include a set of genes involved in the biosynthesis and assembly of the O antigen component of lipopolysaccharides (LPS) or other surface polysaccharides. In certain embodiments, O antigen biosynthesis gene cluster include rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of galF gene which is located in between of colanic acid cluster (wca) and O antigen cluster (rfb). The replaced genes clusters have been selected as they might create interference in the glycan biosynthesis and accumulate unwanted glycans on the OMV.

[0273] In certain embodiments, the exogenous polynucleotides encoding lgtB and / or lgtA are incorporated into the genome of the E. coli. In certain embodiments of the E. coli provided herein, gene cluster for ECA (enterobacterial common antigen) (wec genes) has been replaced with exogenous polynucleotides encoding lgtB and / or lgtA. In certain embodiments of the E. coli provided herein, gene cluster for ECA (wec genes) has been replaced with exogenous polynucleotides encoding lgtB and lgtA. In certain embodiments of the E. coli provided herein, gene cluster for ECA (wec genes) has been replaced with exogenous polynucleotides encoding one copy of lgtB and one copy of lgtA. In certain embodiments, the natural ECA constitutive promoter drives the expression of exogenous polynucleotides encoding lgtB and / or lgtA. In certain embodiments, the natural ECA constitutive promoter drives the expression of exogenous polynucleotides encoding lgtB and lgtA. An exemplary sequence comprises the sequence of the ECA promoter is provided as SEQ ID NO: 55. Enterobacterial Common Antigen (ECA) gene cluster include a set of genes involved in the biosynthesis and assembly of the enterobacterial common antigen. In certain embodiments, ECA gene cluster include wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes. The replaced genes clusters have been selected as they might create interference in the glycan biosynthesis and accumulate unwanted glycans on the OMV.

[0274] In certain embodiments, the Lpt3 is a Lpt3 from Neisseria meningitidis C311, which has a GenBank number QXZ29326. In certain embodiments, the Lpt3 comprises the amino acid NAI-5000113424v1 75sequence set forth in SEQ ID NO: 27. In certain embodiments, lpt3 gene is inserted at waaQ-U gene locus. In certain embodiments, lpt3 gene is inserted to replace waaQ-U genes.

[0275] In certain embodiments, the RfaK is a RfaK from Neisseria meningitidis MC58, which has a GenBank number AAF42053. In certain embodiments, the RfaK comprises the amino acid sequence set forth in SEQ ID NO: 28. In certain embodiments, rfaK gene is inserted at waaQ-U gene locus. In certain embodiments, rfaK gene is inserted to replace waaQ-U genes.

[0276] In certain embodiments, the LgtF is a LgtF from Neisseria meningitidis MC58, which has a GenBank number AAF42052. In certain embodiments, the LgtF comprises the amino acid sequence set forth in SEQ ID NO: 29. In certain embodiments, lgtF gene is inserted at waaQ-U gene locus. In certain embodiments, lgtF gene is inserted to replace waaQ-U genes.

[0277] In certain embodiments, the LgtG is a LgtG from Neisseria meningitidis M22790, which has a GenBank number AOA42063. In certain embodiments, the LgtG comprises the amino acid sequence set forth in SEQ ID NO: 30. In certain embodiments, lgtG gene is inserted at waaQ-U gene locus. In certain embodiments, lgtG gene is inserted to replace waaQ-U genes.

[0278] In certain embodiments, the LgtE is a LgtE from N. gonorrhoeae FA19, which has a GenBank number AKP11657. In certain embodiments, the LgtE comprises the amino acid sequence set forth in SEQ ID NO: 31. In certain embodiments, lgtE gene is inserted at waaQ-U gene locus. In certain embodiments, lgtE gene is inserted to replace waaQ-U genes.

[0279] In certain embodiments, the LgtE is a LgtE from N. gonorrhoeae 1291, which has a GenBank number GenBank AAF14363. In certain embodiments, the LgtE comprises the amino acid sequence set forth in SEQ ID NO: 32. In certain embodiments, lgtE gene is inserted at wca-rfb gene locus. In certain embodiments, lgtE gene is inserted to replace wca-rfb genes.

[0280] In certain embodiments, the LgtA is a LgtA from Neisseria meningitidis MC58, which has a GenBank number AAF42258. In certain embodiments, the LgtA comprises the amino acid sequence set forth in SEQ ID NO: 33. In certain embodiments, lgtA gene is inserted at waaQ-U gene locus. In certain embodiments, lgtA gene is inserted to replace waaQ-U genes.

[0281] In certain embodiments, the LgtA is a LgtA from N. gonorrhoeae 1291, which has a GenBank number AAF14359. In certain embodiments, the LgtA comprises the amino acid sequence set forth in SEQ ID NO: 34. In certain embodiments, lgtA gene is inserted at wca-rfb gene locus. In certain embodiments, lgtA gene is inserted to replace wca-rfb genes. In certain embodiments, lgtA gene is inserted at wec gene locus. In certain embodiments, lgtA gene is inserted to replace wec genes. NAI-5000113424v1 76

[0282] In certain embodiments, the LgtB is a LgtB from Neisseria meningitidis MC58, which has a GenBank number AAF42257. In certain embodiments, the LgtB comprises the amino acid sequence set forth in SEQ ID NO: 35. In certain embodiments, lgtB gene is inserted at waaQ-U gene locus. In certain embodiments, lgtB gene is inserted to replace waaQ-U genes.

[0283] In certain embodiments, the LgtB is a LgtB from (wca-rfb locus and wec locus) from N. gonorrhoeae 1291, which has a GenBank number AAF14360. In certain embodiments, the LgtB comprises the amino acid sequence set forth in SEQ ID NO: 36. In certain embodiments, lgtB gene is inserted at wca-rfb gene locus. In certain embodiments, lgtB gene is inserted to replace wca-rfb genes. In certain embodiments, lgtB gene is inserted at wec gene locus. In certain embodiments, lgtB gene is inserted to replace wec genes.

[0284] In certain embodiments, the Lst is a Lst (pLTPro159 and wca-rfb locus) from N. gonorrhoeae 1291, which has a GenBank number AAY41933. In certain embodiments, the Lst comprises the amino acid sequence set forth in SEQ ID NO: 37. In certain embodiments, lst gene is inserted at wca-rfb gene locus. In certain embodiments, lst gene is inserted to replace wca-rfb genes.

[0285] In certain embodiments, a polynucleotide encoding at least one enzyme for producing a glycan antigen can be cloned into an expression vector suitable for the expression system of choice. In certain embodiments, a polynucleotide encoding at least one enzyme for producing a glycan antigen is operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0286] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding KdsB. In certain embodiments, the E. coli comprises an expression vector comprising the exogenous polynucleotide encoding KdsB. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the backbone of the expression vector is pEXT20 (Dykxhoorn, et al.1996). In certain embodiments, the expression vector is plasmid pLTPro231 disclosed herein. In certain embodiments, the expression vector is plasmid pLTPro302 disclosed herein. In certain embodiments, the exogenous polynucleotide encoding KdsB is under the control of an IPTG- inducible promoter. In certain embodiments, the exogenous polynucleotide encoding KdsB is under the control of a J23105 promoter. In certain embodiments, the KdsB is a KdsB from Escherichia coli K12, which has a GenBank number WP_000011603. In certain embodiments, the KdsB comprises the amino acid sequence set forth in SEQ ID NO: 53. In certain embodiments, the KdsB comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 54. NAI-5000113424v1 77

[0287] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding Lst. In certain embodiments, the E. coli comprises an expression vector comprising the exogenous polynucleotide encoding Lst. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the original backbone of the expression vector is pBAD vector. In certain embodiments, the polynucleotide encoding Lst is under a lambda phage promoter PL. In certain embodiments, Lst is expressed constitutively under control of lambda phage promoter PL. In certain embodiments, the Lst is a Lst from N. gonorrhoeae 1291, which has a GenBank number AAY41933. In certain embodiments, the Lst comprises the amino acid sequence set forth in SEQ ID NO: 37.

[0288] In certain embodiments of the E. coli provided herein, the genomic manipulations are achieved homologous recombination techniques. Exemplary technology used for homologous recombination are described in Datsenko et al. Proc Natl Acad Sci U S A. (2000) 6;97(12):6640-5, the content of which is incorporated by reference in its entirety. 5.2.2 Genetic Modifications for Expressing Protein Antigens

[0289] In certain embodiments, the present disclosure further provides an engineered E. coli comprising at least one protein antigen (e.g., at least one protein antigen of Section 5.1.2), wherein the at least one protein antigen are antigens of a pathogen (e.g., N. gonorrhoeae). In certain embodiments, the E. coli comprises genetic modifications for expressing the at least one protein antigen. In certain embodiments, the E. coli comprises an expression system (e.g., vector or vectors, plasmid or plasmids) for expressing the at least one protein antigen. In certain embodiments, the protein antigen produced by the E. coli is located to and associated with the outer membrane of the E. coli, for example, through lipidated N-terminal cysteine. Under suitable conditions, the E. coli produces and releases OMVs, where part of the outer membrane of the E. coli becomes the outer membrane of the OMVs, and thus the protein antigen associated with the outer membrane of the E. coli is incorporated into the OMVs.

[0290] In certain embodiments, the E. coli produces OMVs as described herein (e.g., OMVs of Section 5.1). In certain embodiments, the E. coli produces OMVs as described in Section 5.1. In certain embodiments, the E. coli provided herein produces OMVs comprising at least one protein antigen (e.g., at least one protein antigen of Section 5.1.2).

[0291] In certain embodiments, the original E. coli strain is E. coli C600.

[0292] In certain embodiments, the E. coli provided herein comprises genetic modifications to express the at least one protein antigen (e.g., at least one protein antigen of Section 5.1.2). NAI-5000113424v1 78

[0293] In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide; an exogenous polynucleotide encoding an AniA polypeptide; and / or an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide. In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide; an exogenous polynucleotide encoding an AniA polypeptide; and an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide.

[0294] In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and a signal polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide and a signal polypeptide; an exogenous polynucleotide encoding an AniA polypeptide and a signal polypeptide; and / or an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a signal polypeptide. In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and a signal polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide and a signal polypeptide; an exogenous polynucleotide encoding an AniA polypeptide and a signal polypeptide; and an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a signal polypeptide.

[0295] In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide and a MetQ signal polypeptide; an exogenous polynucleotide encoding an AniA polypeptide and an AniA signal polypeptide; and / or an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide. In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide; an exogenous polynucleotide encoding a MetQ polypeptide and a MetQ signal polypeptide; an exogenous polynucleotide encoding an AniA polypeptide and an AniA signal polypeptide; and an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide.

[0296] In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3; an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid NAI-5000113424v1 79sequence of SEQ ID NO: 7 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6; an exogenous polynucleotide encoding an AniA polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3; and / or an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the E. coli provided herein comprises: an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3; an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6; an exogenous polynucleotide encoding an AniA polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3; and an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6. (a) Expression System and Vectors for Expressing AniA Antigens

[0297] In certain embodiments, the E. coli provided herein comprises genetic modifications for producing an AniA polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide comprising the amino acid sequence of SEQ ID NO: 4.

[0298] In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide and a signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide and an AniA signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide comprising the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding an AniA polypeptide comprising the amino acid sequence of SEQ ID NO: 2.

[0299] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the AniA polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic NAI-5000113424v1 80acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0300] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the AniA polypeptide and the AniA signal polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0301] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the AniA polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments of the E. coli provided herein, a polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments, the original backbone of the expression vector used herein is pEXT20 (Dykxhoorn, et al.1996). In certain embodiments, the expression vector is plasmid pLTPro231 disclosed herein. In certain embodiments, the expression vector is plasmid pLTPro302 disclosed herein. In certain embodiments, the polynucleotide encoding the AniA polypeptide and the AniA signal polypeptide is under an IPTG-inducible promoter. In certain embodiments, the polynucleotide encoding the AniA polypeptide and the AniA signal polypeptide is under a J23105 promoter. In certain embodiments, the nucleotide sequence encoding the AniA polypeptide and the AniA signal polypeptide comprises the nucleotide sequence as set forth in SEQ ID NO: 38. (b) Expression System and Vectors for Expressing MetQ Antigens

[0302] In certain embodiments, the E. coli provided herein comprises genetic modifications for producing a MetQ polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 57. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 58. NAI-5000113424v1 81

[0303] In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide and a signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide and a MetQ signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MetQ polypeptide comprising the amino acid sequence of SEQ ID NO: 5.

[0304] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MetQ polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0305] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0306] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MetQ polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments, the original backbone of the expression vector used herein is pEXT20 (Dykxhoorn, et al.1996). In certain embodiments, the expression vector is plasmid pLTPro231 disclosed herein. In certain embodiments, the expression vector is plasmid pLTPro302 disclosed herein. In certain embodiments, the polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide is under an IPTG-inducible promoter. In certain embodiments, the polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide is under a J23105 promoter. In certain embodiments, the nucleotide sequence encoding the MetQ polypeptide and the MetQ signal polypeptide comprises the nucleotide sequence as set forth in SEQ ID NO: 39. NAI-5000113424v1 82(c) Expression System and Vectors for Expressing MsrA / B-AniA fusion polypeptide

[0307] In certain embodiments, the E. coli provided herein comprises genetic modifications for producing a MsrA / B-AniA fusion polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 14.

[0308] In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and a signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide comprising the amino acid sequence of SEQ ID NO: 3. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 13.

[0309] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MsrA / B-AniA fusion polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0310] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0311] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the MsrA / B-AniA fusion polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments of the E. coli provided herein, a polynucleotide encoding MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments, the original backbone of the expression vector used herein is pEXT20 (Dykxhoorn, et al.1996). In certain embodiments, NAI-5000113424v1 83the expression vector is plasmid pLTPro231 disclosed herein. In certain embodiments, the expression vector is plasmid pLTPro302 disclosed herein. In certain embodiments, the polynucleotide encoding the MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide is under an IPTG-inducible promoter. In certain embodiments, the polynucleotide encoding the MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide is under a J23105 promoter. In certain embodiments, the nucleotide sequence encoding the MsrA / B-AniA fusion polypeptide and the AniA signal polypeptide comprises the nucleotide sequence as set forth in SEQ ID NO: 40. (d) Expression System and Vectors for Expressing NHBA-MetQ fusion polypeptide

[0312] In certain embodiments, the E. coli provided herein comprises genetic modifications for producing a NHBA-MetQ fusion polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 21.

[0313] In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide comprising the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 20. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 60. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 61. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 62. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 63. In certain embodiments, the E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 64. In certain embodiments, the NAI-5000113424v1 84E. coli provided herein comprises an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide comprising the amino acid sequence of SEQ ID NO: 65.

[0314] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the NHBA-MetQ fusion polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0315] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide can be cloned into an expression vector suitable for the expression system of choice, operably linked to regulatory sequences that facilitate expression of the heterologous nucleic acid molecule. In general, expression vectors can include transcriptional promoters and optionally enhancers to which the polynucleotide is operably linked, translational signals, and transcriptional and translational termination signals.

[0316] In certain embodiments of the E. coli provided herein, a polynucleotide encoding the NHBA-MetQ fusion polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments of the E. coli provided herein, a polynucleotide encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide is cloned into an expression vector, wherein the expression vector is a plasmid. In certain embodiments, the original backbone of the expression vector used herein is pEXT20 (Dykxhoorn, et al.1996). In certain embodiments, the expression vector is plasmid pLTPro231 disclosed herein. In certain embodiments, the expression vector is plasmid pLTPro302 disclosed herein. In certain embodiments, the polynucleotide encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide is under an IPTG-inducible promoter. In certain embodiments, the polynucleotide encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide is under a J23105 promoter. In certain embodiments, the nucleotide sequence encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide comprises the nucleotide sequence as set forth in SEQ ID NO: 41. 5.2.3 Genetic Modifications for Producing Modified Lipid A

[0317] In certain embodiments, the present disclosure further provides an engineered E. coli comprising a modified lipid A (e.g., a modified lipid A of Section 5.1.3). In certain embodiments, the E. coli comprises genetic modifications for generating the modified lipid A. In certain embodiments, the E. coli comprises an expression system (e.g., vector or vectors) for expressing at least one enzymes for generating the modified lipid A. In certain embodiments, the E. coli provided NAI-5000113424v1 85herein produces OMVs as described in Section 5.1. In certain embodiments, the E. coli provided herein produces OMVs comprising a modified lipid A (e.g., a modified lipid A of Section 5.1.3).

[0318] In certain embodiments, the original E. coli strain is E. coli C600.

[0319] In certain embodiments, the E. coli provided herein comprises genetic modifications to produce a modified lipid A (e.g., a modified lipid A of Section 5.1.3).

[0320] In certain embodiments, the genetic modifications to produce a modified lipid A comprises one or more, or all of the following: (i) lipid A 1-diphosphate synthase lpxT (GenBank NZ_CP031214 position 1,653,666 - 1,652,952) which was replaced by the lipid A 1-phosphatse lpxE from Francisella tularensis subsp novicida U112 (GenBank CP009633.1 position 1715820 - 1715101) preceded by the constitutive lambda PL promoter; (ii) the promoter of the lipid A palmitoyltransferase pagP (GenBank NZ_CP031214 position 3,264,939 - 3,264,378) which was replaced by the constitutive lambda PL promoter; (iii) the gene coding for the phosphoethanolamine transferase EptA (eptA, GenBank NZ_CP031214 position 1,982,323 - 1,983,295) which was replaced by the gene for lipid A 3-O- desacylase PagL from Salmonella enterica (pagL, GenBank CP123648.1, position 1710552 – 1711114) preceded by the lambda PL constitutive promoter (REF).

[0321] In certain embodiments, the engineered E. coli comprises: an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and / or an exogenous polynucleotide encoding lpxE. In certain embodiments, the engineered E. coli comprises: an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and an exogenous polynucleotide encoding lpxE. In certain embodiments, the exogenous polynucleotide encoding msbB, the exogenous polynucleotide encoding pagL, and the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli. In certain embodiments, the engineered E. coli comprises: an exogenous polynucleotide encoding pagL and / or an exogenous polynucleotide encoding lpxE. In certain embodiments, the engineered E. coli comprises an exogenous polynucleotide encoding pagL and an exogenous polynucleotide encoding lpxE. In certain embodiments, the exogenous polynucleotide encoding pagL and the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli.

[0322] In certain embodiments, the engineered E. coli comprises genetic disruption of msbB, eptA, and / or lpxT genes. In certain embodiments, the engineered E. coli comprises genetic disruption of msbB, eptA, and lpxT genes. In certain embodiments, the engineered E. coli comprises NAI-5000113424v1 86genetic disruption of eptA and / or lpxT genes. In certain embodiments, the engineered E. coli comprises genetic disruption of eptA and lpxT genes.

[0323] In certain embodiments, the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0324] In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and / or an exogenous polynucleotide encoding lpxE; genetic disruption of msbB, eptA, and / or lpxT genes; and the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0325] In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and an exogenous polynucleotide encoding lpxE; genetic disruption of msbB, eptA, and lpxT genes; and the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0326] In certain embodiments, the msbB gene is genetically disrupted (e.g., removed) as the initial step, and the msbB gene is re-inserted in more advanced engineered E. coli strains. In certain embodiments, the initial genetic disruption of msbB renders the lipid A inactive in binding TLR4. In certain embodiments, msbB is re-inserted in a more advanced E. coli strain, wherein the integrated msbB is identical to the one originally removed. In certain embodiments, the MsbB is a MsbB from E. coli C600, which has a GenBank number WP_000448381. In certain embodiments, the MsbB comprises the amino acid sequence set forth in SEQ ID NO: 22.

[0327] In certain embodiments, the genetic disruption and then reinsertion of the msbB gene is functionally equivalent to making no genetic modification of the msbB gene. Thus, in certain embodiments, no genetic disruption of the msbB gene or insertion of an exogenous polynucleotide encoding msbB is made in the E. coli.

[0328] In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding pagL and / or an exogenous polynucleotide encoding lpxE; genetic disruption of eptA and / or lpxT genes; and the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding pagL and an exogenous polynucleotide encoding lpxE; genetic disruption of eptA and lpxT genes; and the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

[0329] In certain embodiments, the pagL gene is inserted to replace the eptA gene in the engineered E. coli strains. In certain embodiments, pagL is necessary for the removal of the C12- OH acyl chain from position 3 of the lipid A. In certain embodiments, the pagL gene is inserted under constitutive promoter control. In certain embodiments, the eptA gene is removed to prevent NAI-5000113424v1 87its activity in transferring a phopsohoethanolamine on the position 1 of the lipid A. In certain embodiments, the PagL is a PagL from Salmonella enterica ssp. enterica serovar Typhimurium 14028S, which has a GenBank number WP_000281877. In certain embodiments, the MsbB comprises the amino acid sequence set forth in SEQ ID NO: 23.

[0330] In certain embodiments, the lpxE gene is inserted to replace the lpxT gene in the engineered E. coli strains. In certain embodiments, lpxE is necessary for the removal of the phosphate in position 1 of the lipid A. In certain embodiments, the lpxE gene is inserted under constitutive promoter control. In certain embodiments, the lpxT gene is removed to prevent its activity in adding a further unwanted phosphate group. In certain embodiments, the LpxE is a LpxE from Francisella tularensis ssp. Novicida U112, which has a GenBank number AAU11503. In certain embodiments, the LpxE comprises the amino acid sequence set forth in SEQ ID NO: 24.

[0331] In certain embodiments, the weak and regulated promoter of pagL gene is replaced by the lambda PL promoter. In certain embodiments, the constitutive pagL activity is necessary to add a C16 acyl chain to the C3 of the C14-OH acyl chain in position 2 of the lipid A. An exemplary PagP promoter sequence before substitution with lambda PL promoter is provided below:

[0332] PagP promoter before substitution with lambda PL promoter (start of PagP ORF underlined): cgcatcatctttaatcgatgcgcggaaatatttaacttgaacaagcggaaataaatagagca gctattcagattattctttatgttgggtctattaaggttatgttaattgtagctttgctatg ctagtagtagatttttgataaatgttttatggtcacaaatgaacgtg (SEQ ID NO: 25)

[0333] An exemplary PagP promoter sequence after substitution with lambda PL promoter is provided below:

[0334] After substitution with lambda PL promoter (PL promoter bolded, FRT site double underlined, start of PagP ORF underlined): cgcatcatctttaatcgatgcgatcgcccgcgaagttcctattccgaagttcctattctatc agaagtataggaacttccggccggccttctttgattatctctggcggtgttgacataaatac cactggcggtgatactgagcacatcagcaggacgcactgaccgtaattatatttataaggag gtaattctcgagatgaacgtg (SEQ ID NO: 26)

[0335] In certain embodiments of the E. coli provided herein, the genomic manipulations are achieved homologous recombination techniques. Exemplary technology used for homologous recombination are described in Datsenko et al.2000. Proc Natl Acad Sci U S A. (2000) 6;97(12):6640-5, the content of which is incorporated by reference in its entirety. NAI-5000113424v1 885.2.4 Additional Genetic Modifications

[0336] In certain embodiments, the E. coli provided herein comprises genetic modifications to increase vesiculation.

[0337] In certain embodiments, the E. coli comprises: genetic disruption of ompA gene; genetic disruption of lpp gene; and / or an exogenous a polynucleotide encoding lpp. In certain embodiments, the E. coli comprises: genetic disruption of ompA gene; genetic disruption of lpp gene; and an exogenous polynucleotide encoding lpp. In certain embodiments, the lpp gene has GenBank NZ_CP031214 position 2,164,860 to 2,165,096.

[0338] In certain embodiments, the E. coli further comprises genetic disruption of ompA gene. OmpA is an integral outer membrane porin, which possesses a periplasmic domain which is covalently bound to the peptidoglycan, therefore stabilizing the outer membrane. In certain embodiments, ompA gene genetic disruption results in increased instability of the outer membrane, which therefore is released in form of OMVs. Exemplary approach has been employed in OMV vaccine described in Shigella GMMA. In certain embodiments, the ompA gene has GenBank NZ_CP031214 position 2,901,443 to 2,902,483.

[0339] In certain embodiments, the E. coli further comprises lpp gene genetic disruption and lpp gene re-insertion under arabinose-inducible promoter in the attλ locus of E. coli. Lpp is a heavily expressed small lipoprotein whose function is primarily to link the peptidoglycan to the outer membrane, to stabilize the latter. In certain embodiments, lpp gene genetic disruption results in de- stabilization of the outer membrane which is released as OMVs. In certain embodiments, lpp gene re-insertion is used as a form of arabinose-inducible OMV repression and / or OMV induction by arabinose depletion. The lpp re-insertion method used was described by Haldimann and Wanner, 2001, J Bacteriol.2001 Nov;183(21):6384-93, the content of which is incorporated herein by reference in its entirety. In certain embodiments, the lpp expression is driven by a pBAD promoter. In certain embodiments, the E. coli further comprises an exogenous polynucleotide encoding lpp.

[0340] In certain embodiments, the genome of the E. coli comprises the nucleotide sequence set forth in SEQ ID NO: 42 as shown below, where attλ sites (duplicated upon insertion) are indicated by bold letters, polynucleotide encoding lpp is indicated by underlined letters; pBAD promoter is indicated by double underlined letters, FRT site is indicated by italic bold letters. cagcaccgccgaaaggcgaaactcatcgctacatttttaccgttcacgcgctggatatagaac gtattgatgtcgatgaaggtgccagcggcgcgatggtcgggtttaacgttcatttccactctc tggcaagcgcctcgattactgcgatgtttagttaatcactctgccagatggcgcaatgccatc tggtatcacttaaaggtattaaaaacaactttttgtctttttaccttcccgtttcgctcaagt tagtataaaaaagctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagatt NAI-5000113424v1 89ttgcataaaaaacagactacataatactgtaaaacacaacatatatgcagtcactatgaatca actacttagatggtattagtgacctgtaacagagcattagcgcaaggtgatttttgtcttctt gcgctaattttttgtcatcaaacctgtcgcactccagagaagcacaaagcctcgcaatccagt gcaaagctagcttcttcgtctgtttctactggtattggcacaaacctgattccaatttgagca aggctatgtgccatctcgatactcgttcttaactcaacagaagatgctttgtgcatacagccc ctcgtttattatttatctcctcagccagccgctgtgctttcagtggatttcggataacagaaa ggccgggaaatacccagcctcgctttgtaacggagtagagacgaaagtgattgcgcctacccg gatattatcgtgaggatgcgtcatcgccattaattcactgatcagtgataagctgtcaaacat gagaattcgagctcggtacccgggttacttgcggtatttagtagccatgttgtccagacgctg gttagcacgagctgcgtcatctttagcagcctgaacgtcggaacgcattgcgttcacgtcgtt gctcagctggtcaactttagcgttcagagtctgaacgtcagaagacagctgatcgattttagc gttgctggagcaacctgccagcagagtagaacccaggattaccgcgcccagtaccagtttagt agctttcatatgaattcctccatccaaaaaaacgggtatggagaaacagtagagagttgcgat aaaaagcgtcaggtaggatccgctaatcttatggataaaaatgctatggcatagcaaagtgtg acgccgtgcaaataatcaatgtggacttttctgccgtgattatagacacttttgctacgcgtt tttgtcatggccttggtcccgctttgttacagaatgcttttaataagcggggttaccggtttg gttagcgagaagagccagtaaaagacgcagtgacggcaatgtctgatgcaatatggacaattg gtttcttctctgaatggcggctgcaggcatgcaagcttggcactggccacgcaaaaaggccat ccgtcaggatggccttctgcttaatttgatgcctggcagtttatggcgggcgtcctgcccgcc accctccgggccgttgcttcgcaacgttcaaatccgctcccggcggatttgtcctactcagga gagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgtt ttatttgatgcctggcagttccctactctcgcatggggagaccccacactaccatcgggggcc atcgatgcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaa atacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatctagt ggatcaagagacaggatgaggatcgtttcgcacatatgaatatcctccttagttcctattccg aagttcctattctctagaaagtataggaacttcgaagcagctccagcctacaccgggactctg gggttcgataccgtcaaaacttcatttttaatttttgcggccgcaagatccggccacgatgcg tccggcgtagaggatctgaagatcagcagttcaacctgttgatagtacgtactaagctctcat gtttcacgtactaagctctcatgtttaacgtactaagctctcatgtttaacgaactaaaccct catggctaacgtactaagctctcatggctaacgtactaagctctcatgtttcacgtactaagc tctcatgtttgaacaataaaattaatataaatcagcaacttaaatagcctctaaggttttaag ttttataagaaaaaaaagaatatataaggcttttaaagcttttaaggtttaacggttgtggac aacaagccagggatgtaacgcactgagaagcccttagagcctctcaaagcaattttgagtgac acaggaacacttaacggctgacatgggaattagccatggcatcacagtatcgtgatgacagag gcagggagtgggacaaaattgaaatcaaataatgattttattttgactgatagtgacctgttc gttgcaacaaattgataagcaatgcttttttataatgccaacttagtataaaaaagcaggctt caacggattcatttttctatttcatagcccggagcaacctgtgaacacattttcagtttcccg tctggcgctggcattggcttttggcgtgacgctgaccgcctgtagctcaaccccgcccgatca acgtccttctgatcaaaccgcgcctggtacctcttctcgcccgatt (SEQ ID NO: 42)

[0341] In certain embodiment, the Lpp comprises the amino acid sequence set forth in SEQ ID NO: 43.

[0342] In certain embodiments, the E. coli provided herein comprises genetic disruption of fliC gene (GenBank NZ_CP031214, position 1,786,050 - 1,808,792). FliC gene encodes for flagellin, the structural protein of E. coli’s flagellum. In certain embodiments, the fliC gene genetic disruption is carried out to avoid any potential unwanted reactogenicity. NAI-5000113424v1 90

[0343] In certain embodiments, the E. coli provided herein comprises genetic disruption of fim gene cluster. Fim gene cluster is responsible for fimbriae biosynthesis. In certain embodiments, the fim gene cluster comprises fimHGFDCIA genes, GenBank NZ_CP031214, position 3,975,452 – 9,983,143. In certain embodiments, the fim gene cluster genetic disruption is carried out to avoid any potential unwanted reactogenicity.

[0344] In certain embodiments of the E. coli provided herein, the genomic manipulations are achieved homologous recombination techniques. Exemplary technology used for homologous recombination are described in Datsenko et al.2000. Proc Natl Acad Sci U S A. (2000) 6;97(12):6640-5, the content of which is incorporated by reference in its entirety. 5.2.5 Vectors and Expression Systems

[0345] Some examples of vectors suitable for the disclosure may be a plasmid. Useful plasmids may include, but are not limited to, any plasmids described herein and capable of carrying and encoding the polypeptide as described herein. Some examples of viral vectors suitable for the disclosure include retrovirus -based vectors, e.g., lentiviruses, adenoviruses, adeno- associated viruses (AAV), and vaccinia vectors. In certain embodiments, the structure of the vector may be modified as necessary for optimization of expression or to achieve a desired cellular level, of the polypeptide as described herein, such as including expression controlling elements (e.g., promoter or enhancer sequences).

[0346] Polynucleotides useful in the present disclosure can be provided in an expression system. Expression systems of the disclosure generally include regulatory elements that are functional in the intended host cell (e.g., E. coli) in which the expression system is to be expressed. Regulatory elements used for expression of nuclear genes include promoters, transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements.

[0347] An expression system of the disclosure can comprise a promoter sequence operably linked to a polynucleotide sequence encoding a polypeptide of the disclosure. As used herein, the term “operably linked” refers to a juxtaposition of the components described wherein the components are in a relationship that permits them to function in their intended manner. In general, operably linked components are in contiguous relation. Promoters can be incorporated into a polynucleotide using standard techniques known in the art. Multiple copies of promoters or multiple promoters can be used in an expression construct of the disclosure. In some embodiment, a promoter can be positioned about the same distance from the transcription start site in the expression construct as it is from the transcription start site in its natural genetic environment. Some NAI-5000113424v1 91variation in this distance is permitted without substantial decrease in promoter activity. A transcription start site is typically included in the expression construct.

[0348] Nuclear expression constructs of the disclosure may optionally contain a transcription termination sequence, a translation termination sequence, a sequence encoding a signal peptide, and / or enhancer elements. Transcription termination regions can typically be obtained from the 3 ’ untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination. A signal peptide sequence is a short amino acid sequence typically present at the amino terminus of a protein that is responsible for the relocation of an operably linked mature polypeptide to a wide range of post-translational cellular destinations, ranging from a specific organelle compartment to sites of protein action and the extracellular environment. Targeting gene products to an intended cellular and / or extracellular destination through the use of an operably linked signal peptide sequence is contemplated for use with the polypeptides of the disclosure. Classical enhancers are cis-acting elements that increase gene transcription and can also be included in the expression construct. Classical enhancer elements are known in the art, and include, but are not limited to, the cytomegalovirus (CMV) early promoter enhancer element, and the SV40 enhancer element. Intron- mediated enhancer elements that enhance gene expression are also known in the art. These elements must be present within the transcribed region and are orientation dependent.

[0349] Polynucleotides of the present disclosure can be composed of either RNA or DNA, or hybrids thereof. The present disclosure also encompasses those polynucleotides that are complementary in sequence to the polynucleotides disclosed herein. Polynucleotides and polypeptides of the disclosure can be provided in purified or isolated form.

[0350] In certain embodiments, such a promoter useful in accordance with the present disclosure may include any promoter sequences set forth herein, or other promoter sequences known and / or available in the art. In certain embodiments, primers useful for construction of a plasmid or vector as described herein may include any primer described herein. One of skill in the art will understand that other primers, plasmids, or vectors may be used without deviation from the scope of the present disclosure. 5.2.6 Exemplary Engineered Escherichia Coli for Producing OMVs

[0351] In certain embodiments, a E. coli provided herein for producing an OMV (e.g., an OMV of Section 5.1) comprises (i) one or more genetic modifications for producing at least one glycan antigen (e.g., one or more genetic modifications of Section 5.2.1); (ii) one or more genetic modifications for producing at least one protein antigen (e.g., one or more genetic modifications of NAI-5000113424v1 92Section 5.2.2); (iii) one or more genetic modifications for producing modified lipid A (e.g., one or more genetic modifications of Section 5.2.3); and / or (iv) one or more additional genetic modifications (e.g., one or more genetic modifications of Section 5.2.4).

[0352] In certain embodiments, the E. coli comprises one or more genetic modifications to produce at least one glycan antigen (e.g., genetic modifications of Section 5.2.1). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes. In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, the exogenous polynucleotide encoding lgtE, the exogenous polynucleotide encoding lgtA, the exogenous polynucleotide encoding lgtB, and / or the exogenous polynucleotide encoding lst are incorporated into the genome of the E. coli. In certain embodiments, the exogenous polynucleotide encoding KdsB is expressed from a vector. In certain embodiments, the exogenous polynucleotide encoding Lst is expressed from a vector.

[0353] In certain embodiments, the E. coli comprises one or more genetic modifications to produce at least one glycan antigen (e.g., genetic modifications of Section 5.2.1). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding lgtB, at least one exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, two exogenous polynucleotides each encoding lgtE, three NAI-5000113424v1 93exogenous polynucleotides each encoding lgtA, three exogenous polynucleotides each encoding lgtB, two exogenous polynucleotides each encoding lst, and / or an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes. In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, one of the two exogenous polynucleotides encoding lst, the two exogenous polynucleotides encoding lgtE, the three exogenous polynucleotides encoding lgtA, and / or the three exogenous polynucleotides encoding lgtB are incorporated into the genome of the E. coli. In certain embodiments, one of the two exogenous polynucleotides encoding lst is expressed from a vector. In certain embodiments, the expression of lst is constitutively under control of lambda phage promoter PL in the vector. In certain embodiments, the exogenous polynucleotide encoding KdsB is expressed from a vector.

[0354] In certain embodiments, the E. coli comprises one or more genetic modifications to produce at least one glycan antigen (e.g., genetic modifications of Section 5.2.1). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes. In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, the exogenous polynucleotide encoding lgtE, the exogenous polynucleotide encoding lgtA, the NAI-5000113424v1 94exogenous polynucleotide encoding lgtB, and the exogenous polynucleotide encoding lst are incorporated into the genome of the E. coli. In certain embodiments, the exogenous polynucleotide encoding kdsB is expressed from a vector. In certain embodiments, the exogenous polynucleotide encoding Lst is expressed from a vector.

[0355] In certain embodiments, the E. coli comprises one or more genetic modifications to produce at least one glycan antigen (e.g., genetic modifications of Section 5.2.1). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, at least one exogenous polynucleotide encoding lgtE, at least one exogenous polynucleotide encoding lgtA, at least one exogenous polynucleotide encoding lgtB, at least one exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, two exogenous polynucleotides each encoding lgtE, three exogenous polynucleotides each encoding lgtA, three exogenous polynucleotides each encoding lgtB, two exogenous polynucleotides each encoding lst, and an exogenous polynucleotide encoding kdsB. In certain embodiments, the E. coli comprises genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes. In certain embodiments, the E. coli comprises genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes. In certain embodiments, the E. coli comprises genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes. In certain embodiments, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, one of the two exogenous polynucleotides encoding lst, the two exogenous polynucleotides encoding lgtE, the three exogenous polynucleotides encoding lgtA, and the three exogenous polynucleotides encoding lgtB are incorporated into the genome of the E. coli. In certain embodiments, one of the two exogenous polynucleotides encoding lst is expressed from a vector. In certain embodiments, the expression of lst is constitutively under control of lambda phage promoter PL in the vector. In certain embodiments, the exogenous polynucleotide encoding KdsB is expressed from a vector.

[0356] In certain embodiments, the E. coli comprises one or more genetic modifications to express at least one protein antigen (e.g., genetic modifications of Section 5.2.2). In certain NAI-5000113424v1 95embodiments, the E. coli comprises: an exogenous polynucleotide encoding the MsrA / B polypeptide; an exogenous polynucleotide encoding the MetQ polypeptide; an exogenous polynucleotide encoding the AniA polypeptide; and / or an exogenous polynucleotide encoding the NHBA polypeptide. In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide; an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide; an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide; and / or an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide. In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and / or an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, the exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, the exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, and / or the exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide are expressed from a vector.

[0357] In certain embodiments, the E. coli comprises one or more genetic modifications to express at least one protein antigen (e.g., genetic modifications of Section 5.2.2). In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding the MsrA / B polypeptide; an exogenous polynucleotide encoding the MetQ polypeptide; an exogenous polynucleotide encoding the AniA polypeptide; and an exogenous polynucleotide encoding the NHBA polypeptide. In certain embodiments, the E. coli comprises: an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide; an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide; an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide; and an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide. In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding the MsrA / B- NAI-5000113424v1 96AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and an exogenous polynucleotide encoding the NHBA- MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, the exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, the exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, and the exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide are expressed from a vector.

[0358] In certain embodiments, the E. coli comprises one or more genetic modifications to genetic modifications for producing modified lipid A (e.g., genetic modifications of Section 5.2.3). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and / or an exogenous polynucleotide encoding lpxE. In certain embodiments, the E. coli comprises genetic disruption of msbB, eptA, and / or lpxT genes. In certain embodiments of the E. coli, the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter. In certain embodiments, the exogenous polynucleotide encoding msbB, the exogenous polynucleotide encoding pagL, and / or the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli.

[0359] In certain embodiments, the E. coli comprises one or more genetic modifications to genetic modifications for producing modified lipid A (e.g., genetic modifications of Section 5.2.3). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding pagL and / or an exogenous polynucleotide encoding lpxE. In certain embodiments, the E. coli comprises genetic disruption of eptA and / or lpxT genes. In certain embodiments of the E. coli, the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter. In certain embodiments, the exogenous polynucleotide encoding pagL and / or the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli.

[0360] In certain embodiments, the E. coli comprises one or more genetic modifications to genetic modifications for producing modified lipid A (e.g., genetic modifications of Section 5.2.3). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding msbB, an NAI-5000113424v1 97exogenous polynucleotide encoding pagL, and an exogenous polynucleotide encoding lpxE. In certain embodiments, the E. coli comprises genetic disruption of msbB, eptA, and lpxT genes. In certain embodiments of the E. coli, the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter. In certain embodiments, the exogenous polynucleotide encoding msbB, the exogenous polynucleotide encoding pagL, and the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli.

[0361] In certain embodiments, the E. coli comprises one or more genetic modifications to genetic modifications for producing modified lipid A (e.g., genetic modifications of Section 5.2.3). In certain embodiments, the E. coli comprises an exogenous polynucleotide encoding pagL and an exogenous polynucleotide encoding lpxE. In certain embodiments, the E. coli comprises genetic disruption of eptA and lpxT genes. In certain embodiments of the E. coli, the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter. In certain embodiments, the exogenous polynucleotide encoding pagL and the exogenous polynucleotide encoding lpxE are incorporated into the genome of the E. coli.

[0362] In certain embodiments, the E. coli comprises one or more genetic modifications to increase vesiculation. In certain embodiments, the E. coli further comprises genetic disruption of ompA gene, genetic disruption of lpp gene; and / or an exogenous polynucleotide encoding lpp. In certain embodiments, the E. coli further comprises genetic disruption of ompA gene, genetic disruption of lpp gene; and an exogenous polynucleotide encoding lpp. In certain embodiments, the exogenous polynucleotide encoding lpp is incorporated into the genome of the E. coli. In certain embodiments, the expression of lpp is driven by a pBAD promoter.

[0363] In certain embodiments, the E. coli further comprises genetic disruption of fliC gene.

[0364] In certain embodiments, the E. coli further comprises genetic disruption of fim gene cluster. In certain embodiments, the fim gene cluster comprises fimHGFDCIA genes.

[0365] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; NAI-5000113424v1 98(3) an exogenous polynucleotide encoding an AniA polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding msbB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 22, an exogenous polynucleotide encoding pagL having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 23, and / or an exogenous polynucleotide encoding lpxE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of msbB, eptA, and / or lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 33, an exogenous polynucleotide encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 35, an exogenous polynucleotide encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 37, and / or an exogenous polynucleotide encoding kdsB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes ; NAI-5000113424v1 99(10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes ; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and / or (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0366] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding msbB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 22, an exogenous polynucleotide encoding pagL having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 23, and an exogenous polynucleotide encoding lpxE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of msbB, eptA, and lpxT genes; NAI-5000113424v1 100(7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 33, an exogenous polynucleotide encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 35, an exogenous polynucleotide encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0367] In certain embodiments, the E. coli provided herein comprises: NAI-5000113424v1 101(1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having at least about at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding pagL having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 23 and an exogenous polynucleotide encoding lpxE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of eptA and lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 33, two exogenous polynucleotides each encoding lgtA having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 35, two exogenous polynucleotides each encoding lgtB having at least about 90% sequence identity to the amino acid sequence of SEQ NAI-5000113424v1 102ID NO: 36, two exogenous polynucleotides each encoding lst having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0368] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding msbB having the amino acid sequence of SEQ ID NO: 22, an exogenous polynucleotide encoding pagL having the amino acid sequence of SEQ ID NO: 23, and / or an exogenous polynucleotide encoding lpxE having the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of msbB, eptA, and / or lpxT genes; NAI-5000113424v1 103(7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 33, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 35, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having the amino acid sequence of SEQ ID NO: 37, and / or an exogenous polynucleotide encoding kdsB having the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and / or (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0369] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; NAI-5000113424v1 104(3) an exogenous polynucleotide encoding an AniA polypeptide having the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding msbB having the amino acid sequence of SEQ ID NO: 22, an exogenous polynucleotide encoding pagL having the amino acid sequence of SEQ ID NO: 23, and an exogenous polynucleotide encoding lpxE having the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of msbB, eptA, and lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 33, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 35, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes ; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having the amino acid sequence of SEQ ID NO: 43; NAI-5000113424v1 105(15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0370] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding msbB having the amino acid sequence of SEQ ID NO: 22, an exogenous polynucleotide encoding pagL having the amino acid sequence of SEQ ID NO: 23, and an exogenous polynucleotide encoding lpxE having the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of msbB, eptA, and lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 33, two exogenous polynucleotides each encoding one copy of lgtA having the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 35, two exogenous polynucleotides each encoding one copy of lgtB having the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having the amino acid sequence of SEQ ID NO: 53; NAI-5000113424v1 106(9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes ; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0371] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (5) an exogenous polynucleotide encoding pagL having the amino acid sequence of SEQ ID NO: 23, and an exogenous polynucleotide encoding lpxE having the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of eptA and lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having the amino acid sequence of SEQ ID NO: 30, an NAI-5000113424v1 107exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 33, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 35, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 36, an exogenous polynucleotide encoding lst having the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes ; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0372] In certain embodiments, the E. coli provided herein comprises: (1) an exogenous polynucleotide encoding a MsrA / B-AniA fusion polypeptide having the amino acid sequence of SEQ ID NO: 14 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (2) an exogenous polynucleotide encoding a MetQ polypeptide having the amino acid sequence of SEQ ID NO: 7 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; (3) an exogenous polynucleotide encoding an AniA polypeptide having the amino acid sequence of SEQ ID NO: 4 and an AniA signal polypeptide having the amino acid sequence of SEQ ID NO: 3; (4) an exogenous polynucleotide encoding a NHBA-MetQ fusion polypeptide having the amino acid sequence of SEQ ID NO: 21 and a MetQ signal polypeptide having the amino acid sequence of SEQ ID NO: 6; NAI-5000113424v1 108(5) an exogenous polynucleotide encoding pagL having the amino acid sequence of SEQ ID NO: 23 and an exogenous polynucleotide encoding lpxE having the amino acid sequence of SEQ ID NO: 24; (6) genetic disruption of eptA and lpxT genes; (7) the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; (8) an exogenous polynucleotide encoding lpt3 having the amino acid sequence of SEQ ID NO: 27, an exogenous polynucleotide encoding rfaK having the amino acid sequence of SEQ ID NO: 28, an exogenous polynucleotide encoding lgtF having the amino acid sequence of SEQ ID NO: 29, an exogenous polynucleotide encoding lgtG having the amino acid sequence of SEQ ID NO: 30, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 31, an exogenous polynucleotide encoding lgtE having the amino acid sequence of SEQ ID NO: 32, an exogenous polynucleotide encoding lgtA having the amino acid sequence of SEQ ID NO: 33, two exogenous polynucleotides each encoding lgtA having the amino acid sequence of SEQ ID NO: 34, an exogenous polynucleotide encoding lgtB having the amino acid sequence of SEQ ID NO: 35, two exogenous polynucleotides each encoding lgtB having the amino acid sequence of SEQ ID NO: 36, two exogenous polynucleotide each encoding lst having the amino acid sequence of SEQ ID NO: 37, and an exogenous polynucleotide encoding kdsB having the amino acid sequence of SEQ ID NO: 53; (9) genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; (10) genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL genes; (11) genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes ; (12) genetic disruption of ompA gene; (13) genetic disruption of lpp gene; (14) an exogenous polynucleotide encoding lpp having the amino acid sequence of SEQ ID NO: 43; (15) genetic disruption of fliC gene; and (16) genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

[0373] An exemplary scheme of the E. coli engineering is provided herein in Table 1 below: Table 1: Genetic Modifications of Engineered E. coli NAI-5000113424v1 109Genetic Modifications Description and Functions Engineered E. coli strain: StLTPro353 Original starting strain: E. coli C600 ΔmsbB::msbB lipid A engineering ΔompA vesiculation Δlpp vesiculation attλ:PBAD_lpp vesiculation ΔwaaQ-U: glycan antigen engineering :lgtA_lgtB_lgtE_lpt3_lgtF_rfaK_lgtG E. coli LOS gene cluster has been replaced with one copy of the indicated genes. Δwca-rfb::PO16-lst_IgtB_lgtA_lgtE glycan antigen engineering E. coli adjacent gene cluster for colanic acid and O antigen biosynthesis have been replaced with the indicated genes. The constitutive promoter naturally driving the O antigen expression has been re-inserted to drive the expression of these genes. Multiple dosage has been identified as necessary for the optimal glycan conversion. The replaced genes clusters have been selected as they might create interference in the glycan biosynthesis and accumulate unwanted glycans on the OMV Δwec::lgtB_lgtA glycan antigen engineering E. coli gene cluster for ECA (enterobacterial common antigen) has been replaced with a further copy of the indicated genes. The natural ECA constitutive promoter drives the expression of the genes. Multiple dosage has been identified as necessary for the optimal glycan conversion. The replaced genes clusters have been selected as they might create interference in the glycan biosynthesis and accumulate unwanted glycans on the OMV. ΔfliC further modifications Δ fim gene cluster (fimHGFDCIA) further modifications ΔeptA::pagL lipid A engineering ΔlpxT::lpxE lipid A engineering ΔPpagP::PL lipid A engineering Plasmid pLTPro159 Vector encoding Lst (pRESTmp_PL_lst) Backbone origin: pBAD backbone (pBBR ori, medium copy number). Trimethoprim resistance. Lambda phage promoter PL drives the expression of Lst. Optimal KDO conversion requires plasmid-borne lst expression Plasmid pLTPro231 or pLTPro302 Vector encoding the encoding the four protein antigens and the KdsB. Backbone origin: pEXT20 (Dykxhoorn, et al.1996) (ColE1 ori, high copy number). Resistance cassette exchanged from Ampicillin to Kanamycin. Plasmid-borne expression of KdsB is required for optimal KDO conversion. pLTPro231: Ptac (IPTG) promoter drives the expression of MsrA / B-AniA fusion polypeptide, MetQ polypeptide, AniA polypeptide, NHBA-MetQ fusion polypeptide, and KdsB. NAI-5000113424v1 110Genetic Modifications Description and Functions pLTPro302: Ptac (IPTG) promoter drives the expression of MsrA / B-AniA fusion polypeptide and NHBA-MetQ fusion polypeptide. J23105 promoter drives the expression of MetQ polypeptide, AniA polypeptide, and KdsB.

[0374] Plasmid maps of the expression vectors (as in Table 1) encoding the MsrA / B-AniA fusion polypeptide, MetQ polypeptide, AniA polypeptide, NHBA-MetQ fusion polypeptide, and KdsB are provided in FIG.1A (pLTPro231) and FIG.1B (pLTPro302). In certain embodiments, the E. coli comprises pLTPro231 disclosed herein. In certain embodiments, the E. coli comprises pLTPro302 disclosed herein.

[0375] Sequence information of the expression vectors (as in Table 1) encoding the MsrA / B- AniA fusion polypeptide, MetQ polypeptide, AniA polypeptide, NHBA-MetQ fusion polypeptide, and KdsB is provided in FIG.2A (pLTPro231, SEQ ID NO: 66) and FIG.2B (pLTPro302, SEQ ID NO: 67). 5.3 Pharmaceutical Compositions

[0376] In one aspect, the disclosure provides a therapeutic or pharmaceutical composition comprising engineered E. coli strains as described herein. In one aspect, the disclosure provides a therapeutic or pharmaceutical composition comprising an OMV vaccine as described herein. Vectors are described in detail above and would be known to one of skill in the art.

[0377] In certain embodiments, an OMV vaccine as described herein may be provided as a pharmaceutical or therapeutic composition to be administered to a subject or patient for treatment of N. gonorrhoeae infection.

[0378] In certain embodiments, a glycan antigen as described herein may be provided or administered to a subject or patient as OMV expressing the glycan antigen. In certain embodiments, a protein antigen as described herein may be provided or administered to a subject or patient as OMV expressing the protein antigen. The disclosure provides an OMV vaccine, pharmaceutical compositions and related methods of using these vaccines, compositions, or expression systems for inhibiting, preventing, or treating gonococcal and / or meningococcal infections. Also provided is a use of the polynucleotides, polypeptides, and expression vectors or systems described herein for the manufacture of a medicament to prevent or treat N. gonorrhoeae infections. The pharmaceutical composition can be either a therapeutic formulation or a prophylactic formulation. Typically, a pharmaceutical composition may contain one or more active ingredients and, optionally, some inactive ingredients. In certain embodiments, the active ingredient may be an OMV vaccine, glycan, recombinant polypeptide, an expression vector, or an expression system as described herein. In NAI-5000113424v1 111some other embodiments, the active ingredient may include other antibacterial agents in addition to the expression system of the disclosure. The composition may additionally include one or more pharmaceutically acceptable vehicles and, optionally, other therapeutic ingredients (for example, antibiotics). Various pharmaceutically acceptable additives may also be used in such compositions.

[0379] In certain embodiments, an OMV vaccine for treatment of N. gonorrhoeae infections as described herein, and pharmaceutical compositions thereof, as described herein, may be administered in any appropriate dosage to obtain a therapeutic result. As would be understood by one of skill in the art, a dosage of OMV appropriate for treatment or prevention of N. gonorrhoeae infections or to achieve a particular outcome will vary depending on various factors including, but not limited to, the gene and promoter chosen, the condition, patient-specific parameters, e.g., height, weight, and age, and whether prevention or treatment is to be achieved. An OMV vaccine of the disclosure may conveniently be provided in the form of formulations suitable for administration, e.g., into the blood stream (e.g., in an intracoronary artery). A suitable administration format may best be determined by a medical practitioner or clinician for each patient individually, according to standard procedures and may include, but is not limited to, intramuscular, buccal, rectal, intracoronary, intravenous, intranasal, trans-vaginal, subcutaneous, intra-arterial, intra-articular, intraperitoneal, parenteral or any other suitable mode of administration known in the art.

[0380] A vaccine or pharmaceutical composition of the disclosure may be prepared in accordance with standard procedures well known in the art. See, e.g., Remington’s Pharmaceutical Sciences, 19th Ed., Mack Publishing Company, Easton, Pa., 1995; Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978; U.S. Pat. Nos.4,652,441; 4,917,893; 4,677,191; 4,728,721; and 4,675,189. Pharmaceutical compositions of the disclosure may be readily employed in a variety of therapeutic or prophylactic applications for preventing or treating gonococcal and / or meningococcal infections. For subjects at risk of developing a N. gonorrhoeae infection, a vaccine composition of the disclosure may be administered to provide prophylactic protection against N. gonorrhoeae infections. Depending on the specific subject and conditions, a composition of the disclosure may be administered to a subject or patient by a variety of administration modes known to the person of ordinary skill in the art, for example, intramuscular, subcutaneous, intravenous, intra-arterial, intra-articular, intraperitoneal, or parenteral routes. In certain embodiments, a composition as described herein may be administered to a subject in need of such treatment for a time and under conditions sufficient to prevent, inhibit, and / or ameliorate a selected disease or condition or one or more symptom(s) thereof. For therapeutic applications, a composition may contain a therapeutically effective amount of the NAI-5000113424v1 112expression system described herein. For prophylactic applications, a composition as described herein may contain a prophylactically effective amount of an expression system as described herein. The appropriate amount of the expression system (e.g., expression vectors) may be determined based on the specific disease or condition to be treated or prevented, severity, age of the subject, and other personal attributes of the specific subject (e.g., the general state of the subject’s health and the robustness of the subject’s immune system). Determination of effective dosages may additionally be guided with animal model studies (i.e., primate, canine, or the like), followed by human clinical trials, and by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject.

[0381] For prophylactic applications, an OMV vaccine as described herein may be provided in advance of any symptom, for example in advance of infection. A prophylactic administration of the immunogenic compositions may serve to prevent or ameliorate any subsequent infection. Thus, in certain embodiments, a subject to be treated is one who has, or is at risk for developing, a N. gonorrhoeae infections, for example because of exposure or the possibility of exposure to the bacterium. Following administration of a therapeutically effective amount of the disclosed therapeutic compositions, a subject or patient may be monitored for N. gonorrhoeae infections, symptoms associated with N. gonorrhoeae infections, or both.

[0382] For therapeutic applications, a composition as described herein may be provided at or after the onset of a symptom of disease or infection, for example after development of a symptom of N. gonorrhoeae infections, or after diagnosis of infection. A composition as described herein may thus be provided prior to the anticipated exposure to a N. gonococcal bacterial strain, so as to attenuate the anticipated severity, duration or extent of an infection and / or associated disease symptoms, after exposure or suspected exposure to the bacterium, or after the actual initiation of an infection.

[0383] In certain embodiments, an OMV vaccine of the disclosure may be provided in a dosage form containing an amount of OMV expressing or comprising a glycan antigen and one or more protein antigens that is effective in one or multiple doses. An effective dose may be any range deemed appropriate by a clinician or practitioner. Administration of an OMV vaccine with the glycan antigen and one or more protein antigens of the disclosure, a recombinant bacterial strain producing or expressing the glycan antigen and one or more protein antigens of the disclosure, or a composition comprising any of these may be in a buffer, such as phosphate-buffered saline, or other appropriate buffer or diluent. The amount of buffer or diluent may vary and would be determined by a clinician or practitioner. NAI-5000113424v1 113

[0384] In certain embodiments, a composition of the disclosure may be combined with other agents known in the art for treating or preventing N. gonorrhoeae infections. These may include any drug known or available in the art for treating a bacterial infection, e.g., antibodies or other antibacterial agents such as antibacterial compounds or drugs, protease inhibitors, fusion protein inhibitors, or the like. In certain embodiments, a composition as described herein for treatment or prevention of N. gonorrhoeae infections may be advantageous in situations where a patient or subject is unresponsive to antibiotic treatment due to an increase in antibiotic resistance in the bacteria. Administration of a composition and one or more known anti-bacterial agent may be either concurrently or sequentially.

[0385] As described herein, OMV-based vaccines elicit higher titres of antibodies with broader reactivity than the corresponding recombinant proteins and may be more tolerable since less protein may be required to provide an effective protective antibody response. Thus, in certain embodiments, OMV may be administered with an adjuvant in order to enhance antibody responses. Suitable adjuvants are known in the art and can include, but are not limited to, aluminum compounds (e.g., amorphous aluminum hydroxyphosphate sulfate (AAHS), aluminum hydroxide, aluminum phosphate, potassium aluminum sulfate (Alum), aluminum hydroxide adjuvant (2% ALHYDROGEL)), cytosine phosphoguanine (CpG) nucleotides (e.g., CpG 1018), AS01, AS04, QS-21, RIBI, MF59, or the like. 5.4 Methods of Making

[0386] In one aspect, the present disclosure provides a method for producing engineered E. coli strains as described herein. A number of methods have been reported to create gene knock-outs and gene knock-ins in E. coli. The most popular ones make use of the λ phage recombination system (“recombineering”) that enormously enhances the double cross-over events between the chromosomal DNA and the transforming “donor DNA” designed to create the mutation (Murphy K C (1998) J. Bacteriol.180, 2063). The donor DNA can be either synthetic single / double strand DNA or PCR-derived DNA (Ju et al., (2000) Proc. Natl. Acad. Sci. USA, 97, 5978; Ellis et al., (2001) Proc. Natl. Acad. Sci. USA, 98, 6742). The technology used for homologous recombination is also described in Datsenko et al.2000. More recently, a combination of “recombineering” with CRISPR / Cas genome editing strategy has been shown to generate mutants in E. coli with high efficiency (Jiang et al. (2013) Nat. Biotechnol.31, 233).

[0387] In certain embodiments, the bacterium is cultured in conditions suitable for growth and vesiculation, which include the use of rich media such as LB supplemented with additional carbon and nitrogen sources, or chemically defined media using different carbohydrates as carbon sources. NAI-5000113424v1 114Growth temperatures typically vary from 20° C to 37° C and the supernatants containing the vesicles can be collected toward the end of the exponential phase or in the stationary phase of growth, depending upon the growth conditions in use. The conditions suitable for bacterial growth and vesiculation are known to anyone skilled in the art and are described for instance in Berlanda Scorza, F. et al. “High yield production process for Shigella outer membrane particles”, PLoS One 7, e35616 (2012).

[0388] In one aspect, the present disclosure provides a method for producing an OMV as described herein. In certain embodiments, the OMV is secreted by an engineered E. coli as described in Section 5.2 above. In certain embodiments, the OMV is produced by an engineered E. coli as described in Section 5.2 above.

[0389] In certain embodiments, the method comprises the steps of: a) cultivating a bacteria host cell (e.g., E. coli) comprising a nucleic acid molecule or an expression construct as described herein for expression in the host cell, b) extracting the OMV, and c) recovering the OMV, wherein the recovery at least comprises removal of the bacteria from the OMV. In certain embodiments, the recovery of the OMV in step c) is preceded by a step b), wherein the OMV are extracted.

[0390] In certain embodiments, the method comprises the first step of pre-cultures of the bacteria host cell (e.g., E. coli) are inoculated from glycerol stock and grown overnight. In certain embodiments, bioreactor is inoculated with precultures. In certain embodiments, inducers are either present in the batch medium or absent. In certain embodiments, batch culture in bioreactor is interrupted 6 h after inoculum. In certain embodiments, the method comprises the next step of separating supernatant is from cells by centrifugation. In certain embodiments, supernatant is filtered through 0.45 um and 0.2 um filter, to completely separate from cell material. In certain embodiments, the supernatant can be stored at 4°C. In certain embodiments, the method comprises a further step of filtering the samples to filter away small impurities. In certain embodiments, pH is adjusted, the material undergoes TFF (tangential flow filtration) with 300 kDa cutoff, and buffer is exchanged. In certain embodiments, the sample is again filtered through 0.45 and 0.2 um filters. In certain embodiments, the sample undergoes a last purification step through a SEC chromatography. In certain embodiments, the sample undergoes TFF and diafiltration for final concentration and buffer adjustment.

[0391] In certain embodiments, the expression of protein antigens on the OMVs are assessed, e.g., by immunoblots or ELISAs. In certain embodiments, the expression of glycan antigens on the OMVs are assessed, e.g., by immunoblots or ELISAs. NAI-5000113424v1 115

[0392] In certain embodiments, the four protein antigens as described herein together amount to approximately 3 to 10% of the total OMV protein.

[0393] In certain embodiments, the composition produced by the method disclosed herein has a purity of the OMV of at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 99%, where the purity is calculated as the percentage of the area under the OMV containing peak compared to the area under the entire chromatogram as measured by SEC-HPLC. In certain embodiments, the composition produced by the method disclosed herein has a purity of the OMV of at least 99%, where the purity is calculated as the percentage of the area under the OMV containing peak compared to the area under the entire chromatogram as measured by SEC- HPLC. In certain embodiments, the composition produced by the method disclosed herein does not comprise an aggregation of the OMV as assessed by SEC-HPLC.

[0394] In certain embodiments, the composition produced by the method disclosed herein is essentially free of DNA from E coli. In certain embodiments, the composition comprises less than 5 ng, less than 4 ng, less than 3 ng, less than 1 ng, less than 100 pg, less than 50 pg, less than 25 pg, less than 10 pg, less than 5 pg, or less than 1.5 pg, DNA from E coli / μg total protein as measure by qPCR. In certain embodiments, the composition comprises less than 1.5 pg, DNA from E coli / μg total protein as measure by qPCR.

[0395] In certain embodiments, the diameter of the OM...

Claims

WHAT IS CLAIMED IS:

1. An Escherichia coli (E. coli)-derived outer membrane vesicle (OMV) comprising a glycan antigen and a protein antigen of N. gonorrhoeae.

2. The OMV of claim 1, wherein the OMV further comprises a modified lipid A.

3. An Escherichia coli (E. coli)-derived outer membrane vesicle (OMV) comprising a glycan antigen and a protein antigen of a pathogen, and a modified lipid A.

4. The OMV of claim 3, wherein the pathogen is N. gonorrhoeae.

5. The OMV of any one of claims 2-4, wherein the modified lipid A is produced by at least one lipid A modification enzyme selected from the group consisting of msbB, pagL, lpxE, pagP, and combinations thereof.

6. The OMV of claim 5, wherein the msbB, pagL, and / or lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV.

7. The OMV of claim 5 or 6, wherein the E. coli comprises genetic disruption of msbB, eptA, and / or lpxT genes.

8. The OMV of any one of claims 5-7, wherein the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

9. The OMV of any one of claims 2-8, wherein the modified lipid A comprises a mixture of heterogeneous lipid A species having different chemical structures.

10. The OMV of any one of claims 2-9, wherein the modified lipid A comprises at least one lipid A species comprising only one phosphate group.

11. The OMV of claim 10, wherein the modified lipid A comprises at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone.

12. The OMV of claim 11, wherein at least 60% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone. NAI-5000113424v1 17513. The OMV of claim 11 or 12, wherein between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone.

14. The OMV of any one of claims 2-13, wherein the modified lipid A comprises at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone.

15. The OMV of claim 14, wherein at least 60% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone.

16. The OMV of claim 14 or 15, between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone.

17. The OMV of any one of claims 2-16, wherein the modified lipid A comprises at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A.

18. The OMV of claim 17, wherein at least 50% of the amount of the modified lipid A is 3-O- desacyl-4’-monophosphoryl lipid A.

19. The OMV of claim 17 or 18, wherein between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’-monophosphoryl lipid A.

20. The OMV of any one of claims 2-19, wherein the modified lipid A comprises at least one lipid A species comprising at least three C14-3OH acyl chains.

21. The OMV of claim 20, wherein at least 60% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains.

22. The OMV of claim 20 or 21, wherein between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains.

23. The OMV of any one of claims 2-22, wherein the modified lipid A comprises at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone. NAI-5000113424v1 17624. The OMV of claim 23, wherein at least 30% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone.

25. The OMV of claim 23 or 24, wherein between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone.

26. The OMV of any one of claims 2-25, wherein the modified lipid A comprises at least one lipid A species comprising a C12 acyl chain.

27. The OMV of claim 26, wherein at least 60% of the amount of the modified lipid A comprises a C12 acyl chain.

28. The OMV of claim 26 or 27, wherein between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

29. The OMV of any one of claims 1-28, wherein the protein antigen and glycan antigen are associated with the outer membrane of the OMV.

30. The OMV of any one of claims 1-29, wherein the protein antigen comprises a MsrA / B polypeptide.

31. The OMV of claim 30, wherein the MsrA / B polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

9.

32. The OMV of claim 30 or 31, wherein the MsrA / B polypeptide comprises the amino acid sequence of SEQ ID NO:

9.

33. The OMV of any one of claims 30-32, wherein the N-terminus of the MsrA / B polypeptide is fused to the C-terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine.

34. The OMV of claim 33, wherein the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

14. NAI-5000113424v1 17735. The OMV of claim 33 or 34, wherein the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO:

14.

36. The OMV of any one of claims 1-35, wherein the protein antigen comprises a MetQ polypeptide.

37. The OMV of claim 36, wherein the MetQ polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

7.

38. The OMV of claim 36 or 37, wherein the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO:

7.

39. The OMV of any one of claims 1-38, wherein the protein antigen comprises an AniA polypeptide.

40. The OMV of claim 39, wherein the AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

4.

41. The OMV of claim 39 or 40, wherein the AniA polypeptide comprises the amino acid sequence of SEQ ID NO:

4.

42. The OMV of any one of claims 1-38, wherein the protein antigen comprises a NHBA polypeptide.

43. The OMV of claim 42, wherein the NHBA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

16.

44. The OMV of claim 42 or 43, wherein the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO:

16.

45. The OMV of any one of claims 42-44, wherein the N-terminus of the NHBA polypeptide is fused to the C-terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine.

46. The OMV of claim 45, wherein the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

21. NAI-5000113424v1 17847. The OMV of claim 45 or 46, wherein the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO:

21.

48. An E. coli-derived OMV comprising an AniA polypeptide that is associated with the outer membrane of the OMV, optionally the OMV comprises a glycan antigen.

49. The OMV of claim 48, wherein the AniA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

4.

50. The OMV of claim 48 or 49, wherein the AniA polypeptide comprises the amino acid sequence of SEQ ID NO:

4.

51. An E. coli-derived OMV comprising a MetQ polypeptide and a glycan antigen of a pathogen, wherein the MetQ polypeptide and the glycan antigen are associated with the outer membrane of the OMV.

52. The OMV of claim 51, wherein the MetQ polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

7.

53. The OMV of claim 51 or 52, wherein the MetQ polypeptide comprises the amino acid sequence of SEQ ID NO:

7.

54. An E. coli-derived OMV comprising a NHBA polypeptide and a glycan antigen of a pathogen, wherein the NHBA polypeptide and the glycan antigen are associated with the outer membrane of the OMV.

55. The OMV of claim 54, wherein the N-terminus of the NHBA polypeptide is fused to the C- terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine.

56. An E. coli-derived OMV comprising a NHBA polypeptide that is associated with the outer membrane of the OMV, wherein the N-terminus of the NHBA polypeptide is fused to the C- terminus of a lipidated MetQ polypeptide to form a NHBA-MetQ fusion polypeptide, wherein the lipidated MetQ polypeptide comprises a lipidated N-terminal cysteine. NAI-5000113424v1 17957. The OMV of any one of claims 54-56, wherein the NHBA polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

16.

58. The OMV of any one of claims 54-57, wherein the NHBA polypeptide comprises the amino acid sequence of SEQ ID NO:

16.

59. The OMV of any one of claim 55-58, wherein the NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

21.

60. The OMV of any one of claim 55-59, wherein the NHBA-MetQ fusion polypeptide comprises the amino acid sequence of SEQ ID NO:

21.

61. An E. coli-derived OMV comprising a MsrA / B polypeptide and a glycan antigen of a pathogen, wherein the MsrA / B polypeptide and glycan antigen are associated with the outer membrane of the OMV.

62. The OMV of claim 61, wherein the N-terminus of the MsrA / B polypeptide is fused to the C- terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine.

63. An E. coli-derived OMV comprising a MsrA / B polypeptide that is associated with the outer membrane of the OMV, wherein the N-terminus of the MsrA / B polypeptide is fused to the C- terminus of a lipidated AniA polypeptide to form a MsrA / B-AniA fusion polypeptide, wherein the lipidated AniA polypeptide comprises a lipidated N-terminal cysteine.

64. The OMV of any one of claims 61-63, wherein the MsrA / B polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

9.

65. The OMV of any one of claims 61-64, wherein the MsrA / B polypeptide comprises the amino acid sequence of SEQ ID NO:

9. NAI-5000113424v1 18066. The OMV of any one of claims 62-65, wherein the MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 90% sequence identity to the amino acid sequence of SEQ ID NO:

14.

67. The OMV of any one of claims 62-66, wherein the MsrA / B-AniA fusion polypeptide comprises the amino acid sequence of SEQ ID NO:

14.

68. The OMV of any one of the preceding claims, wherein the glycan antigen comprises keto- deoxyoctulosonate (KDO) as a terminal saccharide unit.

69. The OMV of claim 68, wherein glycan antigen comprises KDOα(2→3)Gal as the terminal saccharide unit.

70. The OMV of claim 68 or 69, wherein the glycan antigen comprises KDOα(2→3)Galβ(1→4)GlcNac as the terminal saccharide unit.

71. The OMV of any one of the preceding claims, wherein the glycan antigen comprises a 2C7 epitope having the structure within the broken line square of the following structure: ,the white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

72. The OMV of any one of the preceding claims, wherein the glycan antigen is covalently conjugated to the modified lipid A. NAI-5000113424v1 18173. The OMV of claim 72, wherein the glycan antigen has the following structure:, , square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D-manno- heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine.

74. An E. coli-derived OMV comprising: a. a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; b. a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, c. an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, d. a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 21, and e. a glycan antigen has the following structure and is linked to a modified lipid A as follows: NAI-5000113424v1 182e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced by a combination of msbB, pagL, lpxE, and pagP; wherein the msbB, pagL, and / or lpxE is encoded by at least one exogenous polynucleotide of an E. coli that produces the OMV, the E. coli comprises genetic disruption of msbB, eptA, and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

75. An E. coli-derived OMV comprising: a. a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; b. a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, c. an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, d. a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 21, and e. a glycan antigen has the following structure and is linked to a modified lipid A as follows: NAI-5000113424v1 183e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A is produced a combination of pagL, lpxE, and pagP, wherein each of the pagL and lpxE is encoded by an exogenous polynucleotide of an E. coli that produces the OMV, wherein the E. coli comprises genetic disruption of eptA and lpxT genes, and the promoter of pagP gene of the E. coli is replaced by a lambda PL promoter.

76. An E. coli-derived OMV comprising: a. a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; b. a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, c. an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, d. a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 21, and e. a glycan antigen has the following structure and is linked to a modified lipid A as follows: NAI-5000113424v1 184e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) at least one lipid A species comprising a C12 acyl chain.

77. An E. coli-derived OMV comprising: a. a MsrA / B-AniA fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 14; b. a MetQ polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 7, c. an AniA polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 4, d. a NHBA-MetQ fusion polypeptide comprises an amino acid sequence having at least about 95% sequence identity to the amino acid sequence of SEQ ID NO: 21, and e. a glycan antigen has the following structure and is linked to a modified lipid A as follows: NAI-5000113424v1 185e white square represents a N- acetylglucosamine (GlcNac), the heptagon represents a L-glycero-D- manno-heptose (Hep), the black circle represents a glucose (Glc), and the PEtN represents a phosphoethanolamine; and (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone; (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A; (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains; (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

78. The OMV of any one of claim 68-77, wherein the KDO can be recognized by antibody 6E4.

79. An E. coli-derived OMV comprising a modified lipid A, wherein the modified lipid A comprises (i) at least one lipid A species comprising only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) at least one lipid A species lacking a fatty acyl chain at 3 position of the disaccharide NAI-5000113424v1 186backbone; (iii) at least one lipid A species that is 3-O-desacyl-4’-monophosphoryl lipid A; (iv) at least one lipid A species comprising at least three C14-3OH acyl chains; (v) at least one lipid A species comprising a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and / or (vi) at least one lipid A species comprising a C12 acyl chain.

80. An E. coli-derived OMV comprising a modified lipid A, wherein: (i) between 70% and 75% of the amount of the modified lipid A comprises only one phosphate group attached at the 4’ position of the disaccharide backbone; (ii) between 80% and 90% of the amount of the modified lipid A lacks a fatty acyl chain at 3 position of the disaccharide backbone; (iii) between 60% and 70% of the amount of the modified lipid A is 3-O-desacyl-4’- monophosphoryl lipid A; (iv) between 90% and 100% of the amount of the modified lipid A comprises at least three C14-3OH acyl chains; (v) between 40% and 50% of the amount of the modified lipid A comprises a C16 acyl chain that is linked to the C14-OH acyl chain at 2 position of the disaccharide backbone; and / or (vi) between 90% and 100% of the amount of the modified lipid A comprises a C12 acyl chain.

81. A composition comprising the OMV of any one of claims 1-80.

82. A pharmaceutical composition comprising the OMV of any one of claims 1-80, and a pharmaceutically acceptable carrier.

83. An Escherichia coli engineered to produce the OMV of any one of claims 1-80.

84. The E. coli of claim 83, wherein the E. coli comprises one or more genetic modifications to express the protein antigen.

85. The E. coli of claim 84, wherein the E. coli comprises: a. an exogenous polynucleotide encoding the MsrA / B polypeptide, optionally wherein the E. coli comprises an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and NAI-5000113424v1 187an AniA signal polypeptide, further optionally wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; b. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, optionally wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; c. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, optionally wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and / or d. an exogenous polynucleotide encoding the NHBA polypeptide, optionally wherein the E. coli comprises an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, further optionally wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO:

6.

86. The E. coli of any one of claims 83-85, wherein the E. coli comprises one or more genetic modifications to produce the modified lipid A.

87. The E. coli of claim 86, wherein the E. coli comprises: a. an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and / or an exogenous polynucleotide encoding lpxE; b. genetic disruption of msbB, eptA, and / or lpxT genes; and / or c. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter.

88. The E. coli of any one of claims 83-87, wherein the E. coli comprises one or more genetic modifications to produce the glycan antigen.

89. The E. coli of claim 88, wherein the E. coli comprises: a. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and / or an exogenous polynucleotide encoding kdsB; b. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and / or waaU genes; NAI-5000113424v1 188c. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and / or ’wbbL genes; and / or d. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and / or wecG genes.

90. The E. coli of any one of claims 83-89, wherein the E. coli further comprises one or more genetic modifications to increase vesiculation.

91. The E. coli of claim 90, wherein the E. coli further comprises: a. genetic disruption of ompA gene; b. genetic disruption of lpp gene; and / or c. an exogenous polynucleotide encoding lpp.

92. The E. coli of any one of claims 83-91, wherein the E. coli further comprises genetic disruption of fliC gene, optionally wherein the E. coli further comprises genetic disruption of fim gene cluster, further optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

93. An Escherichia coli (E. coli) engineered to produce an OMV, wherein the E. coli comprises: a. genetic modifications to express the protein antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; ii. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; iii. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and iv. an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; NAI-5000113424v1 189b. genetic modifications to produce the modified lipid A, wherein the E. coli comprises: i. an exogenous polynucleotide encoding msbB, an exogenous polynucleotide encoding pagL, and an exogenous polynucleotide encoding lpxE; ii. genetic disruption of msbB, eptA, and lpxT genes; and iii. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; c. genetic modifications to produce the glycan antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB; ii. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; iii. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL; and iv. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; d. genetic modifications to increase vesiculation, wherein the E. coli comprises: i. genetic disruption of ompA and lpp genes; ii. an exogenous polynucleotide encoding lpp, optionally wherein the exogenous polynucleotide encoding lpp is inserted at the attλ site of the genome of the E. coli under the promoter Para; e. genetic disruption of fliC gene; and NAI-5000113424v1 190f. genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

94. An Escherichia coli (E. coli) engineered to produce an OMV, wherein the E. coli comprises: a. genetic modifications to express the protein antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding the MsrA / B-AniA fusion polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; ii. an exogenous polynucleotide encoding the MetQ polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; iii. an exogenous polynucleotide encoding the AniA polypeptide and an AniA signal polypeptide, wherein the AniA signal polypeptide comprises the amino acid sequence of SEQ ID NO: 3; and iv. an exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and a MetQ signal polypeptide, wherein the MetQ signal polypeptide comprises the amino acid sequence of SEQ ID NO: 6; b. genetic modifications to produce the modified lipid A, wherein the E. coli comprises: i. an exogenous polynucleotide encoding pagL and an exogenous polynucleotide encoding lpxE; ii. genetic disruption of eptA and lpxT genes; and iii. the promoter of pagP gene of the E. coli being replaced by a lambda PL promoter; c. genetic modifications to produce the glycan antigen, wherein the E. coli comprises: i. an exogenous polynucleotide encoding lpt3, an exogenous polynucleotide encoding rfaK, an exogenous polynucleotide encoding lgtF, an exogenous polynucleotide encoding lgtG, an exogenous polynucleotide encoding lgtE, an exogenous polynucleotide encoding lgtA, an exogenous polynucleotide encoding lgtB, an exogenous NAI-5000113424v1 191polynucleotide encoding lst, and an exogenous polynucleotide encoding kdsB; ii. genetic disruption of waaQ, waaG, waaP, waaS, waaB, waaO, waaR, waaY, waaZ, and waaU genes; iii. genetic disruption of wza, wzb, wzc, wcaA, wcaB, wcaC, wcaD, wcaE, wcaF, gmd, fcl, gmm, wcaI, cpsB, cpsG, wcaJ, wzxC, wcaK, wcaL, wcaM, galF, rfbB, rfbD, rfbA, rfbC, wzx, glf, wzy, wbbI, wbbJ, wbbL’, intS, and ’wbbL; and iv. genetic disruption of wecA, wzzE, wecB, wecC, rmlB, rmlA, wecD, wecE, wzxE, wecF, wzyE, and wecG genes; d. genetic modifications to increase vesiculation, wherein the E. coli comprises: i. genetic disruption of ompA and lpp genes; ii. an exogenous polynucleotide encoding lpp, optionally wherein the exogenous polynucleotide encoding lpp is inserted at the attλ site of the genome of the E. coli under the promoter Para; e. genetic disruption of fliC gene; and f. genetic disruption of fim gene cluster, optionally wherein the fim gene cluster comprises fimHGFDCIA genes.

95. The E. coli of claim 93 or 94, wherein the exogenous polynucleotide encoding the MsrA / B- AniA fusion polypeptide and the AniA signal polypeptide, the exogenous polynucleotide encoding the MetQ polypeptide and the MetQ signal polypeptide, the exogenous polynucleotide encoding the AniA polypeptide and the AniA signal polypeptide, the exogenous polynucleotide encoding the NHBA-MetQ fusion polypeptide and the MetQ signal polypeptide, and the exogenous polynucleotide encoding KdsB are expressed from a first vector.

96. The E. coli of any one of claims 93-95, wherein the exogenous polynucleotide encoding lst is expressed from a second vector, wherein the expression of lst is constitutively under control of lambda phage promoter PL in the second vector.

97. The E. coli of any one of claims 93-96, wherein the exogenous polynucleotide encoding msbB, the exogenous polynucleotide encoding pagL, the exogenous polynucleotide encoding lpxE, the exogenous polynucleotide encoding lpt3, the exogenous polynucleotide encoding rfaK, the exogenous polynucleotide encoding lgtF, the exogenous polynucleotide encoding lgtG, the NAI-5000113424v1 192exogenous polynucleotide encoding lgtE, the exogenous polynucleotide encoding lgtA, the exogenous polynucleotide encoding lgtB, the exogenous polynucleotide encoding lst, and the exogenous polynucleotide encoding lpp are incorporated into the genome of the E. coli.

98. A method of producing a plurality of OMVs, comprising (i) culturing the E. coli of any one of claims 83-97 under conditions suitable for producing OMVs, and (ii) purifying the OMVs produced from the E. coli.

99. A method of inducing an immune response in a subject against N. gonorrhoeae comprising administering to the subject an effective amount of the OMV of any one of claims 1-80 or the composition of claim 81 or 82. NAI-5000113424v1 193

Images