Insecticidal protein and use thereof

Abstract

An insecticidal protein, a nucleic acid molecule encoding the protein, and a method and the use thereof for controlling Lepidopteran pests. The insecticidal protein contains an amino acid sequence as set forth in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 33. The modified Cry1Da1 protein has a better insecticidal effect, with significantly greater insecticidal activity compared to the patented protein BD1-002.

Description

Insecticide protein and its use Technical Field

[0001] The present invention relates to an insecticidal protein, a nucleic acid molecule encoding the protein, and a method and application thereof for controlling lepidopteran pests. Background Art

[0002] Currently, agricultural production faces biotic stresses (such as diseases and insect pests) and abiotic stresses (such as drought, cold, and salt damage), which weaken crop growth and reduce yields, posing a significant threat to global food security. Insect pests are one of the primary biotic stressors affecting agricultural and forestry productivity. As the environmental impacts of chemical pesticide use become increasingly severe, the use of biopesticides has gradually gained attention.

[0003] Bacillus thuringiensis (Bt) is a Gram-positive bacterium that is widely distributed in nature. The biggest feature that distinguishes Bt bacteria from other Bacillus is that crystal proteins are produced in the late growth stage along with the formation of spores, generally known as parasporal crystals. Bt strains are considered to be insect pathogens, and their pathogenicity mainly or entirely depends on parasporal crystal proteins. In recent years, a large number of literatures have reported that various Bt proteins have insecticidal activity against insects such as Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Homoptera. The commercial cultivation of Bt transgenic insect-resistant crops has become one of the main driving forces for significantly improving agricultural productivity. In recent years, the scale of the industrialization of transgenic insect-resistant crops has continued to expand, effectively controlling the occurrence and damage of target pests, reducing the use of chemical pesticides, and providing important guarantees for food and ecological security.

[0004] Long-term, large-scale cultivation of Bt transgenic crops can lead to the development of Bt resistance in pests, a key factor hindering the sustainable use of transgenic insect-resistant crops. To slow the evolution of pest resistance to Bt crops, the "high dose / refuge" strategy has been widely adopted globally. The theoretical basis of this "high dose / refuge" strategy consists of two components: a high dose and a refuge. A "refuge" refers to a non-transgenic plant host near the Bt crop that provides a surviving environment for susceptible individuals of the target pest. A "high dose" refers to a high dose of the insecticidal protein expressed by the transgenic insect-resistant crop, theoretically capable of killing 100% of susceptible individuals and 95% of heterozygous susceptible / resistant individuals in the target pest population. Countries have relatively consistent requirements for this, using 25 times the 99% lethal dose for susceptible target pests as the standard. Any concentration exceeding this is considered a high dose. However, due to the limitations of current biotechnology and plant carrying capacity, the Bt protein dose expressed in transgenic crops cannot be increased indefinitely. Furthermore, lower Bt expression levels can reduce metabolic costs in transgenic plants and improve agronomic traits. Therefore, improving the insecticidal effect of Bt protein in transgenic crops is crucial for the sustainable application of insect-resistant transgenic crops.

[0005] The Cry1Da1 protein, a parasporal crystal protein from Bacillus thuringiensis, is a Lepidoptera-specific Bt insecticidal crystal protein with a novel mechanism of action. Its midgut receptors in Lepidoptera differ from those of other Cry proteins (Reference 1), and it provides good resistance to a variety of Lepidoptera insects, particularly Spodoptera litura pests. However, the insecticidal activity of Cry1Da1 proteins disclosed in the prior art still cannot meet the growing demand for insecticides in agricultural production. Therefore, there is an urgent need for Cry1Da1 proteins with even better insecticidal effects. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a Cry1Da1 protein with better insecticidal effect.

[0007] In a first aspect, the present invention provides an insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:33.

[0008] In a second aspect, the present invention provides a nucleic acid molecule encoding the insecticidal protein of the present invention.

[0009] Preferably, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:33 is shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:34, respectively.

[0010] In a third aspect, the present invention provides a recombinant expression vector comprising the nucleic acid molecule of the present invention.

[0011] In a fourth aspect, the present invention provides an insecticidal composition comprising the insecticidal protein of the present invention.

[0012] In a fifth aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with the insecticidal protein or insecticidal composition of the present invention.

[0013] In a sixth aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing the nucleic acid molecule or recombinant expression vector of the present invention into a plant, and allowing the lepidopteran pests to feed on the plant.

[0014] In a seventh aspect, the present invention provides use of the insecticidal protein, nucleic acid molecule, recombinant expression vector or insecticidal composition of the present invention for controlling lepidopteran pests.

[0015] The beneficial effects of the present invention are:

[0016] The modified Cry1Da1 protein of the present invention significantly increases the mortality rate of lepidopteran pests when fed to them. Furthermore, transgenic plants expressing the modified Cry1Da1 protein also exhibited superior insect resistance. After inoculation with lepidopteran pests, the transgenic plants showed lower leaf damage rates and higher mortality rates. Therefore, the modified Cry1Da1 protein of the present invention exhibits superior insect resistance, significantly outperforming the patented protein BD1-002. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] FIG1 is a flow chart of the construction of a recombinant cloning vector DBN002A containing the nucleotide sequence of the Cry1Da1-related protein BD1-002 of the present invention;

[0018] FIG2 is a flowchart of the construction of the soybean recombinant expression vector DBN002A-B containing the nucleotide sequence of the Cry1Da1-related protein BD1-002 of the present invention;

[0019] FIG3 is a flow chart of the construction of the corn recombinant expression vector DBN002A-C containing the nucleotide sequence of the Cry1Da1-related protein BD1-002 of the present invention. DETAILED DESCRIPTION

[0020] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application should have the common meanings understood by those skilled in the art.

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagents, etc. used in the following examples are commercially available products unless otherwise specified.

[0022] In a first aspect, the present invention provides an insecticidal protein comprising an amino acid sequence as shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:33.

[0023] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0024] The genes and proteins described in the present invention include not only the specific exemplary sequences, but also portions and / or fragments (including internal and / or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras, and fusion proteins that retain the insecticidal activity characteristics of the specific exemplary proteins. The term "variant" or "mutation" refers to a nucleotide sequence encoding the same protein or an equivalent protein with insecticidal activity. The term "equivalent protein" refers to a protein that has the same or substantially the same biological activity against lepidopteran pests as the protein described in the present invention.

[0025] In the present invention, the modified Cry1Da1 protein includes, but is not limited to, amino acid sequences having a certain homology with the amino acid sequences shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 33. The similarity / identity between these sequences and the sequences of the present invention is typically greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and can be greater than 99%. Preferred nucleotides and proteins of the present invention can also be defined based on more specific ranges of identity and / or similarity. For example, there are 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and / or similarity to the sequences exemplified by the present invention.

[0026] In a second aspect, the present invention provides a nucleic acid molecule encoding the insecticidal protein of the present invention. Preferably, the nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:33 is set forth in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:22, or SEQ ID NO:34, respectively.

[0027] In the present invention, nucleic acid molecules or fragments thereof hybridize with the modified Cry1Da1 gene of the present invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the modified Cry1Da1 gene of the present invention. Nucleic acid molecules or fragments thereof can, under certain circumstances, specifically hybridize with other nucleic acid molecules. In the present invention, two nucleic acid molecules are said to be capable of specific hybridization if they can form an antiparallel double-stranded nucleic acid structure. If two nucleic acid molecules exhibit complete complementarity, one is said to be the "complement" of the other. In the present invention, two nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide in one nucleic acid molecule is complementary to the corresponding nucleotide in the other. Two nucleic acid molecules are said to be "minimally complementary" if they can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to be "complementary" if they can hybridize with sufficient stability to anneal and bind to each other under conventional "high stringency" conditions. Deviations from perfect complementarity are permissible as long as such deviations do not completely prevent the two molecules from forming a duplex structure. In order for a nucleic acid molecule to function as a primer or probe, it is only necessary that it possess sufficient sequence complementarity to allow a stable duplex structure to form under the particular solvent and salt concentration employed.

[0028] In the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with the complementary strand of another matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions that promote DNA hybridization, for example, treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by washing with 2.0×SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from about 2.0×SSC at 50°C for low stringency conditions to about 0.2×SSC at 50°C for high stringency conditions. In addition, the temperature in the washing step can be increased from room temperature of about 22°C for low stringency conditions to about 65°C for high stringency conditions. Both the temperature and the salt concentration can be varied, or one of them can be kept constant while the other is varied. Preferably, the stringent conditions of the present invention may be specific hybridization with SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, and SEQ ID NO:34 in a 6×SSC, 0.5% SDS solution at 65°C, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0029] Therefore, sequences having insecticidal activity and hybridizing under stringent conditions to SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 34 of the present invention are included in the present invention. These sequences are at least about 40%-50% homologous, about 60%, 65% or 70% homologous, or even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology to the sequences of the present invention.

[0030] Due to the redundancy of the genetic code, multiple different DNA sequences can encode the same amino acid sequence. Generating alternative DNA sequences encoding identical or substantially identical proteins is within the skill of those skilled in the art. These different DNA sequences are encompassed by the present invention. "Substantially identical" sequences refer to sequences with amino acid substitutions, deletions, additions, or insertions that do not substantially affect insecticidal activity, including fragments that retain insecticidal activity.

[0031] In a third aspect, the present invention provides a recombinant expression vector comprising the nucleic acid molecule of the present invention.

[0032] As used herein, "transgenic" refers to any cell, cell line, callus, tissue, plant part, or plant whose genome has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct. "Transgenic" as used herein includes the original transgenic event and those derived from the original transgenic event by sexual hybridization or asexual propagation, and does not encompass genomic (chromosomal or extrachromosomal) alterations made by conventional plant breeding methods or by naturally occurring events, such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0033] In a fourth aspect, the present invention provides an insecticidal composition comprising the insecticidal protein of the present invention.

[0034] As used herein, "insecticide" or "insect-resistant" refers to being toxic to crop pests, thereby achieving "control" and / or "prevention" of crop pests. Preferably, "insecticide" or "insect-resistant" refers to killing crop pests. More specifically, the target insects are Lepidoptera pests.

[0035] In a fifth aspect, the present invention provides a method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with the insecticidal protein or insecticidal composition of the present invention.

[0036] In a sixth aspect, the present invention provides a method for controlling lepidopteran pests, comprising introducing the nucleic acid molecule or recombinant expression vector of the present invention into a plant, and allowing the lepidopteran pests to feed on the plant.

[0037] The "contact" mentioned in the present invention refers to touching, staying and / or feeding, specifically, insects and / or pests touching, staying and / or feeding on plants, plant organs, plant tissues or plant cells. The plants, plant organs, plant tissues or plant cells may express insecticidal proteins in their bodies, or may have insecticidal proteins and / or microorganisms that produce insecticidal proteins on their surfaces.

[0038] The "control" and / or "prevention" mentioned in the present invention refers to the contact of lepidopteran pests with Cry1Da1 and its modified proteins, and the growth of the lepidopteran pests is inhibited and / or caused to die after contact. Furthermore, the lepidopteran pests come into contact with the Cry1Da1 protein by feeding on plant tissues, and the growth of all or part of the lepidopteran pests is inhibited and / or caused to die after contact. Inhibition refers to sublethal, that is, it is not lethal but can cause certain effects in growth and development, behavior, physiology, biochemistry and tissue, such as slow growth and / or cessation. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for product consumption and / or production. In addition, plants and / or plant seeds that control lepidopteran pests containing nucleotide sequences encoding Cry1Da1 proteins have reduced plant damage compared to non-transgenic wild-type plants under conditions of artificial inoculation of lepidopteran pests and / or natural occurrence of lepidopteran pests. The specific manifestations include but are not limited to improved leaf resistance, and / or increased grain weight, and / or increased yield, etc. The "control" and / or "prevention" effect of Cry1Da1 protein on lepidopteran pests can exist independently. Specifically, any tissue of the transgenic plant (containing a nucleotide sequence encoding the Cry1Da1 protein) simultaneously and / or asynchronously presents and / or produces Cry1Da1 protein and / or another substance that can control lepidopteran pests. The presence of the other substance cannot result in the "control" and / or "prevention" effect being completely and / or partially achieved by the other substance, and is unrelated to the Cry1Da1 protein. Normally, in the field, the process of lepidopteran pests feeding on plant tissues is short and difficult to observe with the naked eye. Therefore, under conditions of artificial inoculation of lepidopteran pests and / or natural occurrence of lepidopteran pests, if dead lepidopteran pests are present in any tissue of a transgenic plant (containing a nucleotide sequence encoding a Cry1Da1 protein), and / or lepidopteran pests whose growth is inhibited and which stay thereon, and / or the plant has reduced damage compared to non-transgenic wild-type plants, the method and / or use of the present invention is achieved, i.e., the method and / or use of controlling lepidopteran pests is achieved by contacting lepidopteran pests with Cry1Da1 protein.

[0039] In a preferred embodiment, the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera or Spodoptera argentipes.

[0040] In a preferred embodiment, the plant is a monocot or a dicot; in a more preferred embodiment, the plant is corn or soybean.

[0041] The "plant" described in the present invention is any plant, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc.

[0042] In a seventh aspect, the present invention provides use of the insecticidal protein, nucleic acid molecule, recombinant expression vector or insecticidal composition of the present invention for controlling lepidopteran pests.

[0043] In a preferred embodiment, the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera or Spodoptera argentipes.

[0044] The amino acid and nucleotide sequences involved in this article are shown in the following table:

[0045] The technical solution of the present invention is further illustrated below through specific embodiments.

[0046] Example 1 Mutational modification of Cry1Da1 protein

[0047] Through protein structure analysis, we discovered that the loop region in Domain II of the Cry1Da1 protein (herein referred to as BD1-001) may be important for receptor binding. We focused on modifying this region, mutating multiple amino acid positions. Furthermore, we found that substitutions at the C-terminus enhanced the protein's insecticide activity to a certain extent. The protein modification methods are listed in Table 1.

[0048] Table 1 Cry1Da1 modified protein and modification method

[0049] In the modification method, the first amino acid abbreviation represents the original amino acid in the protein, the number following it represents the amino acid position, and the second amino acid abbreviation represents the amino acid placed at that position in the modified protein. The C-terminus of Cry8Ea1 and the C-terminus of Cry1Ac refer to the replacement of the amino acid sequence after position 606 of the original amino acid sequence with the corresponding amino acid sequences of the Cry8Ea1 and Cry1Ac proteins.

[0050] Example 2 Construction of in vitro expression vector of Cry1Da1 protein and protein purification

[0051] 1. Construction of a recombinant cloning vector containing Cry1Da1 genes

[0052] 1) After site-directed mutagenesis of the BD1-001 amino acid sequence, the Cry1Da1-like amino acid sequences BD1-011, BD1-013, BD1-014, BD1-015, BD1-018, BD1-019, BD1-020, BD1-021, and BD1-022 were obtained. The BD1-022 amino acid sequence was truncated at the C-terminus to obtain BD1-022S.

[0053] 2) Using the BamHI and HindIII restriction sites, the nucleotide sequence of the control protein BD1-002 gene (SEQ ID NO: 13) was cloned and ligated into the pET28a plasmid (Novagen, USA, CAT: 69864-3) to generate the recombinant vector DBN002A. The construction process is shown in Figure 1 (wherein, f1 origin represents the replication origin of bacteriophage f1; Kan represents the kanamycin resistance gene; T7 promoter represents the T7 RNA polymerase promoter; His Tag represents the His tag; BD1-002 represents the nucleotide sequence of BD1-002 (SEQ ID NO: 13); and T7 terminator represents the T7 terminator). Competent Escherichia coli BL21(DE3) cells (Transgen, China, CAT: CD501) were transformed using the heat shock method. Heat shock conditions were as follows: 50 μL of E. coli BL21 (DE3) competent cells and 10 μL of plasmid DNA were incubated in a 42°C water bath for 30 seconds, followed by shaking at 37°C at 100 rpm for 1 hour. The culture was then plated onto a LB solid plate (1% tryptone, 1% NaCl, 0.5% yeast extract, 1.5% agar) containing 50 mg / L kanamycin and incubated at 37°C for 12 hours. A single colony was then inoculated into 5 mL of LB liquid medium (1% tryptone, 1% NaCl, 0.5% yeast extract, adjusted to pH 7.5 with NaOH) and supplemented with kanamycin to a final concentration of 50 mg / L. The plate was then shaken at 37°C at 220 rpm for 16 hours, and the plasmid was extracted using the AxyPrep Plasmid DNA Extraction Kit (CORNING, China, CAT: AP-MN-P-50). The obtained plasmid was verified by BamHI and HindIII enzyme digestion, and the positive clone was sequenced. The results showed that the target nucleotide sequence inserted in the positive recombinant cloning vector was the nucleotide sequence shown in SEQ ID NO: 13 in the sequence list, that is, the BD1-002 nucleotide sequence was correctly inserted.

[0054] 3) Following the above-described method for constructing a recombinant cloning vector, the BD1-011 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN011A, wherein BD1-011 represents the BD1-011 nucleotide sequence (SEQ ID NO: 14). Enzyme digestion and sequencing verification confirmed that the BD1-011 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN011A.

[0055] 4) Following the above-described method for constructing a recombinant cloning vector, the BD1-013 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN013A, wherein BD1-013 represents the BD1-013 nucleotide sequence (SEQ ID NO: 15). Enzyme digestion and sequencing verification confirmed that the BD1-013 nucleotide sequence in the recombinant cloning vector DBN013A was correctly inserted.

[0056] 5) Following the above-described method for constructing a recombinant cloning vector, the nucleotide sequence of BD1-014 was ligated into pET28a to generate the recombinant cloning vector DBN014A, wherein BD1-014 represents the nucleotide sequence of BD1-014 (SEQ ID NO: 16). Enzyme digestion and sequencing verification confirmed that the nucleotide sequence of BD1-014 was correctly inserted into the recombinant cloning vector DBN014A.

[0057] 6) Following the above-described method for constructing a recombinant cloning vector, the BD1-015 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN015A, wherein BD1-015 represents the BD1-015 nucleotide sequence (SEQ ID NO: 17). Enzyme digestion and sequencing verification confirmed that the BD1-015 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN015A.

[0058] 7) Following the above-described method for constructing a recombinant cloning vector, the BD1-018 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN018A, wherein BD1-018 represents the BD1-018 nucleotide sequence (SEQ ID NO: 18). Enzyme digestion and sequencing verification confirmed that the BD1-018 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN018A.

[0059] 8) Following the above-described method for constructing a recombinant cloning vector, the BD1-019 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN019A, wherein BD1-019 represents the BD1-019 nucleotide sequence (SEQ ID NO: 19). Enzyme digestion and sequencing verification results confirmed that the BD1-019 nucleotide sequence in the recombinant cloning vector DBN019A was correctly inserted.

[0060] 9) Following the above-described method for constructing a recombinant cloning vector, the BD1-020 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN020A, wherein BD1-020 represents the BD1-020 nucleotide sequence (SEQ ID NO: 20). Enzyme digestion and sequencing verification results confirmed that the BD1-020 nucleotide sequence in the recombinant cloning vector DBN020A was correctly inserted.

[0061] 10) Following the above-described method for constructing a recombinant cloning vector, the BD1-021 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN021A, wherein BD1-021 represents the BD1-021 nucleotide sequence (SEQ ID NO: 21). Enzyme digestion and sequencing verification confirmed that the BD1-021 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN021A.

[0062] 11) Following the above-described method for constructing a recombinant cloning vector, the BD1-022 nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN022A, wherein BD1-022 represents the BD1-022 nucleotide sequence (SEQ ID NO: 22). Enzyme digestion and sequencing verification confirmed that the BD1-022 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN022A.

[0063] 12) Following the above-described method for constructing a recombinant cloning vector, the BD1-022S nucleotide sequence was ligated into pET28a to generate the recombinant cloning vector DBN022SA, wherein BD1-022S represents the BD1-022S nucleotide sequence (SEQ ID NO: 34). Enzyme digestion and sequencing verification confirmed that the BD1-022S nucleotide sequence was correctly inserted into the recombinant cloning vector DBN022SA.

[0064] 2. In vitro expression of Cry1Da1-like proteins

[0065] 1) Pick a positive monoclonal colony and inoculate it into 5 mL of LB liquid medium. Add kanamycin to a final concentration of 50 mg / L and culture on a shaker at 37°C and 220 rpm for 16 h to obtain the activated strain.

[0066] 2) The bacterial suspension was transferred to 2×YT medium (1.6% tryptone, 0.5% NaCl, 1% yeast extract) at a ratio of 1:10 and cultured on a shaker at 37° C. and 220 rpm for 1 h.

[0067] 3) When the culture solution OD600 = 0.6-0.8, add IPTG with a final concentration of 0.5 mM to induce expression, and culture on a shaker at 37°C and 220 rpm for 6 h.

[0068] 4) Collect the cells at 7000 rpm for 5 min, discard the supernatant, and resuspend the cells in an appropriate amount of PBS buffer. Ultrasonicate the cells to obtain a broken bacterial solution. Centrifuge the broken bacterial solution at 7000 rpm for 5 min to obtain a soluble fraction and an insoluble fraction. Resuspend the insoluble fraction in PBS buffer.

[0069] 5) Take an appropriate amount of sample and perform SDS-PAGE analysis. The results show that the target protein is mainly present in the soluble fraction.

[0070] 3. Purification of Cry1Da1-like proteins

[0071] 1) Using the AKTA Rapid Purification System, purify the soluble fraction using a HisTrap HP nickel column to obtain purified Cry1Da1-like protein. Desalt the purified protein using a HiTrap Desalting column. Refer to the AKTA manual for the procedure.

[0072] 2) Take an appropriate amount of the desalted and purified sample and perform SDS-PAGE detection.

[0073] 3) Calculate the protein concentration in the desalted protein solution based on the BSA standard curve.

[0074] 4) The purified protein was stored at -20°C for future use.

[0075] Example 3 Test of resistance of modified protein to Lepidoptera insects

[0076] 3.1 Bioassay for Fall Armyworm Feed

[0077] The modified proteins expressed in prokaryotes were fed to the fall armyworm to compare their insecticide activity. The concentrated protein solution was mixed with fall armyworm feed (final concentration 1μg / g), mixed evenly and placed in a culture dish. Healthy, unfed newly hatched larvae of fall armyworm were selected as test insects. Ten larvae were inoculated. After the insect test dish was covered, it was placed at a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark) of 16:8 until the end of the experiment on the third day. By comparing the mortality rate and inhibition rate of the test insects, the insecticide activity of each protein was divided into four levels, represented by "+". The larger the number, the better the insecticide effect. The results are shown in Table 2.

[0078] Table 2. Comparison of anti-insect activity of modified proteins against Spodoptera frugiperda The more “+” there are, the better the insect resistance effect is.

[0079] A modified protein with excellent resistance to Spodoptera frugiperda was selected and compared with the patented protein BD1-002 (BD1-002 (Cry1Da1_7) is a patented sequence modified from BD1-001 (Cry1Da1)). The BD1-001 and BD1-002 sequences are from the public information of patent US10287605B2 or NCBI GenBank: CAA38099.1, with a full amino acid sequence length of 1165 aa). The same protein feeding method as described above was used, but the final protein concentration in the feed was adjusted to 1 μg / g. After three days of treatment, the mortality rate of Spodoptera frugiperda larvae was calculated: mortality rate = number of dead larvae / total number of larvae exposed × 100%. A diet supplemented with CBS buffer alone and a diet supplemented with sterile water alone served as negative controls. The mortality rate in the CBS buffer-treated group was used as the control mortality rate, and the control mortality rate was used to calculate the adjusted mortality rate: adjusted mortality rate = (treatment mortality rate - control mortality rate) / (1 - control mortality rate) × 100%. Each system was replicated 6 times and the experiment was repeated 2 times. The results are shown in Table 3.

[0080] Table 3. Insect resistance results of fall armyworm fed with protein (3 days) *Indicates that the data are significantly different.

[0081] As can be seen from Table 3, compared with the BD1-002 protein, the mortality rate of the fall armyworm that ingested the above-mentioned modified protein was significantly increased, indicating that the insecticidal activity of the above-mentioned modified protein of the present application against the fall armyworm is significantly better than that of the patented protein BD1-002.

[0082] 3.2 Bioassay of cotton bollworm feed

[0083] The concentrated protein solution was mixed with cotton bollworm diet (final concentration 20 μg / g), mixed thoroughly, and placed in a Petri dish. Healthy, unfed, newly hatched larvae of cotton bollworms were selected as test larvae, with one larva placed per well, and 12 larvae were assigned as replicates. The plates were covered and incubated at 25-28°C, 70% relative humidity, and a photoperiod (light / dark ratio) of 16:8 until the seventh day of the experiment. Mortality of the cotton bollworm larvae was calculated as follows: mortality = number of deaths / total number of inoculated larvae × 100%. A diet supplemented with CBS buffer alone and a diet supplemented with sterile water alone served as negative controls. The mortality of the CBS buffer-treated group was used as the control mortality. The control mortality was used to calculate the adjusted mortality: adjusted mortality = (treatment mortality - control mortality) / (1 - control mortality) × 100%. Six replicates were performed for each system, and the experiment was repeated twice. The results are shown in Table 4.

[0084] Table 4. Insect resistance results of cotton bollworms fed with protein (7 days) *Indicates that the data are significantly different.

[0085] As can be seen from Table 4, compared with the BD1-002 protein, the mortality rate of cotton bollworms fed with the modified protein of the present application was significantly increased, indicating that the insecticidal activity of the modified protein of the present application against cotton bollworms is significantly better than that of the patented protein BD1-002.

[0086] 3.3 Bioassay for Spodoptera exigua Feed

[0087] The concentrated protein solution was mixed with Spodoptera argentipes feed (final concentration 100 μg / g), mixed thoroughly, and placed in a Petri dish. Healthy, unfed, newly hatched larvae of Spodoptera argentipes were selected as test insects, and 10 larvae were seeded. The plates were covered and kept at 25-28°C, 70% relative humidity, and a photoperiod (light / dark ratio) of 16:8. The experiment was terminated on the third day. Mortality of Spodoptera argentipes larvae was calculated as follows: mortality = number of dead larvae / total number of larvae seeded × 100%. A diet supplemented with CBS buffer alone and a diet supplemented with sterile water alone served as negative controls. The mortality of the CBS buffer-treated group was used as the control mortality. The control mortality was used to calculate the adjusted mortality: adjusted mortality = (treatment mortality - control mortality) / (1 - control mortality) × 100%. Six replicates were performed for each system, and the experiment was repeated twice. The results are shown in Table 5.

[0088] Table 5. Anti-insect results of Spodoptera argentea fed with protein (3 days) *Indicates that the data are significantly different.

[0089] As can be seen from Table 5, compared with the BD1-002 protein, the mortality rate of the Spodoptera that ingested the modified protein of the present application was significantly increased, indicating that the insecticidal activity of the modified protein of the present application against the Spodoptera is significantly better than that of the patented protein BD1-002.

[0090] Example 4 Construction of plant transformants encoding engineered proteins

[0091] 4.1 Construction of transgenic maize plants

[0092] 4.1.1 Construction of expression cassette

[0093] 4.1.1.1 Construction of intermediate vector containing target gene

[0094] The promoter is the maize ubiquitin gene promoter prZmUbi, and the terminator is the nopaline synthase (nos) terminator tNos. The detailed construction process is as follows:

[0095] 1) Using pCAMBIA2301 as a template, PCR amplify the promoter pZmUbi. Add the 20 bp homology arm preceding the DBN-backbone HindIII restriction site to the 5' end and the 20 bp homology arm from the 5' end of the BD1-002 gene to the 3' end to obtain the prZmUbi promoter fragment.

[0096] 2) Using DBN002A as a template, PCR amplify the target gene BD1-002. Add the 20 bp homology arm from the 3' end of prZmUbi to the 5' end and the 20 bp homology arm from the 5' end of tNos gene to the 3' end to obtain the target gene BD1-002 fragment;

[0097] 3) Using pCAMBIA2301 as a template, PCR amplify the terminator tNos. Add a 20-bp homology arm from the 3' end of the BD1-002 gene to the 5' end and a 20-bp homology arm following the DBN-backbone SbfI restriction site to the 3' end to obtain the tNos terminator fragment.

[0098] 4) Double-digest DBN-backbone with HindIII and SbfI to obtain the fragment HindIII-DBN-backbone-SbfI.

[0099] 5) The four fragments obtained in the above steps were connected and transformed using seamless cloning to obtain the intermediate vector DBN-BD1 (RB: right border; prZmUbi: maize ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nopaline synthase (nos) terminator; LB: left border), as shown in Figure 3.

[0100] 4.1.1.2 Construction of intermediate vector containing reporter gene Hpt

[0101] The reporter gene Hpt is a hygromycin phosphotransferase gene, the promoter is the cauliflower mosaic virus 35S promoter pr35S, and the terminator is the cauliflower mosaic virus 35S terminator t35S. The detailed construction process is as follows:

[0102] 1) Using pCAMBIA2301 as a template, PCR amplify the promoter pr35S-06. Add the 20 bp homology arm before the DBN-backbone HindIII restriction site to the 5' end and the 20 bp homology arm from the 5' end of the Hpt gene to the 3' end to obtain the pr35S promoter fragment.

[0103] 2) Using pCAMBIA2301 as a template, PCR amplify the reporter gene Hpt. Add 20 bp of homology to the 3' end of the pr35S promoter at the 5' end and 20 bp of homology to the 5' end of the t35sS terminator at the 3' end to obtain the Hpt gene fragment.

[0104] 3) Using pCAMBIA2301 as a template, PCR amplify the terminator t35S. Add a 20-bp homology arm from the 3' end of the Hpt gene to the 5' end and a 20-bp homology arm following the DBN-backbone SbfI restriction site to the 3' end to obtain the t35S terminator fragment.

[0105] 4) Double-digest DBN-backbone with HindIII and SbfI to obtain the fragment HindIII-DBN-backbone-SbfI.

[0106] 5) The four fragments obtained in the above steps were connected and transformed using seamless cloning to obtain the intermediate vector pDBN-Hpt (RB: right border; pr35S: cauliflower mosaic virus 35S promoter; Hpt: hygromycin phosphotransferase gene; t35S: cauliflower mosaic virus 35S terminator; LB: left border) as shown in Figure 3.

[0107] 4.1.1.3 Final vector construction

[0108] 1) Double-digest DBN-backbone with HindIII and SbfI to obtain the fragment HindIII-DBN-backbone-SbfI;

[0109] 2) PCR amplify BD1-002 cassette using pDBN-BD1 as template, add 20 bp homology arm before DBN-backbone HindIII restriction site at 5' end, and add 20 bp homology arm of Hpt cassette 5' end at 3' end to obtain fragment BD1-002 cassette.

[0110] 3) Using pDBN-Hpt as a template, PCR amplify the Hpt cassette. Add the 20 bp homology arm from the 3' end of the BD1-002 cassette to the 5' end and the 20 bp homology arm after the DBN-backbone SbfI restriction site to the 3' end to obtain the Hpt cassette fragment.

[0111] 4) The three fragments obtained above were connected and transformed using seamless cloning to obtain the final vector DBN002A-C (RB: right border; prZmUbi: maize ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nopaline synthase (nos) terminator; pr35S: cauliflower mosaic virus 35S promoter; Hpt: hygromycin phosphotransferase gene; t35S: cauliflower mosaic virus 35S terminator; LB: left border) as shown in Figure 3.

[0112] 4.1.1.4 Transformation and identification of vectors

[0113] The recombinant expression vector DBN002A-C was transformed into Escherichia coli T1 competent cells using the heat shock method. The heat shock conditions were as follows: 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA were incubated in a 42°C water bath for 30 seconds, followed by shaking at 37°C for 1 hour (shaking at 100 rpm). The culture product was then spread onto a solid LB plate containing 50 mg / L kanamycin and incubated at 37°C for 12 hours. A single colony was selected and inoculated into 5 mL of LB liquid medium, supplemented with kanamycin to a final concentration of 50 mg / L, and incubated on a shaker at 37°C and 220 rpm for 16 hours. A single colony was selected and added to LB liquid medium supplemented with kanamycin to a final concentration of 50 mg / L. The culture was then incubated overnight at 37°C, and the plasmid was extracted using the AxyPrep Plasmid DNA Extraction Kit. The extracted plasmid was digested with restriction endonucleases SbfI and HindⅢ and identified, and the positive clones were sequenced and identified. The results showed that the nucleotide sequence of the recombinant expression vector DBN002A-C between the SbfI and HindⅢ cleavage sites contained the nucleotide sequence shown in SEQ ID NO:13 in the sequence listing, namely, the BD1-002 nucleotide sequence.

[0114] The recombinant expression vector DBN018A-C was obtained by the above-mentioned method for constructing DBN002A-C. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN018A-C contained the nucleotide sequence shown in SEQ ID NO: 18 in the sequence listing, namely the BD1-018 nucleotide sequence.

[0115] The recombinant expression vector DBN019A-C was obtained by the above-mentioned method for constructing DBN002A-C. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN019A-C contained the nucleotide sequence shown in SEQ ID NO: 19 in the sequence listing, namely the BD1-019 nucleotide sequence.

[0116] The recombinant expression vector DBN021A-C was obtained by the above-mentioned method for constructing DBN002A-C. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN021A-C contained the nucleotide sequence shown in SEQ ID NO: 21 in the sequence listing, namely, the BD1-021 nucleotide sequence.

[0117] The recombinant expression vector DBN022A-C was obtained by the above-mentioned method for constructing DBN002A-C. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN022A-C contained the nucleotide sequence shown in SEQ ID NO: 22 in the sequence listing, namely, the BD1-022 nucleotide sequence.

[0118] The recombinant expression vector DBN022SA-C was constructed using the above-mentioned method. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN022SA-C contained the nucleotide sequence shown in SEQ ID NO: 34 in the sequence listing, i.e., the BD1-022S nucleotide sequence.

[0119] 4.1.2 Transformation of Agrobacterium with recombinant expression vector

[0120] The correctly constructed recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C, and DBN022SA-C were transformed into Agrobacterium tumefaciens LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using the liquid nitrogen method. The transformation conditions were as follows: 100 μl of Agrobacterium tumefaciens LBA4404, 3 μl of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and then in a 37°C warm water bath for 10 minutes; the transformed Agrobacterium tumefaciens LBA4404 was inoculated into an LB test tube and incubated at 28°C and 200 rpm. After culturing for 2 hours, the cells were plated on LB plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single colonies emerged. Single colonies were picked and cultured, and their plasmids were extracted. The recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C, and DBN022SA-C were digested with restriction endonucleases and verified. The results showed that the structures of the recombinant expression vectors DBN002A-C, DBN018A-C, DBN019A-C, DBN021A-C, DBN022A-C, and DBN022SA-C were completely correct.

[0121] 4.1.3 Agrobacterium infection of corn plants

[0122] According to the conventional Agrobacterium infection method, sterile immature embryos of the maize variety TJ806 were co-cultured with Agrobacterium transformed with the recombinant expression vector, and the T-DNA of the recombinant expression vector DBN002A-C was transferred into the maize chromosome group to obtain maize plants with the BD1-002 nucleotide sequence; wild-type maize plants were used as a control.

[0123] According to the above method for obtaining corn plants containing BD1-002, corn plants transformed with BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences were obtained.

[0124] For Agrobacterium-mediated transformation of maize, briefly, immature embryos are isolated from maize and contacted with a suspension of Agrobacterium, wherein the Agrobacterium is capable of transmitting the Cry1Da1 nucleotide sequence to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are preferably immersed in the Agrobacterium suspension (OD 660= 0.4-0.6, and inoculated with infection medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / L sucrose, 36 g / L glucose, 40 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH = 5.3) for initial inoculation. The immature embryos are co-cultivated with Agrobacterium for 3 days (Step 2: Co-cultivation Step). Preferably, after the infection step, the immature embryos are cultured on solid medium (4.3 g / L MS salts, 300 mg / L MS vitamins, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH = 5.8). This co-cultivation phase can be followed by an optional "recovery" step. During the "recovery" step, the recovery medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / L agar, pH 5.8) contains at least one antibiotic (cephalosporin) known to inhibit Agrobacterium growth, and no selective agent for plant transformants is added (Step 3: Recovery Step). Young embryos are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells to form callus. The callus is then plated on medium containing the selective agent (hygromycin) to culture and select for growing transformed callus (Step 4: Selection Step). Preferably, callus tissue is cultured on a solid screening medium containing a selective agent (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 5 g / L, hygromycin 50 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8), resulting in the selective growth of transformed cells. The callus tissue is then regenerated into plants (step 5: regeneration step). Preferably, callus tissue grown on a medium containing a selective agent is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate plants. Resistant callus obtained through screening is transferred to the MS differentiation medium (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, hygromycin 50 mg / L, agar 8 g / L, pH 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to MS rooting medium (MS salts 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH 5.8), cultured at 25°C to a height of approximately 10 cm, and then transferred to a greenhouse for cultivation until fruiting. In the greenhouse, the plants were cultured at 28°C for 16 hours and at 20°C for 8 hours each day.

[0125] 4.1.4 Identification of genetically modified corn materials

[0126] Approximately 100 mg of leaves from maize plants transfected with the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S nucleotide sequences were used as samples. Genomic DNA was extracted using the Qiagen DNeasy Plant Maxi Kit. The copy number of the Hpt gene was determined by quantitative TaqMan PCR to determine the copy number of the Cry1Da1 gene. Wild-type TJ806 maize plants were used as controls. The same assay was performed in triplicate. The experimental results of analyzing the copy number of the Hpt reporter gene showed that the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S had been integrated into the chromosome groups of the tested corn plants, respectively, and the corn plants transformed with the nucleotide sequences of BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S had obtained single-copy transgenic corn plants. The single-copy transgenic corn plants were selected for breeding to obtain corn seeds.

[0127] The specific method for detecting the Hpt gene copy number is as follows:

[0128] Step 1: 100 mg of leaves each from a corn plant introduced with the BD1-002 nucleotide sequence, a corn plant introduced with the BD1-018 nucleotide sequence, a corn plant introduced with the BD1-019 nucleotide sequence, a corn plant introduced with the BD1-021 nucleotide sequence, a corn plant introduced with the BD1-022 nucleotide sequence, a corn plant introduced with the BD1-022S nucleotide sequence, and a wild-type corn plant were taken and ground into a homogenate using liquid nitrogen in a mortar. Three replicates were taken for each sample.

[0129] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual.

[0130] Step 3: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0131] Step 4: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL;

[0132] Step 5: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. The sample with known copy number was used as the standard, and the sample of wild-type corn plant was used as the control. Each sample was repeated 3 times, and the average value was taken. The sequences of the fluorescence quantitative PCR primers and probes were:

[0133] Primer 5: cagggtgtcacgttgcaaga (SEQ ID NO: 27);

[0134] Primer 6: ccgctcgtctggctaagatc (SEQ ID NO: 28);

[0135] Probe 1: tgcctgaaaccgaactgcccgctg (SEQ ID NO: 29);

[0136] The PCR reaction system is:

[0137] The 50× primer / probe mixture contained 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1× TE buffer and was stored in an amber tube at 4° C. The PCR reaction conditions were:

[0138] Return to step 1 and perform 40 cycles.

[0139] Data were analyzed using IBM SPSS software.

[0140] 4.2 Construction of transgenic soybean plants

[0141] 4.2.1 Construction of recombinant vector

[0142] The expression vector DBNBC-001 (vector backbone: pCAMBIA2301, provided by CAMBIA) was digested with restriction endonucleases AscⅠ and HindⅢ, and primers 1 (SEQ ID NO: 23) and 2 (SEQ ID NO:24) amplified the BD1-002 nucleotide sequence, and the amplified BD1-002 nucleotide sequence fragment was inserted into the restriction endonuclease AscⅠ and HindⅢ restriction sites of the expression vector DBNBC-001 by seamless cloning to construct a recombinant expression vector DBN002A-B. The construction process is shown in Figure 2 (RB: right border; eFMV: enhancer; prBrCBP: CBP1 gene promoter; spAtCTP2: signal peptide; cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase; tPsE9: pea ribulose-1,5-bisphosphate carboxylase / oxygenase small subunit E9 protein gene terminator; prAtUbi10: Arabidopsis thaliana ubiquitin gene promoter; BD1-002: BD1-002 nucleotide sequence (SEQ ID NO: 13); tNos: nopaline synthase (nos) terminator; pr35s: cauliflower mosaic virus 35S promoter; PAT: phosphinothricin acetyltransferase gene; t35s: cauliflower mosaic virus 35S terminator; LB: left border). The method for constructing this vector is well known to those skilled in the art.

[0143] The recombinant expression vector DBN002A-B was transformed into Escherichia coli T1 competent cells using the heat shock method. The heat shock conditions were as follows: 50 μL of E. coli T1 competent cells and 10 μL of plasmid DNA were incubated in a 42°C water bath for 30 seconds, followed by shaking at 37°C for 1 hour (shaking at 100 rpm). The culture product was then spread onto a solid LB plate containing 50 mg / L kanamycin and incubated at 37°C for 12 hours. A single colony was picked and inoculated into 5 mL of LB liquid medium, which was supplemented with kanamycin to a final concentration of 50 mg / L. The cells were then shaken at 37°C and 220 rpm for 16 hours. A single colony was picked and added to LB liquid medium supplemented with kanamycin to a final concentration of 50 mg / L. The cells were then incubated overnight at 37°C, and the plasmid was extracted using the AxyPrep Plasmid DNA Extraction Kit. The extracted plasmid was digested with restriction endonucleases AscⅠ and HindⅢ and identified, and the positive clones were sequenced and identified. The results showed that the nucleotide sequence of the recombinant expression vector DBN002A-B between the AscⅠ and HindⅢ restriction sites was the nucleotide sequence shown in SEQ ID NO:13 in the sequence listing, namely, the BD1-002 nucleotide sequence.

[0144] Following the above-described method for constructing DBN002A-B, the BD1-018 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25). The amplified BD1-018 nucleotide sequence fragment was seamlessly cloned into the expression vector DBNBC-001 between the restriction enzyme cleavage sites to generate the recombinant expression vector DBN018A-B. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN018A-B contained the nucleotide sequence set forth in SEQ ID NO: 18 in the sequence listing, i.e., the BD1-018 nucleotide sequence.

[0145] Following the above-described method for constructing DBN002A-B, the BD1-019 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25). The amplified BD1-019 nucleotide sequence fragment was seamlessly cloned into the expression vector DBNBC-001 between the restriction enzyme cleavage sites to generate the recombinant expression vector DBN019A-B. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN019A-B contained the nucleotide sequence set forth in SEQ ID NO: 19 in the sequence listing, i.e., the BD1-019 nucleotide sequence.

[0146] Following the above-described method for constructing DBN002A-B, the BD1-021 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 3 (SEQ ID NO: 25). The amplified BD1-021 nucleotide sequence fragment was seamlessly cloned into the expression vector DBNBC-001 between the restriction enzyme cleavage sites to generate the recombinant expression vector DBN021A-B. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN021A-B contained the nucleotide sequence set forth in SEQ ID NO: 21 in the sequence listing, i.e., the BD1-021 nucleotide sequence.

[0147] Following the above-described method for constructing DBN002A-B, the BD1-022 nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 4 (SEQ ID NO: 26). The amplified BD1-022 nucleotide sequence fragment was seamlessly cloned into the expression vector DBNBC-001 between the restriction enzyme cleavage sites to generate the recombinant expression vector DBN022A-B. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN022A-B contained the nucleotide sequence set forth in SEQ ID NO: 22 in the sequence listing, i.e., the BD1-022 nucleotide sequence.

[0148] Following the above-described method for constructing DBN002A-B, the BD1-022S nucleotide sequence was amplified using primer 1 (SEQ ID NO: 23) and primer 9 (SEQ ID NO: 35). The amplified BD1-022S nucleotide sequence fragment was seamlessly cloned into the expression vector DBNBC-001 between the restriction enzyme cleavage sites to generate the recombinant expression vector DBN022SA-B. Enzyme digestion and sequencing confirmed that the nucleotide sequence in the recombinant expression vector DBN022SA-B contained the nucleotide sequence set forth in SEQ ID NO: 34 in the sequence listing, i.e., the BD1-022S nucleotide sequence.

[0149] 4.2.2 Transformation of Agrobacterium with recombinant expression vector

[0150] The correctly constructed recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method. The transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, and then in a 37°C warm water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into an LB test tube and incubated at 28°C and 200 rpm. After culturing for 2 hours, the cells were plated on LB plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single clones grew. Single clones were picked for culture and their plasmids were extracted. The recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were digested with restriction endonucleases and then verified. The results showed that the structures of the recombinant expression vectors DBN002A-B, DBN018A-B, DBN019A-B, DBN021A-B, DBN022A-B and DBN022SA-B were completely correct.

[0151] 4.2.3 Agrobacterium infection of soybean plants

[0152] According to the conventional Agrobacterium infection method, the cotyledonary node tissue of the aseptically cultured soybean variety SY2043C was co-cultured with Agrobacterium transformed with the recombinant expression vector, and the T-DNA of the recombinant expression vector DBN002A-B was transferred into the soybean chromosome group to obtain soybean plants with the BD1-002 nucleotide sequence; at the same time, wild-type soybean plants were used as a control.

[0153] Following the method described above for obtaining soybean plants harboring BD1-002, soybean plants harboring BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S nucleotide sequences were obtained. For Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3 g / L B5 salts, 20 g / L B5 vitamins, 8 g / L sucrose, pH 5.6). Seeds were plated onto the germination medium and incubated under the following conditions: temperature 25 ± 1°C, photoperiod (16 / 8 h light / dark). After 4-6 days of germination, fresh green, swollen soybean seedlings at the cotyledonary node were harvested. The hypocotyl was removed 3-4 mm below the cotyledonary node, the cotyledons were cut longitudinally, and the terminal bud, lateral buds, and seminal roots were removed. The back of a scalpel is used to wound the cotyledonary node, and the wounded cotyledonary node tissue is contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transmitting the Cry1Da1 nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step). In this step, the cotyledonary node tissue is preferably immersed in the Agrobacterium suspension (OD 660=0.5-0.8) and inoculated with infection medium (MS salts 2 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, 2-morpholineethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, acetosyringone 40 mg / L, pH = 5.3) for initial inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation Step). Preferably, after the infection step, the cotyledonary node tissue is cultured on solid medium (MS salts 4 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, agar 8 g / L, MES 4 g / L, ZT 2 mg / L, pH = 5.6). This co-cultivation period can be followed by an optional "recovery" step. In the "recovery" step, the recovery medium (3 g / L B5 salts, 8 g / L B5 vitamins, 8 g / L agar, 30 g / L sucrose, 1 g / L MES, 2 mg / L ZT, 150 mg / L cephalosporin, 100 mg / L glutamic acid, 100 mg / L aspartic acid, pH 5.6) contains at least one antibiotic known to inhibit the growth of Agrobacterium (cephalosporin), and no selective agent for plant transformants is added (Step 3: Recovery Step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on solid medium containing antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Subsequently, the tissue pieces regenerated from the cotyledonary nodes are cultured on medium containing the selective agent (phosphinothricin) to select for growing transformed callus (Step 4: Selection Step). Preferably, the tissue pieces regenerated from the cotyledonary nodes are cultured on a screening solid medium with a selective agent (sucrose 30 g / L, agar 8 g / L, B5 salts 3 g / L, B5 vitamins, MES 1 g / L, 6-benzyladenine 1 mg / L, cephalosporin 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, phosphinothricin 6 mg / L, pH = 5.6), resulting in selective growth of the transformed cells. The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the tissue pieces regenerated from the cotyledonary nodes grown on a medium containing a selective agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0154] The resistant tissue blocks obtained by screening were transferred to the B5 differentiation medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH = 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid 1 mg / L), cultured at 25°C on the rooting medium to a height of approximately 10 cm, and then transferred to the greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 26°C for 16 hours and then at 20°C for 8 hours each day.

[0155] 4.2.4 Identification of genetically modified soybean materials

[0156] Approximately 100 mg of leaves from soybean plants transfected with the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022, and BD1-022S nucleotide sequences were used as samples. Genomic DNA was extracted using the Qiagen DNeasy Plant Maxi Kit. The PAT gene copy number was determined by quantitative TaqMan PCR. Wild-type SY2043C soybean plants were used as controls. The same assay was performed in triplicate. The experimental results of analyzing the copy number of the target gene showed that the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences had been integrated into the chromosome groups of the tested soybean plants, respectively, and the soybean plants transformed with the BD1-002, BD1-018, BD1-019, BD1-021, BD1-022 and BD1-022S nucleotide sequences had obtained single-copy transgenic soybean plants. The single-copy transgenic soybean plants were selected for breeding to obtain soybean seeds.

[0157] The specific method for detecting the PAT gene copy number is as follows:

[0158] Step 1. Take 100 mg of leaves each of soybean plants transformed with the BD1-002 nucleotide sequence, soybean plants transformed with the BD1-018 nucleotide sequence, soybean plants transformed with the BD1-019 nucleotide sequence, soybean plants transformed with the BD1-021 nucleotide sequence, soybean plants transformed with the BD1-022 nucleotide sequence, soybean plants transformed with the BD1-022S nucleotide sequence, and wild-type soybean plants, grind them into homogenates using liquid nitrogen in a mortar, and take three replicates for each sample;

[0159] Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to the product manual.

[0160] Step 3: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0161] Step 4: adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL;

[0162] Step 5: Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample. The sample with known copy number was used as the standard, and the sample of wild-type soybean plant was used as the control. Each sample was repeated three times, and the average value was taken. The sequences of the fluorescence quantitative PCR primers and probes were:

[0163] Primer 7: gagggtgttgtggctggtattg (SEQ ID NO: 30);

[0164] Primer 8: tctcaactgtccaatcgtaagcg (SEQ ID NO: 31);

[0165] Probe 2: cttacgctgggcctggaaggctag (SEQ ID NO: 32);

[0166] The PCR reaction system is:

[0167] The 50× primer / probe mixture contained 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1× TE buffer and was stored in an amber tube at 4° C. The PCR reaction conditions were:

[0168] Return to step 1 and perform 40×cycle

[0169] Data were analyzed using IBM SPSS software.

[0170] Example 5 Activity test of transgenic corn against lepidopteran pests

[0171] 5.1 Anti-insect effect on fall armyworm

[0172] When transgenic corn plants expressing the modified protein reached the V3-V4 stage, fresh corn leaves were collected for Spodoptera frugiperda bioassay. The leaves were rinsed with sterile water and blotted dry with gauze. The leaves were then cut into approximately 2 cm x 3.5 cm strips. One of the cut strips was placed on moisturizing filter paper at the bottom of a circular plastic Petri dish. Ten newly hatched Spodoptera frugiperda larvae were placed in each dish. The test dishes were covered and incubated for one day at a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark ratio) of 16:8. The mortality rate of Spodoptera frugiperda larvae and leaf damage were calculated (mortality = number of dead insects / total number of insects inoculated × 100%). Corn plants with the same genetic background and without the insect-resistant protein were used as a control. The control mortality rate was used to calculate the adjusted mortality rate: (treated mortality - control mortality) / (1 - control mortality) × 100%). The results are shown in Table 6.

[0173] Table 6. Results of insect resistance test on transgenic corn plants inoculated with Spodoptera frugiperda (1 day)

[0174] 5.2 Effect of transgenic corn on cotton bollworm

[0175] When transgenic corn plants expressing the modified protein reached the V3-V4 stage, fresh corn leaves were collected for cotton bollworm testing. The leaves were rinsed with sterile water and blotted dry with gauze. The leaves were then cut into approximately 2 cm x 3.5 cm strips. One of the cut strips was placed on moisturizing filter paper at the bottom of a circular plastic petri dish. Ten newly hatched cotton bollworm larvae were placed in each dish. The test dishes were covered and placed under conditions of a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark ratio) of 16:8 for three days. The mortality rate of the cotton bollworm larvae was calculated as follows: mortality rate = number of dead larvae / total number of inoculated larvae × 100%. Corn plants with the same genetic background and not transfected with the insect-resistant protein were used as a control. The control mortality rate was used to calculate the adjusted mortality rate: adjusted mortality rate = (treated mortality rate - control mortality rate) / (1 - control mortality rate) × 100%. The results are shown in Table 7.

[0176] Table 7. Results of the insect resistance experiment of transgenic corn plants inoculated with cotton bollworm (3 days)

[0177] It can be seen from Tables 6-7 that compared with transgenic corn expressing BD1-002 protein, the mortality rate of fall armyworm and cotton bollworm was higher after inoculation into corn plants expressing the modified protein of the present application, which indicates that corn expressing the modified protein of the present application has a better insect-resistant effect on fall armyworm and cotton bollworm.

[0178] Example 6: Insect-resistant effects of transgenic soybeans on lepidopteran pests

[0179] 6.1 The anti-insect effect of transgenic soybeans on Spodoptera argentea

[0180] When transgenic soybean plants expressing the modified protein reached the V3 stage, the second-to-last leaf was removed for Spodoptera argentea bioassay. The leaves were rinsed with sterile water and blotted dry with gauze. The leaves were then cut into approximately 2 cm x 3.5 cm strips. One of the strips was placed on moisturizing filter paper at the bottom of a circular plastic Petri dish. Ten newly hatched larvae of Spodoptera argentea were placed in each dish. The test dishes were covered and incubated for three days at a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark ratio) of 16:8. The mortality rate of S. argentea larvae and leaf damage were calculated. Mortality rate = number of dead insects / total number of inoculated insects × 100%. The insect inhibition rate was the ratio of insects of the same age to the number of inoculated insects in the control. Soybeans with the same genetic background and without the insect-resistant protein were used as controls. The control mortality rate was used to calculate the adjusted mortality rate: (treated mortality rate - control mortality rate) / (1 - control mortality rate) × 100%. The results are shown in Table 8.

[0181] Table 8. Results of bioassay on soybean leaves of Spodoptera argentea (3 days)

[0182] 6.2 Effect of transgenic soybeans on the resistance of fall armyworm

[0183] When transgenic soybean plants expressing the modified protein reached the V3 stage, the second-lowest leaf was removed for testing against Spodoptera frugiperda. The leaves were rinsed with sterile water and blotted dry with gauze. The leaves were then cut into approximately 2 cm × 3.5 cm strips. One of the cut strips was placed on moisturizing filter paper at the bottom of a circular plastic Petri dish. Ten newly hatched Spodoptera frugiperda larvae were placed in each dish. The test dishes were covered and incubated for 3 days at a temperature of 25-28°C, a relative humidity of 70%, and a photoperiod (light / dark ratio) of 16:8. The mortality rate of the Spodoptera frugiperda larvae was calculated as follows: mortality rate = number of dead insects / total number of inoculated insects × 100%. Corn plants with the same genetic background and without the insect-resistant protein were used as a control. The control mortality rate was used to calculate the adjusted mortality rate: adjusted mortality rate = (treated mortality rate - control mortality rate) / (1 - control mortality rate) × 100%. The results are shown in Table 9.

[0184] Table 9. Results of bioassay on soybean leaves of Spodoptera frugiperda (3 days)

[0185] It can be seen from Table 8 that compared with the transgenic soybeans expressing BD1-002 protein, the soybean plants expressing the modified protein of the present application have a lower leaf damage rate, and a higher insect mortality rate and insect inhibition rate of the silver-striped armyworm, indicating that the soybeans expressing the modified protein of the present application have a more excellent insect-resistant effect on the silver-striped armyworm; similarly, it can be seen from Table 9 that the mortality rate of the soybean plants expressing the modified protein of the present application to the fall armyworm is also higher than that of the transgenic soybeans expressing BD1-002 protein, indicating that the modified protein of the present application has a more excellent insect-resistant effect on the silver-striped armyworm.

[0186] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention.

[0187] References:

[0188] 1.Bacillus thuringiensis Cry1Da_7 and Cry1B.868 Protein Interactions with Novel Receptors Allow Control of Resistant Fall Armyworms,Spodoptera frugiperda(JESmith).(2019)Appl Environ Microbiol 85.

Claims

1. An insecticidal protein comprising the amino acid sequence shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO:

33.

2. A nucleic acid molecule encoding the insecticidal protein according to claim 1; Preferably, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11 or SEQ ID NO:33 is shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:22 or SEQ ID NO:34, respectively. A recombinant expression vector comprising the nucleic acid molecule according to claim 2 .

4. An insecticidal composition comprising the insecticidal protein according to claim 1.

5. A method for controlling lepidopteran pests, comprising contacting the lepidopteran pests with the insecticidal protein according to claim 1 or the insecticidal composition according to claim 4.

6. A method for controlling lepidopteran pests, comprising introducing the nucleic acid molecule according to claim 2 or the recombinant expression vector according to claim 3 into a plant, and allowing the lepidopteran pests to feed on the plant.

7. The method according to claim 5 or 6, wherein the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera or Spodoptera argentipes.

8. The method according to claim 6, wherein the plant is a monocot or a dicot; preferably, the plant is corn or soybean.

9. Use of the insecticidal protein according to claim 1, the nucleic acid molecule according to claim 2, the recombinant expression vector according to claim 3 or the insecticidal composition according to claim 4 for controlling lepidopteran pests.

10. The use according to claim 9, wherein the lepidopteran pest is Spodoptera frugiperda, Helicoverpa armigera or Spodoptera argentipes.

Images