In vitro amplification of DNA methylation patterns
The method using DNMT5 and methyl donor reagents preserves methylation patterns during nucleic acid amplification, addressing the issue of incomplete sequencing in current methods, thereby improving cancer biomarker detection and diagnosis.
Patent Information
- Application Number
- PCT/EP2025/058912
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-17
- Filing Date
- 2025-04-02
- Publication Date
- 2025-10-09
AI Technical Summary
Current nucleic acid amplification methods fail to preserve methylation patterns, which are crucial for identifying cancer biomarkers, leading to incomplete sequencing and diagnostic inefficiencies.
A method involving the use of DNA methyltransferase 5 (DNMT5) to selectively methylate newly synthesized strands during nucleic acid amplification, preserving methylation patterns by contacting the sample with methyltransferase and methyl donor reagents like S-adenosyl-L-methionine, while using adapter complexes with unique molecular identifiers to ensure accurate methylation propagation.
Preserves methylation patterns during amplification, enabling accurate identification of cancer biomarkers and differentiation between cancer subtypes, enhancing diagnostic precision and sequencing accuracy without the need for bisulfite treatment.
Smart Images

Figure EP2025058912_09102025_PF_FP_ABST
Abstract
Description
[0001] IN VITRO AMPLIFICATION OF DNA METHYLATION PATTERNS
[0002] FIELD OF THE INVENTION
[0003] The present disclosure relates to the field of nucleic acid-based diagnostics. More specifically, the invention related to a method of detecting epigenetic modifications in nucleic acid molecules, wherein the epigenetic modifications may have biological and clinical significance.
[0004] SEQUENCE LISTING
[0005] The instant patent application contains a Sequence Listing, which has been submitted electronically in XML format, and is hereby incorporated by reference in its entirety. The XML copy, created February 11, 2025, is named “P38966-US-l_Sequence_Listing,” and is 20,992 bytes in size.
[0006] BACKGROUND OF THE DISCLOSURE
[0007] DNA methylation plays a major role in regulating various physiological and pathological processes in mammals. DNA methylation is an important epigenetic event in modulating embryonic development, genomic imprinting, X inactivation, cellular differentiation, and proliferation. Abnormal patterns of DNA methylation, however, are correlated with DNA instability and will ultimately trigger a subsequent heritage or required diseases such as cancer, though increasingly DNA methylation is being reported as a potential biomarker for other psychiatric and metabolic diseases as well. DNA methylation, primarily occurring at the C5 position within the cytosine ring within cytosine-guanine (CpG) dinucleotides, is frequently found clustered at gene regulatory sites such as promoter regions. Dense methylation of CpGs in the gene promoter region is associated with a compacted chromatin structure resulting in transcriptional silencing of the affiliated gene. If DNA hypermethylation or hypomethylation occurs at the promoter regions of certain critical cancer-related genes, it could lead to tumor suppressor gene silencing and ultimately tumorigenesis.
[0008] Biomarkers constitute one of the most important fields in cancer diagnosis. Cancer biomarkers are especially useful for the early detection or diagnosis of the disease. Biomarkers can be used to screen patients, for classifying the different stages or grades of cancers and to predict prognosis and resistance to therapy. It is believed that DNA methylation changes are present and detectable in tumors and in blood. Therefore, aberrant DNA methylation of specific oncogenes may be regarded as biomarkers for the early diagnosis of cancer.
[0009] BRIEF SUMMARY OF THE DISCLOSURE
[0010] Diagnostic approaches based on the identification of DNA methylation changes may permit an implementation of early detection strategies, tumor staging, and / or novel therapeutic approaches targeting early cellular changes, all of which may lead to more effective cancer treatment. It is thus desirable to identify and / or recognize methylation changes present in DNA, the methylation changes serving as cancer biomarkers for the early detection and / or diagnosis of cancer. In some embodiments, these cancer biomarkers are fragments of a polynucleotide (e.g., regions of genome polynucleotide or DNA) which likely contain CpG island(s), or fragments which are more susceptible to methylation or demethylation than other regions of genome DNA. In some embodiments, the present disclosure facilitates the identification of cancer biomarkers for the early detection and diagnosis of cancer. In other embodiments, the present disclosure facilitates the identification of cancer biomarkers as a tool for differentiating between subtypes of cancer.
[0011] In view of the foregoing, Applicant has developed a method of amplifying one or more nucleic acid molecules while preserving the methylation patterns present in the one or more nucleic acid molecules, such as by contacting the sample with a methyltransferase, such as DNA methyltransferase 5 (DNMT5). Some sequencing platforms, such Roche's Nanopore sequencing platform, have the ability to not only measure the sequence of nucleotides in a nucleic acid molecule, but also to detect signatures associated with methylated versus unmethylated bases within that same nucleic acid molecule. State-of-the-art amplification methods copy only the sequence of the nucleotides without propagating the methylation patterns to progeny nucleic acid molecules. To satisfy the requirements for sequencing, it is usually required that nucleic acid molecules be amplified prior to sequencing. The present disclosure provides a method of both amplifying the original nucleic acid molecule while preserving its methylation pattern, thereby not only allowing the sequence of the nucleic acid molecule to be ascertained but also facilitating the identification of any methylated nucleotides within the nucleic acid molecule.
[0012] A first aspect of the present disclosure is a method of preserving a methylation pattern within one or more nucleic acid molecules during amplification, comprising: (a) obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; (b) ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules; (c) amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and (d) selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules, wherein the selective methylation comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with DNA methyltransferase 5 (DNMT5).
[0013] In some embodiments, the selective methylation further includes contacting the sample including the one or more amplified double stranded nucleic acid molecules with ATP.
[0014] In some embodiments, the selective methylation further includes contacting the sample including the one or more amplified double stranded nucleic acid molecules with a methyl donor reagent. In some embodiments, the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof. In some embodiments, the methyl donating agent is selected from the group consisting of 5-(5 '-Adenosyl )-Z-methionine-(5-methyl-13C) chloride, 5-(5'-Adenosyl)-Z- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-m ethionine iodide, S-(5'-Adenosyl)-L- methionine / ?-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
[0015] In some embodiments, the selective methylation further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP. In some embodiments, the enzyme is a thermostable enzyme. In some embodiments, enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT). In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 80°C to about 110°C. In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 85°C to about 105°C. In some embodiments, the enzyme is incubated with the sample at a temperature of about 90°C. In some embodiments, the enzyme is incubated with the sample for between about 1 minute to about 8 minutes. In some embodiments, the enzyme is incubated with the sample for between about 2 minutes to about 6 minutes. In some embodiments, the enzyme is incubated with the sample for about 4 minutes.
[0016] In some embodiments, the steps of amplification and selective methylation are performed two or more times. In some embodiments, the steps of amplification and selective methylation are performed ten or more times. In some embodiments, the one or more methylated nucleotides include 5-methylcytosine nucleotides. In some embodiments, the adapter complexes include one or more unique molecular identifiers. In some embodiments, the adapter complexes include an epigenetic unique molecular identifier. In some embodiments, the epigenetic unique molecular identifier includes one or more methylated CpG sites. In some embodiments, the epigenetic unique molecular identifier includes two or more methylated CpG sites. In some embodiments, the adapter complexes further include a genetic unique molecular identifier, wherein the genetic unique molecular identifier includes only unmethylated nucleotides. In some embodiments, the adapter complexes further include a methyltransferase binding enhancer motif.
[0017] In some embodiments, the adapter complexes include a methyltransferase binding enhancer motif. In some embodiments, the adapter complexes further include a genetic unique molecular identifier, wherein the genetic unique molecular identifier includes only unmethylated nucleotides.
[0018] In some embodiments, the adapter complexes include a primer binding site having a 3' end including one or more methylated CpGs.
[0019] In some embodiments, the amplifying of the one or more adapter ligated double stranded nucleic acid molecules includes contacting the one or more adapter ligated double stranded nucleic acid molecules with a polymerase. In some embodiments, the polymerase is a thermostable polymerase. In some embodiments, the amplifying of the one or more adapter ligated double stranded nucleic acid molecules includes isothermal amplification.
[0020] In some embodiments, the method further includes sequencing analyzing the methylation pattern of the one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
[0021] In some embodiments, the method further includes sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules is performed without performing a bisulfite treatment of the one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the sequencing includes a sequencing-by-synthesis technique. In some embodiments, the sequencing includes a sequencing-by-expansion technique.
[0022] A second aspect of the present disclosure is a method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: (a) obtain a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; (b) ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise at least one of a unique molecular identifier, a methyltransferase binding enhancer motif, or a primer binding site comprising a 3' end including one or more methylated CpG sites; (c) amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and (d) selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the steps of amplification and selective methylation are performed two or more times. In some embodiments, the one or more methylated nucleotides are 5-methylcytosine nucleotides.
[0023] In some embodiments, the unique molecular identifier includes one or more methylated CpG sites. In some embodiments, the unique molecular identifier includes two or more methylated CpG sites. In some embodiments, the unique molecular identifier includes three or more methylated CpG sites.
[0024] In some embodiments, the adapter complexes include a first unique molecular identifier including only unmethylated nucleotides; and a second unique molecular identifier including one or more methylated nucleotides; wherein the first and second unique molecular identifiers have a size ranging from 5-mer to about 15-mer.
[0025] In some embodiments, the amplifying of the one or more adapter ligated double stranded nucleic acid molecules includes contacting the one or more adapter ligated double stranded nucleic acid molecules with a polymerase. In some embodiments, the polymerase is a thermostable polymerase. In some embodiments, the amplification includes isothermal amplification.
[0026] In some embodiments, the selective methylation includes contacting the sample including one or more amplified double stranded nucleic acid molecules with a methyltransferase.
[0027] In some embodiments, the methyltransferase is DNMT1. In some embodiments, the method further includes contacting the sample including one or more amplified double stranded nucleic acid molecules with a methyl donating reagent. In some embodiments, the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof. In some embodiments, the methyl donating agent is selected from the group consisting of 5-(5 '-Adenosyl) - / .-methionine-CS'-methyl-13C) chloride, 5-(5'-Adenosyl)-Z-methionine chloride dihydrochloride, S-(5'-Adenosyl)-L- methionine iodide, S-(5'-Adenosyl)-L-m ethionine -toluenesulfonate salt, and S-(5'-Adenosyl)-L- homocysteine. In some embodiments, the selectively methylating further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP. In some embodiments, the enzyme is a thermostable enzyme. In some embodiments, enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S- adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT). In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 80°C to about 110°C. In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 85°C to about 105°C. In some embodiments, the enzyme is incubated with the sample at a temperature of about 90°C. In some embodiments, the enzyme is incubated with the sample for between about 1 minute to about 8 minutes. In some embodiments, the enzyme is incubated with the sample for between about 2 minutes to about 6 minutes. In some embodiments, the enzyme is incubated with the sample for about 4 minutes. In some embodiments, the method further includes contacting the sample including one or more amplified double stranded nucleic acid molecules with UHRF 1.
[0028] In some embodiments, the methyltransferase is DNMT5. In some embodiments, the method further includes contacting the sample including one or more amplified double stranded nucleic acid molecules with ATP. In some embodiments, the method further includes contacting the sample including one or more amplified double stranded nucleic acid molecules with a methyl donating reagent. In some embodiments, the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof. In some embodiments, the methyl donating agent is selected from the group consisting of 5-(5 '-Adenosyl) -Z-methionine-(5-methyl-13C) chloride, 5-(5'-Adenosyl)- Z-methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'-Adenosyl)-L- methionine / ?-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine. In some embodiments, the selectively methylating further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP. In some embodiments, the enzyme is a thermostable enzyme. In some embodiments, enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT). In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 80°C to about 110°C. In some embodiments, the enzyme is incubated with the sample at a temperature ranging from between about 85°C to about 105°C. In some embodiments, the enzyme is incubated with the sample at a temperature of about 90°C. In some embodiments, the enzyme is incubated with the sample for between about 1 minute to about 8 minutes. In some embodiments, the enzyme is incubated with the sample for between about 2 minutes to about 6 minutes. In some embodiments, the enzyme is incubated with the sample for about 4 minutes.
[0029] In some embodiments, the method further includes analyzing the methylation pattern of the one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the methylation pattern is analyzed by PCR, sequencing, bisulfate treatment, or a combination thereof.
[0030] In some embodiments, the method further includes sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules. In some embodiments, the sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules is performed without performing a bisulfite treatment of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0031] A third aspect of the present disclosure is a method preserving a methylation pattern in a nucleic acid amplification assay comprising: (a) copying a first nucleic acid molecule having a methylation pattern into a plurality of nucleic acid molecules; and (b) methylating the plurality of nucleic acid molecules by contacting the plurality of nucleic acid molecules with DNA methyltransferase 5 or a functional fragment thereof, a meth; donating reagent, and ATP, wherein the methylation pattern of the first nucleic acid molecule is preserved in the plurality of nucleic acid molecules, thereby preserving a methylation pattern in the nucleic acid amplification assay. In some embodiments, the first nucleic acid molecule is copied in the presence of at least one nucleic acid primer and a DNA polymerase. In some embodiments, the first nucleic acid molecule is copied using an isothermal amplification technique.
[0032] In some embodiments, the method further includes ligating one or more adapter complexes to the first nucleic acid molecule prior to the copying of the first nucleic acid molecule. In some embodiments, the adapter complexes include one or more unique molecular identifiers. In some embodiments, the one or more unique molecular identifiers include one or more methylated CpGs. In some embodiments, the one or more unique molecular identifiers include two or more methylated CpGs. In some embodiments, the adapter complexes include a methyltransferase binding enhancer motif. In some embodiments, the adapter complexes include a primer binding site making a 3' end including one or more methylated CpG sites. In some embodiments, the adapter complexes include a first unique molecular identifier including only unmethylated nucleotides; and a second unique molecular identifier including one or more methylated nucleotides; wherein the first and second unique molecular identifiers each have a size ranging from 5-mer to about 15-mer. In some embodiments, the adapter complexes include at least two of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site including a 3' end including one or more methylated CpG sites.
[0033] In some embodiments, the method further includes analyzing the methylation pattern of the plurality of nucleic acid molecules. In some embodiments, the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof. In some embodiments, the method further includes sequencing the plurality of nucleic acid molecules without performing a bisulfite treatment. In some embodiments, wherein steps (a) and (b) are repeated for a plurality of cycles. In some embodiments, the plurality of nucleic acid molecules serves as the first nucleic acid molecule in each subsequent cycle.
[0034] In some embodiments, the methylating of the plurality of nucleic acid molecules further comprises contacting the plurality of nucleic acid molecules with a methyl donating agent. In some embodiments, the methyl donating agent is S-adenosyl-L-methionine (SAM) or a derivative or analog thereof. In some embodiments, the methyl donating agent is selected from the group consisting of S-(5'-Adenosyl)-L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-m ethionine iodide, S-(5'-Adenosyl)-L- methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
[0035] In some embodiments, the methylating of the plurality of nucleic acid molecules further comprises contacting the plurality of nucleic acid molecules with a thermostable enzyme capable of catalyzing the synthesis of SAM. In some embodiments, the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S- adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
[0036] A fourth aspect of the present disclosure is a method preserving a methylation pattern in a nucleic acid amplification assay comprising: (a) copying a first nucleic acid molecule having a methylation pattern into a plurality of nucleic acid molecules; and (b) methylating the plurality of nucleic acid molecules by contacting the plurality of nucleic acid molecules with a methyltransferase or a functional fragment thereof, a methyl donating molecule, and one or more optional co-factors, wherein the methylation pattern of the first nucleic acid molecule is preserved in the plurality of nucleic acid molecules, thereby preserving a methylation pattern in the nucleic acid amplification assay, wherein the first nucleic acid molecule includes an adapter complex comprising at least one of (i) a primer binding site that includes one or more methylated nucleotides at its 3' end; (ii) an unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif. In some embodiments, the first nucleic acid molecule is copied using an isothermal amplification technique.
[0037] In some embodiments, the methyl donor is S-adenosyl-L-methionine (SAM). In some embodiments, the methyl donor is S-adenosyl-L-methionine (SAM) or a derivative or analog thereof. In some embodiments, the methyl donating agent is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L-methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'-Adenosyl)-L-m ethionine p- toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
[0038] In some embodiments, the methyltransferase is DNMT1. In some embodiments, the methylating of the plurality of nucleic acid molecules further includes contacting the plurality of nucleic acid molecules with Ubiquitin-like with PHD and Ring Finger Domain 1 (UHRF1). In some embodiments, the methyltransferase is DNMT5.
[0039] In some embodiments, the method further includes analyzing the methylation pattern of the plurality of nucleic acid molecules. In some embodiments, the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof. In some embodiments, the method further includes sequencing the plurality of nucleic acid molecules without performing a bisulfite treatment. In some embodiments, wherein steps (a) and (b) are repeated for a plurality of cycles. In some embodiments, the plurality of nucleic acid molecules serves as the first nucleic acid molecule in each subsequent cycle.
[0040] A fifth aspect of the present disclosure is a kit comprising: (a) a DNA methyltransferase; and (b) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites. In some embodiments, the DNA methyltransferase is DNA methyltransferase 1. In some embodiments, the DNA methyltransferase is DNA methyltransferase 5. In some embodiments, the kit further comprises a methyl donor reagent. In some embodiments, the methyl donating reagent is S-adenosyl-L-methionine (SAM). In some embodiments, the methyl donating reagent is a derivative or analog of SAM. In some embodiments, the derivative or analog of SAM is selected from the group consisting of 5-(5 '-Adenosyl) - / .-methionine-CS’-methyl-l 3C) chloride, 5-(5'- Adenosyl)-Z-methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'- Adenosyl)-L-methionine / ?-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
[0041] In some embodiments, the kit further comprises a thermostable enzyme capable of catalyzing the synthesis of SAM. In some embodiments, the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
[0042] A sixth aspect of the present disclosure is a composition comprising (i) DNA methyltransferase 5 (DNMT5), (ii) a polymerase (including any of those described herein), and (iii) a thermostable enzyme capable of catalyzing the synthesis of S-adenosyl-L-methionine (SAM). In some embodiments, the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT). In some embodiments, the composition further comprises MgCh. In some embodiments, the composition further includes ATP.
[0043] BRIEF DESCRIPTION OF THE FIGURES
[0044] For a general understanding of the features of the disclosure, reference is made to the drawings. In the drawings, like reference numerals have been used throughout to identify identical elements.
[0045] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0046] FIG. 1 sets forth a method of sequencing one or more amplified and selectively methylated nucleic acid molecules in accordance with one embodiment of the present disclosure.
[0047] FIG. 2 illustrates hemimethylated DNA following the amplification of a double stranded nucleic acid molecule, where a template strand of the amplified double stranded nucleic acid molecule retains the methylation pattern of the original double stranded nucleic acid molecule, while a newly synthesized strand of the amplified double stranded nucleic acid molecule is devoid of the original methylation pattern (top). FIG. 2 further illustrates the selective methylation of the newly synthesized strand of the amplified double stranded nucleic acid molecule following maintenance with a DNA methyltransferase.
[0048] FIG. 3 illustrates adapter complexes ligated to the 5' and 3' ends of a nucleic acid molecule. FIG. 4 illustrates a method of amplifying and selectively methylating one or more target double stranded nucleic acid molecules, where adapter complexes including a primer binding site and a genetic unique molecular identifier (GUMI) are ligated to the 5' and 3' ends of the target double stranded nucleic acid molecule prior to amplification and selective methylation.
[0049] FIG. 5 illustrates a method of amplifying and selectively methylating one or more target double stranded nucleic acid molecules, where adapter complexes comprising a primer binding site, a genetic unique molecular identifier (GUMI), and an epigenetic unique molecular identifier (EUMI) are ligated to the 5' and 3' ends of the target double stranded nucleic acid molecule prior to amplification and selective methylation.
[0050] FIG. 6 provides a comparison of DNMT5 versus DNMT1 methylation on a hemimethylated template. The template (150bp) had one methylation site which overlapped with the Sau3Al restriction site. Sau3Al restriction digest was blocked by methylation when it is within the restriction site, so Sau3Al was only able to digest non-methylated site and hemimethylated site (75bp) when the methylation was outside the restriction site. The bands at 150bp indicated full methylation post-DNMT5 treatment of hemimethylated template. A significantly stronger uncut band present after DNMT5 treatment indicated much more efficient methylation compared to DNMT1. Furthermore, a comparison of DNMT5 versus DNMT1 methylation of unmethylated CpG template indicated no de novo methylation as present, since there was no significantly darker uncut band under unmethylated template context. (Note: The hemimethylated template used in this experiment only has methylation outside the restriction site, allowing Sau3 Al to fully digest this sample.)
[0051] FIG. 7 provides a comparison of DNMT5 ATPase activity across different "template" and "no template" conditions. Using ADP-Glo Kinase Assay, ATPase activity of DNMT5 was measured in varying concentrations of DNMT5 under different template conditions. Highest ATPase activity occurred under the presence of hemimethylated template, suggesting hemimethylated template preference. Furthermore, the best DNMT5 enzyme ATPase activity occurred when it was present at about 180 nM. Flankseq mixed templates (120bp) with three methylated sites were used for this experiment.
[0052] FIG. 8 illustrates coupling of amplification (1 cycle PCR) with DNMT5 methylation. Hemimethylated strands were synthesized by single cycle PCR amplification of CLASAU 150bp fully methylated template. Sau3 Al digested only half of these hemimethylated strands due to half of these daughter strands having methylation within restriction site and the other half having methylation outside of the restriction site. DNMT5 treatment of these synthesized hemimethylated strands showed that methylation was occurring because there are fewer cut bands present (lighter cut 75bp band).
[0053] FIG. 9 illustrates that higher concentrations of DNMT5 lead to more methylation events.
[0054] FIG. 10 provides a comparison of DNMT1 and DNMT5 methylation percentage on hemimethylated CpG sites that higher concentrations of DNMT5 lead to more methylation events.
[0055] FIG. 11 provides a comparison of DNMT1 and DNMT5 methylation efficiency on de novo methylation sites.
[0056] FIG. 12 provides a comparison of lx, 3x, 6x cycles of DNMT5-mediated PCR amplification.
[0057] FIG. 13 provides the results of bisulfite sequencing post DNMT1 and UHRF1 treatment. In particular, FIG. 13 shows the results of bisulfite sequencing of DNMT1 and UHRF1 treated samples. Sample 1 is a no methylation control; sample 2 is a full methylation control; sample 3 is a hemimethylation control; and sample 4 is a DNMT1 treated sample. Sample 5 is a DNMT1 + UHRF1 treated sample. The results show that all three controls have the expected methylation levels. Sample 4 shows evidence of methylation only on the top strand (pos 77). However, with the addition of UHRF1, a decrease in de novo methylation on pos. 82 was seen. This suggested that UHRF1 may be inhibiting DNMT1 activity.
[0058] FIGS. 14 and 15 illustrate bisulfite sequencing results of a hemi-methylated CpG site post DNMT1 and UHRF1 treatment. The black bar indicated that a hemi-methylated control showed the expected level of methylation. In particular, FIG. 14 shows that increasing the amount of DNMT1 enzyme (e.g., lx, 3x, and 9x) improved the methylation efficiency, which suggested that at the highest DNMT1 enzyme concentration (e.g., 9x), the level of methylation reached a 92% methylation level on a hemi-methylation CpG site. Blue bars represent methylation percentage and with an increased amount of DNMT1 enzyme alone, lx, 3x and 9x show methylation levels of 79.8%, 92% and 92.8%, respectively. The pink bars represent similar conditions with addition of UHRF1, (maintaining a consistent concentration of UHRF1). The data showed consistency in that UHRF1 inhibited activity of DNMT1 drastically.
[0059] FIG. 15 indicates the extent of methylation at de novo methylation sites. Samples with elevated levels of DNMT1 exhibited substantial de novo methylation. Introducing UHRF1 led to a reduction in de novo methylation levels to < 10%, particularly in samples with increased DNMT1 enzyme concentration The findings demonstrate that UHRF1 hinders DNMT1 activity across the majority of de novo sites.
[0060] FIG. 16 illustrates that an SDS-PAGE of the final preparation showed a single band with a molecular mass of 45 ± 1 kDa, consistent with the expected mass from the enzyme's primary amino acid sequence, while gel filtration on a Sephacryl S-200 column indicated that PfMAT forms a dimeric structure with a molecular mass of 90 ± 9 kDa under native conditions. FIG. 17 depicts that the Pfmat enzyme is highly thermoactive; its activity increased sharply up to the optimal temperature of about 90°C and about a 50% activity was still observed at 105°C.
[0061] FIG. 18 illustrates the LC-MS chromatograms of the SAM control stock and the PfMAT reaction. In the top panel (Control SAM Stock), the chromatogram shows two distinct peaks: SAM, with an m / z of 399.147, and MTA (methylthioadenosine), a degradation product of SAM, with an m / z of 298.097. The integrated intensities of SAM and MTA were 48,013,416 and 13,754,229, respectively. The bottom panel represents the PfMAT test reaction conducted at 80°C. This reaction was diluted 10-fold with water, and a 5 pL aliquot was processed for LC-MS analysis. The new peak labeled "SAM" confirms successful SAM generation in the reaction, as it is absent in the reaction buffer alone. The MTA peak is present, while other minor peaks are components from the reaction buffer. The integrated intensities of SAM and MTA from this run were 2,311 ,613 and 12,652,210 resp.
[0062] FIG. 19 provides an MSRE which shows that PfMAT generates enough SAM at 80°C and 90°C for a 1-hour DNMT5 methylation reaction condition.
[0063] FIG. 20 provides a positive proof of concept that PfMAT is generates sufficient SAM for DNMT5 methylation, such as in about 30 seconds. The box in lanes 8 and 9 indicates the presence of a strong uncut top band indicates effective methylation at the restriction site, demonstrating that methylation was indeed blocking the enzyme's ability to cleave the DNA. This positive result instilled confidence in the feasibility of conducting a PCR setup that incorporates both PfMAT and DNMT5, highlighting PfMAT's compatibility with high denaturation temperatures and the short duration required for methylation.
[0064] FIG. 21 provides a table which shows that the PfMAT - PCR setup successfully maintained robust methylation after 10 cycles, contrasting with the control that lacked DNMT5, which exhibited no methylation. This outcome confirms the preservation of the methylation signal throughout the process. Future experiments will explore templates containing additional methylation sites and will implement increased cycle counts to further enhance amplification.
[0065] FIG. 22 provides the sequencing results. Specifically, the results illustrate the effectiveness of DNMT5-mediated methylation using PfM AT -generated SAM within a PCR environment, with no instances of de novo or incorrect methylation calling. The y-axis represents the percentage of methylation, while the x-axis indicates the specific methylation positions. The template controls demonstrate expected results, with over 90% methylation observed in the fully methylated template, while the unmethylated template showed no methylation. Methylation was present only at a single strand in the hemimethylated template.
[0066] FIG. 23 illustrates that the MSRE assay demonstrates that SAM analogs can function as alternative methyl donors, with a distinct upper band at 150bp, indicating successful methylation. Further studies are underway to assess the thermal stability of these SAM analogs, as additional testing is needed.
[0067] FIG. 24 demonstrates the Impact of Heat-Degraded SAM / SAH on Methylation Efficiency. In particular, FIG. 24 shows the expected masses and fragments derived from SAM and SAH on mass spectroscopy. For instance, FIG. 24illustrates that during LC-MS analysis, molecules can be fragmented into smaller pieces. The image shows the different fragments that can be generated from SAM and SAH upon fragmentation. The numbers associated with each fragment represent their respective mass-to-charge ratios (m / z). These mass values are characteristic of specific fragments and were used to identify the presence of SAM and SAH in the sample.
[0068] FIG. 25 provides chromatograms for SAM and SAH samples after heat and pH incubations permitting a rough estimate of the percentage of degradation. As gleaned from this data, heat treatment of SAM converts it to primarily MTA, with a small amount of SAH and aminopurine observed. No apparent degradation of SAH was observed by heat. The type of buffer (reaction buffer, PCR, or pH 8) did not seem to matter on the observed heat degradation of SAM.
[0069] DETAILED DESCRIPTION
[0070] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0071] As used herein, the singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The term "includes" is defined inclusively, such that "includes A or B" means including A, B, or A and B.
[0072] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of' or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law. The terms "comprising," "including," "having," and the like are used interchangeably and have the same meaning. Similarly, "comprises," "includes," "has," and the like are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the common United States patent law definition of "comprising" and is therefore interpreted to be an open term meaning "at least the following," and is also interpreted not to exclude additional features, limitations, aspects, etc. Thus, for example, "a device having components a, b, and c" means that the device includes at least components a, b, and c. Similarly, the phrase: "a method involving steps a, b, and c" means that the method includes at least steps a, b, and c. Moreover, while the steps and processes may be outlined herein in a particular order, the skilled artisan will recognize that the ordering steps and processes may vary.
[0073] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0074] As used herein, the term "adapter" refers a nucleotide sequence that may be added to another sequence to import additional properties to that sequence. An adapter can be single- or doublestranded or may have both a single-stranded portion and a double-stranded portion.
[0075] As used herein "amplification" refers to a process in which a copy number increases. Amplification may be a process in which replication occurs repeatedly over time to form multiple copies of a template. Amplification can produce an exponential or linear increase in the number of copies as amplification proceeds. Exemplary amplification strategies include polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), rolling circle replication (RCA), cascade-RCA, nucleic acid-based amplification (NASBA), and other isothermal amplification techniques. Also, amplification can utilize a linear or circular template. Amplification can be performed under any suitable temperature conditions, such as with thermal cycling or isothermally. Furthermore, amplification can be performed in an amplification mixture (or reagent mixture), which is any composition capable of amplifying a nucleic acid target, if any, in the mixture. PCR amplification relies on repeated cycles of heating and cooling (i.e., thermal cycling) to achieve successive rounds of replication. PCR can be performed by thermal cycling between two or more temperature setpoints, such as a higher denaturation temperature and a lower annealing / extension temperature, or among three or more temperature setpoints, such as a higher denaturation temperature, a lower annealing temperature, and an intermediate extension temperature, among others. PCR can be performed with a thermostable polymerase, such as Taq DNA polymerase. PCR produces an exponential increase in the amount of a product amplicon over successive cycles. PCR is described, for example, in U.S. Pat. No. 4,683,202; U.S. Pat. No. 4,683,195; U.S. Pat. No. 4,000,159; U.S. Pat. No. 4,965,188; U.S. Pat. No. 5,176,995), the disclosures of each are hereby incorporated by reference herein in their entirety.
[0076] As used herein, the term "biological sample," "tissue sample," "specimen" or the like refers to any sample including a biomolecule (such as a protein, a peptide, a nucleic acid, a lipid, a carbohydrate, or a combination thereof) that is obtained from any organism including viruses. Other examples of organisms include mammals (such as humans; veterinary animals like cats, dogs, horses, cattle, and swine; and laboratory animals like mice, rats, and primates), insects, annelids, arachnids, marsupials, reptiles, amphibians, bacteria, and fungi. Biological samples include tissue samples (such as tissue sections and needle biopsies of tissue), cell samples (such as cytological smears such as Pap smears or blood smears or samples of cells obtained by microdissection), or cell fractions, fragments, or organelles (such as obtained by lysing cells and separating their components by centrifugation or otherwise). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucous, tears, sweat, pus, biopsied tissue (for example, obtained by a surgical biopsy or a needle biopsy), nipple aspirates, cerumen, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. In certain embodiments, the term "biological sample" as used herein refers to a sample (such as a homogenized or liquefied sample) prepared from a tumor or a portion thereof obtained from a subject.
[0077] As used herein, the term "CpG islands" refers to a region of genomic DNA which shows higher frequency of 5'-CG-3' (CpG) dinucleotides than other regions of genome DNA. Methylation of DNA at CpG dinucleotides, in particular, the addition of a methyl group to position 5 of the cytosine ring at CpG dinucleotides, is one of the epigenetic modifications in mammalian cells. CpG islands often harbor the promoters of genes and play a pivotal role in the control of gene expression. CpG islands are usually unmethylated in normal tissues, but a subset of islands becomes methylated during the development of a disease (e.g., tumor development). It has been reported that changes in DNA methylation patterns occur in a developmental stage and tissue specific manner and often accompany tumor development, most notably in the form of CpG island hypermethylation. During tumorigenesis, both alleles of a tumor suppressor gene need to be inactivated by genomic changes such as chromosomal deletions or loss-of-function mutations in the coding region of a gene. As an alternative mechanism, transcriptional silencing by hypermethylation of CpG islands spanning the promoter regions of tumor suppressor genes is a common and important process in carcinogenesis. Since hypermethylation generally leads to inactivation of gene expression, this epigenetic alteration is a key mechanism for long-term silencing of tumor suppressor genes.
[0078] As used herein, the term "ligation" refers to a condensation reaction joining two nucleic acid strands wherein a 5 '-phosphate group of one molecule reacts with the 3 '-hydroxyl group of another molecule. Ligation is typically an enzymatic reaction catalyzed by a ligase or a topoisomerase. Ligation may join two single strands to create one single-stranded molecule. Ligation may also join two strands each belonging to a double-stranded molecule thus joining two double-stranded molecules. Ligation may also join both strands of a double-stranded molecule to both strands of another double-stranded molecule thus joining two double-stranded molecules. Ligation may also join two ends of a strand within a double-stranded molecule thus repairing a nick in the doublestranded molecule.
[0079] As used herein, the term "next generation sequencing" refers to sequencing technologies having high-throughput sequencing as compared to traditional Sanger- and capillary electrophoresisbased approaches, wherein the sequencing process is performed in parallel, for example producing thousands or millions of relatively small sequence reads at a time. Some examples of next generation sequencing techniques include, but are not limited to, sequencing by synthesis, sequencing by ligation, and sequencing by hybridization. These technologies produce shorter reads (anywhere from about 25 - about 500 bp) but many hundreds of thousands or millions of reads in a relatively short time. Examples of such sequencing devices available from Illumina (San Diego, CA) include, but are not limited to iSEQ, MiniSEQ, MiSEQ, NextSEQ, NoveSEQ.
[0080] It is believed that the Illumina next-generation sequencing technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid sequencing. The process simultaneously identifies DNA bases while incorporating them into a nucleic acid chain. Each base emits a unique fluorescent signal as it is added to the growing strand, which is used to determine the order of the DNA sequence. A non-limiting example of a sequencing device available from ThermoFisher Scientific (Waltham, MA) includes the Ion Personal Genome Machine™ (PGM™) System.
[0081] It is believed that Ion Torrent sequencing measures the direct release of H+ (protons) from the incorporation of individual bases by DNA polymerase. A non-limiting example of a sequencing device available from Pacific Biosciences (Menlo Park, CA) includes the PacBio Sequel Systems. A non-limiting example of a sequencing device available from Roche (Pleasanton, CA) is the Roche 454. Next-generation sequencing methods may also include nanopore sequencing methods. In general, three nanopore sequencing approaches have been pursued: strand sequencing in which the bases of DNA are identified as they pass sequentially through a nanopore, exonuclease-based nanopore sequencing in which nucleotides are enzymatically cleaved one-by-one from a DNA molecule and monitored as they are captured by and pass through the nanopore, and a nanopore sequencing by synthesis (SBS) approach in which identifiable polymer tags are attached to nucleotides and registered in nanopores during enzyme-catalyzed DNA synthesis. Common to all these methods is the need for precise control of the reaction rates so that each base is determined in order.
[0082] Strand sequencing requires a method for slowing down the passage of the DNA through the nanopore and decoding a plurality of bases within the channel; ratcheting approaches, taking advantage of molecular motors, have been developed for this purpose. Exonuclease-based sequencing requires the release of each nucleotide close enough to the pore to guarantee its capture and its transit through the pore at a rate slow enough to obtain a valid ionic current signal. In addition, both methods rely on distinctions among the four natural bases, two relatively similar purines and two similar pyrimidines.
[0083] The nanopore SBS approach utilizes synthetic polymer tags attached to the nucleotides that are designed specifically to produce unique and readily distinguishable ionic current blockade signatures for sequence determination. In some embodiments, sequencing of nucleic acid molecules includes via nanopore sequencing includes preparing nanopore sequencing complexes and determining polynucleotide sequences. Methods of preparing nanopores and nanopore sequencing are described in U.S. Patent Application Publication No. 2017 / 0268052, and PCT Publication Nos. WO2014 / 074727, W02006 / 028508, WO2012 / 083249, and WO / 2014 / 074727, the disclosures of which are hereby incorporated by reference herein in their entireties. In some embodiments, tagged nucleotides may be used in the determination of the polynucleotide sequences (see, e.g., PCT Publication No. WO / 2020 / 131759, WO / 2013 / 191793, and WO / 2015 / 148402, the disclosures of which are hereby incorporated by reference herein in their entireties). Analysis of the data generated by sequencing is performed using software and / or statistical algorithms that perform various data conversions, e.g., conversion of signal emissions into base calls, conversion of base calls into consensus sequences for a nucleic acid template, etc. Such software, statistical algorithms, and the use of such are described in detail, in U.S. Patent Application Publication Nos. 2009 / 0024331 2017 / 0044606 and in PCT Publication No. WO / 2018 / 034745, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0084] As used herein, the term "nucleic acid molecule" refers to a molecule whose presence is to be enriched, detected, measured, amplified, and / or subject to further assays and analyses. A nucleic acid molecule may comprise any single and / or double-stranded nucleic acid. Nucleic acid s can exist as isolated nucleic acid fragments or be a part of a larger nucleic acid fragment. Nucleic acid molecules can be derived or isolated from any source, such as cultured microorganisms, uncultured microorganisms, complex biological mixtures, biological samples, tissues, sera, ancient or preserved tissues or samples, environmental isolates, or the like. Further, nucleic acid molecules include or are derived from cDNA, RNA, genomic DNA, cloned genomic DNA, genomic DNA libraries, enzymatically fragmented DNA or RNA, chemically fragmented DNA or RNA, physically fragmented DNA or RNA, or the like. In some embodiments, a nucleic acid molecule may include a whole genome. In exemplary embodiments, a nucleic acid molecule may include the entire nucleic acid content of a sample and / or biological sample. In exemplary embodiments, a nucleic acid molecule may include circulating or cell-free DNA's, e.g., circulating tumor DNA ("ctDNA") present in individuals with cancer or circulating fetal or circulating maternal DNA ("cfDNA") fragments present in plasma or serum of pregnant women. Nucleic acid s can come in a variety of different forms including, for example, simple or complex mixtures, or in substantially purified forms. For example, a nucleic acid molecule can be part of a sample that includes other components or can be the sole or major component of the sample. Also, a nucleic acid molecule can have either a known or unknown sequence.
[0085] As used herein, the term "nucleotide" refers to a nucleoside-5 '-oligophosphate compound, or structural analog of a nucleoside-5 '-oligophosphate, which can act as a substrate or inhibitor of a nucleic acid polymerase. Exemplary nucleotides include, but are not limited to, nucleoside-5 '- triphosphates (e.g., dATP, dCTP, dGTP, dTTP, and dUTP); nucleosides (e.g., dA, dC, dG, dT, and dU) with 5 '-oligophosphate chains of 4 or more phosphates in length (e.g., 5'-tetraphosphosphate, 5'-pentaphosphosphate, 5'-hexaphosphosphate, 5'-heptaphosphosphate, 5'-octaphosphosphate); and structural analogs of nucleoside-5 '-triphosphates that can have a modified base moiety (e.g., a substituted purine or pyrimidine base), a modified sugar moiety (e.g., an O-alkylated sugar), and / or a modified oligophosphate moiety (e.g., an oligophosphate comprising a thio-phosphate, a methylene, and / or other bridges between phosphates).
[0086] As used herein, the "polymerase" as used herein, refers to an enzyme that catalyzes the process of replication of nucleic acids. More specifically, DNA polymerase catalyzes the polymerization of deoxyribonucleotides alongside a DNA strand, which the DNA polymerase "reads" and uses as a template. The newly polymerized molecule is complementary to the template strand and identical to the template's partner strand.
[0087] As used herein, the term "sequence," when used in reference to a nucleic acid molecule, refers to the order of nucleotides (or bases) in the nucleic acid molecules. In cases where different species of nucleotides are present in the nucleic acid molecule, the sequence includes an identification of the species of nucleotide (or base) at respective positions in the nucleic acid molecule. A sequence is a property of all or part of a nucleic acid molecule. The term can be used similarly to describe the order and positional identity of monomeric units in other polymers such as amino acid monomeric units of protein polymers.
[0088] As used herein, the term "sequencing" refers to the determination of the order and position of bases in a nucleic acid molecule. More particularly, the term "sequencing" refers to biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. Sequencing, as the term is used herein, can include without limitation parallel sequencing or any other sequencing method known of those skilled in the art, for example, chain-termination methods, rapid DNA sequencing methods, wandering-spot analysis, Maxam- Gilbert sequencing, dye- terminator sequencing, or using any other modem automated DNA sequencing instruments.
[0089] OVERVIEW
[0090] The present disclosure provides methods of amplifying and selectively methylating one or more nucleic acid molecules such that methylation patterns existing within the one or more nucleic acid molecules are preserved during one or more rounds of amplification. Said another way, the present disclosure is directed to methods of preparing amplified nucleic acid molecules from input nucleic acid molecules, whereby the prepared amplified nucleic acid molecules maintain the methylation patterns of the input nucleic acid molecules. The prepared amplified and selectively methylated nucleic acid molecules may then be analyzed to identify methylation patterns, such as analyzed by PCR, sequencing, bisulfite treatment, or any combination thereof. In some embodiments, the prepared amplified and selectively methylated nucleic acid molecules may be directly sequenced without first performing a bisulfite treatment. In some embodiments, the present disclosure is directed to a method of maintaining a methylation pattern of one or more nucleic acid molecules during amplification. In some embodiments, one or more nucleic acid molecules are obtained from a biological sample (such as a sample derived from a subject having cancer or suspected of having cancer); and the one or more obtained nucleic acid molecules are amplified such that the methylation patterns of the one or more obtained nucleic acid molecules are maintained in the amplified one or more nucleic acid molecules. By way of example, amplification and selective methylation of one or more obtained nucleic acid molecules may include the steps of denaturing parent double stranded nucleic molecules (e.g., DNA) into single stranded nucleic acid molecules; copying the parent nucleic acid molecule strands using one or more primers and a polymerase to make daughter strands; methylating the daughter strands with a DNA methyltransferase (such as DNMT1 or DNMT5); and repeating the process for a predetermined number of cycles, wherein in each cycle, the methylated daughter stands are utilized as new parent strands in the next cycle. In some embodiments, the amplification and selective methylation of the one or more obtained nucleic acid molecules includes an isothermal amplification technique. In some embodiments, the method further includes the step of ligating one or more adapter complexes to the one or more obtained nucleic acid molecules, such as one or more adapter complexes including at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites.
[0091] In other embodiments, the present disclosure is directed to a method of detecting and analyzing the methylation patterns of nucleic acid molecules (such as DNA) in an obtained sample. In some embodiments, the method includes amplifying and selectively methylating nucleic acid molecules in accordance with the methods described herein, following by analyzing the amplified nucleic acid molecules (e.g., DNA) for methylation patterns. The analyzing of methylation patterns in the amplified nucleic acid molecules may include a bisulfite treatment reaction followed by PCR, hybridization, and / or sequencing. Other methods of analyzing and / or identifying methylation patterns include direct sequencing using a sequencing-by-synthesis method, such as a method that does not first require bisulfite treatment.
[0092] In yet other embodiments, the present disclosure is directed to a method of sequencing one or more amplified and selectively methylated nucleic acid molecules. In some embodiments, the one or more amplified and selectively methylated nucleic acid molecules are sequenced using a bisulfite sequencing technique. In some embodiments, the one or more amplified and selectively methylated nucleic acid molecules are sequenced using a next-generation sequencing platform, such as a sequencing-by-synthesis platform, such as without first performing a bisulfite treatment. In further embodiments, the present disclosure is directed to a kit for amplifying and selectively methylating one or more nucleic acid molecules. In some embodiments, the kits include a methyltransferase (e.g., DNMT1 or DNMT5) and one or more additional reagents (e.g., methyl donating reagents, cofactors, etc.). In some embodiments, the kit further includes one or more primers and / or one or more polymerases. In some embodiments, the kits include one or more adapters, such as adapters including at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site including a 3' end including one or more methylated CpG sites.
[0093] In yet further embodiments, the present disclosure is directed to a method of diagnosing cancer. In some embodiments, the method includes obtaining a biological sample from a patient suspected of having a cancer or previously determined to have a cancer; amplifying and selectively methylating the nucleic acid molecules in the obtained sample as described herein (such as using one of DNMT1 or DNMT5, along with any methyl donating agents and / or optional cofactors); identifying methylation patterns within the amplified and selectively methylated nucleic acid molecules; comparing the methylation patterns to reference patterns; and deriving a diagnosis based on the comparison, wherein if the methylation patterns in the sample deviates from the patterns in the references, a diagnosis of cancer is determined.
[0094] These are other aspects of the present disclosure are described in further detail herein.
[0095] METHODS OF AMPLIFYING NUCLEIC ACID MOLECULES INCLUDING ONE OR MORE METHYLATED NUCLEOTIDES
[0096] The present disclosure provides methods of amplifying one or more nucleic acid molecules while preserving the methylation pattern present within the one or more nucleic acid molecules. With reference to FIG. 1, a sample is obtained, where the sample includes one or more double stranded nucleic acid molecules, wherein at least one of the one or more double stranded nucleic acid molecules includes one or more methylated nucleotides (e.g., 5mC, 4mC, etc.) (step 101). One or more adapter complexes are then ligated to the one or more double stranded nucleic acid molecules in the obtained sample to provide one or more adapter ligated double stranded nucleic acid molecules (step 102; see also FIG. 2). The adapter ligated one or more double stranded nucleic acid molecules are then amplified to provide one or more amplified double stranded nucleic acid molecules (step 103), where each of the one or more double stranded nucleic acid molecules are hemimethylated (see also FIGS. 4 and 5). Specifically, a template strand of each of the one or more amplified double stranded nucleic acid molecules retains the original methylation pattern of the one or more nucleic acid molecules present in the obtained sample, while a newly synthesized strand of each of the one or more amplified double stranded nucleic acid molecules is devoid of the original methylation pattern.
[0097] Each of the one or more amplified double stranded nucleic acid molecules are then selectively methylated, according to the methylation pattern present in the template strand, to provide one or more amplified and selectively methylated double stranded nucleic acid molecules (step 104; see also FIG. 3). This process of amplification and selective methylation may be repeated any number of times, such as once, twice, three times, four times, five times, six times, seven times, eight times, nine times, 10 times, 12 times, 15 times, 20 times, 30 times, etc. (step 105, dashed box). Following the one or more repeated amplification and selective methylation processes (steps 103, 104, 105), the one or more amplified and selectively methylated double stranded nucleic acid molecules may be sequenced (step 106). In some embodiments, the one or more amplified and selectively methylated double stranded nucleic acid molecules are sequenced using a next-generation sequencing platform, e.g., Roche's nanopore sequencing platform (step 106). In other embodiments, the one or more amplified and selectively methylated double stranded nucleic acid molecules or more amplified and selectively methylated double stranded nucleic acid molecules are sequenced following bisulfite treatment.
[0098] In some embodiments, a biological sample is obtained including one or more nucleic acid molecules, wherein at least one of the one or more nucleic acid molecules in the obtained biological sample includes one or more methylated nucleotides (step 101). In some embodiments, the one or more nucleic acid molecules include two or more methylated nucleotides, such as three or more methylated nucleotides, such as four or more methylated nucleotides, such as five or more methylated nucleotides, etc. In some embodiments, the one or more methylated nucleotides are cytosine nucleotides (e.g., 5-methylcytosine). In some embodiments, the one or more nucleic acid molecules are double stranded nucleic acid molecules.
[0099] In some embodiments, biological samples may be obtained from any source including one or more nucleic acid molecules having one or more methylated nucleotides, e.g., tissue (including tumor tissue or FFPE tissue), blood, skin, swab (e.g., buccal, vaginal), urine, saliva, etc. In some embodiments, the biological sample is derived from a subject or a patient. In some embodiments the biological sample may include a fragment of a solid tissue, or a tumor sample derived from the subject or the patient, e.g., by biopsy. As used herein, the term "tumor sample" encompasses samples prepared from a tumor or from a sample potentially including or suspected of comprising cancer cells, or to be tested for the potential presence of cancer cells, such as a lymph node. As used herein, the term "tumor" refers to a mass or a neoplasm, which itself is defined as an abnormal new growth of cells that usually grow more rapidly than normal cells and will continue to grow if not treated, sometimes resulting in damage to adjacent structures. Tumor sizes can vary widely. A tumor may be solid, or fluid filled. A tumor can refer to benign (not malignant, generally harmless), or malignant (capable of metastasis) growths. Some tumors can include neoplastic cells that are benign (such as carcinoma in situ) and, simultaneously, contain malignant cancer cells (such as adenocarcinoma). This should be understood to include neoplasms found in multiple locations throughout the body. Therefore, for purposes of the disclosure, tumors include primary tumors, lymph nodes, lymphatic tissue, and metastatic tumors.
[0100] Methods for isolating nucleic acid molecules from biological samples and / or purifying the samples are known, e.g., as described in Sambrook, and several kits are commercially available (e.g., High Pure RNA Isolation Kit, High Pure Viral Nucleic Acid Kit, and MagNA Pure LC Total Nucleic Acid Isolation Kit, DNA Isolation Kit for Cells and Tissues, DNA Isolation Kit for Mammalian Blood, High Pure FFPET DNA Isolation Kit, available from Roche). In the context of the presently disclosed methods, genomic DNA can be collected, purified, and / or isolated.
[0101] It will be appreciated that nucleic acid molecules may be isolated from biological samples using any of a variety of procedures known in the art, for example, MagMAX™ DNA Multi-Sample Ultra Kit (Applied Biosystems, Thermo Fisher Scientific), the MagMAX™ Express-96 Magnetic Particle Processor and the KingFisher™ Flex Magnetic Particle Processor (Thermo Fisher Scientific), a RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE and PureLink™ FFPE RNA Isolation Kit (Ambion™, Thermo Fisher Scientific), the ABI Prism™ 6100 Nucleic Acid PrepStation and the ABI Prism™ 6700 Automated Nucleic Acid Workstation (Applied Biosystems, Thermo Fisher Scientific), and the like.
[0102] In some embodiments, an obtained biological sample is further processed prior to any further downstream amplification operations. In some embodiments, the nucleic acid molecules within the obtained sample may be prepared for downstream amplification by fragmenting, cutting, or shearing the nucleic acids. In some embodiments, the fragmenting, cutting, and / or shearing may be carried out using such procedures as mechanical force, sonication, restriction endonuclease cleavage, or any method known in the art. In other embodiments, no fragmentation is necessary (some genomic samples may already consist of appropriately sized fragments and will not require additional fragmentation).
[0103] In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 2500-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10- mer to about 2000-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 1500-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 1000-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 750-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 700-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 650-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 600-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 550-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 500-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 450-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 400-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 350-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 300-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 250-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 200-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 180-mer. In other embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 15-mer to about 150-mer. In some embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 10-mer to about 125-mer. In yet other embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 15-mer to about 100-mer. In further embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 15-mer to about 60-mer. In even further embodiments, the nucleic acid molecules within any obtained biological sample have a size ranging from between about 15-mer to about 40-mer.
[0104] In some embodiments, one or more purification and / or target enrichments steps are performed prior to ligation of adapter constructs to the nucleic acid molecules. In some embodiments, purification includes removing unwanted DNA, such as by enzymatic digestion, size selection, magnetic bead-based cleanups, etc. In some embodiments, enrichment may be effectuated using a Transcription Activator-Like Effector (TALE). In some embodiments, TALEs bind to specific DNA sequences with high precision. TALEs can be linked to magnetic beads or other capture reagents for targeted enrichment.
[0105] In some embodiments, a hybridization-based target enrichment workflow may be utilized to enrich the prepared input sample. In hybridization-based target enrichment workflows, a target area of a nucleic acid molecule is captured by one or more hybridization of probes that can selectively bind to a capture surface. This capture allows the removal of non-nucleic acid s and subsequent release and collection of captured target molecules. Hybridization of target regions may occur either on a solid surface (microarray) or in solution. Hybridization-based target enrichment workflows are described in United States Patent No. 8,383,338, the disclosure of which is hereby incorporated by reference herein in its entirety. Commercial hybridization-based target enrichment workflows are available from Roche Sequencing Solutions, Inc. (e.g., KAPA HyperCap Workflow). Other commercial hybridization-based target enrichment workflows include SECAP EZ Target Enrichment System (ROCHE) and SURESELECT Target Enrichment System (AGILENT).
[0106] By way of example, hybridization-based target enrichment may be performed by capturing the nucleic acid molecules in an input sample with one or more introduced target-specific probes. In some embodiments, the one or more target nucleic molecules in an obtained input sample may be denatured and contacted with single-stranded target-specific probes. In some embodiments, the single-stranded target-specific probes may include a ligand for an affinity capture moiety such that following the formation of hybridization complexes, the hybridization complexes are captured by contacting the input sample with the affinity capture moiety. In some embodiments, the affinity capture moiety is avidin or streptavidin and the ligand is biotin. In some embodiments, the moiety is bound to solid support. In some embodiments, the solid support may include superparamagnetic spherical polymer particles such as DYNABEADS™ magnetic beads or magnetic glass particles. In other embodiments, a primer extension target enrichment (PETE) workflow may be used to enrich the prepared input sample. PETE workflows are described in United Patent Application Publication Nos. 2021 / 0207211 and 2020 / 0392483; in United States Patent Nos. 10,907,204 and 11,499,180; and in International Publication Nos. WO / 2018 / 013710 and WO / 2022 / 008578, the disclosures of which are each incorporated by reference herein in their entireties. Commercial PETE workflows are available from Roche (e.g., HAP A HyperPETE Workflow). By way of example only, a PETE workflow may be utilized to enrich a sample with one or more nucleic acid molecules by: a) providing a reaction mixture comprising the sample and a first target-specific primer, wherein the sample comprises single-stranded nucleic acid molecule having a 3' and a 5' end and non-nucleic acid molecules; b) hybridizing a first target-specific primer to the singlestranded nucleic acid molecules in the reaction mixture, wherein the first target-specific primer hybridizes at least 6 nucleotides from the 3' end of the single-stranded nucleic acid molecule and comprises an affinity ligand; c) extending the hybridized first target-specific primer with a DNA polymerase to form a first double-stranded product comprising the nucleic acid molecule hybridized to the extended first target-specific primer, wherein the hybridized nucleic acid molecule comprises a single-stranded overhang region of at least 6 consecutive nucleotides at the 3' end; d) removing single-stranded target and non-nucleic acid molecules from the reaction mixture by capturing the affinity ligand of the first double-stranded product; e) hybridizing a second target-specific primer to the single-stranded overhang region at the 3 ' end of the hybridized target polynucleotide of the captured first double stranded product, wherein the second targetspecific primer comprises a 3' hybridizing region and a barcode region; and f) extending the hybridized second target-specific primer with a DNA polymerase, wherein the DNA polymerase comprises strand displacement activity, 5 '-3' double stranded DNA exonuclease activity, or a combination thereof, thereby displacing or degrading the extended first target-specific primer and forming a second double-stranded product comprising a barcode, wherein the second doublestranded product comprises the nucleic acid molecule hybridized to an extended second targetspecific primer, wherein the extended second target-specific primer comprises: i) a complement of at least a portion of the nucleic acid molecule; and, ii) a single-stranded 5' overhang region comprising the barcode.
[0107] Ligation of One or More Adapter Constructs to the Nucleic acid Molecules Including the One or More Methylated Nucleotides
[0108] Following the preparation of a biological sample including one or more nucleic acid molecules (where at least one of the one or more nucleic acid molecules within the obtained biological sample includes one or more methylated nucleotides), one or more adapter constructs are ligated to the nucleic acid molecules including the one or more methylated nucleotides to provide a sample including one or more adapter ligated nucleic acid molecules. In some embodiments, the function of an adaptor construct is to introduce desired elements (described herein) into the one or more nucleic acid molecules in the obtained biological sample.
[0109] In some embodiments, the adapter construct includes a primer binding site. In other embodiments, the adapter constructs include a primer binding site (PBS) and at least one of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif (MB EM). In other embodiments, the adapter construct includes a primer binding site and two of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif. In yet other embodiments, the adapter construct includes a primer binding site and each of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif.
[0110] In further embodiments, the adapter construct includes a primer binding site that includes one or more methylated nucleotides at its 3' end; and at least one of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif. In yet further embodiments, the adapter construct includes a primer binding site that includes one or more methylated nucleotides at its 3' end; and at least two of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif. In yet even further embodiments, the adapter construct includes a primer binding site that includes one or more methylated nucleotides at its 3' end; and each of (i) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iii) a methyltransferase binding enhancer motif.
[0111] It is believed that an adapter complex including (i) a primer binding site that includes one or more methylated nucleotides at its 3' end; (ii) a genetic unique molecular identifier that includes only unmethylated nucleotides; (ii) an epigenetic unique molecular identifier that includes one or more methylated nucleotides; and (iv) a methyltransferase binding enhancer motif, provides enhanced specificity (e.g., the MBEM and methylated primer site can work together to precisely target methylated regions); improved accuracy (UMIs reduce amplification bias and ensure accurate quantification; and better flexibility (UMIs also allow for multiplexing and distinguishing genuine signal from noise). In some embodiments, the adapter complexes do not include a hairpin. In other embodiments, the adapter complexes include a hairpin. In some embodiments, the adapter complexes are not asymmetrical. In some embodiments, the adapter complexes are asymmetrical. Each of the components of the adapter constructs of the present disclosure are described herein. In general, a nucleic acid molecule including ligated adapter constructs will have the general structure:
[0112] [Adapter Construct] - [5' Nucleic Acid Molecule 3'] - [Adapter Construct]
[0113] Likewise, a double stranded nucleic acid molecule including ligated adapter constructs will have the general structure:
[0114] [Adapter Construct] - [5' Nucleic Acid Molecule 3'] - [Adapter Construct]
[0115] [Adapter Construct] - [3' Nucleic Acid Molecule 5'] - [Adapter Construct]
[0116] Overview of Unique Molecular Identifiers
[0117] As noted above, in some embodiments the adapter constructs may include a genetic unique molecular identifier (GUMI) or an epigenetic unique molecular identifier (EUMI). GUMIs and EUMIs are similar in that they each include a unique molecular identifier, which is a barcode that identifies a nucleic acid to which it is attached. As used herein, the term "barcode" refers to a nucleic acid sequence that can be detected and identified. In some embodiments, the barcodes include between about 5 and about 20 nucleotides, such that in a sample, the nucleic acids incorporating the barcodes can be distinguished or grouped according to the barcodes. In some embodiments, the barcodes include between about 5 and about 15 nucleotides. In some embodiments, the barcodes include between about 5 and about 10 nucleotides. In some embodiments, the barcodes include between about 10 and about 15 nucleotides. In some embodiments, the barcodes include about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15 nucleotides. Non-limiting examples of barcodes and / or unique molecular identifiers (UMIs) are described in U.S. Publication No. 2020 / 0032244, and in U.S. Patent Nos. 7,393,665, 8,168,385, 8,481,292, 8,685,678, and 8,722,368, and in PCT Publication No. WO / 2018 / 138237, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0118] In general, UMIs can be used as part of an overall DNA amplification and sequencing workflow to perform error correction. In some embodiments, errors are introduced (1) by the polymerase during amplification, and (2) during sequencing (i.e., reading) of the amplified molecules. In some embodiments, UMIs ligated to nucleic acid molecules reduce the impact of one or both sources of error.
[0119] In some embodiments, UMI's (including the GUMIs and EUMIs described herein) are ligated to nucleic acid molecules prior to amplification. In some embodiments, each nucleic acid molecule receives a UMI having a unique sequence. In some embodiments, the UMIs, along with the nucleic acid molecules are amplified during PCR. In some embodiments, the UMIs, along with the nucleic acid molecules are sequenced, during sequencing. In some embodiments, during secondary analysis, UMI codes are used to cluster reads into groups of reads that came from amplified molecules which were all descendants of the same original UMI ligated nucleic acid molecules. Once reads are correctly clustered into such groups, algorithms can be applied to correct for errors introduced in both PCR amplification (for example misincorporation errors by the polymerase) or during sequencing (sequence detection errors).
[0120] In some embodiments, the UMIs (including GUMIs and EUMIs) have the one of the general Formulas set forth below:
[0121] (W)(N)(N)(N)(N)(N)(W)(N)(N)(N)(N)(N)(W), or
[0122] (N)(W)(N)(N)(N)(W)(N)(N)(N), where N includes (in the aggregate) about 25% adenosine; about 25% guanine; about 25% cytosine; and about 25% thymine; and W includes (in the aggregate) about 50% adenosine and about 50% thymine; provided that none of the nucleotides included within the GUMIs are methylated.
[0123] Genetic Unique Molecular Identifier (GUMI)
[0124] In some embodiments, the adapter constructs ligated to the one or more nucleic acid molecules includes a GUMI which includes only unmethylated nucleotides, i.e., the GUMIs are free from methylated nucleotides, such as 5-methylcytosine. It is believed that GUMIs may be included in any adapter construct to: (i) reduce technical noise (GUMIs help differentiate genuine DNA molecules from PCR duplicates, minimizing noise caused by amplification bias); (ii) facilitate accurate quantification (GUMIs help ensure reliable quantification by distinguishing true reads from artifacts); (iii) facilitate error correction (GUMIs facilitate error correction within sequencing data, improving overall accuracy and confidence); and (iv) permit variant detection (GUMIs may assist in identifying and characterizing genetic variants with greater precision).
[0125] In some embodiments, the GUMIs comprise between about 5-mer and about 20-mer. In other embodiments, the GUMIs comprise between about 5-mer and about 10-mer. In yet other embodiments, the GUMIs comprise between about 10-mer and about 15-mer. In further embodiments, the GUMIs comprise 7-mer, 8-mer, 9-mer, 10-mer, or 11-mer.
[0126] In some embodiments, the GUMIs included within any adapter construct are located such that when the adapter construct is ligated to a nucleic acid molecule, the GUMIs flank the 5' and 3' ends of the target nucleic molecule. For instance, an adapter construct ligated nucleic acid molecule including GUMIs may have the following structure: PBS - GUMI - [5' Nucleic Acid Molecule 3'] - GUMI - PBS
[0127] Epigenetic Unique Molecular Identifier (EUMI)
[0128] In some embodiments, the adapter constructs ligated to the one or more nucleic acid molecules include a EUMI. Like GUMIs, EUMIs are stretches of DNA that could be included in an adapter construct. EUMIs, in comparison to GUMIs, include one or more methylated nucleotides. In some embodiments, each EUMI includes one or more CpG sites which are methylated. In other embodiments, each EUMI includes two or more CpG sites which are methylated. In yet other embodiments, each EUMI includes three or more CpG sites which are methylated. In further embodiments, each EUMI includes four or more CpG sites which are methylated. In even further embodiments, each EUMI includes five or more CpG sites which are methylated.
[0129] As noted herein, the present disclosure describes a protocol whereby a nucleic acid molecule is amplified and selectively methylated, such as using a methyltransferase (described herein). This amplification and selective methylation process is repeated one or more times (see, e.g., step 105 of FIG. 1). In some instances, it is possible that some nucleic acid molecules may miss the selectively methylation copying step. It is believed that if this occurs just once, then the progeny of that particular nucleic acid molecule from that point on will all miss their methylation patterns. It is also possible that the methylation pattern on the first part of a nucleic acid molecule is copied, but that the methyltransferase does not have time to process along the entire length of the nucleic acid molecule before time runs out for that step, and the processing temperature is raised. It is believed that the inclusion of EUMIs within an adapter construct provides a "check" on whether a nucleic acid molecule was processed from end to end with a methyltransferase. For instance, if EUMIs present on either the 5' or 3' ends of the nucleic acid molecule present as entirely unmethylated during sequencing after one or more rounds of amplification / selective methylation, then those reads will not be utilized as a contributing read toward generating an epigenetic consensus sequence. This concept takes advantage of the fact that DNA methyltransferases (e.g., DNMT1, DNMT5) is known to be a highly processive enzyme.
[0130] In some embodiments, the EUMIs comprise between about 5-mer and about 20-mer. In other embodiments, the EUMIs comprise between about 5-mer and about 10-mer. In yet other embodiments, the EUMIs comprise between about 10-mer and about 15-mer. In further embodiments, the EUMIs comprise 7-mer, 8-mer, 9-mer, 10-mer, or 11-mer.
[0131] In some embodiments, the adapter constructs include an EUMI but not a GUMI. In these embodiments, the EUMIs included within any adapter construct are located such that when the adapter construct is ligated to a nucleic acid molecule, the EUMIs flank the 5' and 3' ends of the target nucleic molecule. For instance, an adapter complex ligated nucleic acid molecule may have the following structure:
[0132] PBS - EUMI - [5' Nucleic Acid Molecule 3'] - EUMI - PBS
[0133] In other embodiments, the adapter constructs include both an EUMI and a GUMI. In some embodiments, the EUMIs included within any adapter construct are located such that when the adapter construct is ligated to a nucleic acid molecule, the EUMIs flank the 5' and 3' ends of the target nucleic molecule; and the GUMIs flank the 5' and 3' ends of the EUMIs. For instance, an adapter complex ligated nucleic acid molecule may have the following structure:
[0134] PBS - GUMI - EUMI - [5' Nucleic Acid Molecule 3'] - EUMI - GUMI - PBS
[0135] In other embodiments, the EUMIs included within any adapter construct are located such that when the adapter construct is ligated to a nucleic acid molecule, the GUMIs flank the 5' and 3' ends of the target nucleic molecule; and the EUMIs flank the 5' and 3' ends of the GUMIs. For instance, an adapter complex ligated nucleic acid molecule may have the following structure:
[0136] PBS- EUMI - GUMI - [5' Nucleic Acid Molecule 3'] - GUMI - EUMI - PBS
[0137] Methyltransferase Binding Enhancer Motif
[0138] In some embodiments, the adapter construct ligated to a nucleic acid molecule includes a methyltransferase binding enhancer motif. In some embodiments, the methyltransferase binding enhancer motif includes a sequence that is known to enhance the binding activity of a methyltransferase (e.g., DNMT). In some embodiments, the methyltransferase binding enhancer motif is a region of an adapter complex including a high GC content. In some embodiments, the methyltransferase binding enhancer motif includes between about 5-mer and about 20-mer. In other embodiments the methyltransferase binding enhancer motif includes between about 5-mer and about 15-mer. In some embodiments, the methyltransferase binding enhancer motif includes a high GC count, such as a region of the
[0139] In some embodiments, the methyltransferase binding enhancer motif enhances the binding activity of a methyltransferase relative to an average location within the adapter ligated nucleic acid molecule by a factor of greater than 1, such as greater than 1.5, such as greater than 2, such as greater than 5, such as greater than 10, such as greater than 20, such as greater than 40, such as greater than 60, such as greater than 80, such as greater than 100, etc.
[0140] It is believed that the incorporation of a methyltransferase binding enhancer motif (i) reduces the probability of methyltransferase binding at a random position on the nucleic acid molecule, and increases the probability that the methyltransferase binds at the beginning of the adapter construct, thereby decreasing the chance that methylation patterns toward the beginning of the adapter ligated nucleic acid molecule are missed during one of the amplification stages; and / or (ii) reduces the duration of the methyltransferase incubation step.
[0141] Non-limiting examples of MBEMs include the following:
[0142] TA CG TA TC CG TA TC CG GT TC CG AA TC CG TT
[0143] TC CG CT TC CG AT TA CG GT GA CG TA AC CG TA
[0144] TT CG TA GT CG TA TG CG TA TC CG CA AA CG TA
[0145] TT CG GT TC CG GA AT CG TA AC CG GT GC CG TA
[0146] In some embodiments, the methyltransferase binding enhancer motif (MBEM) is located between a primer binding site (PBS) and a EUMI. Examples of adapter complexes including a methyltransferase binding enhancer motif, and which are ligated to a nucleic acid molecule are set forth below:
[0147] PBS - MBEM - EUMI - [5' Nucleic Acid 3'] - EUMI - MBEM - PBS
[0148] PBS - MBEM - EUMI - GUMI - [5' Nucleic Acid 3'] - GUMI - EUMI -MBEM - PBS
[0149] In other embodiments, the methyltransferase binding enhancer motif (MBEM) is located at a position flanking the nucleic acid molecule. Examples of such adapter complexes ligated to a nucleic acid molecule are set forth below:
[0150] PBS - MBEM - [5' Nucleic Acid 3'] - MBEM - PBS
[0151] PBS - GUMI - MBEM - [5' Nucleic Acid 3'] - MBEM - GUMI - PBS
[0152] PBS - EUMI - MBEM - [5' Nucleic Acid 3'] - MBEM - EUMI - PBS
[0153] PBS - EUMI - GUMI - MBEM - [5' Nucleic Acid 3'] - MBEM - GUMI - EUMI - PBS
[0154] PBS - GUMI - EUMI - MBEM - [5' Nucleic Acid 3'] - MBEM - EUMI - GUMI - PBS
[0155] In yet other embodiments, the methyltransferase binding enhancer motif is provided within or as part of a primer binding sequence that includes one or more methylated nucleotides (described herein).
[0156] Primer Binding Site
[0157] In some embodiments, the adapter construct ligated to a nucleic acid molecule includes a primer binding site. In some embodiments, the primer binding site includes only unmethylated nucleotides. In other embodiments, the primer binding site includes one or more methylated cytosines at its 3' end. It is believed that incorporating one or more methylated nucleotides or at least one methylated CpG site within the 3' end of the primer biding site may facilitate the preferential amplification of nucleic acid molecules that have been methylated by a methyltransferase during a selective methylation step (see the disclosures herein regarding repeated rounds of amplification and selective methylation).
[0158] By way of example, the melting temperature of methylcytosine (mC) to guanine pairs is significantly higher than unmethylated cytosine to guanine base pairs. It is believed that the higher stability of a mC:G pairing compared to a C:G pairing, combined with increased annealing temperatures during PCR, would mean that templates which had undergone selective methylation by methyltransferase (see the disclosure of selective methylation, herein) would be primed more efficiently and outcompete the unmethylated templates.
[0159] In some embodiments, a 3' end of a primer binding site includes at least one methylated CpG. In other embodiments, a 3' end of a primer binding site includes at least two methylated CpGs. In yet other embodiments, a 3' end of a primer binding site includes at least three methylated CpGs.
[0160] An example of the bias in favor of methylated templates during PCR is provided in Example 1, herein.
[0161] Following the ligation of the one or more adapter complexes to the one or more double stranded nucleic acid (step 102), the one or more adapter complex ligated double stranded nucleic acid molecules are amplified (step 103). In some embodiments, amplification of the one or more adapter complex ligated double stranded nucleic acid molecules include polymerase chain reaction. In other embodiments, the one or more adapter complex ligated double stranded nucleic acid molecules are amplified using an isothermal amplification technique.
[0162] The amplification of the one or more adapter complex ligated double stranded nucleic acid molecules generates one or more amplified double stranded nucleic acid molecules, where template strands of the one or more amplified double stranded nucleic acid molecules include the methylation pattern of the original double stranded nucleic acid molecule, and where the newly synthesized strands of the one or more amplified double stranded nucleic acid molecules are unmethylated. Said another way, the amplified double stranded nucleic acid molecules are hemimethylated.
[0163] In some embodiments, amplification of the one or more adapter complex ligated nucleic acid molecules including the one or more methylated nucleotides is based on template directed oligonucleotide primer extension using one or more polymerases. For instance, the sample including the one or more adapter complex ligated nucleic acid molecules including the one or more methylated nucleotides is contacted with a polymerase and / or other amplification reagents to provide one or more amplified nucleic acid molecules (step 103).
[0164] Non-limiting examples of polymerases include prokaryotic DNA polymerases (e.g., Pol I, Pol II, Pol III, Pol IV, and Pol V), eukaryotic DNA polymerase, archaeal DNA polymerase, etc. In some embodiments, suitable polymerases may be derived from: archaea (e.g., Thermococcus litoralis (Vent, GenBank: AAA72101), Pyrococcus furiosus (Pfu, GenBank: D12983, BAA02362), Pyrococcus woesii, Pyrococcus GB-D (Deep Vent, GenBank: AAA67131), Thermococcus kodakaraensis KODI (KOD, GenBank: BD175553, BAA06142; Thermococcus sp. strain KOD (Pfx, GenBank: AAE68738)), Thermococcus gorgonarius (Tgo, Pdb: 4699806), Sulfolobus solataricus (GenBank: NC002754, P26811), Aeropyrum pernix (GenBank: BAA81109), Archaeglobus fulgidus (GenBank: 029753), Pyrobaculum aerophilum (GenBank: AAL63952), Pyrodictium occultum (GenBank: BAA07579, BAA07580), Thermococcus 9 degree Nm (GenBank: AAA88769, Q56366), Thermococcus fumicolans (GenBank: CAA93738, P74918), Thermococcus hydrothermalis (GenBank: CAC18555), Thermococcus sp. GE8 (GenBank: CAC12850), Thermococcus sp. JDF-3 (GenBank: AX135456; WO0132887), Thermococcus sp. TY (GenBank: CAA73475), Pyrococcus abyssi (GenBank: P77916), Pyrococcus glycovorans (GenBank: CAC12849), Pyrococcus horikoshii (GenBank: NP 143776), Pyrococcus sp. GE23 (GenBank: CAA90887), Pyrococcus sp. ST700 (GenBank: CAC 12847), Thermococcus pacificus (GenBank: AX411312.1), Thermococcus zilligii (GenBank: DQ3366890), Thermococcus aggregans, Thermococcus barossii. Thermococcus celer (GenBank: DD259850.1), Thermococcus profundus (GenBank: E14137), Thermococcus siculi (GenBank: DD259857.1), Thermococcus ihioreducens. Thermococcus onnurineus NA1, Sulfolobus acidocaldarium. Sulfolobus tokodaii, Pyrobaculum calidifonlis. Pyrobaculum islandicum (GenBank: AAF27815), Methanococcus jannaschii (GenBank: Q58295), Desulforococcus species TOK, Desulforococcus, Pyrolobus, Pyrodictium, Staphylothermus, VulcanisaeUa, Methanococcus (GenBank: P52025) and other archaeal B polymerases, such as GenBank AAC62712, P956901, BAAA07579)), thermophilic bacteria Thermus species (Q. .,flavus, ruber, thermophilus, lacteus, rubens, aquaticus), Bacillus stearothermophilus, Thermotoga maritima, Methanothermus fervidus, KOD polymerase, TNA1 polymerase, Thermococcus sp. 9 degrees N-7, T4, T7, phi29, Pyrococcus furiosus, P. abyssi, T. gorgonarius, T. litoralis, T. zilligii, T. sp. GT, P. sp. GB-D, KOD, Pfu, T. gorgonarius, T. zilligii, T. litoralis and Thermococcus sp. 9N-7 polymerases.
[0165] To effectuate amplification, the one or more adapter ligated nucleic acid molecules including the one or more methylated nucleotides are heat denatured. Melting temperatures for heat denaturation are dependent upon several variables including the GC content of the nucleic acid molecule and / or the size of the nucleic acid molecule, but in general may be about 95°C or higher, such as for about 15 seconds to about 2 minutes. Following heat denaturation, oligonucleotide primers are annealed to the template sequence of the one or more adapter ligated nucleic acid molecules including the one or more methylated nucleotides at a lower temperature, (typically between about 40°C and about 60°C, such as for about 30 to about 60 seconds). The annealing temperature, like the heat denaturation temperature, is dependent upon the GC content and / or length of the primers. The oligonucleotides form stable associations ('anneal') with the single stranded DNA (hereinafter referred to as the template strand) and thus serve as primers for nucleic acid synthesis by a polymerase. Subsequently, a corresponding nucleic acid strand to the template is synthesized from the primer oligonucleotide through use of the polymerase and deoxynucleotide triphosphates (dNTPs) (also referred to as "primer extension"). In some embodiments, the temperature is raised for the polymerase, which in the case of commonly used thermostable polymerases is about 74° C, primer extension then lasts approximately 1 to 2 minutes. Reactions take place in a PCR master mixture which includes the nucleic acid molecule, a polymerase, oligonucleotide primers, deoxynucleotide triphosphates (dNTPs), reaction buffer, magnesium and / or optional additives.
[0166] In some embodiments, the one or more adapter complex ligated double stranded nucleic acid molecules are isothermally amplified. Isothermal amplification methods provide detection of a nucleic acid target sequence in a streamlined, exponential manner, and are not limited by the constraint of thermal cycling. Instead of melting DNA strands apart at high temperatures, isothermal amplification takes advantage of DNA polymerases with high strand displacement activity, (e.g., Bst or phi29 DNA polymerases). Although isothermal amplification methods may vary, they all share some features in common. For example, because the double stranded nucleic acid molecule strands are not heat denatured, all isothermal methods rely on an alternative approach to enable primer binding and initiation of the amplification reaction, namely a polymerase having strand-displacement activity. Once the reaction is initiated, the polymerase must also separate the strand that is still annealed to the sequence of interest.
[0167] In some embodiments, when amplifying under isothermal conditions, the reaction may be kept at an essentially constant temperature, which means the temperature may not be maintained at precisely one temperature. For example, small fluctuations in temperature (e.g., ±1 to 5 degrees Celsius) may occur in an isothermal amplification process due to, for example, environmental or equipment-based variables. In some embodiments, isothermal amplification may be conducted at a temperature ranging from between about 55°C to about 75°C, such as at a temperature of about 55°C, about 56 °C, about 57°C, about 58°C, about 59°C, about 60°C, about 61°C, about 62°C, about 63°C, about 64°C, about 65°C, about 66°C, about 67°C, about 68°C, about 69°C, about 70°C, about 71°C, about 72°C, about 73°C, about 74°C, or about 75°C. As noted above, isothermal amplification employs a DNA polymerase capable of "strand displacement." As used herein, the term "strand displacement" refers to the ability of the enzyme to separate the DNA strands in a double-stranded DNA molecule during primer-initiated synthesis. The enzyme can be a complete enzyme or a biologically active fragment thereof. The enzyme can be isolated and purified or recombinant. In some embodiments, the enzyme is thermostable. Such an enzyme is stable at elevated temperatures (e.g., greater than 40°C) and heat resistant to the extent that it effectively polymerizes DNA at the temperature employed.
[0168] In some embodiments, the strand displacing polymerase used during isothermal amplification is a +29-DNA polymerase derived from bacteriophage (Blanco et al., U.S. Pat. Nos. 5,198,543 and 5,001,050). Other examples strand displacing DNA polymerase include, but are not limited to, DNA polymerase of the Bst large fragment (Exo (-) Bst (Aliotta et al., Genet. Anal. (Holland) 12: 185-195 (1996) and Exo(-)BcaDNA polymerase (Walker and Linn, Clinical Chemistry 42: 1604- 1608 (1996)), phage M2 DNA polymerase(Matsumoto et al., Gene 84: 247 (1989)), phage cpPRDl DNA polymerase (Jung et al., Proc. Natl. Acad. Sci. USA 84: 8287 (1987)), VENT® DNA polymerase (Kong et al., J. Biol. Chem. 268: 1965-1975 (1993)), Klenow fragment of DNA polymerase I (Jacobsen et al., Eur. J. Biochem. 45: 623-627 (1974)), T5 DNA polymerase (Chatterjee et al., Gene 97: 13-19 (1991)), SEQUENASE® (manufactured by US Biochemicals Corp.), PRD1 DNA polymerase (Zhu and Ito, Biochem. Biophys. Acta. 1219: 267-276 (1994)), T4 DNA polymerase holoenzyme (Kaboord and Benkovic, Curr. Biol. 5: 149-157 (1995)), etc.
[0169] In some embodiments, the isothermal amplification includes Loop-Mediated Isothermal Amplification (LAMP). LAMP a single-step amplification reaction utilizing a DNA polymerase with strand displacement activity (e.g., Notomi et al., NucL Acids. Res. 28: E63, 2000; Nagamine et al., Afo / . Cell. Probes 16:223-229, 2002; Mori et al., J. Biochem. Biophys. Methods 59: 145-157, 2004). LAMP utilizes 4 to 6 primers recognizing 6 to 8 distinct regions of target DNA for a highly specific amplification reaction. In some embodiments, the primers include a forward outer primer (F3), a backward outer primer (B3), a forward inner primer (HP), and a backward inner primer (BIP). A forward loop primer (Loop F), and a backward loop primer (Loop B) can also be included in some embodiments. A strand-displacing DNA polymerase initiates synthesis and two specially designed primers form "loop" structures (with inverted repeats of the nucleic acid sequence) to facilitate subsequent rounds of amplification through extension on the loops and additional annealing of primers.
[0170] In some embodiments, a LAMP reaction mixture includes the one or more adapter complex ligated double stranded nucleic acid molecules, LAMP primers, a DNA polymerase with strand displacement activity, dNTPs, and a reaction buffer. Additionally, specific modifications can be made to the reaction mix to facilitate methylation-specific detection, such as the addition of methylation-sensitive restriction enzymes or methylation-specific DNA-binding proteins. The LAMP reaction is incubated at a constant temperature, typically about 60°C to about 65°C. The DNA polymerase initiates strand displacement DNA synthesis, resulting in the accumulation of large amounts of amplification products. The amplification process involves multiple steps, including DNA strand displacement and DNA annealing / elongation, leading to a rapid and exponential increase in DNA amplification.
[0171] In other embodiments, the isothermal amplification includes Recombinase Polymerase Amplification (RPA). RPA is an isothermal amplification mechanism that operates at a relatively low temperature, such as between about 37°C to about 42°C, which exploits the activity of two different enzymes: a recombinase and a DNA polymerase and single stranded DNA-binding proteins to ensure single stranded DNA stabilization. RPA is based on the principle of strand displacement amplification. In RPA, a DNA template is first hybridized to a pair of primers. The primers are designed to bind to sequences that are located on opposite strands of the DNA template. The primers then initiate a DNA polymerase reaction, which copies the DNA template. The DNA polymerase reaction is repeated multiple times, resulting in the amplification of the DNA template. In yet other embodiments, the isothermal amplification comprises Rolling Circle Amplification (RCA). RCA operates at a relatively low temperature (e.g., from between about 23°C to about 60°C). In some embodiments, specific RCA primers can be designed to target unmethylated regions flanking the methylation sites of interest in the DNA. The DNA is denatured to separate the DNA strands following which RCA primers anneal to the unmethylated regions of the cfDNA, providing a starting point for the subsequent amplification. The addition of DNA polymerase and nucleotides (dNTPs) allows for the isothermal amplification of the target regions. The DNA polymerase extends from one of the RCA primers, utilizing the circularized DNA template as a substrate for strand displacement synthesis. This process generates multiple copies of the circularized DNA, resulting in amplified products.
[0172] In some embodiments, the one or more adapter complex ligated double stranded nucleic acid molecules are not glycosylated prior to amplification. In other embodiments, the one or more adapter complex ligated double stranded nucleic acid molecules are glycosylated prior to amplification.
[0173] Selective Methylation
[0174] Following the preparation of the one or more amplified double stranded nucleic acid molecules (step 103), the newly synthesized strands of the one or more amplified double stranded nucleic acid molecules (which are unmethylated) are selectively methylated (step 104) to provide one or more amplified and selectively methylated double stranded nucleic acid molecules. Said another way, the hemi-methylated nucleic acid molecule is selectively methylated.
[0175] The selective methylation is carried out in a manner such that unmethylated nucleotides within the newly synthesized strands of the one or more amplified double stranded nucleic acid molecules are methylated according to the methylation statuses of the corresponding nucleotides in the respective template strands of the one or more amplified double stranded nucleic acid molecules (see, e.g., FIGS. 2, 4, and 5). For instance, for a methylated nucleotide (e.g., a 5-methylcytosine) within a template strand of a double stranded nucleic acid molecule, a suitable enzyme will facilitate methylation of the corresponding unmethylated nucleotide (e.g., unmethylated cytosine) on the corresponding newly synthesized strand of the amplified double stranded nucleic acid molecule. On the other hand, if the nucleotide in the template strand of the amplified double stranded nucleic acid molecule is unmethylated (e.g., unmethylated cytosine), then the corresponding unmethylated nucleotide (e.g., unmethylated cytosine) in the corresponding newly synthesized strand of the amplified double stranded nucleic acid molecule will remain unmethylated.
[0176] In some embodiments, selective methylation of the newly synthesized unmethylated strand is performing by contacting the one or more amplified double stranded nucleic acid molecules with a methyltransferase. In other embodiments, selective methylation of the newly synthesized unmethylated strand is performing by contacting the one or more amplified double stranded nucleic acid molecules with a methyltransferase and one or more additional reagents.
[0177] In some embodiments, the methyltransferase and any other optional additional reagents are added to the sample including the one or more amplified nucleic acid molecules after each round of amplification. In some embodiments, the process of amplification and selective methylation is performed one or more times, such as two or more times, three or more times, four or more times, five or more times, 10 or more times, 15 or more times, 20 or more times, etc. (step 105). In particular, and subsequent to each cycle of the polymerase chain reaction (step 103), the hemimethylated nucleic acid is contacted with a methyltransferase (step 104) thereby allowing for the selective methylation of the unmethylated strand of the double stranded nucleic acid molecule (see, e.g., FIGS. 2, 4, and 5).
[0178] In some embodiments, the methyltransferase can introduce one or more methyl groups to cytosines at the 5-position (N5-methylcytosine) within the newly synthesized strands of the one or more amplified double stranded nucleic acid molecules. In some embodiments, the methyltransferase is maintenance methyltransferase. In some embodiments, the maintenance methyltransferase is DNA methyltransferase 1 (DNMT 1). The in vitro action mechanism of DNMT1 is described by Pradhan, S., Bacolla, A., Wells, R. D., Roberts, R. J., 'Recombinant Human DNA (Cytosine-5) Methyltransferase. I. Expression, Purification and comparison of de novo and maintenance methylation.' J. Biol. Chem. 274: 33002- 33010; and Bacolla A, Pradhan S, Roberts R J, Wells R D. 'Recombinant human DNA (cytosine- 5) methyltransferase. II. Steady-state kinetics reveal allosteric activation by methylated DNA,' J Biol Chem. 12;274(46):33011-9, the disclosures of which are hereby incorporated by reference herein in their entireties. DNMT1 possesses a multi-domain structure crucial for its methylation activity; and includes four key domains: (i) a Replication Focus Targeting Sequence (RFTS): This domain targets newly replicated DNA, directing DNMT1 to its site of action; (ii) a CXXC Zinc Finger: This domain recognizes and binds to unmethylated CpG dinucleotides, specifically targeting the cytosine base; (iii) BAH Domains: These domains (BAH1 and BAH2) contribute to protein-protein interactions and might influence substrate specificity; and (iv) a Catalytic Methyltransferase Domain: This core domain contains the machinery for adding a methyl group to the target cytosine using S-adenosyl-L-methionine (SAM) as a donor.
[0179] The DNMT1 enzyme is processive, yet intramolecularly inhibited, both by a CXXC -type Zinc finger domain (which binds unmethylated CpG and limits the de novo activity), and by a larger RFTS domain (for Replication Foci Targeting Sequence). The RFTS and CXXC finger domains are located at the N-terminus, while the BAH domains and catalytic domain are at the C-terminus. The CXXC finger interacts with the target CpG, positioning it within the catalytic domain for methylation. The RFTS has a ubiquitin-interaction motif, and its inhibitory effect is lifted when it engages histone H3 bearing mono-ubiquitin at lysines 14 and 18.
[0180] In other embodiments, the maintenance methyltransferase is DNA methyltransferase 5 (DNMT 5). In some embodiments, the DNMT5 is derived from C. neoformans. It is believed that DNMT5 has specificity for hemimethylated DNA. DNMT5 is characterized by an N-terminal chromodomain (CD) followed by a cytosine methyltransferase catalytic domain, a RING finger, and a domain related to those of SNF2-type ATPases. It is believed that the chromodomain recognizes and binds to methylated histone tails, potentially directing DNMT5 to specific genomic regions. The SNF2 domain exhibits ATPase activity and it is believed that it may play a role in unwinding DNA, thereby facilitating methylation access. A DNMTase domain includes the catalytic machinery for adding a methyl group to the target cytosine base.
[0181] In other embodiments, the DNA methyltransferase is a DNA methyltransferase 3a (DNMT3a), a DNA methyltransferase 3b (DNMT3b), or a DNA methyltransferase 3L (DNMT3L).
[0182] Reaction conditions for DNA methylation are maintained so that the methyltransferase methylates substantially all the sites in the adapter ligated nucleic acid molecule capable of being methylated by the methyltransferase; and does not methylate any of the sites in the adapter ligated nucleic acid molecule not capable of being methylated. Maintaining reaction conditions includes providing an "effective amount" of methyltransferase and any additional reagents, such as methyl-donating agent and / or cofactors. For instance, an "effective amount" of the methyltransferase and methyl- donating reagent is an amount necessary to methylate substantially all the C-methylation sites capable of being methylated but also sufficiently low to avoid methylation of almost any of C- methylation sites not capable of being methylated.
[0183] In some embodiments, methylation of substantially all the C-methylation sites capable of being methylated indicates that the methyltransferase methylates at least 80%, such as 90%, such as 99%, and such as 100% of all the C-methylation sites capable of being methylated. More particularly, methylation of substantially all of the C-methylation sites capable of being methylated indicates that the methyltransferase methylates at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of all the C-methylation sites capable of being methylated. In some embodiments, methylation of almost none of the C-methylation sites not capable of being methylated indicates that the methyltransferase methylates less than 20%, such as 10%, such as 1%, and such as 0% of all the C-methylation sites not capable of being methylated. More particularly, methylation of almost none of the C-methylation sites not capable of being methylated indicates that the DNA methyltransferase methylates less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0% of all the C-methylation sites not capable of being methylated. In some embodiments, a ratio of the amount of the one or more amplified double stranded nucleic acid molecules to an introduced amount of a DNA methyltransferase is about 1 : 16, such as about 1 :15, such as about 1 : 14, such as about 1 : 13, such as about 1 : 12, such as about 1 : 11, such as about 1 : 10, such as about 1 : 9, such as about 1 : 8, such as about 1 : 7, such as about 1 : 6, or such as about 1 : 5. In exemplary embodiments, a ratio of the amount of the one or more amplified double stranded nucleic acid molecules to an introduced amount of a DNA methyltransferase ranges from between about 1 : 8 to about 1 : 11. In one exemplary embodiment, a ratio of the amount of the one or more amplified double stranded nucleic acid molecules to an introduced amount of a DNA methyltransferase (such as DNMT1) ranges from between about 1 : 9 to about 1 : 9.5, such as 1 :9.0, 1 :9.1, 1 :9.2, 1 :9.3, 1 :9.4, or 1 :9.5. In one exemplary embodiment, a ratio of the amount of the one or more amplified double stranded nucleic acid molecules to an introduced amount of a DNA methyltransferase (such as DNMT5) ranges from between about 1 : 12.5 to about 1 : 13.5, such as 1 :12.5, 1 : 12.6, 1 : 12.7, 1 :12.8, 1 : 12.9, 1 : 13.0, 1 : 13.1, 1 : 13.2, 1 : 13.3, 1 :13.4, or 1 : 13.5. In some embodiments, selective methylation with DNMT1 takes place at a temperature ranging from between about 35°C to about 40°C. In some embodiments, selective methylation with DNMT1 takes place at a temperature of about 37°C. In some embodiments, selective methylation with DNMT1 place at a pH ranging from between about 7 to about 8. In some embodiments, selective methylation with DNMT1 takes place at a pH of about 7.5. In some embodiments, selective methylation with DNMT1 takes place for a time period ranging from between about 20 minutes to about 80 minutes, such as about 20 minutes to about 70 minutes, such as about 30 minutes to about 60 minutes. In one exemplary embodiment, selective methylation takes place at a temperature of about 37°C and at a pH of about 7.5 for a time period ranging from between about 30 minutes to about 60 minutes.
[0184] In some embodiments, selective methylation with DNMT5 takes place at a temperature ranging from between about 25°C to about 65°C. In some embodiments, the DNMT5 enzyme from C. neoformans is most active at about 25°C. It some embodiments, DNMT5 from C. neoformans is utilized a temperature of about 25°C, about 35°C, about 45°C, about 55°C, or about 65°C. In some embodiments, selective methylation with DNMT5 takes place at a pH ranging from about 7 to about 9. In some embodiments, selective methylation with DNMT5 takes place at a pH of about 8. In some embodiments, selective methylation with DNMT5 takes place for a time period ranging from between about 1 minute to about 4 hours. In some embodiments, selective methylation with DNMT5 takes place for about 1 minute, for about 2 minutes, for about 5 minutes, for about 30 minutes, for about 60 minutes, or for about 4 hours.
[0185] As noted above, in some embodiments, the selective methylation takes place in the presence of one or more additional reagents, such as two or more additional reagents, such as three or more additional reagents, etc. In some embodiments, the one or more additional reagents are one or more methyl donors (also referred to herein as "methyl donating agents" or "methyl donating reagents"). Examples of methyl donors include, but are not limited to, S-adenosyl-L-methionine (SAM), derivatives or analogs of SAM (e.g., 5-(5 '-Adenosyl) -Z-methionine-(5-methyl-13C) chloride, S- (5 '-Adenosyl )- / .-m ethionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S- (5'-Adenosyl)-L-methionine / ?-toluenesulfonate salt, S-(5'-Adenosyl)-L-homocysteine, etc.), betaine, vitamin B6, etc. In some embodiments, additional aliquots of a methyl donor are added after each round of amplification and / or selective methylation.
[0186] In other embodiments, the one or more additional reagents are one or more enzymes (such as one or more thermostable enzymes, including those derived from thermophilic or hyperthermophilic archaebacterium) which facilitate (e.g., catalyze) the synthesis of a methyl donor, such as SAM or a derivative or analog thereof, such as from L-methionine and ATP. In the context of SAM synthesis, a thermostable enzyme would, it is believed, permit efficient and reliable production of SAM, even under high-temperature conditions. This is believed to be particularly important for processes such as polymerase chain reaction, where high temperatures are required for DNA amplification.
[0187] In some embodiments, the thermostable enzyme is Pyrococcus furiosus methionine adenosyltransferase (PfMAT), which is believed to catalyzes the synthesis of S- adenosylmethionine from L-methionine and ATP (see Porcelli M, et. al., Biochemical characterization of a thermostable adenosylmethionine synthetase from the archaeon Pyrococcus furiosus with high catalytic power. Appl Biochem Biotechnol. 2015 Mar;175(6):2916-33). In other embodiments, the thermostable enzyme is S-adenosylmethionine synthetase (Smat), which is derived from Sulfolobus solfataricus (see Porcelli M, S-adenosylmethionine synthetase in the thermophilic archaebacterium Sulfolobus solfataricus. Purification and characterization of two isoforms. Eur J Biochem. 1988 Nov l;177(2):273-80). In other embodiments, the thermostable enzyme is a DNA Methyltransferase M.PabI from the Archaeon Pyrococcus abyssi (see Watanabe M, Hyperthermophilic DNA methyltransferase M.PabI from the archaeon Pyrococcus abyssi. Appl Environ Microbiol. 2006 Aug;72(8):5367-75). In other embodiments, the thermostable enzyme is S-adenosylmethionine synthetase from the archaeon Methanococcus jannaschii (MjMAT) (see Lu ZJ, Enzymatic properties of S-adenosylmethionine synthetase from the archaeon Methanococcus jannaschii. J Biol Chem. 2002 May 10;277(19): 16624-31. doi: 10.1074 / jbc.Ml 10456200. Epub 2002 Feb 28. PMID: 11872742.). Without wishing to be bound by any particular theory, it is believed that the addition of the one or more enzymes which facilitate the synthesis of the methyl donor permits the continued synthesis of the methyl donor after each round of amplification and / or selective methylation without the need to introduce additional amounts of the one or more enzyme. Of course, in some embodiments, additional amounts of the one or more enzymes may be added after each round of amplification and / or selective methylation. In some embodiments, additional ATP is introduced after or prior to each round of amplification and / or selective methylation. In some embodiments, the one or more enzymes are incubated with the sample, such as a sample including one or more amplified double stranded nucleic acid molecules, for a time period ranging from between about 1 minute to about 10 minutes, such as about 1 minute to about 8 minutes, such as about 2 minutes to about 6 minutes, etc. In some embodiments, the one or more enzymes are incubated with the sample for a time period of about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, etc.
[0188] In some embodiments, the one or more enzymes are incubated with the sample at a temperature ranging from between about 80°C to about 110°C, such as a temperature ranging from between about 85°C to about 105°C, such as a temperature ranging from between about 85°C to about 95°C, etc. In some embodiments, the one or more enzymes are incubated with the sample at a temperature of about 88°C, 89°C, 90°C, 91 °C, 92°C, etc.
[0189] In some embodiments, a concentration of the one or more enzymes added to the sample ranges from between about 100 pM to about 300 pM, such as from between about 150 pM to about 250 pM, such as from between about 160 pM to about 240 pM, such as from between about 170 pM to about 230 pM, such as from between about 180 pM to about 220 pM, or such as from between about 190 pM to about 210 pM. In some embodiments, a concentration of the one or more enzymes added to the sample is about 150 pM, such as about 155 pM, such as about 160 pM, such as about 165 pM, such as about 170 pM, such as about 175 pM, such as about 180 pM, such as about 185 pM, such as about 190 pM, such as about 195 pM, such as about 200 pM, such as about 205 pM, such as about 210 pM, such as about 215 pM, such as about 220 pM, such as about 225 pM, such as about 230 pM, such as about 235 pM, such as about 240215 pM, such as about 245 pM, or such as about 250 pM,
[0190] In some embodiments, ATP and / or magnesium chloride are introduced in conjunction with the addition of the one or more enzymes. For instance, ATP may be introduced in an amount ranging from between about 0.5 mM to about 10 mM, such as in an amount ranging from between about 0.6 mM to about 9 mM, such as in an amount ranging from between about 0.7 mM to about 8 mM, such as in an amount ranging from between about 0.8 mM to about 7 mM, such as in an amount ranging from between about 0.9 mM to about 6 mM, such as in an amount ranging from between about 1 mM to about 5 mM, By way of example, magnesium chloride may be introduced in an amount ranging from between about 1 mM to about 20 mM, such as in an amount ranging from between about 2 mM to about 18 mM, such as in an amount ranging from between about 3 mM to about 16 mM, such as in an amount ranging from between about 4 mM to about 14 mM, such as in an amount ranging from between about 5 mM to about 12 mM, or such as in an amount ranging from between about 5 mM to about 12 mM. In other embodiments, the one or more additional reagents include ATP (which may serve as a cofactor for DNMT5, and which may be present in an amount ranging from between about ImM to about 5nM).
[0191] In yet other embodiments, the one or more additional reagents include Ubiquitin-like with PHD and Ring Finger Domain 1 (UHRF1).
[0192] UHRF1 is a multi-domain protein with various activities, including: (i) Hemi-methylated DNA binding; (ii) DNMT1 recruitment; and (iii) Histone ubiquitination. Without wishing to be bound by any particular theory, it is believed that UHRFl's SRA domain binds to hemimethylated DNA, ensuring targeting to the correct sites. It is further believed that UHRF1 interacts with DNMTl's C -terminal region, bringing the enzyme close to the target DNA. In some embodiments, UHRF1 is utilized during selective methylation to increase the specificity and / or efficiency of methylation by DNMT, such as by directing DNMT1 to specific locations in the one or more amplified double stranded nucleic acid molecules, thereby increasing methylation accuracy. In some embodiments, UHRF1 is utilized during selective methylation to decrease de novo methylation.
[0193] In some embodiments, a ratio of DNMT 1 to UHRF1 ranges from between 1 : 1 to about 1 :4. In some embodiments, a ratio of DNMT1 to UHRF1 is about 1 : 1.5. In other embodiments, a ratio of DNMT1 to UHRF1 is about 1 :2. In yet other embodiments, a ratio of DNMT1 to UHRF1 is about 1 :2.5. In yet other embodiments, a ratio of DNMT1 to UHRF1 is about 1:3.
[0194] By way of example, a methylation reaction in the presence of DNMT 1 may include the following components: 20ng of nucleic acid molecules (4 - 5 nM); 46 nM of DNMT1; 160 pM of S- adenosyl-L-methionine; buffer; optionally 100 nM of UHRF1; and nuclease-free water.
[0195] By way of yet a further example, a methylation reaction in the presence of DNMT1 may include the following components: 20ng of nucleic acid molecules (4 - 5 nM); 46 nM of DNMT1; 160 pM of S-adenosyl-L-methionine; buffer; optionally 100 nM of UHRF1; and nuclease-free water. By way of yet an even further example, a methylation reaction in the presence of DNMT 5 may include the following components: about lOnM of nucleic acid molecules; 180 nM of DNMT5; 4 pM of S-adenosyl-L-methionine; ImM of ATP; 50 mM Tris-HCl, pH 8; 25 mM NaCl; 10% glycerol; 2 mM DTT; 1 mM MgCb; and Nuclease-free water.
[0196] By way of example, a methylation reaction in the presence of DNMT 5 may include the following components: about lOnM of nucleic acid molecules; 180 nM of DNMT5; about 200 nM of an enzyme capable of catalyzing the synthesis of SAM; ImM of ATP; 50 mM Tris-HCl, pH 8; 25 mM NaCl; 10% glycerol; 2 mM DTT; 1 mM MgCL; and Nuclease-free water. IDENTIFICATION OF METHYLATION PATTERNS
[0197] Methylated nucleotides (or methylation patterns) in the one or more amplified and selectively methylated double stranded nucleic acid molecules can be identified directly or indirectly. For instance, 5-mC may be indirectly identified using a bisulfite sequencing method (bisulfite conversion followed by PCR and nucleic acid sequencing). Methylated nucleotides can also be directly detected such as using a sequencing-by-synthesis platforms include the Pacific BioSciences platform utilizing SMRT sequencing (Pacific Biosciences, Menlo Park, CA) or a platform utilizing nanopore technology such as those manufactured by Roche Sequencing Solutions (Genia) (Santa Clara, Calif.).
[0198] Bisulfite Sequencing
[0199] Bisulfite sequencing provides a qualitative approach to identify 5-methylcytosine at single basepair resolution. This method is based on the finding that the deamination reactions of cytosine and 5-methylcytosine (5-mC) result in different nucleic acid base conversions after the treatment of sodium bisulfite. In some embodiments, the one or more amplified and selectively methylated nucleic acid molecules are first treated with bisulfite reagents that specifically convert unmethylated cytosines in the one or more amplified and selectively methylated nucleic acid molecules to uracil residues (see Scheme 1, below) while having no impact on methylated cytosines.
[0200] Scheme 1 : Reaction between cytosine and bisulfite (step 1) leads to deamination (step 2) at acidic pH. Afterward, desulfonation at alkaline pH produces uracil (step 3).
[0201] The resulting uracil residues are then recognized as thymine in subsequent PCR amplification and sequencing, however, 5-mCs are immune to this conversion and remain as cytosines allowing 5- mCs to be distinguished from unmethylated cytosines.
[0202] Nanopore Sequencing
[0203] Nanopore sequencing refers to the approach in which tags that are attached to nucleotides can be distinguished by their effect on ionic currents passing through nanopores as these tagged nucleotide analogs are added to a growing (nascent) DNA strand. Measurements can be made while tagged nucleotides are still part of the ternary complex, or after their tags are released by the polymerase reaction.
[0204] Nanopore sequencing of a nucleic acid molecule may be achieved by strand sequencing and / or exosequencing of the polynucleotide sequence. In some embodiments, nanopores may be used to sequence nucleic acid molecules where a polymerized nucleic acid molecule does not pass through the nanopore during sequencing. In these embodiments, the nucleic acid molecule may be at least partially located in the vestibule of the nanopore, but not in the pore (i.e., narrowest portion) of the nanopore. The nucleic acid molecule may pass within any suitable distance from and / or proximity to the nanopore, and optionally within a distance such that byproducts released from nucleotide incorporation events, e.g., tags cleaved from tagged nucleotide analogs, are detected in the nanopore.
[0205] Nanopore sequencing utilizes different tagged nucleotide analogs each having a covalently attached tag moiety that provides an identifiable, and distinguishable signature when detected within or near a nanopore. In some embodiments, nanopore sequencing requires a set of at least the four-standard deoxy-nucleotides dA, dC, dG, and dT, wherein each nucleotide has an attached tag capable of being detected by a nanopore upon the nucleotide being incorporated by a strand extending enzyme. Examples of tagged nucleotide analogs are described in United States Patent No. 10,975,426, the disclosure of which is hereby incorporated by reference herein in its entirety. In some embodiments, a strand extending enzyme (e.g., a DNA polymerase), such as one located in proximity to a nanopore, specifically binds a tagged nucleotide analog that is complimentary to a nucleotide of a nucleic acid molecule which is hybridized to a growing (nascent) nucleic acid strand at its active site. The strand extending enzyme (e.g., a DNA polymerase) then catalytically incorporates the complementary nucleotide moiety of the tagged nucleotide analog ("nucleotide incorporation event") to the end of the nascent nucleic acid strand. Nucleotide incorporation events are catalyzed by the enzyme, such as DNA polymerase or any mutant or variant thereof and use base pair interactions with a template molecule to choose amongst the available nucleotides for incorporation at each location. Completion of the catalytic incorporation event results in the release of the tag moiety and the oligophosphate moiety (minus the one phosphate incorporated into the growing strand) which then passes through the adjacent nanopore.
[0206] "Nucleotide incorporation events," as that term is used herein, means the incorporation of a tagged nucleotide analog into a growing polynucleotide chain. In some embodiments, byproducts of nucleotide incorporation events may be detected by the nanopore. In some embodiments, a byproduct may be correlated with the incorporation of a given type of modified or unmodified nucleotide. In some embodiments, the byproduct passes through the nanopore and / or generates a signal detectable in the nanopore. Released tag molecules are examples of byproducts of nucleotide incorporation events. Additional details pertaining to such nanopore-based sequencing systems and methods are described in United States Patent Nos. 9,605,309 and 9,557,294, the disclosures of which are hereby incorporated by reference herein in their entireties.
[0207] It is possible to detect and / or measure nucleotide incorporation events relating to the incorporation and / or release of a tagged nucleotide. For instance, it is possible to measure the dwell time and / or waiting time of a tagged nucleotide. Dwell time and waiting time are independent of each other and may be separately measured and used to identify variant bases in a nucleic acid molecule.
[0208] As used herein, the "dwell time" is the amount of time that a single tag spends within a nanopore while being held by the polymerase during nanopore sequencing. It is a measure of the interaction between the tag and the pore. The "waiting time," which is the amount of time spent between "dwells." Each tagged nucleotide will exhibit different dwell times and / or wait times based on its incorporation into a nascent nucleic acid strand. These different dwell times and / or wait times will depend on the complementarity of the tagged nucleotide analog to the modified or unmodified nucleotide in the nucleic acid molecule to which it is being hybridized. For instance, a tagged nucleotide analog may exhibit a different dwell time or a different wait time if the corresponding nucleotide in the nucleic acid molecule is a modified nucleotide (5-mC) versus an unmodified nucleotide (unmethylated cytosine). By exploiting these measurable differences in dwell times and / or wait times, it is possible to determine with single base resolution the species of modified nucleotide or unmodified nucleotide at each position in a nucleic acid molecule.
[0209] By way of example, a measured dwell time of DI and a measured wait time of W1 may be correlated with an unmodified cytosine residue. By way of another example, a measured dwell time of D2 and a wait time of W2 may be correlated to a 5mC residue.
[0210] In some embodiments, the dwell times and / or wait times (or ratios between a dwell times and / or a wait times) are derived, the derived dwell time and / or wait time (or a ratio between a derived dwell time and / or a derive wait time) are used to determine the specific modified or unmodified nucleotide incorporated into a nascent strand. In other embodiments, a "look-up" table of known dwell times, wait times, and / or ratios between known dwell times and known wait times is used to determine the specific modified or unmodified nucleotide incorporated into a nascent strand.
[0211] In some embodiments, a method for sequencing a nucleic acid molecule comprises (a) polymerizing protected tagged nucleotide analogs (e.g., using an enzyme which incorporates one tagged nucleotide at a time using a first nucleic acid molecule as a template) wherein a tag associated with an individual nucleotide analog is released upon polymerization; and (b) detecting the released tag with the aid of a nanopore. In some embodiments, the enzyme draws from a pool of tagged nucleotide analogs. As noted herein, each type of tagged nucleotide analog is coupled to a different tag molecule so that when the tags are released and pass near or through the nanopore, they may be differentiated from each other based on a signal that is generated (e.g., dwell time, wait time, etc.). In some embodiments, each tag may have a different detectable signal, e.g., different signal intensities, different signal amplitudes, etc. which may be interpreted such as by base calling algorithms.
[0212] In some embodiments, a released tag flows through the nanopore or in close proximity to the nanopore such that a sensing circuit detects an electrical signal associated with the tag as it passes through or near the nanopore. Detected signals may be measured and stored in a memory location and later used to construct a sequence of the nucleic acid. The detected signals may be processed to account for any abnormalities in the detected signals, such as errors. Suitable nanopore detectors are described in United States Patent Application Publication Nos. 2011 / 0193570 and 2018 / 0073071, the disclosures of which are hereby incorporated by reference herein in their entireties. Likewise, United States Patent Nos. 9,377,437 and 8,324,914 describe the collection and analysis of electrical signals from nanopore-based sequencing systems, the disclosures of which are hereby also incorporated by reference herein in their entireties.
[0213] In some embodiments, the enzymes coupled or otherwise conjugated to nanopores include polynucleotide processing enzymes, e.g., DNA and RNA polymerases, reverse transcriptases, exonucleases, and unfoldases. In some embodiments, the enzyme is a helicase. In some embodiments, the enzyme can be a wild-type enzyme, or it can be a variant form of the wild-type enzyme. In some embodiments, the enzyme is a polymerase variant. Suitable enzymes are disclosed in United States Patent Application Publication No. 2016 / 0257942.
[0214] In some embodiments, the nanopores of the nanopore sequencing complex include, without limitation, biological nanopores, solid state nanopores, and hybrid biological-solid state nanopores. Biological nanopores of the nanopore sequencing complexes include OmpG from E. coli, sp., Salmonella sp., Shigella sp., and Pseudomonas sp., Cytolysin A (ClyA), and alpha hemolysin from S. aureus sp., MspA from M. smegmatis sp. The nanopores may be wild type nanopores, variant nanopores, or modified variant nanopores. See, for example, United States Patent Application Publication No. 2017 / 0088588, the disclosure of which is hereby incorporated by reference herein in its entirety. In some embodiments, the variant nanopore of the nanopore sequencing complex is engineered to reduce the ionic current noise of the parental nanopore from which it is derived. Yet other nanopores are described in United States Patent Application Publication Nos. 2017 / 0268052, 2017 / 0356037 and 2018 / 0201993, the disclosures of which are hereby incorporated by reference herein in their entireties. Any nanopore variant now known or later discovered may be screened according to the methods described herein, such as contemporaneously with the screening of one or more enzyme variants (e.g., to identify a nanopore variant and enzyme variant pair that provides desirable properties).
[0215] The nanopore may be formed or otherwise embedded in a membrane disposed adjacent to a sensing electrode of a sensing circuit, such as an integrated circuit. The integrated circuit may be an application specific integrated circuit (ASIC). In some examples, the integrated circuit is a field effect transistor or a complementary metal-oxide semiconductor (CMOS). The sensing circuit may be situated in a chip or other device having the nanopore, or off of the chip or device, such as in an off-chip configuration. The semiconductor can be any semiconductor, including, without limitation, Group IV (e.g., silicon) and Group III-V semiconductors (e.g., gallium arsenide, molybdenum disulfide). Methods for assembling nanopore sequencing complexes are described in U.S. Patent Application Publication No. 2017 / 0268052, the disclosure of which is hereby incorporated by reference herein in its entirety. Other suitable methods for complexing each of the different templates to nanopore-enzyme conjugates include those described in PCT Publication Nos. WO2014 / 074727, W02006 / 028508, and WO2012 / 083249, the disclosures of each are hereby incorporated by reference herein in their entireties.
[0216] A chip for sequencing a nucleic acid sample may include a plurality of individually addressable nanopores. An individually addressable nanopore of the plurality can contain at least one nanopore formed in a membrane disposed adjacent to an integrated circuit. In some embodiments, each individually addressable nanopore can be capable of detecting a tag associated with an individual nucleotide.
[0217] Multiple nanopore sensors may be provided as arrays, such as arrays present on a chip or biochip. The array of nanopores may have any suitable number of nanopores. In some instances, the array comprises about 200, about 400, about 600, about 800, about 1000, about 1500, about 2000, about 3000, about 4000, about 5000, about 10000, about 15000, about 20000, about 40000, about 60000, about 80000, about 100000, about 200000, about 400000, about 600000, about 800000, about 1000000, and the like nanopores. Biochips and methods for making biochips are described in PCT Publication No. W02015 / 061511, the disclosure of which is hereby incorporated by reference herein in its entirety. Further suitable biochips including a plurality of nanopores are described in United States Patent Application Publication No. 2017 / 0268052, the disclosure of which is hereby incorporated by reference herein in its entirety. Yet further suitable nanopore arrays are described in United States Patent No. 8,986,928, the disclosure of which is hereby incorporated by reference herein in its entirety. Sequencing on the SMRT Platform
[0218] It is believed that sequencing using the SMRT platform allows the observation of single DNA polymerases reading individual molecules of DNA in real time. It is also believed that the kinetic characteristics of DNA polymerization are observable on a single-molecule basis.
[0219] In some embodiments the incorporation of differently labeled nucleotides is observed in real time as template dependent synthesis is carried out. In particular, an individual immobilized primer / template / polymerase complex is observed as fluorescently labeled nucleotides are incorporated, permitting real time identification of each added base as it is added. In this process, label groups are attached to a portion of the nucleotide that is cleaved during incorporation. For example, by attaching the label group to a portion of the phosphate chain removed during incorporation, i.e., a P, y, or other terminal phosphate group on a nucleoside polyphosphate, the label is not incorporated into the nascent strand, and instead, natural DNA is produced. Observation of individual molecules typically involves the optical confinement of the complex within a very small illumination volume. By optically confining the complex, a monitored region is created in which randomly diffusing nucleotides are present for a very short period of time, while incorporated nucleotides are retained within the observation volume for longer as they are being incorporated. This results in a characteristic signal associated with the incorporation event, which is also characterized by a signal profile that is characteristic of the base being added. In some embodiments, interacting label components, such as fluorescent resonant energy transfer (FRET) dye pairs, are provided upon the polymerase or other portion of the complex and the incorporating nucleotide, such that the incorporation event puts the labeling components in interactive proximity, and a characteristic signal results, that is again, also characteristic of the base being incorporated (see, e.g., U.S. Pat. Nos. 6,056,661, 6,917,726, 7,033,764, 7,052,847, 7,056,676, 7,170,050, 7,361,466, 7,416,844 and Published U.S. Patent Application No. 2007- 0134128, the disclosures of which are each hereby incorporated by reference herein in their entireties).
[0220] The SMRT platform uses a polymerase enzyme, a template sequence, and a primer sequence complementary to a portion of the template sequence. These components are immobilized within a confined illumination volume. The reaction mixture surrounding the complex has the four different nucleotides (A, G, T and C) each labeled with a spectrally distinguishable fluorescent label attached through its terminal phosphate group. Because the illumination volume is small, nucleotides and their associated fluorescent labels diffuse in and out of the illumination volume quickly and thus provide only very short fluorescent signals. When a particular nucleotide is incorporated by the polymerase in a primer extension reaction, the fluorescent label associated with the nucleotide is retained within the illumination volume for a longer time. Once incorporated, the fluorescent label is cleaved from the base through the action of the polymerase, and the label diffuses away.
[0221] By identifying longer pulses of different spectral characteristics, the identity of each incorporated base may be detected in real time as it is being incorporated. It is believed that the kinetic characteristics, such as the time duration between two successive base incorporations, are altered by the presence of a modified base in the DNA template. This is observable as an increased space between fluorescence pulses, which is called the interpulse duration (IPD). These changes in the DNA polymerase rate of binding and / or incorporation, relative to an amplified control template lacking modified bases, can be measured for each template position to indicate the presence of modified bases in the DNA template. In addition to the interpulse duration, other kinetic signals may be measured and associated with different modified and / or unmodified nucleotides. In addition to IPD, in some embodiments, pulse width and / or other kinetic parameters may be measured and monitored to indicate the presence of modified bases in the DNA template (see, e.g., U.S. Patent No. 8,133,672 the disclosure of which is hereby incorporated by reference herein in its entirety).
[0222] COMPOSITIONS
[0223] The present disclosure also provides for a composition comprising a thermostable enzyme capable of catalyzing SAM synthesis, ATP, and MgCh. In some embodiments, the thermostable enzyme is one of Pfmat, Smat, MpabI, or Mjmat*, as described herein. In some embodiments, the composition further includes a methyltransferase, such as DNMT-1 or DNMT-5. In some embodiments, the composition further includes one or more PCR reagents.
[0224] The present disclosure also provides for a composition comprising S-adenosyl-L-methionine (SAM) or a derivative or analog of SAM (e.g., 5-(5 '-Adenosyl) -Z-methionine-(5-methyl-13C) chloride, 5-(5'-Adenosyl)-Z-m ethionine chloride dihydrochloride, S-(5'-Adenosyl)-L-m ethionine iodide, S-(5'-Adenosyl)-L-methionine / ?-toluenesulfonate salt, S-(5'-Adenosyl)-L-homocysteine, etc.); ATP; and MgCh. In some embodiments, the composition further includes a methyltransferase, such as DNMT-1 or DNMT-5. In some embodiments, the composition further includes one or more PCR reagents.
[0225] KITS
[0226] In some embodiments, the present disclosure provides a kit including components for amplifying and / or selectively methylating nucleic acid molecules. In some embodiments, the kits include a first container includes a methyltransferase; and a second container comprising one or more PCR reagents. In some embodiments, the first container includes a methyltransferase and one or more additional reagents, e.g., methyl donors, cofactors, etc. In some embodiments, the methyl donor is S-adenosyl-L-methionine (SAM) or a derivative or analog of SAM (e.g., 5-(5 '-Adenosyl) -L- methionine-(5-methyl-13C) chloride, A’-(5 '-Adenosyl (- / .-methionine chloride dihydrochloride, S- (5'-Adenosyl)-L-methionine iodide, S-(5'-Adenosyl)-L-methionine / ?-toluenesulfonate salt, S-(5'- Adenosyl)-L-homocysteine, etc.).
[0227] In some embodiments, the first container includes a thermostable enzyme capable of catalyzing SAM synthesis, ATP, and MgCh. In some embodiments, the thermostable enzyme is one of Pfmat, Smat, MpabI, or Mjmat*, as described herein.
[0228] In some embodiments, the first container comprises DNMT1 and one of Pfmat, Smat, MpabI, or Mjmat*. In some embodiments, the first container comprises DNMT5 and one of Pfmat, Smat, MpabI, or Mjmat*. In some embodiments, the container further includes ATP.
[0229] In some embodiments, the first container comprises DNMT1 and S-adenosyl-L-methionine. In some embodiments, the first container comprises DNMT and UHFR1. In some embodiments, a ratio of DNMT1 to UHRF1 ranges from between 1 : 1 to about 1 :4. In some embodiments, a ratio of DNMT1 to UHRF1 is about 1 : 1.5. In other embodiments, a ratio of DNMT1 to UHRF1 is about 1:2. In yet other embodiments, a ratio of DNMT1 to UHRF1 is about 1 :2.5. In yet other embodiments, a ratio of DNMT1 to UHRF1 is about 1 :3. In some embodiments, the first container comprises DNMT 1, S-adenosyl-L-methionine, and UHRFl.
[0230] In some embodiments, the first container comprises DNMT5. In some embodiments, the first container comprises DNMT5 and ATP. In some embodiments, the first container comprises DNMT5;ATP and a thermostable enzyme capable of catalyzing the synthesis of SAM.
[0231] In some embodiments, the one or more PCR reagents include a polymerase. In some embodiments, the polymerase is selected from those described herein. One example of a polymerase is a Taq or Taq-derived polymerase (e.g., KAPA 2G polymerase from KAPA BIOSYSTEMS). Another example polymerase is a B-family DNA polymerase (e.g., KAPA HIFI polymerase from KAPA BIOSYSTEMS).
[0232] In some embodiments, the PCR reagents include one or more nucleotides. In some embodiments, the PCR reagents include deoxynucleoside triphosphates (dNTPs), such as all the four naturally occurring deoxynucleoside triphosphates (dNTPs). In some embodiments, the PCR reagents include deoxyribonucleoside triphosphate molecules, including all dATP, dCTP, dGTP, dTTP. In some embodiments, the PCR reagents also include compounds useful in aiding the activity of the nucleic acid polymerase. For example, in some embodiments, the PCR reagent include a divalent cation, e.g., magnesium ions. In some embodiments, the magnesium ions are provided in the form of magnesium chloride, magnesium acetate, or magnesium sulfate. In some embodiments, the PCR reagents further include a buffer or buffer solution. In some embodiments, each of the PCR reagents are provided alone. In other embodiments, each of the PCR reagents are provided in admixture.
[0233] In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; and (b) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites. In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; (b) a PCR master mix; and (c) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites. In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; (b) a methyl donor reagent; (c) an optional cofactor for the DNA methyltransferase; and (d) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyl transferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites. In some embodiments, the DNA methyltransferase is DNA methyltransferase 1. In some embodiments, the DNA methyltransferase is DNA methyltransferase 5. In some embodiments, the kit further comprises a methyl donor agent. In some embodiments, the methyl donating reagent is S-adenosyl-L-methionine. In some embodiments, the kit further includes UHRF 1. In some embodiments, the kit further includes ATP. In some embodiments, the adapters include the first unique molecular identifier including the at least one methylated CpG. In some embodiments, the first unique molecular identifier includes at least two methylated CpGs. In some embodiments, the kit further includes a second unique molecular identifier including only unmethylated CpGs. In some embodiments, the adapters include the primer binding site comprising the 3' end including the one or more methylated CpG sites.
[0234] In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; (b) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; and (c) an enzyme capable of catalyzing the synthesis of SAM. In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; (b) a PCR master mix; (c) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; and (d) an enzyme capable of catalyzing the synthesis of SAM. In some embodiments, the present disclosure provides a kit comprising: (a) a DNA methyltransferase; (b) a methyl donor reagent; (c) an optional cofactor for the DNA methyltransferase; (d) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; and (e) an enzyme capable of catalyzing the synthesis of SAM. In some embodiments, the DNA methyltransferase is DNA methyltransferase 1. In some embodiments, the DNA methyltransferase is DNA methyltransferase 5. In some embodiments, the enzyme capable of catalyzing the synthesis of SAM is selected from Pfirnat, Smat, MpabI, or Mjmat*. In some embodiments, each of the kits may further include ATP.
[0235] EXAMPLES
[0236] Example 1: Bias in Favor of Methylated Templates During PCR
[0237] The priming site in the adapter has a number of CpG’s (underlined) at the 3' end of the amplification primer binding site next to the genomic insert (nucleic acid molecule) which itself contains a number of CpG sites (underlined). Methyl cytosines are indicated in bold font. Only one end of the molecule is shown.
[0238] 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGACGACGAATCATATCATGA CGATACTCGACTTC (SEQ ID NO: 1), where GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 2) is a portion of the adapter construct.
[0239] CGACGACG is a primer binding site portion of the adapter construct; and
[0240] AATCATATCATGACGATACTCGACTTC (SEQ ID NO: 3) is the nucleic acid molecule.
[0241] 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 4), where CAGAGCACCCGAGCCTCTACACATATTCTCTGTC (SEQ ID NO: 5) is a portion of the adapter construct.
[0242] GCTGCTGC is a primer binding site portion of the adapter construct; and
[0243] TTAGTATAGTACTGCTATGAGCTGAAG (SEQ ID NO: 6) is the nucleic acid molecule. The PCR primer would be: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGACGACG3' (SEQ ID NO: 7) After a few rounds of PCR followed by DNMT1 methylation, two double stranded nucleic acid molecules may be produced, one which had the methylation pattern faithfully replicated:
[0244] 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGACGACGAATCATATCATGA CGATACTCGACTTC (SEQ ID NO: 8) 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 9)
[0245] And one where the methylation pattern has been lost:
[0246] 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGACGACGAATCATATCATGA CGATACTCGACTTC (SEQ ID NO: 10) 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 11)
[0247] From these two molecules, in the next round of PCR two possible template strands are presented to the primer for binding:
[0248] Methylated template: 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 12)
[0249] Unmethylated template: 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 13)
[0250] Due to the higher Tm of the mC:G base pair, the methylated template will preferentially bind to the primer and be extended.
[0251] 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCGACGACG (SEQ ID NO: 14)
[0252] 3'CAGAGCACCCGAGCCTCTACACATATTCTCTGTCGCTGCTGCTTAGTATAGTACTG CTATGAGCTGAAG (SEQ ID NO: 15)
[0253] Over many cycles of PCR, even a small preference for the methylated template, should translate to a bias in favor of the amplification molecules which have been methylated by the processive activity of DNMT 1. Example 2: Sequencing of Amplified and Selectively Methylated Nucleic Acid Molecules
[0254] Nucleic acid molecules were obtained, amplified, and selectively methylated in accordance with the methods described herein. In particular, selective methylation was carried out in the presence of DNMT5 and ATP. Applicant has found that the DNMT5 has significantly increased activity as compared with the DNMT1. Applicant has discovered that DNMT5 primarily targets and only methylates existing hemi methylated sites FIG. 6 unlike DNMT1, which can methylate both unmethylated and methylated CpG sites. Applicant has further demonstrated that de novo methylation activity is absent in DNMT5, and this further enhances its specificity for detecting existing methylation patterns (see FIG. 7). Additionally, Applicant has discovered that DNMT5 exhibits higher ATPase activity when bound to hemimethylated DNA compared to unmethylated DNA (see FIG. 8). Applicant believes that this allows for superior methylation activity, potentially leading to faster and more sensitive assays. Finally, Applicant has determined that no special cofactors are necessary when utilizing DNMT5 for selective methylation, thereby simplifying assay design and reducing complexity.
[0255] FIG. 9 illustrates that higher DMNT5 concentrations lead to increase overall methylation. For instance, there is a dose dependent effect in that higher concentrations of DNMT5 lead to more methylation events.
[0256] Example 3: Preservation of Methylation Patterns During DNA Amplification: Incorporation of DNMT5-mediated DNA methylation during PCR Amplification
[0257] This study presents the development of a novel method for preserving DNA methylation patterns during amplification mediated by DNMT5 methyltransferase. DNA methylation is an epigenetic marker and plays a crucial role in gene regulation and various biological processes, including disease development. The traditional PCR amplification method poses challenges in conserving methylation, resulting in the loss of DNA methylation patterns and subsequent loss of original epigenetic information. To address this challenge, a novel amplification assay has been developed that incorporates DNMT5 methyltransferase into the amplification process, thus preserving methylation signatures. This study demonstrated DNMT5 (C.neoformans) achieved up to 90% on- target methylation with no detectable de novo methylation above background noise. Additionally, this study showed successful preservation of methylation patterns by incorporating DNMT5 methyltransferase in multi-cycling conditions, resulting in the development of high-fidelity methylation amplification method. The data represents preliminary findings toward the development of a methylation assay capable of detecting methylation signatures in cfDNA. Methods
[0258] Synthetic DNA templates, containing multiple 5mC modifications, were utilized to investigate DNMT5 methylation efficiency. Methylation detection, after multiple PCR cycles with DNMT5, was achieved through Bisulfite sequencing analysis. For comparative analysis, a synthetic hemimethylated DNA template was utilized to assess DNMT5 activity at two different concentrations (45nM and 180nM). A synthetic DNA template, 150 base pairs in length and containing primer binding sites at both ends, was treated with M.SssI methyltransferase (NEB cat#: M0226) to methylate all CpG dinucleotides on both the upper and lower strands. Copies of hemi-methylated DNA strands were generated through a single primer extension from a fully methylated template using 20mer primers designed for its priming sites. Subsequently, DNMT5 was administered to lOng (or about 6nM) of the starting hemi-methylated substrates and to copies generated after each cycle of PCR amplification. DNMT5 concentrations were adjusted to 360nM post 1st and 2nd cycles, 720nM post 3rd and 4th cycles, and 1010 nM post 5th and 6th cycles. PCR amplification was performed using the Phusion High-Fidelity PCR kit from NEB (cat #: E0553). This method involved rounds of PCR reaction and DNMT5 treatment on newly synthesized hemi-methylated DNA, with bead cleanup (2:1 or 2x bead to sample ratio) conducted between each reaction (in accordance with the methods described herein). The methylation reaction in presence of DNMT5 and hemi-methylated substrates was incubated at 25°C for 4 hours after the addition of these following components: 160 pM of S-adenosyl-L-methionine; 1 to 5mM of ATP; 50 mM Tris-HCl, pH 8; 25 mM NaCl; 10% glycerol; 2 mM DTT; 1 mM MgCE; and Nuclease-free water. The fully methylated templates treated with DNMT5 were ligated with methylated adapters and underwent bisulfite (BS) conversion using the Zymo EZ DNA Methylation-Lightning kit (cat #: D5030). Library preparation was conducted using adapters, primers, and accompanying reagents from NEBNext® Multiplex Oligos for Enzymatic Methyl-seq (cat #:E7140). The resulting bisulfite- converted DNA library was sequenced on Miseq and Nextseq Illumina platforms for downstream analysis. DNMT5 methylation, coupled with multiple PCR cycles, demonstrated the preservation of methylation across PCR cycles. The subsequent inclusion of DNMT5 treatment after each PCR cycle ensured the maintenance of methylation. The Bisulfite-sequencing (BS-seq) plots exhibited high percentages of DNMT5 on-target methylation, with no signs of methylation at de novo sites, affirming the preservation of methylation through multiple cycles of PCR (lx, 3x, and 6x cycles).
[0259] The sequences utilized are:
[0260] Upper Strand
[0261] CTG CTT GTC TGT ACT TAC GTA CTG CTT GTC TGT ACT TCC GTA CTG CTT GTC TGT ACT CGCGGG CTG CTT GTC TGT ACT TCCGTA CTG CTT GTC TGT ACT TAC GTA CTG CTT GTC TGT ACT (SEQ ID NO: 16)
[0262] Lower Strand:
[0263] AGTACAGACAAGCAGTACGTAAGTACAGACAAGCAGTACGGAAGTACAGACAAGC AGCCCGCGAGTACAGACAAGCAGTACGGAAGTACAGACAAGCAGTACGTAAGTAC AGACAAGCAG (SEQ ID NO: 17)
[0264] Results
[0265] FIG. 10 presents a comparison of methylation activity between DNMT1 and DNMT5. The BS- seq results demonstrate an equivalent DNMT5 on-target methylation percentage compared to DNMT1. In the left plot, showing various shades of blue bars depict >90% on-target methylation on hemi-methylated sites with increasing concentration of DNMT1. Similarly, the gray bars on the right plot illustrate comparable methylation level using DNMT5. Both DNMT1 and DNMT5 exhibit a dose-response relationship.
[0266] FIG. 11 presents a comparison of methylation levels observed across all de novo CpG sites. The blue and gray bars in both plots represent all de novo CpG positions within the template. In the left plot, DNMT1 methylation at various concentrations exhibits around 25% de novo methylation. The right plot demonstrates DNMT5 with no detectable methylation above background noise (<0.4%) on de novo sites. The BS-seq analysis and results plot demonstrate that DNMT5 exhibits superior high specificity and efficiency for hemi-methylated sites, with no detectable de novo methylation activity.
[0267] In FIG. 12, a comparison is presented of data plot of methylation levels observed after lx, 3x and 6x cycles of PCR. The x-axis displays all 24 CpG positions in the template, of which 12 mCpG on the upper strand and 12 mCpG present in the lower strand, where methylation was detected. The y-axis represents the percentage methylation observed at each site. Red bars indicate Hemimethylation and purple bars, Fully-methylation controls and each of blue, orange, and green bars represents a comparison of methylation levels observed after lx, 3x, and 6x cycles of PCR amplification and DNMT5 methylation. DNMT5 methylation was coupled with multiple cycles of PCR to demonstrate the preservation of methylation across PCR cycles. Hemimethylated strands were generated using a single cycle PCR amplification of a fully methylated template. Synthesized hemi-methylated templates were then methylated by DNMT5 treatment after each PCR cycle. The BS-seq results indicate high percentages of methylation (>90%), exhibiting that methylation was maintained through multiple cycles of PCR (lx, 3x, and 6x cycles).
[0268] Discussion
[0269] The results demonstrate the capability of the DNMT5 methyltransferase to successfully preserve the DNA methylation information from the original template across multiple PCR cycles. Leveraging the insights gained from DNMT5 methylation during PCR, we will refine and optimize strategies for preserving methylation patterns with high fidelity during PCR amplification. This will involve elucidating the optimal conditions for DNMT5 activity within the amplification reaction, such as temperature, buffer composition, and substrate concentration to maximize processivity or minimize dissociation events. These results will inform the development of a prototype methylation assay that can be used to detect methylation signatures in cfDNA or tissue samples containing very low levels of methylated DNA.
[0270] Conclusion
[0271] The key results from the BS-seq analysis on DNMT5 methylation in cycling conditions prove that DNA methylation can be preserved with high fidelity during PCR amplification, using DNMT5. This leads to the advancement of methylation amplification techniques from a single cell or cfDNA, while maintaining original methylation information. These findings offer significant potential for applications in both epigenetic research and clinical diagnostics.
[0272] Example 4: Methylation with DNMT1 Alone or Combined with UHRF1
[0273] To detect the level of 5-methylcytosine (5mC) after DNMT1 treatment, a bisulfite sequencing method was utilized. As described herein, bisulfite sequencing is a method that converts unmethylated cytosines to uracil, while leaving methylated cytosines unchanged. This allowed for a differentiation between methylated and unmethylated cytosines.
[0274] DNA was treated with sodium bisulfite, which converted unmethylated cytosines to uracil. The DNA was then amplified using PCR primers designed to amplify a region of DNA that contains both methylated and unmethylated cytosines. The amplified DNA was then sequenced using Illumina Miseq platform. The NGS data was then analyzed to determine the level of 5mC.
[0275] If the level of 5mC methylation was increased, it would suggest that DNMT1 was methylating the cytosine bases opposite the hemimethylated strand. If the level of 5mC methylation as decreased, it would suggest that DNMT1 as not active.
[0276] A 156bp fully methylated template was obtained. The template was extended to create a hemimethylated molecule which was subsequently treated with DNMT1 and UHRF1. Using a Zymo- Seq Cell Free DNA WGBS Library Kit, the extended and methylated molecule was prepared for bisulfite sequencing. The results are shown in FIGS. 13, 14, and 15.
[0277] Overall, a sequencing QC report showed good sequencing quality, QC metrics and coverages with all controls showing expected methylation levels. DNMT1 alone increased methylation in hemimethylated sites but had less of an effect on de novo methylation. Addition of UHRF1 decreased de novo methylation levels in most sites. Varied methylation levels cannot be explained by published preferred DNMT1 sequence context, indicating additional factors affecting DNMT1 / UHRF1 activity.
[0278] Example 5 - Strategies for Enhanced S-Adenosylmethionine (SAM) Thermal Stability Enzymatic Regeneration and SAM analogs for nucleic aciAd methylation S-adenosylmethionine (SAM) serves as an essential cofactor for DNA methylation reaction; however, its thermal instability effect on DNMT5-mediated methylation present significant obstacles in PCR and isothermal workflows. Here, strategies were explored to enhance SAM stability and optimize DNMT -mediated methylation reactions to overcome these challenges.
[0279] Stability and Optimization of SAM in Methylation Reactions
[0280] SAM is believed to be thermally unstable at pH 7.5 and 37 °C, requiring fresh preparation for each reaction. For prolonged reactions, replenishing SAM is needed to continue methylation reaction. Key strategies tested to improve SAM's functionality include
[0281] Enzymatic SAM Regeneration via PjMAT in the methylation reaction
[0282] By utilizing the thermostable enzyme Pyrococcus juriosus methionine adenosyltransferase (PfMAT), we have successfully enabled continuous synthesis of S-adenosylmethionine (SAM) from L-methionine and ATP to support methylation reactions, particularly during PCR amplification cycles. PfMAT operates optimally at 90°C and possesses a high melting temperature of 99°C, which ensures robust performance and stability under thermal cycling conditions (see FIGS. 18 and 19).
[0283] Synthetic SAM Analogs
[0284] SAM analogs were tested, including SAM-iodide, SAM-chloride, and SAM-toluene and demonstrated that they can replace SAM in the methylation reaction. These analogs are yet to be tested for improved thermal stability and hence functional replacement options in methylation reactions (see FIG. 23, where Lanes 8, 9, and 10 show the SAM analogs that were tested, namely SAM-iodide, SAM-Chloride, or SAM-Toluene).
[0285] Isothermal Conditions
[0286] Conducting reactions under stable, isothermal conditions minimizes temperature-induced SAM degradation, enhancing its stability and the efficiency of DNMT-mediated methylation. However, different isothermal amplification techniques require temperatures ranging from 30°C to 65°C, so improved thermal stability of SAM will aid robustness in these amplification techniques.
[0287] By implementing these approaches, it was believed that SAM-associated challenges could be mitigated, optimizing DNMT -mediated methylation workflows for applications in early disease detection, epigenetic research, and diagnostic assays.
[0288] Materials and Methods
[0289] Enzyme
[0290] The enzyme Pyrococcus furiosus methionine adenosyltransferase (PfMAT) was custom prepared by GenScript, who carried out cloning and protein expression (The analysis of the complete sequenced genome of P. furiosus identified an open reading frame, PF 1866, of 1206 base pairs, encoding a protein of 401 amino acids with homology to archaeal methionine adenosyltransferase (MAT). This gene, annotated as PfMAT, has a predicted molecular mass of 44,279 Da. The final enzyme was supplied in a buffer containing 50 mM HEPES-KOH, 150 mM KC1, 10% glycerol, and 2 mM DTT at pH 7.9).
[0291] Enzyme Assay
[0292] PfMAT activity was determined following the formation of AdoMet from 1-methionine and ATP by HPLC using a Beckman system Gold apparatus. Unless otherwise stated, the standard incubation mixture contained the following: 50 mM Tris / HCl buffer, pH 8.0, 20 mM MgCh, 5 mM 1-methionine, 10 mM ATP, and the enzyme in a final volume of 200 pL.
[0293] TEST DNA Template Sequences
[0294] CLA / SAU template synthesized from IDT was used for testing PfMAT, with the single methylation site. CLA / SAU Template Sequence:CLASAU Hemi mCpG 150 bp
[0295] SEQUENCE OF HEMI METHYLATED TEMPLATE-CLASAU Hemi mCpG 150 bp
[0296] Sense - / 5Phos / GG AAC GGC TGG CCA TTA TCT CGG TGG TAG GTG ATG GTA TGC GCA CCT TGC GTG GTC GGC GAA ATT CTT TGG ATC GAT TGC ACT GGC CCG CGC CAA TAT CAA CAT TGT CGC CAT TGC TCA GGG ATT CTG AAC GCT CAA TCT CTG TCG TGG T (SEQ ID NO: 18)
[0297] Antisense - / 5Phos / AC CAC GAC AGA GAT TGA GCG TTC AGA ATC CCT GAG CAA TGG CGA CAA TGT TGA TAT TGG CGC GGG CCA GTG CAA T / iMe-dC / G ATC CAA AGA ATT TCG CCG ACC ACG CAA GGT GCG CAT ACC ATC ACC TAC CAC CGA GAT AAT GGC CAG CCG TTC C (SEQ ID NO: 19)
[0298] SEQUENCE OF FULLY METHYLATED TEMPLATE-CLASAU Hemi mCpG 150 bp (for the PCR the fully methylated version of CLASAU 150 bp was used)
[0299] Sense - / 5Phos / GG AAC GGC TGG CCA TTA TCT CGG TGG TAG GTG ATG GTA TGC GCA CCT TGC GTG GTC GGC GAA ATT CTT TGG AT / iMe-dC / GAT TGC ACT GGC CCG CGC CAA TAT CAA CAT TGT CGC CAT TGC TCA GGG ATT CTG AAC GCT CAA TCT CTG TCG TGG T (SEQ ID NO: 20)
[0300] Antisense - / 5Phos / AC CAC GAC AGA GAT TGA GCG TTC AGA ATC CCT GAG CAA TGG CGA CAA TGT TGA TAT TGG CGC GGG CCA GTG CAA T / iMe-dC / G ATC CAA AGA ATT TCG CCG ACC ACG CAA GGT GCG CAT ACC ATC ACC TAC CAC CGA GAT AAT GGC CAG CCG TTC C (SEQ ID NO: 21)
[0301] Results
[0302] PfMAT Test Sample LC-MS Analysis
[0303] PfMAT successfully catalyzed the conversion of L-methionine and ATP to S-adenosylmethionine (SAM) in the test reaction. To replicate this synthesis, the conditions outlined in the referenced protocol were followed.
[0304] Detection and Analysis
[0305] The reaction products were analyzed using liquid chromatography-mass spectrometry (LC-MS) to confirm the formation of SAM.
[0306] The assay conditions were as follows:
[0307] Enzyme and Substrate:
[0308] L-methionine and ATP served as the substrates, with PfMAT catalyzing the reaction.
[0309] Detection Method
[0310] LC-MS analysis was performed, focusing on identifying the characteristic peaks for SAM and any byproducts.
[0311] Assay Reaction Conditions tested were as follows:
[0312] 50 mM Tris / HCl buffer (pH 8.0),
[0313] 20 mM MgCh,
[0314] 5 mM L-methionine,
[0315] 10 mM ATP,
[0316] PfMAT(200nM), in a total volume of 100 pL.
[0317] This approach allowed confirmation of successful SAM synthesis by PfMAT, validating the enzyme’s effectiveness under the specified conditions. The assay consisted of:
[0318] Production of SAM via PfMAT in conjunction with DNMT5 methylation as demonstrated by MSRE Assay.
[0319] To evaluate the effectiveness of PfMAT in producing SAM for methylation reactions, a methylation-sensitive restriction enzyme (MSRE) assay was performed. This assay utilized a 150 bp template with a single methylation site, which is susceptible to cleavage by the Sau3 Al enzyme. The presence of a methyl group at this site prevents cleavage, resulting in an uncut band. The results showed a distinct uncut band, indicating successful methylation and the efficacy of PfMAT in providing the necessary SAM for the reaction. P1MAT+DNMT5 Rxn Components and procedure -
[0320] To assess feasibility of PfMAT and DNMT5 working in conjunction
[0321] IX PfMAT Reaction Buffer
[0322] L-methionine: 5 mM
[0323] ATP: 10 mM PfMAT: 200 nM
[0324] Water: to reach the desired final volume of lOul
[0325] Procedure:
[0326] Incubation: Incubate the above reaction mixture at 80°C or 90°C for 5 minutes to facilitate the synthesis of S-adenosylmethionine (SAM). Bring the temperature down to 25°C.
[0327] Add the DNA mixture, which includes:
[0328] IX HiFi KAPA Fidelity Buffer
[0329] 10 pL of CLA / SAU 150 bp hemi (1 : 10 ng / pL)-(200 ng DNA in total 20uL reaction (lOuL PfMAT
[0330] + lOuL of DNA mixture containing Fidelity Buffer, DNA, DNMT5)
[0331] 180 nM DNMT5 enzyme
[0332] Water: to adjust the final volume as needed.
[0333] Methylation Incubation: 1-hour incubation at 25°C to facilitate the methylation reaction.
[0334] Cleanup: Column clean-up to purify the reaction products.
[0335] Restriction Digestion: Take the purified product through a Sau3AI restriction digestion before loading on the gel for analysis.
[0336] Integration of SAM Biosynthesis by PfMAT with Short Incubation Time and PCR Denaturation Conditions and Optimization of ATP and MgCL Concentration for Methylation Reaction
[0337] In the optimization process for ATP and MgCE concentrations, the performance of PfMAT was assessed at temperatures up to 98°C which is typical in a PCR setup. The MSRE assay confirmed that PfMAT successfully generated S-adenosylmethionine (SAM) during the denaturation step at about 98°C for about 40 seconds, a condition representative of typical PCR setups. This reaction time was found to be sufficient for effective DNMT5-mediated methylation which also required only about 30 seconds of incubation, overall, dramatically improving the total time of the reactions. Key takeaways from this optimization include:
[0338] PfMAT effectively functions at about 98°C for about 40 seconds coupled with successful methylation within a 30-second incubation period with DNMT5.
[0339] Compatibility of PfMAT and DNMT5 with PCR conditions through the use of lowered final concentrations of ATP and MgCk
[0340] This integration strategy highlighted the potential for streamlined workflows in methylation reactions, ensuring efficient SAM production while adhering to PCR denaturation parameters.
[0341] Proof of Concept (PoC) PCR Amplification with PfMAT and DNMT5 (10 Cycle PCR )
[0342] About a 15-fold amplification (with about 1 ng input) was achieved in the PCR setup by integrating PfMAT and DNMT5 for methylation. The master mix for the reaction consisted of MgCE, L- methionine, primers, and fully methylated DNA. Following this, the HiFi Hotstart PCR mix, PfMAT, and ATP were sequentially added. Employing a standard PCR thermocycling protocol, we incorporated a 30-second methylation step at 25°C after the extension phase, during which DNMT5 was spiked in every cycle. This approach allowed a total of 10 cycles to be run, ultimately resulting in a significant amplification yield of 15 times. The reaction components are as follows: Order of Addition for PCR Setup:
[0343] Master Mix (Yellow)
[0344] 2X KAPA HiFi Hotstart Ready Mix
[0345] PfMAT
[0346] ATP
[0347] Sequencing Data: Evaluation of DNMT5 Methylation Using PfMAT in PCR Settings with a
[0348] Single Methylated Site Template
[0349] The aim was to generate quantitative data for DNMT5-mediated methylation using PfMAT in a PCR setup. The method of DNA sequencing is as follows:
[0350] DNA Extraction and Quality Check: DNA was extracted, and quality assessments were performed to ensure proper length, quantity, and purity for successful sequencing. Column purification was done after methylation reactions.
[0351] Library Preparation: DNA ends were prepared for adapter attachment, followed by ligation of native barcodes and sequencing adapters from the kit, and then the prepared DNA library was loaded.
[0352] Sequencing: A sequencing run was initiated software to collect raw data and convert it into base calls. Basecalled reads were subsequently demultiplexed. FIG. 21 shows the experimental design.
[0353] SAM analogs
[0354] SAM (S-adenosylmethionine) analogs are chemically modified versions of SAM that are designed to mimic its structure and function while potentially offering enhanced stability or altered properties. These analogs can serve as alternatives to SAM in reactions, particularly in methylation processes where SAM acts as a methyl donor. Examples of SAM analogs tested:
[0355] Structural Modifications: SAM analogs may have modifications in the adenosyl or methionine portions of the molecule. For example:
[0356] SAM-iodide (SAM-I): Contains an iodine atom, which may affect its stability and reactivity in biological systems.
[0357] SAM-chloride (SAM-C1): Has a chlorine atom incorporated, which could influence its interaction with enzymes or substrates.
[0358] SAM-toluene: A variant that might alter the hydrophobic properties of the molecule.
[0359] Improved Thermal Stability: Some SAM analogs may be engineered to withstand higher temperatures, making them suitable for use in processes like PCR (polymerase chain reaction) where thermal cycling is involved. Three SAM analogs mentioned above were tested as potential replacements for SAM in methylation reactions and found that, under similar test conditions, they can effectively substitute for SAM. However, their thermal stability still requires further investigation to confirm their performance in high-temperature applications.
[0360] Discussion
[0361] S-adenosylmethionine (SAM) plays a crucial role as a methyl donor in various biological processes, particularly in DNA methylation. However, its thermal instability and the inhibitory effects on DNMT5-mediated methylation have posed significant challenges in PCR workflows. The inherent instability of SAM at physiological temperatures necessitates fresh preparation for each reaction and periodic replenishment during prolonged methylation processes. By employing higher concentrations of DNMT5 and shortening reaction times, we successfully mitigated these challenges, leading to improved outcomes. The utilization of the thermostable enzyme Pyrococcus juriosus methionine adenosyltransferase (PfMAT) is a significant advancement in SAM production. The data demonstrates that PfMAT can continuously synthesize SAM from L- methionine and ATP, particularly under the thermal conditions typical of PCR. The enzyme’s optimal activity at about 90°C and its high thermal stability (up to about 105°C) allows it to function effectively during the denaturation phase of PCR, ensuring that SAM is readily available throughout the amplification process. This approach not only enhances the efficiency of methylation reactions but also supports longer PCR cycles without compromising the integrity of the methylation signal.
[0362] The findings demonstrate that integrating PfMAT and DNMT5 within PCR workflows is feasible and effective. The observed amplification of 15-fold using PfMAT and DNMT5 indicates a significant enhancement in methylation efficiency and suggests that this combined approach can streamline methylation assays in high-throughput settings.
[0363] Exploring SAM analogs, such as SAM-iodide and SAM-chloride, presents an alternative strategy to improve the thermal stability of methylation reactions. These analogs may serve as functional replacements that could potentially withstand the thermal stress of PCR cycles, thereby providing additional tools to optimize workflows.
[0364] Future studies will focus on using templates with additional methylated sites and increasing the cycle count to further optimize amplification. The sequencing results reinforce the efficacy of this method, showing no de novo or incorrect methylation calling and confirming the preservation of the methylation signal throughout the PCR process. This opens new avenues for utilizing PfMAT in various applications, from early disease detection to detailed epigenetic analysis.
[0365] Conclusion
[0366] A compelling Proof of Concept (PoC) has been provided demonstrating the preservation of methylation signatures over 10 PCR cycles. The innovative enzyme cocktail, combining DNMT, PfMAT, and Polymerase, eliminates the need for additional methyl donor spiking per PCR cycle, offering a valuable solution for methylation conservation and catering to the diverse needs of diagnostic applications. In conclusion, our exploration of strategies to enhance SAM stability, including enzymatic regeneration, the use of synthetic SAM analogs, and optimization of PCR conditions, sets the stage for improved methodologies in methylation research. These advancements hold the promise of facilitating more robust and efficient workflows in both basic research and clinical diagnostics. The ability to preserve methylation across PCR cycles opens doors to assay development beyond the oncology space, extending to neurodegenerative diseases, metabolic disorders, and more.
[0367] ADDITIONAL EMBODIMENTS
[0368] A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0369] The method of additional embodiment 2, wherein the steps of amplification and selective methylation are performed two or more times.
[0370] The method of any one of additional embodiments 1 and 2, wherein the one or more methylated nucleotides are 5-methylcytosine nucleotides.
[0371] The method of any one of additional embodiments 1 - 3, wherein the adapter complexes comprise at least the first unique molecular identifier including the at least one methylated CpG.
[0372] The method of additional embodiment 4, wherein the first unique molecular identifier comprises at least two methylated CpG sites.
[0373] The method of any one of additional embodiments 1 - 5, wherein the adapter complexes further comprise a second unique molecular identifier comprising only unmethylated nucleotides, wherein the first and second unique molecular identifiers have a size ranging from 5-mer to about 15-mer. The method of any one of additional embodiments 31 - 36, wherein the amplifying of the one or more adapter ligated double stranded nucleic acid molecules comprises contacting the one or more adapter ligated double stranded nucleic acid molecules with a polymerase.
[0374] The method of additional embodiment 7, wherein the polymerase is a thermostable polymerase.
[0375] The method of any one of additional embodiments 1 - 7, wherein the amplification comprises isothermal amplification.
[0376] The method of any one of additional embodiments 1 - 9, wherein the selective methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with a methyltransferase.
[0377] The method of additional embodiment 10, wherein the methyltransferase is a maintenance methyl transferase.
[0378] The method of additional embodiment 11, wherein the maintenance methyltransferase is DNMT1. The method of additional embodiment 11, wherein the maintenance methyltransferase is DNMT5. The method of any one of additional embodiments 10 - 13, further comprising contacting the sample comprising one or more amplified double stranded nucleic acid molecules with a methyl donating reagent.
[0379] The method of additional embodiment 14, wherein the methyl donating reagent is S-adenosyl-L- methionine.
[0380] The method of any one of additional embodiments 13 - 15, further comprising contacting the sample with ATP.
[0381] The method of additional embodiment 11, further comprising contacting the sample comprising one or more amplified double stranded nucleic acid molecules with UHRF1.
[0382] The method of any one of the preceding additional embodiments, further comprising analyzing the methylation pattern of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0383] The method of additional embodiment 18, wherein the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
[0384] The method of any one of additional embodiments 1 - 17, further comprising sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0385] The method of additional embodiment 20, wherein the sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules is performed without performing a bisulfite treatment of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0386] The method of additional embodiment 21, further comprising determining the methylation pattern in the one or more double stranded nucleic acid molecules in the obtained sample.
[0387] A method of preserving a methylation pattern within a nucleic acid amplification assay comprising: (a) copying a first nucleic acid molecule having a methylation pattern into a plurality of nucleic acid molecules; and (b) methylating the plurality of nucleic acid molecules by contacting the plurality of nucleic acid molecules with a maintenance methyltransferase or a functional fragment thereof, a methyl donor, and an optional cofactor, wherein the methylation pattern of the first nucleic acid molecule is preserved in the plurality of nucleic acid molecules, thereby preserving a methylation pattern in the nucleic acid amplification assay, wherein the first nucleic acid molecule includes adapter complexes comprising at least one of (i) a unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites.
[0388] The method of additional embodiment 23, wherein the first nucleic acid molecule is copied by contacting the first nucleic acid molecule with at least one nucleic acid primer and a DNA polymerase.
[0389] The method of additional embodiment 25, wherein the adapter complexes include two or more methylated CpGs.
[0390] The method of 23, wherein the adapter complexes comprise at least two of (i) a unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites.
[0391] The method of any one of additional embodiments 1 - 5, further comprising analyzing the methylation pattern of the plurality of nucleic acid molecules.
[0392] The method of additional embodiment 27, wherein the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
[0393] The method of any one of additional embodiments 23 - 28, wherein steps (a) and (b) are repeated for a plurality of cycles.
[0394] The method of additional embodiment 29, wherein the plurality of nucleic acid molecules serves as the first nucleic acid molecule in each subsequent cycle.
[0395] A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise a first unique molecular identifier including at least one methylated CpG; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0396] The method of additional embodiment 31, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT1.
[0397] The method of additional embodiment 31, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT5.
[0398] A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise a methyltransferase binding enhancer motif; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0399] The method of additional embodiment 34, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT1.
[0400] The method of additional embodiment 34, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT5.
[0401] A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise a primer binding site comprising a 3' end including one or more methylated CpG sites; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0402] The method of additional embodiment 37, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT1.
[0403] The method of additional embodiment 37, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT5. A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise at two one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0404] The method of additional embodiment 40, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT1.
[0405] The method of additional embodiment 40, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT5.
[0406] A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising: obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides; ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, and (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites; amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
[0407] The method of additional embodiment 43, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT1.
[0408] The method of additional embodiment 43, wherein the selectively methylation comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with DNMT5.
[0409] All the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and / or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications, and publications to provide yet further embodiments.
[0410] Although the present disclosure has been described with reference to several illustrative embodiments, it should be understood that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of this disclosure. More particularly, reasonable variations and modifications are possible in the component parts and / or arrangements of the subject combination arrangement within the scope of the foregoing disclosure, the drawings, and the appended claims without departing from the spirit of the disclosure. In addition to variations and modifications in the component parts and / or arrangements, alternative uses will also be apparent to those skilled in the art.
Claims
CLAIMS1. A method of preserving a methylation pattern within one or more nucleic acid molecules during amplification, comprising:(a) obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides;(b) ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules;(c) amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and(d) selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules, wherein the selective methylating comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with DNA methyltransferase 5 (DNMT5).
2. The method of claim 1, wherein the selectively methylating further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with ATP.
3. The method of claim 2, wherein the selectively methylating further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with a methyl donating reagent.
4. The method of claim 3, wherein the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof.
5. The method of claim 3, wherein the methyl donating agent is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'-Adenosyl)-L-methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
6. The method of claim 2, wherein the selectively methylating further comprises contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP.
7. The method of claim 6, wherein the enzyme is a thermostable enzyme.
8. The method of claim 6, wherein the enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
9. The method of any one of claims 6 - 8, wherein the enzyme is incubated with the sample at a temperature ranging from between about 80°C to about 110°C.
10. The method of any one of claims 6 - 8, wherein the enzyme is incubated with the sample at a temperature ranging from between about 85°C to about 105°C.
11. The method of any one of claims 6 - 8, wherein the enzyme is incubated with the sample at a temperature of about 90°C.
12. The method of any one of claims 9 - 11, wherein the enzyme is incubated with the sample for between about 1 minute to about 8 minutes.
13. The method of any one of claims 9 - 11, wherein the enzyme is incubated with the sample for between about 2 minutes to about 6 minutes.
14. The method of any one of claims 9 - 11, wherein the enzyme is incubated with the sample for about 4 minutes.
15. The method of any one of claims 1 - 14, wherein the steps of amplifying and selectively methylating are performed two or more times.
16. The method of any one of claims 1 - 15, wherein the one or more methylated nucleotides are 5-methylcytosine nucleotides.
17. The method of any one of claims 1 - 16, wherein the adapter complexes include one or more unique molecular identifiers.
18. The method of claim 17, wherein the unique molecular identifier comprises one or more methylated CpG sites.
19. The method of claim 17, wherein the unique molecular identifier comprises two or more methylated CpG sites.
20. The method of any one of claims 1 — 19, wherein the adapter complexes ligated to the one or more double stranded nucleic acid molecules further include a methyltransferase binding enhancer motif.
21. The method of any one of claims 1 - 20, wherein the adapter complexes ligated to the one or more double stranded nucleic acid molecules further include a methyltransferase binding enhancer motif.
22. The method of any one of claims 1 - 21, wherein the adapter complexes ligated to the one or more double stranded nucleic acid molecules further comprise a unique molecular identifier comprising only unmethylated nucleotides.
23. The method of any one of claims 1 - 22, wherein the adapter complexes ligated to the one or more double stranded nucleic acid molecules further include a primer binding site comprising a 3' end including one or more methylated CpG sites.
24. The method of any one of claims 1 - 23, wherein the amplifying of the one or more adapter ligated double stranded nucleic acid molecules comprises contacting the one or more adapter ligated double stranded nucleic acid molecules with a polymerase.
25. The method of any one of claims 1 - 23, wherein the amplifying of the one or more adapter ligated double stranded nucleic acid molecules comprises isothermal amplification.
26. The method of claim 25, wherein the isothermal amplification comprises Loop-Mediated Isothermal Amplification.
27. The method of claim 25, wherein the isothermal amplification comprises Recombinase Polymerase Amplification.
28. The method of claim 25, wherein the isothermal amplification comprises Rolling Circle Amplification.
29. The method of any one of claims 1 - 28, further comprising analyzing the methylation pattern of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
30. The method of claim 29, wherein the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
31. The method of any one of claims 1 - 30, further comprising sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules.
32. The method of claim 31, wherein the sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules is performed without performing a bisulfite treatment of the one or more amplified and selectively methylated double strandednucleic acid molecules.
33. The method of claim 32, further comprising determining the methylation pattern in the one or more double stranded nucleic acid molecules in the obtained sample.
34. A method of preserving a methylation pattern of one or more nucleic acid molecules during amplification, comprising:(a) obtaining a sample comprising one or more double stranded nucleic acid molecules, wherein the one or more double stranded nucleic acid molecules include one or more methylated nucleotides;(b) ligating adapter complexes to the one or more double stranded nucleic acid molecules to provide a sample comprising one or more adapter ligated double stranded nucleic acid molecules, wherein the adapter complexes comprise at least one of (i) a unique molecular identifier, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites;(c) amplifying the one or more adapter ligated double stranded nucleic acid molecules to provide a sample comprising one or more amplified double stranded nucleic acid molecules, wherein each of the one or more amplified double stranded nucleic acid molecules comprises (i) a newly synthesized strand, and (ii) a template strand including the one or more methylated nucleotides; and(d) selectively methylating the newly synthesized strands of each of the one or more amplified double stranded nucleic acid molecules accordingly to the methylation pattern of the corresponding nucleotides in the respective template strand of each of the one or more amplified double stranded nucleic acid molecules to provide a sample comprising one or more amplified and selectively methylated double stranded nucleic acid molecules.
35. The method of claim 34, wherein the steps of amplifying and selectively methylating are performed two or more times.
36. The method of any one of claims 34 and 35, wherein the one or more methylated nucleotides are 5-methylcytosine nucleotides.
37. The method of any one of claims 34 - 36, wherein the unique molecular identifier comprises one or more methylated CpG sites.
38. The method of any one of claims 34 - 37, wherein the unique molecular identifier comprises two or more methylated CpG sites.
39. The method of any one of claims 34 - 38, wherein the adapter complexes comprise a firstunique molecular identifier comprising only unmethylated nucleotides; and a second unique molecular identifier comprising one or more methylated nucleotides; wherein the first and second unique molecular identifiers each have a size ranging from 5-mer to about 15-mer.
40. The method of any one of claims 34 - 39, wherein the amplifying of the one or more adapter ligated double stranded nucleic acid molecules comprises contacting the one or more adapter ligated double stranded nucleic acid molecules with a polymerase.
41. The method of any one of claims 34 - 39, wherein the amplifying of the one or more adapter ligated double stranded nucleic acid molecules comprises isothermal amplification.
42. The method of claim 41, wherein the isothermal amplification comprises Loop-Mediated Isothermal Amplification, Recombinase Polymerase Amplification, or Rolling Circle Amplification.
43. The method of any one of claims 34 - 42, wherein the selectively methylating comprises contacting the sample comprising one or more amplified double stranded nucleic acid molecules with a methyltransferase.
44. The method of claim 43, wherein the methyltransferase is DNMT1.
45. The method of claim 44, further comprising contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with a methyl donating reagent.
46. The method of claim 45, wherein the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof.
47. The method of claim 45, wherein the methyl donating agent is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'- Adenosyl)-L-methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
48. The method of claim 45, wherein the methyl donating agent is betaine or vitamin B6.
49. The method of claim 44, further comprising contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP.
50. The method of claim 49, wherein the enzyme is a thermostable enzyme.
51. The method of claim 50, wherein the enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
52. The method of any one of claims 44 - 51, further comprising contacting the sample comprising one or more amplified double stranded nucleic acid molecules with UHRF1.
53. The method of claim 43, wherein the methyltransferase is DNMT5.
54. The method of claim 53, further comprising contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with a methyl donating reagent and ATP.
55. The method of claim 54, wherein the methyl donating agent is S-adenosyl-L-methionine or a derivative or analog thereof.
56. The method of claim 54, wherein the methyl donating agent is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'- Adenosyl)-L-methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
57. The method of claim 53, further comprising contacting the sample comprising the one or more amplified double stranded nucleic acid molecules with an enzyme that facilitates the synthesis of S-adenosyl-L-methionine and optionally ATP.
58. The method of claim 57, wherein the enzyme is a thermostable enzyme.
59. The method of claim 58, wherein the enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
60. The method of any one of claims 34 - 59, further comprising analyzing the methylation pattern of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
61. The method of claim 60, wherein the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
62. The method of any one of claims 34 - 61, further comprising sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules.
63. The method of claim 62, wherein the sequencing the one or more amplified and selectively methylated double stranded nucleic acid molecules is performed without performing a bisulfite treatment of the one or more amplified and selectively methylated double stranded nucleic acid molecules.
64. The method of any one of claims 34 - 63, further comprising determining the methylationpattern in the one or more double stranded nucleic acid molecules in the obtained sample.
65. A kit comprising:(a) a DNA methyltransferase; and(b) adapters, wherein each of the adapters comprises at least one of (i) a first unique molecular identifier including at least one methylated CpG, (ii) a methyltransferase binding enhancer motif, or (iii) a primer binding site comprising a 3' end including one or more methylated CpG sites.
66. The kit of claim 65, wherein the DNA methyltransferase is DNA methyltransferase 1.
67. The kit of claim 65, wherein the DNA methyltransferase is DNA methyltransferase 5.
68. The kit of any one of claims 65 - 67, further comprising a methyl donor reagent.
69. The kit of claim 68, wherein the methyl donating reagent is S-adenosyl-L-methionine(SAM).
70. The kit of claim 68, wherein the methyl donating reagent is a derivative or analog of SAM.
71. The kit of claim 70, wherein the derivative or analog of SAM is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'- Adenosyl)-L-methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
72. The kit of any one of claims 65 - 67, further comprising a thermostable enzyme capable of catalyzing the synthesis of SAM.
73. The kit of claim 72, wherein the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi. and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
74. A method of preserving a methylation pattern within a nucleic acid amplification assay comprising:(a) copying a first nucleic acid molecule having a methylation pattern into a plurality of nucleic acid molecules; and(b) methylating the plurality of nucleic acid molecules by contacting the plurality of nucleic acid molecules with DNA methyltransferase 5 (DNMT5) or a functional fragment thereof, a methyl donor, and ATP, wherein the methylation pattern of the first nucleic acid molecule is preserved in the plurality of nucleic acid molecules, thereby preserving a methylation pattern in the nucleic acid amplification assay.
75. The method of claim 74, wherein the first nucleic acid molecule is copied by contacting the first nucleic acid molecule with at least one nucleic acid primer and a DNA polymerase.
76. The method of claim 74, wherein the first nucleic acid molecule is copied using an isothermal amplification technique.
77. The method of claim 74, further comprising ligating one or more adapter complexes to the first nucleic acid molecule prior to the copying of the first nucleic acid molecule.
78. The method of claim 77, wherein the adapter complexes include one or more unique molecular identifiers.
79. The method of claim 78, wherein the one or more unique molecular identifiers comprise one or more methylated CpGs.
80. The method of 79, wherein the one or more unique molecular identifiers comprise two or more methylated CpGs.
81. The method of claim 77, wherein the adapter complexes include a methyltransferase binding enhancer motif.
82. The method of claim 77, wherein the adapter complexes include a primer binding site comprising a 3' end including one or more methylated CpG sites.
83. The method of claim 77, wherein the adapter complexes comprise a first unique molecular identifier comprising only unmethylated nucleotides; and a second unique molecular identifier comprising one or more methylated nucleotides; wherein the first and second unique molecular identifiers each have a size ranging from 5-mer to about 15-mer.
84. The method of any one of claims 74 - 83, further comprising analyzing the methylation pattern of the plurality of nucleic acid molecules.
85. The method of claim 84, wherein the methylation pattern is analyzed by PCR, sequencing, bisulfite treatment, or a combination thereof.
86. The method of claim 74 - 85, wherein steps (a) and (b) are repeated for a plurality of cycles.
87. The method of claim 86, wherein the plurality of nucleic acid molecules serves as the first nucleic acid molecule in each subsequent cycle.
88. The method of any one of claims 74 - 87, wherein the methylating of the plurality of nucleic acid molecules further comprises contacting the plurality of nucleic acid molecules with a methyl donating agent.
89. The method of claim 88, wherein the methyl donating agent is S-adenosyl-L-methionine (SAM) or a derivative or analog thereof.
90. The method of claim 88, wherein the methyl donating agent is selected from the group consisting of S-(5 '-Adenosyl) -L-methionine-(S-methyl-13C) chloride, S-(5'-Adenosyl)-L- methionine chloride dihydrochloride, S-(5'-Adenosyl)-L-methionine iodide, S-(5'- Adenosyl)-L-methionine p-toluenesulfonate salt, and S-(5'-Adenosyl)-L-homocysteine.
91. The method of any one of claims 74 - 87, wherein the methylating of the plurality of nucleic acid molecules further comprises contacting the plurality of nucleic acid molecules with a thermostable enzyme capable of catalyzing the synthesis of SAM.
92. The method of claim 91, wherein the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
93. A composition comprising (i) DNA methyltransferase 5 (DNMT5), (ii) ATP, and (iii) a thermostable enzyme capable of catalyzing the synthesis of S-adenosyl-L-methionine (SAM).
94. The composition of claim 93, wherein the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
95. The composition of any one of claims 93 - 94, further comprising MgCh.
96. A composition comprising (i) DNA methyltransferase 5 (DNMT5), (ii) a polymerase, and (iii) a thermostable enzyme capable of catalyzing the synthesis of S-adenosyl-L-methionine (SAM).
97. The composition of claim 96, wherein the thermostable enzyme is selected from the group consisting of Pyrococcus furiosus methionine adenosyltransferase, S-adenosylmethionine synthetase derived from Sulfolobus solfataricus, DNA Methyltransferase M.PabI derived from Archaeon Pyrococcus abyssi, and S-adenosylmethionine synthetase from archaeon Methanococcus jannaschii (MjMAT).
98. The composition of any one of claims 96 - 97, further comprising ATP.
99. The composition of any one of claims 96 - 97, further comprising MgCh.
Citation Information
Patent Citations
Primer extension target enrichment
US10907204B2
Polypeptide tagged nucleotides and use thereof in nucleic acid sequencing by nanopore detection
US10975426B2
Primer extension target enrichment and improvements thereto including simultaneous enrichment of DNA and RNA
US11499180B2
Methods and processes for calling bases in sequence by incorporation methods
US20090024331A1
Systems and methods for characterizing a molecule
US20110193570A1