Diagnosis of alzheimer's disease using changes in DNA methylation of genes
DNA methylation in LRRC27, NUP93, and OR2AG1 genes serves as biomarkers for accurate and cost-effective Alzheimer's disease diagnosis and progression prediction, addressing the limitations of current methods.
Patent Information
- Application Number
- PCT/KR2025/009927
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-09
- Filing Date
- 2025-07-09
- Publication Date
- 2026-01-15
AI Technical Summary
Current diagnostic methods for Alzheimer's disease are inaccurate due to age and education level biases, and invasive or expensive equipment requirements, necessitating the need for non-invasive and cost-effective biomarkers for early diagnosis and risk prediction.
Utilizing DNA methylation changes in LRRC27, NUP93, and OR2AG1 genes as biomarkers by measuring methylation levels at specific CpG sites to diagnose Alzheimer's disease dementia, mild cognitive impairment, and predict progression to dementia.
Provides accurate, non-invasive, and economical methods for diagnosing Alzheimer's disease and predicting its progression, enabling early intervention and reducing socioeconomic burdens.
Smart Images

Figure KR2025009927_15012026_PF_FP_ABST
Abstract
Description
Diagnosing Alzheimer's disease using changes in DNA methylation of genes
[0001] The present invention relates to a composition, a kit, and a method for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia at an early stage, or predicting the risk of progression to Alzheimer's disease dementia by detecting or measuring the methylation level of a gene CpG region.
[0002] Korea's rapid economic growth, Westernized lifestyles, and advancements in medicine have led to an increase in the average life expectancy of its citizens. Meanwhile, Korea also has the fastest aging population in the world. Consequently, the incidence of neurodegenerative diseases, often associated with aging, is also rapidly increasing.
[0003] Dementia is a major social and economic burden, and Alzheimer's disease (AD) is the most common type. It is a representative neurodegenerative brain disease that begins with memory loss, progresses gradually over time to symptoms such as loss of spatial and temporal perception, delusions and personality changes, language and motor dysfunction, and ultimately leads to death.
[0004] Despite decades of research into the treatment of Alzheimer's disease, there is currently no fundamental cure, with treatments only alleviating symptoms or slowing the progression of the disease. Therefore, the most effective way to manage Alzheimer's disease is to delay the onset of dementia through early diagnosis and preemptive treatment.
[0005] However, the neurocognitive tests currently used to diagnose Alzheimer's disease have the disadvantage that the accuracy of the test results is greatly affected by the patient's age, education level, or intentional refusal to answer, and brain imaging tests using MRI or PET have the disadvantage that they are difficult to perform in the early stages when no particular symptoms appear because they use expensive equipment.
[0006] Accordingly, biochemical methods such as detecting beta-amyloid protein in cerebrospinal fluid or serum, measuring the concentration of tau protein, and detecting glial fibrillary acidic protein (GFAP) antibodies have been proposed as other methods for diagnosing Alzheimer's disease dementia. However, problems have been raised regarding the efficiency and accuracy of clinical application of these diagnostic methods (International Patent Publication No. 92 / 17152; U.S. Patent No. 4,666,829; International Patent Publication No. 89 / 06242; U.S. Patent No. 5,231,000, etc.).
[0007] Therefore, there is an urgent need for new diagnostic markers that can represent clinical symptoms for the diagnosis or early diagnosis of Alzheimer's disease dementia or measure the preclinical state before the onset of symptoms.
[0008] The present inventors have confirmed that the LRRC27 (Leucine Rich Repeat Containing 27), NUP93 (Nucleoporin 93), and / or OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1) genes exhibit specific methylation changes in Alzheimer's disease, and have confirmed that Alzheimer's disease can be diagnosed using these as biomarkers, thereby completing the present invention. Specifically, the Alzheimer's disease diagnosis includes diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
[0009] Accordingly, an example of the present invention is a method for diagnosing Alzheimer's disease in a subject, a method for assisting in the diagnosis of Alzheimer's disease, a method for providing information for diagnosing Alzheimer's disease, or a method for detecting a biomarker for diagnosing Alzheimer's disease, the method comprising the steps of (i) measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93, and OR2AG1 in a sample of the subject, and (ii) comparing the level measured in step (i) with a reference value; and when the CpG site of the promoter of the gene of LRRC27 in the sample of the subject is hypomethylated below the reference value, Alzheimer's disease dementia is diagnosed; and when the CpG site of the promoter of the gene of NUP93 in the sample of the subject is hypermethylated below the reference value, Alzheimer's disease mild cognitive impairment is diagnosed or Alzheimer's disease dementia is diagnosed early; A method is provided for predicting a risk of progression to Alzheimer's disease dementia when a CpG site of the OR2AG1 gene promoter in a sample of the above individual is hypermethylated above the reference level.
[0010] Another example is a kit for diagnosing Alzheimer's disease, comprising an agent for measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93 and / or OR2AG1, wherein the diagnosis of Alzheimer's disease is for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
[0011] Another example provides a composition for diagnosing Alzheimer's disease, comprising an agent for measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93 and / or OR2AG1, wherein the diagnosis of Alzheimer's disease is for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
[0012] The present invention provides a molecular biological diagnostic method for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia by measuring the degree of methylation at specific gene CpG sites in genomic DNA collected from a patient sample. This method has the advantages of being simple, noninvasive, and economical. Furthermore, DNA methylation changes are easy to detect and, compared to conventional protein or RNA markers, are stable and easy to analyze.
[0013] Figure 1 shows the difference in the degree of DNA methylation of the LRRC27 gene promoter between a normal control group (“Normal”) and a group of Alzheimer’s disease dementia patients (“AD”).
[0014] Figure 2 shows the results of a receiver operating characteristics curve (ROC curve) analysis to evaluate the effectiveness of differentiating Alzheimer's disease dementia patients from normal controls using DNA methylation changes in the LRRC27 gene promoter.
[0015] Figure 3 shows the difference in the level of DNA methylation of the NUP93 gene between a normal control group (“Normal”) and a group of patients with mild cognitive impairment (MCI) of Alzheimer’s disease.
[0016] Figure 4 shows the difference in the level of DNA methylation of the NUP93 gene between the normal control group (“Normal”) and the Alzheimer’s disease dementia patient group (“AD”).
[0017] The left figure in Figure 5 shows the results of a receiver operating characteristics curve (ROC curve) analysis to evaluate the effectiveness of using DNA methylation changes in the NUP93 gene to distinguish between Alzheimer's disease mild cognitive impairment patients and normal controls, and the right figure shows the results of a ROC curve analysis to evaluate the effectiveness of using DNA methylation changes in the NUP93 gene to distinguish between Alzheimer's disease dementia patients and normal controls.
[0018] Figure 6 shows the difference in the degree of DNA methylation of the OR2AG1 gene between a group of patients with mild cognitive impairment without amyloid pathology (“MCI-NAD”) and a group of patients with mild cognitive impairment with Alzheimer’s disease (“MCI-AD”) in a DNA methylation mutation analysis.
[0019] Figure 7 shows the results of a receiver operating characteristics curve (ROC curve) analysis to evaluate the effectiveness of using DNA methylation changes in the OR2AG1 gene to distinguish between a group of patients with mild cognitive impairment without amyloid pathology and a group of patients with mild cognitive impairment of Alzheimer's disease.
[0020] The present invention is based on the fact that LRRC27 (Leucine Rich Repeat Containing 27), NUP93 (Nucleoporin 93), and / or OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1) genes exhibit specific methylation changes in Alzheimer's disease, and provides a molecular biological diagnostic technique for diagnosing Alzheimer's disease by measuring the degree of specific DNA methylation occurring at a specific CpG position of the gene promoter.
[0021] DNA methylation changes are easy to detect because they exist in DNA, are more stable than protein or RNA markers, and occur at specific locations in a gene, making them easy to analyze.
[0022] Specifically, in one embodiment of the present invention, genomic DNA was extracted from samples of a normal control group (a group with normal cognitive function without amyloid pathology) and a group of Alzheimer's disease dementia patients, and DNA methylation profiles were analyzed through DNA methylation mutation analysis. Compared to the normal control group, genes with DNA methylation changes of more than 30% in the CpG region of the gene promoter region of Alzheimer's disease dementia patients were selected. Among these selected genes, it was confirmed that the DNA methylation of the CpG region of the promoter of the LRRC27 gene was reduced by approximately 43% in the Alzheimer's disease dementia patient group compared to the normal control group (Fig. 1). Furthermore, the ROC curve analysis results confirmed that hypomethylation of the CpG region of the LRRC27 gene promoter could distinguish the Alzheimer's disease dementia patient group with high accuracy (AUC = 0.8322) compared to the normal control group (Fig. 2). These results indicate that disease-specific hypomethylation of the LRRC27 gene can be used as a biomarker for noninvasive diagnosis of Alzheimer's disease dementia.
[0023] In addition, in one embodiment of the present invention, genomic DNA was extracted from samples of a normal control group (a normal cognitive function group without amyloid pathology), a group of patients with mild cognitive impairment of Alzheimer's disease, and a group of patients with dementia of Alzheimer's disease, and DNA methylation profiles were analyzed through DNA methylation mutation analysis. In comparison with the normal control group, genes in which DNA methylation was changed by 30% or more in the CpG sites of the gene promoter regions of patients with mild cognitive impairment of Alzheimer's disease and dementia of Alzheimer's disease were selected. Among these selected genes, we confirmed that the DNA methylation of the CpG region of the promoter of the NUP93 gene was increased by approximately 36% and 47% in the Alzheimer's disease mild cognitive impairment patient group and the Alzheimer's disease dementia patient group compared to the normal control group, respectively (Fig. 3, Fig. 4). Through receiver operating characteristics curve (ROC curve) analysis, we confirmed that the hypermethylation of the CpG region of the NUP93 gene promoter could distinguish the Alzheimer's disease mild cognitive impairment patient group (AUC = 0.8120) and the Alzheimer's disease dementia patient group (AUC = 0.8454) with high accuracy compared to the normal control group (Fig. 5). These results indicate that the disease-specific hypermethylation of the NUP93 gene can be used as a biomarker for non-invasive diagnosis of Alzheimer's disease mild cognitive impairment or for early diagnosis of Alzheimer's disease dementia from the mild cognitive impairment stage.
[0024] In addition, in one embodiment of the present invention, genomic DNA was extracted from samples of patients with mild cognitive impairment without amyloid pathology and patients with mild cognitive impairment of Alzheimer's disease, and DNA methylation profiles were analyzed through DNA methylation mutation analysis. In comparison with the patient group with mild cognitive impairment without amyloid pathology, genes with DNA methylation changes of 20% or more in the CpG sites of the gene promoter regions of the patient group with mild cognitive impairment of Alzheimer's disease were selected. Among these selected genes, we confirmed that the DNA methylation of the CpG region of the OR2AG1 gene promoter was increased by approximately 21% in the Alzheimer's disease mild cognitive impairment patient group compared to the mild cognitive impairment patient group without amyloid pathology (Fig. 6). Through receiver operating characteristics curve (ROC curve) analysis, we confirmed that the hypermethylation of the CpG region of the OR2AG1 gene promoter could distinguish the Alzheimer's disease mild cognitive impairment patient group from the mild cognitive impairment patient group without amyloid pathology with high accuracy (AUC = 0.8177) (Fig. 7). These results indicate that the disease-specific hypermethylation of the OR2AG1 gene can be used as a biomarker to noninvasively predict the risk of progression to Alzheimer's disease dementia in patients with mild cognitive impairment.
[0025] Accordingly, one specific example is a method for diagnosing Alzheimer's disease in a subject, a method for assisting in the diagnosis of Alzheimer's disease, a method for providing information for the diagnosis of Alzheimer's disease, or a method for detecting a biomarker for the diagnosis of Alzheimer's disease, the method comprising the steps of (i) measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93, and / or OR2AG1 in a sample of the subject, and (ii) comparing the level measured in step (i) with a reference value; wherein if the CpG site of the promoter of the gene of LRRC27 in the sample of the subject is hypomethylated below the reference value, Alzheimer's disease dementia is diagnosed; and if the CpG site of the promoter of the gene of NUP93 in the sample of the subject is hypermethylated below the reference value, Alzheimer's disease mild cognitive impairment is diagnosed or Alzheimer's disease dementia is diagnosed early; A method is provided for predicting a risk of progression to Alzheimer's disease dementia when a CpG site of the OR2AG1 gene promoter in a sample of the above individual is hypermethylated above the reference level.
[0026] Another specific example is a kit for diagnosing Alzheimer's disease, comprising a preparation for measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93 and / or OR2AG1, wherein the diagnosis of Alzheimer's disease is for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
[0027] Another specific example provides a composition for diagnosing Alzheimer's disease, comprising an agent for measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27, NUP93 and / or OR2AG1, wherein the diagnosis of Alzheimer's disease is for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
[0028] Hereinafter, the present invention will be described in more detail.
[0029] As used herein, the term "methylation" or "methylation" refers to the attachment of a methyl group to a base constituting DNA. Preferably, methylation in the present invention refers to methylation occurring at a cytosine in a CpG region of a specific gene promoter. When methylation occurs, the binding of transcription factors is hindered, thereby suppressing the expression of a specific gene. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene increases.
[0030] In addition to A, C, G, and T, the genomic DNA of mammalian cells contains a fifth base called 5-methylcytosine (5-mC), which has a methyl group attached to the fifth carbon of the cytosine ring. Methylation of 5-methylcytosine occurs only at the C of the CG dinucleotide (5'-mCG-3'), called CpG, and methylation of CpG suppresses the expression of alu or transposons and repetitive sequences in the genome. In addition, because the 5-mC of CpG readily deamidates naturally to thymine (T), CpG is the site where most epigenetic changes frequently occur in mammalian cells.
[0031] In the present invention, the term "measurement of methylation level" refers to measuring the methylation level of a gene CpG site, and can be measured through methylation-specific PCR, for example, methylation-specific PCR (methylation-specific polymerase chain reaction, MSP), real-time methylation-specific PCR (real-time methylation-specific polymerase chain reaction), PCR using methylated DNA-specific binding protein, or quantitative PCR. Alternatively, it can be measured by a method such as automated base analysis such as pyrosequencing or bisulfite sequencing, or a DNA methylation microarray, or an immunoprecipitation method using a methylated CpG binding domain or an anti-methylcytosine antibody, but is not limited thereto.
[0032] In the present invention, Alzheimer's disease dementia can be diagnosed by specifically showing hypomethylation in the LRRC27 gene in a patient's sample compared to a reference value, for example, a sample from a healthy individual or a sample from an individual not diagnosed with Alzheimer's disease, or compared to a predetermined threshold (cut-off); Alzheimer's disease mild cognitive impairment can be diagnosed or Alzheimer's disease dementia can be diagnosed early by specifically showing hypermethylation in the NUP93 gene in a patient's sample; or the risk of progression to Alzheimer's disease dementia can be predicted by specifically showing hypermethylation in the OR2AG1 gene in a patient's sample.
[0033] The human LRRC27 gene is located on chromosome 10 and is registered in the NCBI Entrez database as Gene ID: 80313. The human NUP93 gene is located on chromosome 16 and is registered in the NCBI Entrez database as Gene ID: 9688. The human OR2AG1 gene is located on chromosome 11 and is registered in the NCBI Entrez database as Gene ID: 144125.
[0034] In the present invention, the CpG site of a gene refers to a CpG site existing on the DNA of the gene. The DNA of the gene is a concept that includes a series of structural units that are necessary for the expression of the gene and are operably linked to each other, for example, a promoter region, a protein coding region (open reading frame, ORF), and a terminator region. Therefore, the CpG site of the gene may be present in the promoter region, protein coding region (open reading frame, ORF), or terminator region of the gene. Preferably, the CpG site where disease-specific hypomethylation occurs in the LRRC27 gene, and the CpG site where disease-specific hypermethylation occurs in the NUP93 and OR2AG1 genes may be present in the promoter of the gene.
[0035] For example, measuring the methylation level of the CpG site of the LRRC27 gene promoter in the present invention may include measuring the methylation level of cytosine in the CpG site of the promoter of the LRRC27 gene, more specifically, in the CpG site appearing in the base sequence of nucleotides 132335620 to 132335741 of chromosome 10 (SEQ ID NO: 1):
[0036] GTAGGGGCTGTACGGTGCAGGTTCCTCCCCTGGTTCCTCATAGGCAGAGTACTATAGGGT[CG]CAGTCTTCCTGGACGTTCCCTATTGGTTGTTGGGCAGGGGCTGTAGGTATTTTCTTTAGG
[0037] More specifically, it may include measuring methylation of cytosine located at base 132335680 of chromosome 10 (base 61 of SEQ ID NO: 1).
[0038] As another example, measuring the methylation level of the CpG site of the NUP93 gene promoter in the present invention may include measuring the methylation level of cytosine in the CpG site of the promoter of the NUP93 gene, more specifically, in the CpG site appearing in the nucleotide sequence at positions 56789449 to 56789570 of chromosome 16 (SEQ ID NO: 2):
[0039] TGGGACCCAGCAGTCTGACAGTGACAGATGGCCTGGTGCCCACACAGTGCCATGTTATAT[CG]CCAAGGTCTGCCACCTGTGGCTCCAGAGCTGCCTGCAGCAGTGATGGATCTGCTGAGCTG
[0040] More specifically, it may include measuring methylation of cytosine located at base 56789509 of chromosome 16 (base 61 of SEQ ID NO: 2).
[0041] As another example, measuring the methylation level of the CpG site of the OR2AG1 gene promoter in the present invention may include measuring the methylation level of cytosine in the promoter CpG site of the OR2AG1 gene, more specifically, in the CpG site appearing in the base sequence of nucleotides 6783692 to 6783813 (SEQ ID NO: 3) of chromosome 11:
[0042] TCTGCTTCCTGGTGGAAATCGCAATACTTGTCTTTAGACCCTGTGTGCTCTGCTGGCTCC[CG]GTAACGCATTTTTGCATCTATCAGATGATGAATATCCTAAAGGGCCATCTAAAAAGTGAT
[0043] More specifically, it may include measuring methylation of cytosine located at base 6783752 of chromosome 11 (base 61 of SEQ ID NO: 3).
[0044] In the present invention, the base sequence of the human genome chromosome region is expressed according to GRCh38 Genome Reference Consortium Human Reference 38 (GRCh38 / hg38), but the specific sequence of the human genome chromosome region may be somewhat changed in expression as the genome sequence research results are updated, and the expression of the human genome chromosome region of the present invention may be different according to such change. Therefore, even if the human genome chromosome region expressed according to GRCh38 Genome Reference Consortium Human Reference 38 (GRCh38 / hg38) of the present invention is changed differently from the present expression due to an update of the human reference sequence after the filing date of the present invention, it will be apparent that the scope of the present invention extends to the changed human genome chromosome region. Anyone having ordinary skill in the art to which the present invention pertains can easily understand the contents of such changes.
[0045] In the present invention, the term "Alzheimer's disease (AD)" is a representative neurodegenerative brain disease that begins with memory loss and is followed by a decline in overall cognitive function. Previously, Alzheimer's disease was defined based on clinical symptoms and confirmed through brain autopsy. However, recently, as neuropathological changes associated with Alzheimer's disease have been discovered and can be utilized in clinical tests, it has become possible to define Alzheimer's disease by confirming these changes through in vivo biomarkers. Although the definitive diagnosis of Alzheimer's disease is still based on postmortem brain autopsy findings, the pathological accumulation of amyloid proteins and tau proteins, which are known as representative features of brain autopsy findings, can now be indirectly confirmed through PET imaging or cerebrospinal fluid examinations, leading to a dramatic improvement in diagnostic accuracy compared to the past when diagnosis was based solely on clinical features.
[0046] Biomarkers for defining Alzheimer's disease include beta-amyloid-related markers (e.g., binding of amyloid-PET ligand in the cerebral cortex or Aβ in the cerebrospinal fluid). 42 ), tau-related markers in the form of neurofibrillary tangles (e.g., increased phosphorylated tau in cerebrospinal fluid or binding of tau-PET ligands in the cerebral cortex), or markers of neurodegeneration (e.g., increased total tau in cerebrospinal fluid or brain atrophy on MRI and brain hypometabolism on FDG-PET).
[0047] According to the 2018 Alzheimer's disease research criteria (Jack CR, et al., NIA-AA Research Framework: toward a biological definition of Alzheimer's disease. Alzheimers Dement 2018;14:535-562), which are an update of the NIA-AA Alzheimer's disease diagnostic criteria announced by the National Institute of Aging (NIA) and the Alzheimer Association (AA) in 2011, Alzheimer's disease is included in the diagnostic criteria if the pathological characteristics of Alzheimer's disease (Alzheimer's disease biomarkers as described above) are observed even before the appearance of clinical symptoms of dementia. Specifically, Alzheimer's disease is broadly categorized into preclinical Alzheimer's disease, prodromal Alzheimer's disease, and symptomatic Alzheimer's disease through a combination of biomarkers and cognitive stages, and explained as a continuum.
[0048] Alzheimer's disease normal cognitive function corresponds to the preclinical stage where biological marker tests show pathological findings of Alzheimer's disease but there are no clinical symptoms. The next stage, Alzheimer's disease mild cognitive impairment, is the stage where biological marker tests show pathological findings of Alzheimer's disease but there is mild objective cognitive decline and the ability to perform independent daily living is maintained. The terms "AD with mild cognitive impairment" or "prodromal AD" are also used. Alzheimer's disease dementia shows pathological findings of Alzheimer's disease in biological marker tests, dementia symptoms appear, and independent daily living ability is impaired due to objective cognitive decline. The terms "AD with dementia" or "Symptomatic AD" are also used.
[0049] Accordingly, in the present invention, the term "Alzheimer's disease mild cognitive impairment" refers to a state prior to the onset of Alzheimer's disease dementia, in which objective cognitive decline is present but the ability to perform daily living activities is preserved, thus not dementia, assuming that the pathological characteristics (biomarkers) of Alzheimer's disease are exhibited.
[0050] In contrast, the general term "mild cognitive impairment (MCI)" includes cases where cognitive ability is clinically judged to decline not only due to Alzheimer's disease but also other neurodegenerative diseases or various factors. While 1-2% of the general elderly population progresses to dementia each year, 5-20% of elderly people with MCI progress to dementia each year, so MCI is considered a high-risk group for dementia. However, MCI may progress to other dementia diseases such as frontotemporal dementia or vascular dementia rather than Alzheimer's disease dementia, and 20-30% are known to recover to normal or remain in a similar state of MCI without progressing to dementia.
[0051] However, in this hospital, "Alzheimer's disease mild cognitive impairment" refers to mild cognitive impairment caused by Alzheimer's disease, that is, mild cognitive impairment that exhibits the pathological characteristics (biomarkers) of Alzheimer's disease, and is much more likely to progress to Alzheimer's disease dementia than general mild cognitive impairment. According to previous reports, in the case of mild cognitive impairment not caused by Alzheimer's disease, the rate of progression to Alzheimer's disease dementia within 3 years was only about 5%, but in the case of Alzheimer's disease mild cognitive impairment according to the NIA-AA diagnostic criteria, the rate of progression to Alzheimer's disease dementia within 3 years was much higher at about 59% (Brain 2015: 138; 1327-1338).
[0052] Accordingly, the methylation marker LRRC27 of the present invention is specifically hypomethylated in the Alzheimer's disease dementia patient group compared to the normal control group, and its effectiveness in distinguishing the Alzheimer's disease dementia patient group from the normal control group was confirmed through ROC curve analysis, and thus it can be used as a marker for diagnosing Alzheimer's disease dementia.
[0053] In addition, the methylation marker NUP93 of the present invention is specifically hypermethylated in the Alzheimer's disease mild cognitive impairment patient group and the Alzheimer's disease dementia patient group compared to the normal control group, and the validity of distinguishing the above patient groups from the normal group was confirmed through ROC curve analysis, so that not only can Alzheimer's disease mild cognitive impairment be diagnosed, but also can be utilized as a marker for early diagnosis of Alzheimer's dementia from the mild cognitive impairment stage by accurately predicting patients who progress from Alzheimer's disease mild cognitive impairment to Alzheimer's disease dementia.
[0054] In addition, the methylation marker OR2AG1 of the present invention is specifically hypermethylated in the Alzheimer's disease mild cognitive impairment patient group compared to the mild cognitive impairment patient group without amyloid pathology findings, and the validity of distinguishing between the mild cognitive impairment patient group without amyloid pathology findings and the Alzheimer's disease mild cognitive impairment patient group was confirmed through ROC curve analysis, and therefore, it can be used as a diagnostic marker for predicting Alzheimer's disease dementia, which predicts the risk of progression from mild cognitive impairment to Alzheimer's disease dementia in advance.
[0055] Therefore, the composition, kit, and method of the present invention can diagnose Alzheimer's disease dementia, diagnose Alzheimer's disease mild cognitive impairment, diagnose Alzheimer's disease dementia early, or predict the risk of progression to Alzheimer's disease dementia, thereby selecting patients with a high risk of progression to Alzheimer's disease dementia and delaying the worsening of the disease through active preventive management and early treatment. In addition, if clinically utilized in the future, it can delay the onset of dementia and reduce the prevalence rate due to early detection, ultimately improving the quality of life of patients and their families and significantly reducing the socioeconomic costs borne by the country.
[0056] In the present invention, "diagnosis" refers to confirming the presence of a disease, the presence or characteristics of a disease pathology, or both. Broadly speaking, diagnosis may include confirming whether a person currently has a specific disease, assessing the condition prior to the onset of symptoms, determining the prognosis of a disease, or even determining whether a disease is progressing or worsening.
[0057] In the present invention, “early diagnosis” means confirming the presence of a disease, the presence or characteristics of a disease pathological condition, or predicting whether a disease will develop, progress, or worsen from a state before symptoms appear.
[0058] In the present invention, the term "prediction of risk of progression to Alzheimer's disease dementia" means assessing and predicting in advance the risk of developing or progressing to Alzheimer's disease dementia in the future at a stage before symptoms of Alzheimer's disease dementia appear.
[0059] In the present invention, the agent for measuring the methylation level of a CpG site may include a compound or a methylation-sensitive restriction enzyme that modifies an unmethylated cytosine base, a primer specific to a methylated allele sequence of a gene, a primer specific to an unmethylated allele sequence, a methylated CpG binding domain, or a methylated DNA antibody that specifically binds to methylated DNA (e.g., an antibody that specifically binds to methylcytosine).
[0060] The compound that modifies the above unmethylated cytosine base may be, but is not limited to, bisulfite or a salt thereof, and preferably may be sodium bisulfite. Methylation of bisulfite-modified DNA can be detected through various methods, such as sequence analysis or methylation-specific PCR, and methods for detecting whether a gene is methylated by modifying unmethylated cytosine residues using such bisulfite are widely known in the art (e.g., WO01 / 26536; US2003 / 0148326A1).
[0061] In addition, the above methylation-sensitive restriction enzyme may be a restriction enzyme that can specifically detect methylation of a CpG site and may be a restriction enzyme that contains CG as a recognition site of the restriction enzyme. Examples thereof include, but are not limited to, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, etc. Depending on methylation or unmethylation at C of the above restriction enzyme recognition site, whether or not the restriction enzyme cuts is different, and this can be detected through PCR or Southern Blot analysis. Other methylation-sensitive restriction enzymes other than the above restriction enzymes are well known in the art.
[0062] As a representative example of measuring the methylation level at a specific CpG site of an individual's gene, genomic DNA is obtained from a patient's sample, the obtained DNA is treated with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme, the treated DNA is amplified by PCR using primers, and the presence or absence of the amplified result is confirmed.
[0063] Accordingly, the formulation of the present invention may include a primer specific for a methylated allele sequence of a gene and a primer specific for an unmethylated allele sequence. As used herein, the term "primer" refers to a short nucleic acid sequence having a short free three-terminal hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. In addition, the primer, as a sense and antisense nucleic acid having a sequence of 7 to 50 nucleotides, may incorporate additional features that do not alter the basic properties of the primer, which serves as a starting point for DNA synthesis.
[0064] The primers of the present invention can be preferably designed according to the sequence of a specific CpG site to be analyzed for methylation, and can be a primer pair that can specifically amplify cytosine that is methylated and not modified by bisulfite, and a primer pair that can specifically amplify cytosine that is not methylated and modified by bisulfite.
[0065] Meanwhile, a methylated DNA antibody refers to an antibody that specifically binds to methylated bases in DNA. Specifically, an antibody that recognizes and binds to methylated cytosine in a DNA chain, such as an antibody targeting methylcytosine, may be mentioned. Furthermore, among commercially available methylated DNA antibodies, an antibody capable of specifically recognizing and binding to methylated DNA as described herein may be used.
[0066] Methylated DNA antibodies can be produced using methylated bases, methylated DNA, etc. as antigens by conventional methods. For example, to produce a methylcytosine antibody, an antibody is produced using 5-methylcytidine, 5-methylcytosine, or DNA containing 5-methylcytosine as an antigen, and then the antibody can be selected using specific binding to methylcytosine in the DNA as an indicator.
[0067] In addition, when measuring the methylation level using a methylated CpG binding domain (MBD) or methylated DNA antibody, the methylated DNA can be immunoprecipitated using these, and then a specific CpG site can be identified through Southern blot, PCR, microarray, or sequencing. In addition, a substrate, an appropriate buffer solution, a chromogenic enzyme or fluorescent substance label, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, and a chromogenic substrate can be used for immunological detection or quantification of the antibody. In the above, the substrate may be a nitrocellulose membrane, a 96-well plate synthesized with polyvinyl resin, a 96-well plate synthesized with polystyrene resin, and a glass slide glass, and the chromogenic enzyme may be peroxidase, alkaline phosphatase, etc., and the fluorescent substance may be FITC, RITC, etc., and the chromogenic substrate solution may be ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)) or OPD (o-phenylenediamine), TMB (tetramethyl benzidine), and other radioisotope labels, latex bead labels, colloid labels, biotin labels, etc., but are not limited thereto.
[0068] In addition to the above formulation, the above composition and kit may further include polymerase agarose, a buffer solution required for electrophoresis, and the like. In addition, the kit may be implemented in the form of a DNA methylation microarray.
[0069] In another specific example, the present invention relates to a method for diagnosing Alzheimer's disease dementia by measuring the methylation level at a CpG site of the LRRC27 gene promoter.
[0070] In addition, the present invention relates to a method for detecting the methylation level of a CpG region of a gene promoter from a sample of an individual to provide information necessary for diagnosing Alzheimer's disease dementia.
[0071] In addition, the present invention relates to a method for providing information for diagnosing Alzheimer's disease dementia, comprising a step of measuring the methylation level at a CpG site of the LRRC27 gene promoter from a sample of an individual.
[0072] As an embodiment for this purpose, the present invention relates to a method for providing information for diagnosing Alzheimer's disease dementia, comprising the steps of: measuring the methylation level of a CpG site of a LRRC27 gene promoter from a sample of an individual; and comparing the methylation level with the methylation level of the corresponding gene in a control sample without Alzheimer's disease or with a predetermined threshold (cut-off).
[0073] In another specific example, the present invention relates to a method for diagnosing mild cognitive impairment of Alzheimer's disease or early diagnosis of Alzheimer's disease dementia by measuring the methylation level at a CpG site of the NUP93 gene promoter.
[0074] In addition, the present invention relates to a method for detecting the methylation level of a CpG region of a gene promoter from a sample of an individual to provide information necessary for the diagnosis of mild cognitive impairment of Alzheimer's disease or the early diagnosis of dementia of Alzheimer's disease.
[0075] In addition, the present invention relates to a method for providing information for diagnosing mild cognitive impairment of Alzheimer's disease or early diagnosis of dementia of Alzheimer's disease, comprising a step of measuring the methylation level at a CpG site of a NUP93 gene promoter from a sample of an individual.
[0076] As an embodiment for this, the present invention relates to a method for providing information for diagnosing mild cognitive impairment of Alzheimer's disease or early diagnosis of dementia of Alzheimer's disease, comprising the steps of measuring the methylation level of a CpG site of a NUP93 gene promoter from a sample of an individual; and comparing the methylation level with the methylation level of the corresponding gene in a control sample without Alzheimer's disease or with a predetermined threshold (cut-off).
[0077] In another specific example, the present invention relates to a method for predicting the risk of progression to Alzheimer's disease dementia by measuring the methylation level at a CpG site of the OR2AG1 gene promoter.
[0078] In addition, the present invention relates to a method for detecting the methylation level of a CpG region of a gene promoter from a sample of an individual to provide information necessary for predicting the risk of progression to Alzheimer's disease dementia.
[0079] In addition, the present invention relates to a method for providing information for predicting the risk of progression to Alzheimer's disease dementia, comprising a step of measuring the methylation level at a CpG site of the OR2AG1 gene promoter from a sample of an individual.
[0080] As an embodiment for this, the present invention relates to a method for providing information for predicting the risk of progression to Alzheimer's disease dementia, comprising the steps of measuring the methylation level of a CpG site of an OR2AG1 gene promoter from a sample of an individual; and comparing the methylation level with the methylation level of the corresponding gene in a control sample without Alzheimer's disease or with a predetermined threshold (cut-off).
[0081] The term "sample" in the present invention includes samples such as cells, tissues, whole blood, serum, plasma, cerebrospinal fluid, saliva, sputum, or urine, in which the level of gene methylation differs due to Alzheimer's disease. However, the present invention is not limited to the above examples, and any sample from which DNA can be extracted may be used. Preferred specific examples include skin tissue or skin cells, including, but not limited to, skin fibroblasts.
[0082] First, to obtain genomic DNA from a sample of an individual and detect the methylation level, the genomic DNA can be obtained using a phenol / chloroform extraction method, an SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), a CTAB separation method (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or a commercially available DNA extraction kit, which are commonly used in the art.
[0083] The step of detecting the methylation level of a specific CpG site of the above gene can be performed by a method using a restriction enzyme or bisulfite that utilizes the difference between methylated and unmethylated bases, an immunoprecipitation method (e.g., MIRA, MeDIP) using a methylated CpG binding domain or an anti-methylcytosine antibody, a method using a DNA methylation microarray, etc. For example, the methylation level can be measured or detected using a methylation-specific polymerase chain reaction, a real-time methylation-specific polymerase chain reaction, PCR using a methylated DNA-specific binding protein, quantitative PCR, pyrosequencing, bisulfite sequencing, a DNA methylation microarray, or an immunoprecipitation method using a methylated CpG binding domain or an anti-methylcytosine antibody.
[0084] For example, the method of the present invention may include the steps of (a) treating genomic DNA in the obtained sample with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme; and (b) amplifying the treated DNA by PCR using primers capable of amplifying a specific CpG site of the gene.
[0085] The compound that modifies the unmethylated cytosine base in step (a) may be a bisulfite, preferably sodium bisulfite. Methods for detecting whether a gene is methylated by modifying unmethylated cytosine residues using such bisulfite are widely known in the art.
[0086] In addition, in the step (a), the methylation-sensitive restriction enzyme may be a restriction enzyme that can specifically detect methylation of a specific CpG site as described above and may be a restriction enzyme containing CG as a recognition site of the restriction enzyme, and examples thereof include, but are not limited to, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, etc.
[0087] In the above step (b), amplification can be performed using a conventional PCR method. The primers used at this time can be preferably designed according to the sequence of the specific CpG site to be analyzed for methylation, as described above, and can be a primer pair that can specifically amplify cytosines that are methylated and not modified by bisulfite, and a primer pair that can specifically amplify cytosines that are not methylated and modified by bisulfite.
[0088] The step of detecting the methylation level of a specific CpG site of the gene may further include the step of (c) confirming the presence or absence of the amplified result in step (b). The presence or absence of the amplified result in step (c) can be determined by a method known in the art, for example, by performing electrophoresis and determining whether a band at a desired position is detected. For example, when a compound that modifies an unmethylated cytosine residue is used, the degree of methylation can be determined based on the presence or absence of PCR results amplified by the two types of primer pairs used in step (a), i.e., a primer pair that can specifically amplify cytosine that is methylated and not modified by bisulfite, and a primer pair that can specifically amplify cytosine that is not methylated and modified by bisulfite. Preferably, the presence or absence of methylation can be determined by treating sample genomic DNA with bisulfite, amplifying a CpG site of the corresponding gene by PCR, and analyzing the base sequence of the amplified site, using a bisulfite genome sequencing method.
[0089] In addition, even when using a restriction enzyme, the methylation can be determined by a method known in the art, for example, if a PCR result is shown in mock DNA, if a PCR result is found in DNA treated with a restriction enzyme, it is determined that CpG is methylated, and if a PCR result is not found in DNA treated with a restriction enzyme, it is determined that CpG is unmethylated, and this is obvious to those skilled in the art. In the above, mock DNA refers to sample DNA that has been separated from a sample and has not been treated in any way.
[0090] Another example of detecting the methylation level of a specific CpG site in a gene includes immunoprecipitation using a methylated DNA antibody, such as an antibody against a methylated CpG binding domain (MBD) or methylcytosine. For example, after immunoprecipitation using an antibody that specifically recognizes a methylated CpG binding domain or 5-methylcytosine, a specific CpG site can be identified through Southern blot, PCR, microarray, or sequencing.
[0091] In addition, the method of the present invention includes a step of comparing the result of measuring the methylation level of a CpG site of one or more gene promoters selected from the group consisting of LRRC27, NUP93 and OR2AG1 with a reference value, wherein the reference value may be measured in a sample of a healthy individual or a sample of an individual not diagnosed with Alzheimer's disease, or may be a predetermined threshold value (cut-off).
[0092] According to this method, if the CpG site of the LRRC27 gene promoter in the target sample is detected as being hypomethylated, Alzheimer's disease dementia can be diagnosed; if the CpG site of the NUP93 gene promoter in the target sample is detected as being hypermethylated, Alzheimer's disease mild cognitive impairment can be diagnosed or Alzheimer's disease dementia can be diagnosed or predicted early; and if the CpG site of the OR2AG1 gene promoter in the target sample is detected as being hypermethylated, the risk of progression to Alzheimer's disease dementia can be predicted in advance.
[0093] Therefore, according to the present invention, since the methylation change of a specific CpG site of a gene appears specifically in a sample of an individual, the methylation change of the gene can be usefully used as a biomarker for diagnosing Alzheimer's disease. For example, hypomethylation of a specific CpG site of the LRRC27 gene can be usefully used as a biomarker for diagnosing Alzheimer's disease dementia. In addition, hypermethylation of a specific CpG site of the NUP93 gene can be usefully used as a biomarker for diagnosing mild cognitive impairment of Alzheimer's disease or early diagnosis of Alzheimer's disease dementia. In addition, hypermethylation of a specific CpG site of the OR2AG1 gene can be usefully used as a biomarker for predicting the risk of progression to Alzheimer's disease dementia.
[0094] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are only illustrative of the present invention, and the present invention is not limited to the following examples.
[0095] Example 1. Research subjects
[0096] The Alzheimer's disease patient group includes three groups: preclinical Alzheimer's disease (AD), prodromal Alzheimer's disease, and symptomatic Alzheimer's disease. The control group includes three groups: normal control (normal cognitive function, no amyloid pathology), mild cognitive impairment (MCI) due to non-AD, and dementia due to non-AD.
[0097] Diagnosis and classification of the above six study subjects were performed according to the following four steps:
[0098] In the first step, a structured interview with a neurologist was conducted to collect medical history from the subjects and their guardians.
[0099] In the second step, neuropsychological testing was used to assess the degree of cognitive decline and the presence of impairment in daily living skills. Through these two steps, three stages of cognitive decline were determined: normal cognitive function, mild cognitive impairment, and dementia. The normal cognitive function group, regardless of subjective complaints of cognitive decline, demonstrated objective neuropsychological test scores of ≥-1.5 (z score ≥-1.5), indicating no objective evidence of cognitive decline and no impairment in daily living skills. Mild cognitive impairment refers to patients or informants complaining of memory decline and neuropsychological test scores of 1.5 or lower (z score <-1.5), indicating objective memory decline, but maintaining overall cognitive function and daily living skills. The dementia group demonstrated objective decline (z score ≤1.5) in two or more cognitive domains, with a slowly progressive clinical picture and impairment in daily living skills, requiring the care of others.
[0100] In the third step, blood tests and structural brain imaging (computed tomography, CT or magnetic resonance imaging, MRI) and functional brain imaging (functional MRI, amyloid positron emission tomography, amyloid PET) were performed to exclude other causes of cognitive decline and to check for the accumulation of amyloid pathology in the brain. Excluding other causes of cognitive decline is an important step in diagnosing Alzheimer's disease. It is important to exclude these possibilities by checking for thyroid hormone dysfunction, vitamin B12 or folate deficiency, and neurosyphilis in blood tests. In addition, alcoholism, drug addiction, major depressive disorder, bipolar disorder, schizophrenia, and seizure disorders were also excluded as they may be associated with cognitive decline. In addition, structural brain abnormalities such as normal pressure hydrocephalus, stroke, and brain tumors were excluded from brain imaging tests, and other neurodegenerative diseases such as Parkinson's disease, dementia with Lewy bodies, and vascular dementia were also excluded. According to the 2018 research diagnostic criteria for Alzheimer's disease, if the amyloid PET result was positive (Brain amyloid Plaque load, BAPL 2 or 3), the patient was considered to have Alzheimer's disease and was classified into one of the following groups: preclinical, prodromal, and symptomatic AD, depending on clinical symptoms. If the amyloid PET result was negative (BAPL 1), the patient was classified as a control group and, depending on clinical symptoms, was classified into one of the following groups: normal control group (normal cognitive function and no amyloid pathology), mild cognitive impairment (MCI) due to non-AD, and dementia due to non-AD.Fourth, by synthesizing the clinical information of these three stages, we made a final decision on six groups.
[0101]
[0102] Example 2. Skin biopsy collection and skin fibroblast culture
[0103] A skin biopsy was obtained from the patient's inner thigh using a 2-mm diameter cylindrical blade. The biopsy was divided into six equal parts and placed in a 24-well cell culture plate coated with 0.1% gelatin with enough medium (DMEM / 20% FBS) to submerge the skin biopsy pieces. Cells were observed to extend from the edges of the skin biopsy pieces for 7 days. The medium was replenished every 2-3 days to prevent the skin biopsy pieces from drying. After 7 days, the medium volume was increased to 500 μL and replaced every 2-3 days. After 14 days, when cells had grown around the skin biopsy pieces and filled the culture wells, the cells were transferred to 35-mm culture dishes and the concentration of fetal bovine serum (FBS) in the medium was reduced from 20% to 10%, and cell culture was continued. Subculture was performed when the cells reached 80-90% confluence in the 35-mm culture dish. After repeating the subculture 2-3 times and selecting only skin fibroblasts, the expression of SERPHINH1, a fibroblast marker, was confirmed using the SERPHINH1 antibody.
[0104]
[0105] Example 3. Genomic DNA extraction
[0106] Genomic DNA was extracted from cultured skin fibroblasts in Example 2 using the QIAmp DNA mini kit (Qiagen). The extraction method was performed according to the manufacturer's manual. The extracted genomic DNA was quantified using a spectrophotometer, and the DNA status was confirmed for degradation by electrophoresis on a 1% agarose gel.
[0107]
[0108] Example 4. DNA methylation mutation analysis
[0109] DNA methylation mutation analysis was performed by extracting DNA from skin fibroblasts of patient and control groups, performing bisulfite conversion to change unmethylated cytosine to uracil, and measuring the degree of methylation for approximately 850,000 CpG sites using an Infinium MethylationEPIC bead chip (illumina). The degree of DNA methylation is expressed as a β value ranging from 0 to 1, with a β value of 0 indicating complete unmethylation of the CpG site, and a β value of 1 indicating complete methylation.
[0110] To identify differentially methylated genes (DMGs) between patient and control groups, an independent t-test method was used. Ultimately, promoter CpG sites with a p value < 0.05 and an absolute β difference ≥ 0.2 were selected as differentially methylated CpG sites, and genes with altered methylation levels at these CpG sites were selected as DMGs.
[0111]
[0112] Experimental results
[0113] 1. Identification of disease-specific DNA methylation changes in patients with Alzheimer's disease.
[0114] From 2018 to 2019, genomic DNA was extracted from skin fibroblasts cultured from 19 normal controls (normal cognitive function group without amyloid pathology) and 16 patients with Alzheimer's disease who visited Ewha Womans University Mokdong Hospital. DNA methylation profiles were analyzed using the Illumina Human MethylationEPIC bead chip. Genes with DNA methylation changes of 30% or more at specific CpG sites in the gene promoter of Alzheimer's disease patients were selected compared to the normal control group. Among these selected genes, the LRRC27 (Leucine Rich Repeat Containing 27) gene showed a 43% decrease in DNA methylation at a specific promoter CpG site (cg14683065) in skin fibroblasts from Alzheimer's disease patients compared to the normal control group (Table 1).
[0115] GeneTarget IDβ value (difference)*Methylation statusp valueLRRC27cg14683065-0.4252084Hypomethylation0.0008619*The value obtained by subtracting the β value of the normal control cells from the β value of the patient cells
[0116] The difference in the degree of DNA methylation of the LRRC27 gene between the normal control group and the Alzheimer's disease dementia patient group is shown in a scatter dot plot in Figure 1, and the mean ± standard error (mean ± SEM) values are indicated.
[0117]
[0118] 2. Selection of diagnostic markers for Alzheimer's disease using changes in DNA methylation.
[0119] We used the receiver operating characteristics curve (ROC curve) to determine whether the Alzheimer's disease patient group and the normal control group could be distinguished. In general, the area under the curve (AUC) of the ROC curve is classified as uninformative (AUC=0.5) and less accurate (0.5). <AUC≤0.7), 중등도의 정확한(0.7<AUC≤0.9), 매우 정확한(0.9<AUC<1.0) 그리고 완벽한 검사(AUC=1.0)로 분류한다.
[0120] In the case of LRRC27, it was hypomethylated in the Alzheimer's disease dementia patient group, and it was confirmed that this hypomethylation could distinguish between the normal control group and the Alzheimer's disease dementia patient group with high accuracy (AUC = 0.8322) (Fig. 2).
[0121] These results indicate that disease-specific hypomethylation of the LRRC27 gene in skin fibroblasts from patients with Alzheimer's disease dementia is a valid diagnostic marker for noninvasive diagnosis of Alzheimer's disease dementia.
[0122]
[0123] 3. Confirmation of disease-specific changes in DNA methylation in patients with mild cognitive impairment (MCI) and Alzheimer's disease.
[0124] From 2018 to 2019, genomic DNA was extracted from skin fibroblasts cultured from the skin tissues of 19 normal controls (normal cognitive function group without amyloid pathology) and 28 patients with mild cognitive impairment (MCI) of Alzheimer's disease who visited Ewha Womans University Mokdong Hospital. DNA methylation profiles were analyzed using the Illumina Human MethylationEPIC bead chip, and genes with DNA methylation changes of more than 30% at specific CpG sites in the gene promoter of the fibroblasts of the patient group with mild cognitive impairment of Alzheimer's disease were selected compared to the normal control group without amyloid pathology. Among these selected genes, the NUP93 (Nucleoporin 93) gene showed a 36% increase in DNA methylation at a specific promoter CpG site in the fibroblasts of the patient group with mild cognitive impairment of Alzheimer's disease compared to the normal control group.
[0125] GeneTarget IDβ value (difference)*Methylation statusp valueNUP93cg229683270.35741High methylation0.00012*The value obtained by subtracting the β value of the normal control cells from the β value of the patient cells
[0126] The difference in the degree of DNA methylation of the NUP93 gene between the normal control group and the Alzheimer's disease mild cognitive impairment patient group is shown in a scatter dot plot in Figure 3, and the mean ± standard error (mean ± SEM) values are indicated.
[0127]
[0128] 4. Identification of disease-specific DNA methylation changes in patients with Alzheimer's disease.
[0129] From 2018 to 2019, genomic DNA was extracted from skin fibroblasts cultured from the skin tissues of 19 normal controls (normal cognitive function group without amyloid pathology) and 16 Alzheimer's disease dementia patients who visited Ewha Womans University Mokdong Hospital. DNA methylation profiles were analyzed using the Illumina Human MethylationEPIC bead chip, and genes with DNA methylation changes of more than 30% at specific CpG sites in the gene promoter of the skin fibroblasts from the Alzheimer's disease dementia patient group compared to the normal control group without amyloid pathology were selected. Among these selected genes, the NUP93 (Nucleoporin 93) gene showed a 47% increase in DNA methylation at a specific promoter CpG site in the skin fibroblasts from the Alzheimer's disease mild cognitive impairment patient group compared to the normal control group.
[0130] GeneTarget IDβ value (difference)*Methylation statusp valueNUP93cg229683270.46966251High methylation0.00015507*The value obtained by subtracting the β value of the normal control cells from the β value of the patient cells
[0131] The difference in the degree of DNA methylation of selected genes between the normal control group and the Alzheimer's disease dementia patient group is shown in a scatter dot plot in Figure 4, and the mean ± standard error (mean ± SEM) values are indicated.
[0132]
[0133] 5. Selection of markers for early diagnosis of Alzheimer's disease using changes in DNA methylation.
[0134] We used the receiver operating characteristics curve (ROC curve) to determine whether the patient group could be distinguished from the normal control group. In general, the area under the curve (AUC) of the ROC curve is classified as non-informative (AUC=0.5) and less accurate (0.5). <AUC≤0.7), 중등도의 정확한(0.7<AUC≤0.9), 매우 정확한(0.9<AUC<1.0) 그리고 완벽한 검사(AUC=1.0)로 분류한다.
[0135] In the case of NUP93, it was found to be hypermethylated in the Alzheimer's disease mild cognitive impairment patient group and the Alzheimer's disease dementia patient group, and it was confirmed that this hypermethylation could distinguish the Alzheimer's disease mild cognitive impairment patient group (AUC = 0.8120) and the Alzheimer's disease dementia patient group (AUC = 0.8454) with high accuracy compared to the normal control group (Fig. 5).
[0136] These results indicate that disease-specific hypermethylation of the NUP93 gene in skin fibroblasts from patients with Alzheimer's disease dementia is effective as a noninvasive method for diagnosing mild cognitive impairment in Alzheimer's disease or as an early diagnostic marker for Alzheimer's disease dementia, diagnosing Alzheimer's disease dementia from the mild cognitive impairment stage.
[0137]
[0138] 6. Confirmation of disease-specific changes in DNA methylation in patients with mild cognitive impairment (MCI) and Alzheimer's disease.
[0139] From 2018 to 2019, we extracted genomic DNA by culturing skin fibroblasts from the skin tissues of 19 patients with mild cognitive impairment without amyloid pathology and 28 patients with mild cognitive impairment due to Alzheimer's disease who visited Ewha Womans University Mokdong Hospital. DNA methylation profiles were analyzed using the Illumina Human MethylationEPIC bead chip, and genes with DNA methylation changes of 20% or more at specific CpG sites of gene promoters in skin fibroblasts from the Alzheimer's disease mild cognitive impairment patient group were selected compared to the mild cognitive impairment patient group without amyloid pathology. Among these selected genes, the OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1) gene was found to have a 21% increase in DNA methylation at a specific promoter CpG site in skin fibroblasts from patients with mild cognitive impairment (MCI) and Alzheimer's disease (AD) compared to patients with mild cognitive impairment (MCI) without amyloid pathology.
[0140] GeneTarget IDβ value (difference)*Methylation statusp valueOR2AG1cg121869810.2129912High methylation0.0052804*The value obtained by subtracting the β value of the normal control cells from the β value of the patient group cells
[0141] The difference in the degree of DNA methylation of the OR2AG1 gene between the mild cognitive impairment patient group without amyloid pathology and the Alzheimer's disease mild cognitive impairment patient group is shown in a scatter dot plot in Figure 6, and the mean ± standard error (mean ± SEM) values are presented.
[0142]
[0143] 7. Selection of markers for predicting Alzheimer's disease using changes in DNA methylation.
[0144] We used the receiver operating characteristics curve (ROC curve) to determine whether it could distinguish between patients with mild cognitive impairment without amyloid pathology and patients with mild cognitive impairment due to Alzheimer's disease. In general, the area under the curve (AUC) of the ROC curve was classified as uninformative (AUC=0.5) and less accurate (0.5). <AUC≤0.7), 중등도의 정확한(0.7<AUC≤0.9), 매우 정확한(0.9<AUC<1.0) 그리고 완벽한 검사(AUC=1.0)로 분류한다.
[0145] In the case of OR2AG1, it was found to be hypermethylated in the Alzheimer's disease mild cognitive impairment patient group, and it was confirmed that this hypermethylation could distinguish between the mild cognitive impairment patient group without amyloid pathology and the Alzheimer's disease mild cognitive impairment patient group with high accuracy (AUC = 0.8177) (Fig. 7).
[0146] These results indicate that disease-specific hypermethylation of the OR2AG1 gene in skin fibroblasts from patients with mild cognitive impairment (MCI) of Alzheimer's disease is a valid diagnostic marker for predicting Alzheimer's disease dementia in a noninvasive manner, allowing for the early prediction of progression to Alzheimer's disease dementia in patients with MCI.
[0147] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical concept or essential characteristics thereof. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A method for diagnosing Alzheimer's disease in an individual, (i) a step of measuring the methylation level of a CpG site of a promoter of one or more genes selected from the group consisting of LRRC27 (Leucine Rich Repeat Containing 27), NUP93 (Nucleoporin 93) and OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1) in a sample of an individual, and (ii) a step of comparing the level measured in step (i) with a reference value; If the CpG site of the gene promoter of LRRC27 in the sample of the above individual is hypomethylated below the reference value, Alzheimer's disease dementia is diagnosed. If the CpG site of the NUP93 gene promoter in the sample of the above individual is hypermethylated above the reference value, the individual is diagnosed with mild cognitive impairment of Alzheimer's disease or is diagnosed with early-stage dementia of Alzheimer's disease. A method for predicting a risk of progression to Alzheimer's disease dementia when the CpG site of the OR2AG1 gene promoter in a sample of the above individual is hypomethylated below the reference level.
2. In paragraph 1, A method for measuring the methylation level of a CpG site of the gene promoter, wherein the agent comprises a compound or a methylation-sensitive restriction enzyme that modifies an unmethylated cytosine base, a primer specific to a methylated sequence of the CpG site of the gene promoter, a primer specific to an unmethylated sequence, a methylated CpG binding domain, or an antibody that specifically binds to methylcytosine.
3. In the first paragraph, the step of measuring the methylation level of the CpG site of the gene promoter is (a) a step of treating the genomic DNA in the obtained sample with a compound that modifies unmethylated cytosine bases or a methylation-sensitive restriction enzyme; and (b) A method comprising a step of amplifying the treated DNA by PCR using a primer capable of amplifying the CpG region of the gene promoter.
4. A method according to claim 2 or 3, wherein the compound that modifies the unmethylated cytosine base is bisulfite or a salt thereof.
5. A composition according to claim 2 or 3, wherein the methylation sensitive restriction enzyme is SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI or NotI.
6. In the first paragraph, the method for detecting the methylation level is selected from the group consisting of methylation-specific polymerase chain reaction, real-time methylation-specific polymerase chain reaction, PCR using a methylated DNA-specific binding protein, quantitative PCR, pyrosequencing, bisulfite sequencing, DNA methylation microarray, and immunoprecipitation using a methylated CpG binding domain or an anti-methylcytosine antibody.
7. A method according to claim 1, wherein the reference value is measured in a sample of a healthy individual or a sample of an individual not diagnosed with Alzheimer's disease, or is a predetermined threshold value (cut-off).
8. A kit for diagnosing Alzheimer's disease, comprising a preparation for measuring the methylation level of a CpG site of one or more gene promoters selected from the group consisting of LRRC27 (Leucine Rich Repeat Containing 27), NUP93 (Nucleoporin 93) and OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1). The above Alzheimer's disease diagnosis kit is for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
9. A composition for diagnosing Alzheimer's disease, comprising an agent for measuring the methylation level of a CpG site of one or more gene promoters selected from the group consisting of LRRC27 (Leucine Rich Repeat Containing 27), NUP93 (Nucleoporin 93) and OR2AG1 (Olfactory Receptor Family 2 Subfamily AG Member 1). The above Alzheimer's disease diagnosis is a composition for diagnosing Alzheimer's disease dementia, diagnosing Alzheimer's disease mild cognitive impairment, diagnosing Alzheimer's disease dementia early, or predicting the risk of progression to Alzheimer's disease dementia.
Citation Information
Patent Citations
Epigenetic early diagnostic composition for Alzheimer''s disease or mild cognitive impairment
KR101718940B1
Canistrer drop system using hot air balloon and operation method of the same
KR1020230027435A
Non-demolded beam formwork that improves safety by preventing deck plates separation
KR1020250095437A
A novel variant of ribose-phosphate pyrophosphokinase and a method for producing L-amino acid using the same
KR1020250117544A
Test for detecting alzheimers disease
US20200080132A1