Splint-mediated RNA synthesis
The hybridization and ligation of RNA fragments using splint DNA oligonucleotides and ligases addresses the inefficiencies in synthesizing long RNAs, enhancing yield and purity, particularly for gRNAs, by forming specific ligation sites and avoiding DNase treatment.
Patent Information
- Application Number
- PCT/IB2025/053671
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-08
- Filing Date
- 2025-04-07
- Publication Date
- 2025-10-16
AI Technical Summary
Current methods for synthesizing long RNAs, such as gRNAs, face challenges in achieving high yields of full-length products and isolating them from truncation products, particularly with phosphoramidite chemistry, which results in approximately 30-40% full-length product yield and incomplete purification using standard chromatography.
A method involving hybridization and ligation of RNA fragments using splint DNA oligonucleotides and ligases, allowing for the synthesis of long RNAs by forming complexes at specific ligation sites, thereby improving yield and reducing truncation products without the need for DNase treatment.
The method enhances the synthesis of long RNAs, including gRNAs, by increasing full-length product yield and reducing truncation products, while maintaining high purity without the use of DNase, thus providing efficient and effective RNA production.
Smart Images

Figure IB2025053671_16102025_PF_FP_ABST
Abstract
Description
80EM-341789-WO / CT233-PCT1 PATENT SPLINT-MEDIATED RNA SYNTHESIS RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional Patent Application Ser. No. 63 / 631,331, filed April 8, 2024, the entire content of which is hereby expressly incorporated by reference in its entirety. REFERENCE TO SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 80EM-341789-WO_SeqList, created March 6, 2025, which is 58.7 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety. BACKGROUND Field
[0003] The present disclosure generally relates to the field of molecular biology and biotechnology, including the synthesis of RNA molecules. Description of the Related Art
[0004] Available approaches for the synthesis of RNA include intracellular transcription of an exogenous plasmid and solid-phase synthesis using phosphoramidite chemistry. Direct chemical synthesis of gRNA allows for incorporation of chemical modifications that increase the chemical stability of the RNA, decrease its immunogenicity, and reduce potential off-target effects (i.e., cleaving genomic DNA at undesired locations). Chemical synthesis is not optimal for gRNAs which are fairly long RNAs typically ranging from 60 to 100 nucleotides. For example, if the phosphoramidite chemistry being used has a coupling efficiency of ~0.99X(where X is the number of nucleotides), the overall synthesis process would be expected to yield approximately 30-40% full-length product (FLP) when synthesizing gRNAs with lengths on the order of 100 nucleotides. Complete isolation of the FLP from the remaining side products formed from incomplete coupling (truncation products) and deprotection is not currently achievable for RNA molecules with lengths on the order of 100 nucleotides by standard purification methods (such as chromatography). There is a need for more efficient methods for synthesizing RNAs that can be used in various gene editing approaches. SUMMARY
[0005] Disclosed herein include methods, compositions, and kits for synthesizing RNAs. In some embodiments, the method can comprise, for example: hybridizing a first RNAfragment, a second RNA fragment, a third RNA fragment, a first splint DNA oligonucleotide, and a second first splint DNA oligonucleotide to form a complex, wherein (a) the first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) the second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) the third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) the first splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; and (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, wherein the first splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 4; and (e) the second splint DNA oligonucleotide comprises (i) a first portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (ii) a second portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the second splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 5, wherein the complex comprises (i) a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and (i) a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment, and ligating the first and second RNA fragments, and the second and third RNA fragments, respectively, with a ligase at the first and second ligation sites in the complex, thereby synthesizing a RNA.
[0006] In some embodiments, the method can comprise, for example, hybridizing a first RNA fragment, a second RNA fragment, a third RNA fragment, a splint DNA oligonucleotide to form a complex, wherein (a) the first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) the second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) the third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, and (d) the splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, (iii) a third portion complementary to the second terminal region comprising the 3’ hydroxyl group ofthe second RNA fragment; and (iv) a fourth portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 39; and wherein the complex comprises (i) a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and (i) a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment, and ligating the first and second RNA fragments, and the second and third RNA fragments, respectively, with a ligase at the first and second ligation sites in the complex, thereby synthesizing a RNA.
[0007] In some embodiments, the RNA comprises in 5’ to 3’ order: a spacer sequence, a scaffold sequence, and an extension sequence. The scaffold sequence can, for example, comprise an invariable sequence comprising a stem loop formed between a crRNA repeat sequence and a tracrRNA anti-repeat sequence, and a 3’ tracrRNA sequence comprising at least one stem-loop. In some embodiments, the extension sequence region comprises an editing template complementary to a target sequence and a flap binding sequence at least partially complementary to the spacer sequence. In some embodiments, the first ligation site and the second ligation site correspond to sites in the scaffold sequence. In some embodiments, the first ligation site corresponds to a site in a stem-loop structure formed between the crRNA repeat sequence and the tracrRNA anti-repeat sequence; and optionally wherein the site in the first stem-loop structure is in a tetraloop portion of the stem-loop structure. In some embodiments, the second ligation site corresponds to a site in the loop portion of a stem-loop structure in the tracrRNA sequence of the scaffold sequence.
[0008] The RNA can, for example, comprise in 5’ to 3’ order the first RNA fragment linked to the second RNA fragment by a first phosphodiester bond, and the second RNA fragment linked to the third RNA fragment by a second phosphodiester bond. In some embodiments, the first phosphodiester bond is formed between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and wherein the second phosphodiester bond is formed between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment. In some embodiments, the first RNA fragment comprises a nucleotide sequence that is 5’ to the first ligation site. In some embodiments, the second RNA fragment comprises a nucleotide sequence that is between the first ligation site and the second ligation site. In some embodiments, the third RNA fragment comprises a nucleotide sequence that is 3’ to the second ligation site. In some embodiments, the terminal region of the first RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 3’end of thefirst RNA fragment. In some embodiments, the first portion of the first splint DNA oligonucleotide is perfectly complementary to the terminal region of the first RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the terminal region of the first RNA fragment. In some embodiments, the first terminal region of the second RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 5’end of the second RNA fragment.
[0009] In some embodiments, the second portion of the first splint DNA oligonucleotide is perfectly complementary to the first terminal region of the second RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the first terminal region of the second RNA fragment.
[0010] In some embodiments, the second terminal region of the second RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 3’end of the second RNA fragment. In some embodiments, the first portion of the second splint DNA oligonucleotide is perfectly complementary to the second terminal region of the second RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the second terminal region of the second RNA fragment. In some embodiments, the second RNA fragment comprises a center sequence region between the first terminal region and the second terminal region, and optionally wherein the center sequence region does not comprise a nucleotide sequence complementary to the first splint oligonucleotide and / or the second splint oligonucleotide, and further optionally wherein the center sequence region is about 10 to about 60 nucleotides in length.
[0011] In some embodiments, the terminal region of the third RNA fragment comprises a nucleotide sequence of about 10 to about 40 nucleotides located at the 5’end of the third RNA fragment. In some embodiments, the second portion of the second splint DNA oligonucleotide is perfectly complementary to the terminal region of the third RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the terminal region of the third RNA fragment. In some embodiments, the first RNA fragment comprises a spacer sequence that is complementary to a sequence in a target DNA; and optionally wherein the target DNA is mammalian DNA or human DNA. In some embodiments, the second RNA fragment comprises a scaffold sequence capable of binding to an RNA-guided endonuclease or a variant thereof.
[0012] The RNA-guided endonuclease can be, for example, a small Cas nuclease or a small RNA-guided endonuclease. The RNA-guided endonuclease can be, for example, a Cas9, a Cas12, aCas13, and variants thereof; and optionally wherein the RNA-guided endonuclease is a Streptococcus pyogenes Cas9 (SpyCas9) or a Staphylococcus aureus (SaCas9). In some embodiments, the RNA-guided endonuclease is a variant of Cas9. The variant of Cas9 can be, for example, a small Cas9, a dead Cas9 (dCas9), a Cas9 nickase, or a Cas9 fusion protein.
[0013] In some embodiments, the third fragment comprises an extension region, andoptionally wherein the extension region comprises an editing template that comprises a region of complementarity to a target sequence. In some embodiments, third fragment comprises a flap binding sequence at least partially complementary to the spacer. In some embodiments, the flap binding sequence is 3’ of the editing template.
[0014] In some embodiments, the first RNA fragment, the second RNA fragment, and the third RNA fragment are each independently about 10 to about 90 nucleotides in length, and optionally wherein the first RNA fragment, the second RNA fragment, and the third RNA fragment are each independently about 25 to about 70 nucleotides in length, and further optionally wherein the first RNA fragment and the third RNA fragment are each independently about 20 to 40 nucleotides in length and the second RNA fragment is about 45 to about 65 nucleotides in length.
[0015] The RNA can be, for example, about 100 to about 250 nucleotides in length, for example about 100 to about 200 nucleotides in length, about 100 to about 150 nucleotides in length, or about 110 to about 140 nucleotides in length.
[0016] In some embodiments, the hybridizing step and the ligating step occur simultaneously. In some embodiments, the hybridizing step and ligating step occur at different temperature. In some embodiments, the hybridizing step occurs in the presence of the ligase.
[0017] In some embodiments, hybridizing is performed in a solution, and wherein the hybridizing is performed with or without an annealing step, and optionally wherein the annealing step comprises (i) heating the solution to about 80°C to about 95°C for a period of time less than about 10 minutes; and / or (ii) cooling the solution at a rate of about 0.1°C to about 2°C per second to a temperature used for the ligation.
[0018] In some embodiments, two or more of the first splint oligonucleotide, the second splint oligonucleotide, the first RNA fragment, the second RNA fragment, and the third RNA fragment are present in the solution in an about equal concentration.
[0019] In some embodiments, the ligating is carried out at about 15 ºC to about 45 ºC, and optionally the ligating is carried out at about 15 ºC, 20 ºC, 22 ºC, 24 ºC, 27 ºC, 30 ºC, or 33 ºC. In some embodiments, the complex has a melting temperature (Tm) greater than 15 ºC and lower than 60 ºC, and optionally the Tm of the complex is lower than 55 ºC, 50 ºC, 45 ºC, 40 ºC or 35 ºC.
[0020] The ligase can be, for example, a T4 DNA ligase, T4 RNA ligase I, or T4 RNA ligase II. The ligating can be, for example, carried out for about 0.1 to about 48 hours, optionally 6 hours. In some embodiments, the ligating further comprises using one or more of a protease, a chelating agent, and a crowding agent. In some embodiments, the chelating agent comprises EDTA, EGTA, or both. In some embodiments, the crowding agent comprise polyethylene glycol(PEG), Ficoll®, ethylene glycol, dextran, or any combination thereof.
[0021] In some embodiments, the method comprises isolating and / or purifying the gRNA.
[0022] In some embodiments, the purified gRNA is at least 80%, 85%, 90%, 95%, or 98% in purity.
[0023] In some embodiments, the method comprises after ligating, separating the RNA and one or more of the first and second splint DNA oligonucleotides. In some embodiments, the method comprises isolating and / or purifying one or more of the first and second splint DNA oligonucleotides. The isolating and / or purifying can, for example, comprise using a chromatographic method, a size-based separation method, an affinity-based method, a charge- based separation method, or a combination thereof. Non-limiting examples of chromatographic method include reversed-phase HPLC, ion-exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, affinity chromatography, or polyacrylamide gel purification, and any combination thereof.
[0024] In some embodiments, the method does not comprise using any DNase. In some embodiments, the method does not comprise digesting one or more of the first and second splint DNA oligonucleotides after the ligating step. In some embodiments, the method does not comprise digesting one or more of the first and second splint DNA oligonucleotides in the complex after the ligating step. In some embodiments, the method does not comprise separating the RNA and one or more of the first and second splint DNA oligonucleotides enzymatically. In some embodiments, the hybridizing step is carried out in the presence of one or more RNase inhibitors.
[0025] In some embodiments, one or more of the first RNA fragment, the second RNA fragment, and the third RNA fragment comprises at least one secondary structure, and wherein the complex formed by hybridizing the first, second, and third RNA fragments and the first and second splint oligonucleotides has a lower free energy than that of the secondary structure with the lowest free energy.
[0026] The RNA can be, for example, a guide RNA (gRNA), optionally a single gRNA (sgRNA).
[0027] In some embodiments, the method comprises providing the first, second and third RNA fragments and the first and second splint oligonucleotides. In some embodiments, providing the first, second and third RNA fragments and the first and second splint oligonucleotides comprises synthesis of the RNA fragments and the oligonucleotides using enzymatic synthesis or phosphoramidite chemistry, optionally comprising purifying the RNA fragments and the oligonucleotides after synthesis. In some embodiments, the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises one or more modificationsin the RNA backbone; and optionally wherein at least one of the one or more modifications is selected from the group consisting of 2’ methoxy (2’OMe), 2’ fluorine (2’fluoro), 2’-O-methoxy- ethyl (MOE), Locked Nucleic Acids (LNA), Unlocked Nucleic Acids (UNA), bridged nucleic acids, 2’deoxynucleic acids (DNA), and peptide nucleic acids (PNA).
[0028] In some embodiments, the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises one or more base modifications; and optionally wherein at least one of the one or more base modifications is selected from the group consisting of 2- aminopurine, hypoxanthine, thymine, 2,6-diaminopurine, 2-pyrimidone, and 5-methyl cytosine. In some embodiments, the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises at least one phosphorothioate linkage. In some embodiments, the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35. In some embodiments, the second RNA fragment comprises (1) a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; and / or (2) a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37. In some embodiments, the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38. In some embodiments, the terminal region of the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35; the first terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; the second terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37; and / or the terminal region of the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38.
[0029] Provided includes a method of synthesizing a long RNA, the method comprising: providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) a first splint DNA oligonucleotide comprises (i) a first portion complementaryto the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; and (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, wherein the first splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 4; and (e) a second splint DNA oligonucleotide comprises (i) a first portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (ii) a second portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the second splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 5; and (f) a ligase; hybridizing the first, second, and third RNA fragments and the first and second splint DNA oligonucleotides to form a complex having a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment; and ligating the first and second RNA fragments at the first ligation site and the second and third RNA fragments at the second ligation site using the ligase to synthesize a long RNA comprising from 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target DNA, a scaffold sequence capable of binding to an RNA-guided endonuclease or a DNA binding domain, and an extended sequence region comprising one or more intended nucleotide edits compared to the sequence of the target DNA, wherein the first and second ligation sites correspond to sites in the scaffold sequence of the RNA.
[0030] In some embodiments, a method of synthesizing a long RNA can comprise: providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) a splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of thesecond RNA fragment, (iii) a third portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (iv) a fourth portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 39; and (e) a ligase; hybridizing the first, second, and third RNA fragments and the splint DNA oligonucleotides to form a complex having a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment; and ligating the first and second RNA fragments at the first ligation site and the second and third RNA fragments at the second ligation site using the ligase to synthesize a long RNA comprising from 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target DNA, a scaffold sequence capable of binding to an RNA-guided endonuclease or a DNA binding domain, and an extended sequence region comprising one or more intended nucleotide edits compared to the sequence of the target DNA, wherein the first and second ligation sites correspond to sites in the scaffold sequence of the RNA.
[0031] In some embodiments, the long RNA is capable of binding to a reverse transcriptase editor comprising a DNA binding domain and a DNA polymerase domain. The DNA polymerase domain can comprise a reverse transcriptase and the DNA binding domain comprises a Cas9 nickase.
[0032] In some embodiments, the extended sequence region comprising an editing template complementary to a target sequence and a flap binding sequence at least partially complementary to the spacer sequence. In some embodiments, the long RNA is a target priming RNA for use in a reverse transcriptase editing system. The long RNA can be, for example, about 100 to about 150 nucleotides in length, about 100 to about 140 nucleotides in length. In some embodiments, the first ligation site corresponds to a site in a lower stem loop formed adjacent to the spacer sequence.
[0033] In some embodiments, the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35. In some embodiments, the second RNA fragment comprises (1) a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; and / or (2) a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37. In some embodiments, the third RNAfragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38.
[0034] In some embodiments, the terminal region of the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35; the first terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; the second terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37; and / or the terminal region of the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG.1 is a non-limiting schematic illustration showing the synthesis of a RNA molecule by ligating two RNA fragments using a splint oligonucleotide.
[0036] FIG. 2A is a non-limiting schematic illustration showing the synthesis of a RNA molecule by ligating three RNA fragments using two splint oligonucleotides. FIG.2B is a non-limiting schematic illustration showing the synthesis of a RNA molecule by ligating three RNA fragments using one splint oligonucleotide.
[0037] FIG. 3 shows the sequence and secondary structure of an exemplary RNA synthesized using the methods described herein. The ligation site between RNA1 and RNA2, and the ligation site between RNA2 and RNA3 are shown as LS1 and LS2, respectively.
[0038] FIG.4 shows the UV spectrum acquired from a crude mixture of an exemplary ligation reaction.
[0039] FIG.5 shows the MS spectrum of the main peak in the UV signal of a crude mixture.
[0040] FIG. 6 shows the RP purification chromatogram of a crude mixture from a ligation reaction.
[0041] FIG. 7 shows the UV spectrum of a center fraction from product peak in purification.
[0042] FIG. 8 shows the deconvoluted mass of the main peak in UV signal of purification fraction.
[0043] FIG. 9 show the UV spectrums acquired from crudes of exemplary ligation reactions.
[0044] FIG.10 shows the UV spectrum acquired from a crude mixture of an exemplary ligation reaction.DETAILED DESCRIPTION
[0045] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein and made part of the disclosure herein.
[0046] All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.
[0047] Disclosed herein include methods, compositions and kits for generating RNAs, for example long RNAs of at least 100 nucleotides in length, by ligating RNA fragments using one or more splint DNA oligonucleotides and one or more ligases. The long RNAs can be, for example, guide RNAs (gRNAs), including single gRNAs (sgRNAs), or target priming RNAs (tagRNA) that can be used in a reverse transcriptase (RT) editing system. In some embodiments, one or more of the RNA fragments comprise at least a portion of a sequence that can bind to an RNA-guided endonuclease or a DNA binding domain of a reverse transcriptase editor (RT editor). In some embodiments, one or more of the RNA fragments comprise a spacer sequence for targeting a target sequence in a target DNA (e.g., genomic DNA molecule). In some embodiments, one or more of the RNA fragments comprises an extended nucleotide sequence comprising one or more intended nucleotide edits compared to the endogenous sequence of a target gene. The extended nucleotide sequence can further comprise a flap binding sequence at least partially complementary to the spacer and an editing template that comprises a region complementary to a target sequence.
[0048] Current approaches for the synthesis of moderate length or long RNAs include intracellular transcription of an exogenous plasmid or solid-phase synthesis using phosphoramidite chemistry. Chemical synthesis of moderate length or long RNAs is not desirable. For example, if the phosphoramidite chemistry being used has a coupling efficiency of ~0.99X(where X is the number of nucleotides), the overall synthesis process would be expected to yield approximately 30-40% full-length product (FLP) when synthesizing RNAs with lengths on the order of 100 nucleotides. Complete isolation of the FLP from the remaining side products formed from incomplete coupling (truncation products) and deprotection is not currently achievable forRNA molecules with lengths on the order of 100 nucleotides using standard purification methods (e.g., chromatography). Methods, compositions and kits disclosed herein are efficient in synthesizing long RNAs, improves the yield of full-length products, and decreases the number of truncation products as compared to the existing technologies. The methods disclosed herein can be used in synthesis of both unmodified long RNAs (e.g., a gRNA or tagRNA) and long RNAs comprising one or more chemical modifications, such as, a backbone modification (e.g., a phosphorothioate linkage) and / or a nucleoside modification (e.g., 2’-O-methylation).
[0049] In some embodiments, tagRNAs for use with an RT editor in RT editing system can be effectively synthesized using a splint-mediated ligation approach by ligating three or more RNA fragments using one or more splint DNA oligonucleotides, and one or more ligases. In some embodiments, the ligation comprises three RNA fragments, two splint DN oligonucleotides, and a ligase, wherein the first and second RNA fragments hybridize to the first splint DNA oligonucleotide and the second and third RNA fragments hybridize to the second splint DNA oligonucleotide to form a complex comprising a first ligation site and a second ligation site, respectively. In some embodiments, the tagRNA comprises a nucleotide sequence that is 5’ the first ligation site, a nucleotide sequence that is 3’ the first ligation site and 5’ the second ligation site, and a nucleotide sequence that is 3’ the second ligation site, wherein a first RNA fragment corresponds to the nucleotide sequence that is 5’ the first ligation site, a second RNA fragment corresponds to the nucleotide sequence that is 3’ the first ligation site and 5’ the second ligation site, and a third RNA fragment corresponds to the nucleotide sequence 3’ the second ligation site, wherein ligation at the first and second ligation sites enables joining of the first, second, and third RNA fragments to form the nucleotide sequence of the tagRNA.
[0050] In some embodiments, the first splint DNA oligonucleotide comprises a first portion complementary to a first RNA fragment at the terminal region including a 3’ hydroxyl group moiety and a second portion complimentary to a second RNA fragment at the terminal region including a 5’ phosphate moiety and has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having 1, 2 or 3 mismatches relative to SEQ ID NO: 4. The second splint DNA oligonucleotide comprises a first portion complementary to a second RNA fragment at the terminal region including a 3’ hydroxyl group and a second portion complimentary to a third RNA fragment at the terminal region including a 5’ phosphate moiety and has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having 1, 2 or 3 mismatches relative to SEQ ID NO: 5.
[0051] In the embodiments described herein, free tagRNA can be obtained without a DNase treatment. For example, the method (including the ligation reaction) does not comprise the use of a DNase and / or the method does not comprise adding a DNase into a ligation reaction mixture prior to or after the ligation reaction.
[0052] In some embodiments, the nucleotide sequence of a synthesized tagRNA comprises 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a target site in a nucleic acid molecule (e.g., genomic DNA molecule), a scaffold sequence that can bind to a RNA-guided endonuclease or the DNA binding domain of a RT editor, and an extended nucleotide sequence comprising one or more intended nucleotide edits compared to the endogenous sequence of the target site. The scaffold sequence can comprise from 5’ to 3’: a lower stem loop formed adjacent to the spacer sequence and one or more upper stem loops adjacent to the extended nucleotide sequence.
[0053] The two ligation sites are placed within the scaffold sequence of the synthesized tagRNA. In some embodiments, the first ligation site corresponds to a site within a lower stem loop formed adjacent to the spacer sequence (e.g., 5’ stem loop), optionally within the tetraloop of the stem loop. The second ligation site can correspond to a site within an upper stem loop, such as the loop portion of the stem loop (e.g., a 3’ stem loop). As described herein, placement of the ligation sites in a stem loop prevents formation of secondary structure in the RNA fragments (i.e., the RNA fragments joined at the ligation site) that would prevent or disfavor hybridization of the RNA fragments with a splint oligonucleotide. For example, disruption of a stem loop by a ligation site provides RNA fragments (i.e., RNA fragments joined at the ligation site) that have (i) minimal secondary structure; and / or (ii) secondary structure with free energy higher that is higher than the free energy resulting from hybridization of the RNA fragments and the splint oligonucleotide. Definition
[0054] As used herein, the term “about” means plus or minus 5% of the provided value.
[0055] As used herein, the term “long RNA” refers an RNA molecule with a length of at least 100 nucleotides. A long RNA can be or be about, at least, or at least about 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, or a number or a range between any two of these values, nucleotides in length. For example, a long RNA can be a RNA (e.g., a target priming RNA) of about 100 to 150 nucleotides in length, optionally the target priming RNA is about 110 to about 140 nucleotides in length.
[0056] As used herein, the term “RNA-guided endonuclease” refers to a polypeptide capable of binding a RNA (e.g., a gRNA) to form a complex targeted to a specific DNA sequence (e.g., in a target DNA). A non-limiting example of RNA-guided endonuclease is a Cas polypeptide (e.g., a Cas endonuclease, such as a Cas9 endonuclease). In some embodiments, the RNA-guided endonuclease as described herein is targeted to a specific DNA sequence in a target DNA by an RNA molecule to which it is bound. The RNA molecule can include a sequence that iscomplementary to and capable of hybridizing with a target sequence within the target DNA, thus allowing for targeting of the bound polypeptide to a specific location within the target DNA.
[0057] As used herein, the term “guide RNA” or “gRNA” refers to a site-specific targeting RNA that can bind an RNA-guided endonuclease to form a complex and direct the activities of the bound RNA-guided endonuclease (such as a Cas endonuclease) to a specific target sequence within a target nucleic acid. The guide RNA can include one or more RNA molecules.
[0058] As used herein, a “secondary structure” of a nucleic acid molecule (e.g., an RNA fragment, or a gRNA) refers to the base pairing interactions within the nucleic acid molecule.
[0059] As used herein, the term “target DNA” refers to a DNA that includes a “target site” or “target sequence.” The term “target sequence” is used herein to refer to a nucleic acid sequence present in a target DNA to which a DNA-targeting sequence or segment (also referred to herein as a “spacer”) of a gRNA can hybridize, provided sufficient conditions for hybridization exist. For example, the target sequence 5'-GAGCATATC-3' within a target DNA is targeted by (or is capable of hybridizing with, or is complementary to) the RNA sequence 5'-GAUAUGCUC- 3'. Hybridization between the DNA-targeting sequence or segment of a gRNA and the target sequence can, for example, be based on Watson-Crick base pairing rules, which enables programmability in the DNA-targeting sequence or segment. The DNA-targeting sequence or segment of a gRNA can be designed, for instance, to hybridize with any target sequence.
[0060] As used herein, the term “Cas endonuclease” or “Cas nuclease” refers to an RNA-guided DNA endonuclease associated with the CRISPR adaptive immunity system.
[0061] Unless otherwise indicated “nuclease” and “endonuclease” are used interchangeably herein to refer to an enzyme which possesses endonucleolytic catalytic activity for polynucleotide cleavage.
[0062] As used herein, the term “cleavage” refers to the breakage of the covalent backbone of a DNA molecule. The cleavage can be a single-stranded cleavage or a double- stranded cleavage. For example, a double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events.
[0063] As used herein, the term “domain” refers to a segment of a protein or a nucleic acid. Unless otherwise indicated, a domain need not have any specific functional property.
[0064] As used herein, the term “splint oligonucleotide” refers to an oligonucleotide that, when hybridized to other polynucleotides (e.g., RNA fragments), acts as a “splint” to position the ends of the polynucleotides next to one another so that they can be ligated together. The splint oligonucleotide can be any oligomer that can hybridize with the polynucleotides through Watson- Crick base-pairing interactions. The splint oligonucleotide can be DNA, RNA, non-natural, or artificial nucleic acids (e.g., peptide nucleic acids). The splint oligonucleotide can include anucleotide sequence that is partially complimentary to nucleotide sequences from two or more different oligonucleotides. In general, an RNA ligase, a DNA ligase, or another variety of ligase can be used to ligate two nucleotide sequences together. In some embodiments, the splint oligonucleotide is a DNA oligonucleotide that can be digested by DNase. In some embodiments, the splint oligonucleotide is an oligonucleotide susceptible to digestion by DNase. The splint oligonucleotide can include one or more modifications on one or more sugar moieties and / or one or more bases. In some embodiments, the splint oligonucleotide comprises one or more modified and / or non-natural bases.
[0065] As used herein, the “spacer” or “variable region” of a gRNA includes a nucleotide sequence that is complementary to a specific sequence within a target DNA (the complementary strand of the target DNA). In some aspects, the spacer confers target specificity to the gRNA combined with an RNA-guided endonuclease, enabling the RNA-guided endonuclease to cleave at the target site targeted by the spacer in the target DNA. As used herein, the term “spacer” is used interchangeably with the term “spacer sequence.”
[0066] As used herein, the term “invariable region” of a gRNA refers to the nucleotide sequence of the gRNA that associates with the RNA-guided endonuclease. In some embodiments, the gRNA comprises a crRNA and a transactivating crRNA (tracrRNA), wherein the crRNA and tracrRNA hybridize to each other to form a duplex. In some embodiments, the crRNA comprises 5’ to 3’: a spacer sequence and minimum CRISPR repeat sequence (also referred to as a “crRNA repeat sequence” herein); and the tracrRNA comprises a minimum tracrRNA sequence complementary to the minimum CRISPR repeat sequence (also referred to as a “tracrRNA anti- repeat sequence” herein) and a 3’ tracrRNA sequence. In some embodiments, the invariable region of the gRNA refers to the portion of the crRNA that is the minimum CRISPR repeat sequence and the tracrRNA.
[0067] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. A polynucleotide can be single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids / triple helices, or a polymer including purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.
[0068] As used herein, the term “binding” refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it means that the molecule X binds to molecule Y in a non-covalent manner). Binding interactions can be characterized by a dissociationconstant (Kd), for example a Kd of, or a Kd less than, 10-6M, 10-7M, 10-8M, 10-9M, 10-10M, 10-11M, 10-12M, 10-13M, 10-14M,10-15M, or a number or a range between any two of these values. Kd can be dependent on environmental conditions, e.g., pH and temperature. “Affinity” refers to the strength of binding, and increased binding affinity is correlated with a lower Kd.
[0069] As used herein, the term “hybridizing” or “hybridize” refers to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a substantially or fully complementary sequence through base pairing to form a hybridization complex. “Hybridizing” or “hybridize” can comprise denaturing the molecules to disrupt the intramolecular structure(s) (e.g., secondary structure(s)) in the molecule. In some embodiments, denaturing the molecules comprises heating a solution comprising the molecules to a temperature sufficient to disrupt the intramolecular structures of the molecules. In some instances, denaturing the molecules comprises adjusting the pH of a solution comprising the molecules to a pH sufficient to disrupt the intramolecular structures of the molecules. For purposes of hybridization, two nucleic acid sequences or segments of sequences are “substantially complementary” if at least 80% of their individual bases are complementary to one another. In some embodiments, a splint oligonucleotide sequence is not more than about 50% identical to one of the two polynucleotides (e.g., RNA fragments) to which it is designed to be complementary. The complementary portion of each sequence can be referred to herein as a ‘segment’, and the segments are substantially complementary if they have 80% or greater identity.
[0070] It is advantageous to obtain long RNAs in high purity, which is not only important for meeting regulatory requirements but also allows chemical modifications currently only used in short oligonucleotides (e.g., siRNAs and anti-sense RNAs) to be applied in long RNAs. Highly purified long RNAs can also allow the efficient production and use of RNA / DNA hybrids in gene editing (e.g., chRDNA (CRISPR hybrid RNA-DNA) and gRNA prodrugs. Methods, compositions and kits described herein can be used to synthesize and obtain highly purified long RNAs (e.g., long RNAs that are at least 80%, 85%, 90%, 95%, 99%, or more in purity). Splint Oligonucleotides
[0071] Disclosed herein include methods, compositions and kits for synthesizing RNAs, particularly long RNAs such as guide RNAs or target priming RNAs, using splint- mediated ligation of two or more RNA fragments. In some embodiments, the method comprises use of a splint-mediated ligation of two, three, or more (e.g., four, five, six, seven, or eight) RNA fragments using one or more splint oligonucleotide(s). The splint oligonucleotides can, forexample, hybridize to a first RNA fragment and a second RNA fragment to form a complex, which facilitates ligation of the first and second RNA fragments at a ligation site present between the RNA fragments. In some embodiments, the method comprises use of a splint-mediated ligation of two RNA fragments using one splint oligonucleotide (see e.g., FIG.1). In some embodiments, the method comprises use of a splint-mediated ligation of three RNA fragments using two splint oligonucleotides (see, for example, FIG.2A). In some embodiments, the method comprises use of a splint-mediated ligation of three RNA fragments using one splint oligonucleotide (see, for example, FIG.2B). In some embodiments, the method comprises use of a splint-mediated ligation of more than three RNA fragments (e.g., four, five, six, seven, or eight RNA fragments) using an appropriate number of splint oligonucleotides needed to ligate the RNA fragments.
[0072] In some embodiments, a splint oligonucleotide includes, for example, a first portion complementary to the first RNA fragment at the terminal region that includes a 3’ hydroxyl group. It further includes a second portion complimentary to the second RNA fragment at the terminal region comprising a 5’ phosphate moiety. The splint oligonucleotide can hybridize with the first RNA fragment and the second RNA fragment to form a complex. In the complex, the RNA fragments are positioned favorably for ligation at a ligation site present between the RNA fragments. A second splint oligonucleotide can be provided to hybridize with the second RNA fragment and a third fragment. The second splint oligonucleotide includes, for example, a first portion complementary to the second RNA fragment at the terminal region that includes a 3’ hydroxyl group. The second splint oligonucleotide further includes a second portion complimentary to the third RNA fragment at the terminal region comprising a 5’ phosphate moiety. The second splint oligonucleotide can therefore hybridize with the second RNA fragment and the third RNA fragment (see, for example, FIG.2A).
[0073] In some embodiments, a splint oligonucleotide includes, for example, a first portion complementary to the first RNA fragment at the terminal region that includes a 3’ hydroxyl group, a second portion complimentary to the second RNA fragment at the terminal region comprising a 5’ phosphate moiety, a third portion complementary to the second RNA fragment at the terminal region that includes a 3’ hydroxyl group, and a fourth portion complimentary to the third RNA fragment at the terminal region comprising a 5’ phosphate moiety. The splint oligonucleotide can hybridize with the first RNA fragment, the second RNA fragment, and the third RNA fragment to form a complex. In the complex, the RNA fragments are positioned favorably for ligation at two ligation sites present between the RNA fragments (see, for example, FIG.2B).
[0074] The splint oligonucleotide can include a sequence complementary to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between anytwo of these values, nucleotides, consecutively or non-consecutively, in the first RNA fragment at the terminal region that includes a 3’ hydroxyl moiety. The splint oligonucleotide can include a sequence complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or a number or a range between any two of these values, nucleotides, of the first RNA fragment, and where the nucleotides can be consecutive or non- consecutive. The splint oligonucleotide can include a sequence complementary to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between any two of these values, nucleotides, consecutively or non-consecutively, in the second RNA fragment at the terminal region comprising a 5’ phosphate group. The splint oligonucleotide may include a sequence complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or a number or a range between any two of these values, nucleotides, of the second RNA fragment, and where the nucleotides can be consecutive or non- consecutive. The length of the sequence in the splint oligonucleotide complementary to the first RNA fragment and the length of the sequence complementary to the second RNA fragment can be the same or can be different. In some embodiments, the length of the sequence in the splint oligonucleotide complementary to the first RNA fragment and the length of the sequence complementary to the second RNA fragment differ by, or by about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or a number or a range between any two of these values, nucleotides.
[0075] The splint oligonucleotide can further include a sequence complementary to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between any two of these values, nucleotides, consecutively or non-consecutively, in the second RNA fragment at the terminal region that includes a 3’ hydroxyl moiety. The splint oligonucleotide can further include a sequence complementary to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or a number or a range between any two of these values, nucleotides, consecutively or non-consecutively, in the third RNA fragment at the terminal region comprising a 5’ phosphate group.
[0076] A splint oligonucleotide can be designed to preferentially promote complex formation between the RNA fragments and the splint oligonucleotide over intramolecular structures (e.g., secondary structures) present in the RNA fragments and / or the splint oligonucleotide. Minimum free energy prediction algorithms can be used for designing suitable splint oligonucleotides provided by the methods of the present disclosure. In theory, the lower the free energy, the more likely the complex between the RNA fragments and the splint oligonucleotide will form. The minimum free energy structure of a sequence is the secondary structure that is calculated to have the lowest value of free energy (and thus most likely to form in theory). By way of example, minimum free energy prediction algorithms can be used to calculatethe free energy of the secondary structure(s) of an RNA fragment, which is represented by ΔGintra, and the free energy of the intermolecular hybridization between the RNA fragment and the splint oligonucleotide, which is represented by ΔGinter. In some embodiments, the Nearest-Neighbor approximations are used. The Tm of the secondary structure(s) of an RNA fragment is represented by Tm-intra. The melting temperature of the RNA fragment and splint oligonucleotide hybrid is represented by Tm-inter. The length of the splint oligonucleotide can be designed to ensure that ΔGintra is greater than ΔGinter, and / or Tm-inter is greater than Tm-intra. In instances where the first RNA fragment, the second RNA fragment, or both, comprises at least one secondary structure, hybridizing the first RNA fragment, the second RNA fragment, and the splint oligonucleotide results in a lower free energy than the free energy associated with one or more of the at least one secondary structure. Hybridizing the first RNA fragment, the second RNA fragment, and the splint oligonucleotide can also result in, for example, a lower free energy than that of the secondary structure with the lowest free energy (or the minimum free energy) of the first RNA fragment, the second RNA fragment, or both.
[0077] One or more splint oligonucleotides can be used to hybridize with the RNA fragments to mediate ligation of the RNA fragments. The number of splint oligonucleotide(s) used for mediating ligation can be fewer than the number of RNA fragments to be ligated. For example, the number of the splint oligonucleotide(s) used for mediating ligation can be one fewer than the number of RNA fragments to be ligated, i.e., if the number of RNA fragments to be ligated is n, the number of the splint oligonucleotide(s) can be n-1. In some embodiments, the number of the splint oligonucleotide(s) used for mediating ligation can be two few than the number of RNA fragments to be ligated, i.e., if the number of RNA fragments to be ligated is n (e.g., 3), the number of the splint oligonucleotide can be n-2 (e.g., 1).
[0078] The length of the splint oligonucleotide can vary. For example, the splint oligonucleotide can be, or be about, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, or a number or a range between any two of these values, nucleotides in length. In some embodiments, the splint oligonucleotides are at least 40 nucleotides in length. For example, the splint oligonucleotides are 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the splint oligonucleotides are no more than 32 nucleotides in length. For example, the splint oligonucleotides are 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 31, or 32 nucleotides in length. In some embodiments, the splint oligonucleotides are short oligonucleotides. Short splint oligonucleotides are equal to or greater than 27 and less than 32 nucleotides in length. For example, the splint oligonucleotides are 27, 28, 29, 30, 31 or 32 nucleotides in length. In some embodiments, the splint oligonucleotides are very short oligonucleotides. Very short splint oligonucleotides are equal to or greater than 10and less than 27 nucleotides in length. For example, the splint oligonucleotides are 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the splint oligonucleotides are about 15 to 26 nucleotides in length.
[0079] When the splint oligonucleotides are no more than 26 nucleotides in length (e.g., very short splint oligonucleotides), as described herein, the RNAs synthesized from the ligation reaction do not remain bound to one or more splint oligonucleotides (e.g., due to their low Tm values) so that no further process (e.g., enzymatic treatment) is needed to obtain free RNAs or RNAs in high purity. Examples of gRNA synthesis mediated by very short splint oligonucleotides demonstrate that very short splints mediated ligation can significantly improve the purity and yield of synthesized free RNAs (e.g., gRNAs) in large scale (e.g., 1mg–5 mg) without the need of DNase treatment (see e.g., Example 1). In these embodiments, since the integrity of the splint oligonucleotides are maintained, the splint oligonucleotides can be isolated and further purified from the synthesized RNAs and / or unreacted RNA fragments and recycled for a next ligation cycle. By recycling the splint oligonucleotides, the method herein described can provide an advantage in reducing cost and time required to prepare new splint oligonucleotides.
[0080] In some embodiments, the splint oligonucleotide(s) is designed with a length sufficient to obtain a complex formed by the RNA and the splint oligonucleotide(s) having a melting temperature (Tm) less than 60 ºC. For example, the Tm of the gRNA / splint DNA complex can be about, at most, or at most about 30ºC, 31ºC, 32ºC, 33ºC, 34ºC, 35ºC, 36ºC, 37ºC, 38ºC, 39ºC, 40ºC, 41ºC, 42ºC, 43ºC, 44ºC, 45ºC, 46ºC, 47ºC, 48ºC, 49ºC, 50ºC, 51ºC, 52ºC, 53ºC, 54ºC, 55ºC, 56ºC, 57ºC, 58ºC, 59ºC, 60ºC, or a number or a range between any two of these values. In some embodiments, the splint oligonucleotides are designed with a length sufficient to obtain a Tm of the gRNA and / or the splint DNA greater than the temperature the RNA fragment ligation reaction is carried out. For example, the Tm of the gRNA and / or the splint DNA can be about, at least, or at least about 15 ºC, 16 ºC, 17 ºC, 18 ºC, 19 ºC, 20 ºC, 21, 22 ºC, 23 ºC, 24 ºC, 25 ºC, 26 ºC, 27 ºC, 28 ºC, 29 ºC, 30 ºC, 31 ºC, 32 ºC, 33 ºC, or a number or a range between any two of these values. In some embodiments, the Tm of the formed gRNA and DNA heteroduplex is greater than 15 ºC and lower than 60 ºC. In some embodiments, the Tm of the formed gRNA and DNA heteroduplex is lower than 55 ºC, 50 ºC, 45 ºC, 40 ºC, 35 ºC or 30 ºC.
[0081] In some embodiments, a first splint DNA oligonucleotide comprising a first portion complementary to a first RNA fragment at the terminal region including a 3’ hydroxyl group moiety and a second portion complimentary to a second RNA fragment at the terminal region including a 5’ phosphate moiety has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having 1, 2 or 3 mismatches relative to SEQ ID NO: 4. A second splint DNA oligonucleotide comprising a first portion complementary to a second RNA fragment at theterminal region including a 3’ hydroxyl group and a second portion complimentary to a third RNA fragment at the terminal region including a 5’ phosphate moiety has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having 1, 2 or 3 mismatches relative to SEQ ID NO: 5.
[0082] In some embodiments, a single splint DNA oligonucleotide is used to ligate a first RNA fragment, a second RNA fragment, and a third RNA fragment. The splint DNA oligonucleotide comprising a first portion complementary to a first RNA fragment at the terminal region including a 3’ hydroxyl group moiety, a second portion complimentary to a second RNA fragment at the terminal region including a 5’ phosphate moiety, a third portion complementary to a second RNA fragment at the terminal region including a 3’ hydroxyl group, and a fourth portion complimentary to a third RNA fragment at the terminal region including a 5’ phosphate moiety has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having 1, 2 or 3 mismatches relative to SEQ ID NO: 39.
[0083] The splint oligonucleotide can be in a free form or be attached to a support. The splint oligonucleotide can be attached to the support using a variety of techniques. For example, the splint oligonucleotide can be directly attached to a support or immobilized to the support by chemical immobilization. For example, a chemical immobilization can take place between functional groups on the support and corresponding functional elements in the splint oligonucleotide. Such corresponding functional elements in the splint oligonucleotide can either be an inherent chemical group of the splint oligonucleotide, e.g., a hydroxyl group or be additionally introduced. An example of such a functional group is an amine group. In some embodiments, the splint oligonucleotide is immobilized includes a functional amine group or is chemically modified to include a functional amine group.
[0084] The location of the functional group within the splint oligonucleotide to be immobilized can be used to control and shape the binding behavior and / or orientation of the splint oligonucleotide, e.g., the functional group can be placed at the 5’ or 3’ end of the splint oligonucleotide or within the sequence of the splint oligonucleotide. A typical support for a splint oligonucleotide to be immobilized includes moieties which are capable of binding to such splint oligonucleotide, e.g., to amine-functionalized nucleic acids. Non-limiting examples of such supports include carboxy, aldehyde, and epoxy supports. Supports on which a splint oligonucleotide is immobilized can be chemically activated, e.g., by the activation of functional groups, available on the support. The term “activated substrate” relates to a material in which interacting or reactive chemical functional groups were established or enabled by chemical modification procedures. For example, a support including carboxyl groups can be activated before use. Furthermore, certain supports contain functional groups that can react with specific moieties already present in the splint oligonucleotide.
[0085] A covalent linkage used to couple a splint oligonucleotide to a support can be viewed as both a direct and indirect linkage, in that although the splint oligonucleotide is attached by a “direct” covalent bond, there can be a chemical moiety or linker separating the “first” nucleotide of the splint oligonucleotide from the support, i.e., an indirect linkage. In some embodiments, splint oligonucleotides that are immobilized to the support by a covalent bond and / or chemical linker are generally seen to be immobilized or attached directly to the support. A splint oligonucleotide may not bind directly to the support, but interacts indirectly, for example by binding to a molecule which itself binds directly or indirectly to the support. The splint oligonucleotide can also be indirectly attached to a support (e.g., via a solution including a polymer).
[0086] In embodiments where the splint oligonucleotide is immobilized on the support indirectly, e.g., via hybridization to a surface oligonucleotide capable of binding the splint oligonucleotide, the splint oligonucleotide can further include an upstream sequence (5’ to the sequence that hybridizes to the two or more RNA fragments as described herein) that is capable of hybridizing to the 5’ end of the surface oligonucleotide. The splint oligonucleotide can be, for example, attached to the support via its 5’ end or its 3’ end. The splint oligonucleotide attached to the support can be in situ synthesized on the support. Methods of Synthesizing RNAs
[0087] Methods of synthesizing a RNA can include providing two or more RNA fragments and one or more splint DNA oligonucleotides. In some embodiments, a method of synthesizing a RNA comprises providing a first RNA fragment, a second RNA fragment, and a splint DNA oligonucleotide. The first RNA fragment, the second RNA fragment, and the splint oligonucleotide are hybridized together to form a complex. Forming such a complex positions the first and second RNA fragments in close proximity to facilitate ligation. A ligase is used to ligate the first and second RNA fragments across the ligation site to obtain a RNA. In some embodiments, the method does not comprise the use of a nuclease (e.g., a DNase).
[0088] In some embodiments, the methods can be used to synthesize a long RNA, for example, a RNA having at least 100 nucleotides in length. The methods can comprise providing a first RNA fragment, a second RNA fragment, a third RNA fragment, a first splint DNA oligonucleotide, and a second DNA oligonucleotide. The first RNA fragment, the second RNA fragment, and the first splint oligonucleotide are hybridized together; and the second RNA fragment, the third RNA fragment, and the second splint oligonucleotides are hybridized together, thereby forming a complex comprising the first, second, and third RNA fragments, and the first and second splint DNA oligonucleotides. In some embodiments, the methods can compriseproviding a first RNA fragment, a second RNA fragment, a third RNA fragment, and a single splint DNA oligonucleotide. The first RNA fragment, the second RNA fragment, the third RNA fragment, and the splint oligonucleotide are hybridized together, thereby forming a complex comprising the first, second, and third RNA fragments, and the splint DNA oligonucleotide. Formation of the complex positions (i) a 3’ hydroxyl group of the first RNA fragment and a 5’ phosphate moiety of the second RNA fragment in close proximity to provide a first ligation site; and (ii) a 3’ hydroxyl group of the second RNA fragment and a 5’ phosphate moiety of the third RNA fragment in close proximity to provide a second ligation site. The method further comprises using a ligase to ligate the first and second RNA fragments at the first ligation site, and to ligate the second and third RNA fragments at the second ligation site.
[0089] In some embodiments, the one or more splint oligonucleotide(s) is no more than 27 nucleotides in length (e.g., very short splint oligonucleotides). In some embodiments, the method does not comprise using a DNase to digest the splint DNA oligonucleotide(s) (e.g., the first and / or second splint oligonucleotide(s)). For example, the method does not comprise a DNase treatment to digest the splint oligonucleotide(s) after ligation and before purification. The free RNAs and / or RNAs in high purity can be synthesized by using a ligase to ligate the first and second RNA fragments at the first ligation site, and to ligate the second and third RNA fragments at the second ligation site. In some embodiments, the RNAs synthesized from the ligation reaction can dissociate from the one or more splint oligonucleotides that mediate the ligation reaction. Therefore, the method does not comprise separating the RNAs (e.g., long RNAs) and the splint DNA oligonucleotides (e.g., via enzyme treatment). For example, the method does not comprise digesting the splint DNA oligonucleotide in the complex after the ligating step and before a purification step. In some embodiments, the ligation reaction does not comprise a DNase and / or the method does not comprise adding a DNase into a ligation reaction mixture prior to or after the ligation reaction.
[0090] When the splint oligonucleotide is no more than 27 nucleotides in length, even without the DNase treatment after the ligation reaction the method can still provide long RNAs in high purity, for example in a purity of, or a purity of about, or a purity at least about, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96%, 97%, 98%, 99%, 99.5%, 100%, or a number or a range between any two of these values. Purified long RNAs (e.g., gRNAs or tagRNAs) generated by the methods, compositions, and kits described herein can be, be about, or be at least about, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96%, 97%, 98%, 99%, 99.5%, 100%, or a number or a range between any two of these values. In some embodiments, the long RNAs (e.g., gRNAs or tagRNAs) can be provided at least 85%, 90%, 95%, or 98% in purity by these methods described herein.
[0091] Hybridizing the first RNA fragment, the second RNA fragment, and the splint DNA oligonucleotide can be performed in a solution. In some embodiments, the hybridizing further comprises a third RNA fragment, and optionally a second splint DNA oligonucleotide, which is performed in the solution. When hybridizing in solution, the concentration of the first RNA fragment can be, e.g., about the same as the concentration of the second RNA fragment. In some embodiments, wherein the hybridization further comprises a third RNA fragment, the concentration of the first RNA fragment and the second RNA fragment are each about the same to the concentration of the third RNA fragment. Depending upon the methods, fragments, and splint oligonucleotide(s) employed, the concentration of the splint oligonucleotide in the solution can be about the same as, more than, or less than, the concentration of the first RNA fragment in the solution, or a concentration of the second RNA fragment in the solution. For example, the concentration of the splint oligonucleotide, the first RNA fragment, and the second RNA fragment can be about equal. In some embodiments, the method comprises a first, second, and third RNA fragment, and a splint oligonucleotide, where the concentration of the splint oligonucleotide, the concentration of the first RNA fragment, the concentration of the second RNA fragment, and the concentration of the third RNA fragment in the solution are each about the same. In some embodiments, the method comprises a first, second, and third RNA fragment, and a first and second splint oligonucleotide, where the concentration of the first splint oligonucleotide, the concentration of the second splint oligonucleotide, the concentration of the first RNA fragment, the concentration of the second RNA fragment, and the concentration of the third RNA fragment in the solution are each about the same.
[0092] For hybridizing, in some embodiments, the RNA fragments and / or the splint oligonucleotide can be denatured, i.e., the intramolecular structures of the RNA fragments and / or the splint oligonucleotide are disrupted to allow for annealing between the RNA fragments and the splint oligonucleotide. Denaturing can be achieved, for example, by heating a solution containing the RNA fragments and the splint oligonucleotide to, to about, or to at least about, 37°C, 38°C, 39°C, 40°C, 42°C, 44°C, 46°C, 48°C, 50°C, 52°C, 54°C, 56°C, 58°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, or a number or a range between any two of these values. In some embodiments, hybridizing does not include heating the solution.
[0093] In some embodiments, hybridizing includes cooling the solution to a temperature of, or of about, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or a number or a range between any two of these values, after heating. For example, in some embodiments, hybridizing includes cooling the solution to about 37°C after heating. Hybridizing can include cooling the solution to a temperature at which a ligase used in the presently describedmethods retains ligase activity sufficient to ligate the first and second RNA fragments, and / or to a temperature below the melting temperature of the complex formed by the RNA fragments and the splint oligonucleotide upon hybridization. In instances where hybridizing does not comprise heating the solution, hybridizing can be carried out at a temperature that is lower than the melting temperature of the complex formed by the RNA fragments and the splint oligonucleotide upon hybridization. Depending on the specific method being performed, cooling the solution after heating can include reducing the temperature of the solution at a constant rate or at an uncontrolled rate.
[0094] The methods described herein include ligating the first and second RNA fragments using a ligase at a ligation site. Ligating can include ligating the 3’ hydroxyl group at the terminal region of the first RNA fragment with the 5’ phosphate group at the terminal region of the second RNA fragment. Catalyzed by the ligase, the 5’ phosphate group and the 3’ hydroxyl group can react to form a phosphodiester bond. A ligation site can be the site at which the phosphodiester bond between the 5’ phosphate group and the 3’ hydroxyl group is formed. In some embodiments, the methods comprise ligating a first RNA fragment and a second RNA fragment at a first ligation site, and ligating the second RNA fragment and a third RNA fragment at a second ligation site. In some embodiments, the ligating comprises ligation of a 3’ hydroxyl group at the terminus of the first RNA fragment with a 5’ phosphate at the terminus of the second RNA fragment; and ligation of a 3’ hydroxyl group at the terminus of the second RNA fragment and a 5’ phosphate at the terminus of the third RNA fragment, each ligation resulting in formation of a phosphodiester bond.
[0095] Ligating the first and second RNA fragments can be carried out at a suitable temperature, for example a temperature of, or of about, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44 °C, 45°C, or a number or a range between any two of these values. For example, ligating the first and second RNA fragments can be carried out at 37°C. Ligating the first and second RNA fragments can be carried out for various duration, for example, a duration of, or of about, 0.1, 0.2, 0.3, 0.4, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, or a number or a range between any two of these values hours. In some embodiments, the temperature and / or reaction time used for the splint-mediated ligation reaction is independent of the number of RNA fragments used in the reaction, for example, a reaction temperature and / or reaction time suitable for a splint-mediated ligation reaction comprising two RNA fragments is suitable for a splint-mediated ligation reaction comprising three or more RNA fragments.
[0096] In some embodiments, it can be advantageous to quench the ligation reactionfollowing synthesis of the gRNA. For example, a ligation reaction can be quenched using a protease or a chelating agent. Non-limiting examples of proteases include proteinase K. Non- limiting examples of chelating agents include EDTA and EGTA, or a combination of both.
[0097] In some embodiments, ligating the first and second RNA fragments further comprises using one or more crowding agents, including but not limited to, polyethylene glycol (PEG), Ficoll®, ethylene glycol, and dextran, or any combination thereof. In some embodiments, use of one or more crowding agents is suitable in a splint-mediated ligation reaction comprising two, three, or more RNA fragments. In some embodiments, hybridizing a first RNA fragment, a second RNA fragment and a splint DNA oligonucleotide is carried out in the presence of one or more RNase inhibitors. In some embodiments, ligating the first and second RNA fragments with a ligase at a ligation site present between the first and second RNA fragments is carried out in the presence of one or more RNase inhibitors. In some embodiments, hybridizing three or more RNA fragments and one or more splint DNA oligonucleotides is carried out in the presence of one or more RNase inhibitors. In some embodiments, ligating three or more RNA fragments with a ligase at two or more ligation sites is carried out in the presence of one or more RNase inhibitors. RNase inhibitors can be used to inhibit and control RNase contamination during the hybridization and / or ligation reaction. Any of a variety of RNase inhibitors known in the art can be used herein.
[0098] A variety of ligases can be used in the methods, compositions and kits described herein. For example, the ligase can comprise, or be, a T4 DNA ligase, T4 RNA ligase I, T4 RNA ligase II, RtcB ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, PBCV-1 DNA ligase, thermostable DNA ligase (e.g., 5'AppDNA / RNA ligase), an ATP dependent DNA ligase, or a combination thereof. Combinations of any two or more such ligases can be used in some embodiments. In some embodiments, the ligase is a T4 RNA ligase II or a variant thereof. For example, the T4 RNA ligase II can be truncated and / or comprise a mutation. For example, the T4 RNA ligase II can comprise a K227Q mutation and / or a R55K mutation. In some instances, the T4 RNA ligase II can be both truncated and have a K227Q and / or a R55K mutation. Also useful in the presently described methods is a PBCV-1 DNA ligase (i.e., Chlorella virus DNA ligase; SplintR®ligase). In some instances, the ligase can be a DNA ligase (e.g., a 9°N®DNA ligase).
[0099] In some embodiments, three or more (e.g., three, four or five) RNA fragments can be ligated to synthesize a long RNA. Ligation of the three or more RNA fragments can be carried out in the same step, or in separate steps (such as in a step-wise fashion).
[0100] Methods described herein can further include separating the splint oligonucleotide(s), isolating the long RNA, and / or purifying the long RNA after synthesis. The isolation / purification can separate the full-length RNA product from unreacted RNA fragments and / or splint oligonucleotides. The isolation / purification can include, for example, enzymaticallydegrading the unreacted RNA fragments, e.g., using an exonuclease, such as one specific for 5'- monophosphate-containing RNA. An exemplary exonuclease is XRN-1.
[0101] In some embodiments, the method does not comprise treating the splint oligonucleotide(s) with the DNase. Therefore, in some embodiments, the method described herein can comprise separating the splint oligonucleotide and the long RNA (e.g., gRNAs or tagRNAs) after ligating the RNA fragments (e.g., the first, second, and third RNA fragments). The separated splint oligonucleotides and / or the long RNAs can be isolated and / or purified. In these embodiments, since the splint oligonucleotides are not treated with any DNase, the integrity of the splint oligonucleotides are preserved. Therefore, in some embodiments, the method can include isolating and / or purifying the splint DNA oligonucleotide. The isolated and / or purified splint DNA oligonucleotide can be recycled and used for the next ligation reaction. Isolating and / or purifying the splint oligonucleotides can be carried out using any isolation and / or purification methods known in the art.
[0102] Purification of the full-length RNA product and / or splint oligonucleotides (e.g., from the unreacted RNA fragments) can be carried out using ultra-filtration or with chromatographic methods. Non-limiting examples of chromatographic methods include reversed- phase HPLC, ion-exchange chromatography (e.g., strong anion exchange HPLC or weak anion exchange HPLC), size exclusion chromatography, hydrophobic interaction chromatography, affinity chromatography, liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), capillary gel electrophoresis (CGE), polyacrylamide gel purification, or any combination thereof.
[0103] In some embodiments, the method does not comprise a DNase treatment after ligation and before purification, while still capable of providing a full-length free gRNA and / or full-length gRNA in high purity (e.g., at least 80%, 85%, 90%, 95%, or 98% in purity).
[0104] Also provided herein include methods of synthesizing a long RNA molecule that includes the invariable, scaffold sequence such as all or a portion of a tracrRNA sequence using the methods described herein. The RNA molecule can optionally be purified and used for generating a full-length gRNA (e.g., sgRNA). To generate a full-length sgRNA, three RNA fragments and one or two splint DNA oligonucleotides are provided. The first RNA fragment can comprise a spacer sequence that is complementary or substantially complementary to a target sequence in a target nucleic acid, a minimum CRISPR repeat sequence (e.g., crRNA), and optionally a tetraloop or a portion thereof, for example, in 5’ to 3’ order. The second RNA fragment can comprise the tetraloop (or a portion thereof), the tracrRNA repeat sequence, and a portion of the 3’ tracrRNA sequence (i.e., a portion that is 5’ to the second ligation site) of the sgRNA. The third RNA fragment can comprise a portion of the 3’ tracrRNA sequence (i.e., thatis 3’ to the second ligation site) of the sgRNA.
[0105] The first and second ligation site correspond to sites in the invariable region of the sgRNA. In some embodiments, the first ligation site corresponds to a site in the duplex formed between a crRNA repeat sequence and a tracrRNA anti-repeat sequence. In some embodiments, the first ligation site is in the crRNA repeat sequence, in a tetraloop joining the crRNA repeat sequence and the tracRNA anti-repeat sequence, or in the tracrRNA anti-repeat sequence. In some embodiments, the second ligation site corresponds to a site in the first stem loop, the second stem loop, or the third stem loop of the 3’ tracrRNA. In some embodiments, the second ligation site corresponds to a site in the second stem loop. In some embodiments, the second ligation site corresponds to a site in the 5’ stem of the second stem loop, a site in the tetraloop of the second stem loop, or a site in the 3’ stem of the second stem loop.
[0106] In some embodiments, the synthesized gRNA comprises 5’ to 3’: a crRNA and a tracrRNA, wherein the crRNA and tracrRNA hybridize to form a duplex. In some embodiments, the crRNA comprises a spacer sequence capable of targeting a target sequence in a target nucleic acid (e.g., genomic DNA molecule) and a crRNA repeat sequence. In some embodiments, the tracrRNA comprises a tracrRNA anti-repeat sequence and a 3’ tracrRNA sequence. In some embodiments, the 3’ end of the crRNA repeat sequence is linked to the 5’ end of the tracrRNA anti-repeat sequence, e.g., by a tetraloop, wherein the crRNA repeat sequence and the tracrRNA anti-repeat sequence hybridize to form the sgRNA. In some embodiments, the sgRNA comprises 5’ to 3’: a spacer sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA anti-repeat sequence, and a 3’ tracrRNA sequence. In some embodiments, the sgRNA comprise a 5’ spacer extension sequence. In some embodiments, the sgRNA comprise a 3’ tracrRNA extension sequence. The 3’ tracrRNA can comprise, or consist of, one or more stem loops, for example one, two, three, or more stem loops.
[0107] These methods can, for example, produce full-length gRNAs specific for any target DNA sequence by ligating an RNA fragment containing the corresponding spacer sequence onto the previously synthesized RNA molecule comprising all or a portion of the tracrRNA sequence. For example, the second and third RNA fragments are ligated first, using a splint oligonucleotide, to form an invariable RNA construct that includes a portion of a tracrRNA sequence. This RNA product can, for example, be isolated, purified and / or stored for later use. Another RNA fragment (i.e., the first RNA fragment) that includes a sequence complementary to a specific target DNA can then be combined with the previously synthesized RNA construct to form a full-length gRNA.RNA Fragments
[0108] Method of synthesizing RNAs as described herein can include providing at least two RNA fragments, a first RNA fragment comprising a terminal region that includes a 3’ hydroxyl group and a second RNA fragment comprising a terminal region that includes a 5’ phosphate moiety, and at least one splint DNA oligonucleotide, where a RNA is synthesized by ligating the first and second RNA fragments (FIG. 1). In some embodiments, the method of synthesizing RNAs does not comprise digesting the splint DNA oligonucleotide (e.g., using a DNase) after the ligation step.
[0109] When synthesizing a gRNA, the first RNA fragment, the second RNA fragment, or both, can include at least a portion of a sequence that can bind to an RNA-guided endonuclease. An exemplary gRNA can comprise, from 5’ to 3’, the first RNA fragment followed by the second RNA fragment. The first RNA fragment may not include a 5’ phosphate moiety. The 5’ phosphate moiety can be, e.g., a 5’-phosphate or a 5’-phosphorothioate. The first fragment, the second RNA fragment, or both, can include a sequence or a portion of a sequence that is complementary to a sequence in a target DNA. In some instances, the first RNA fragment comprises a sequence that is complementary to a sequence in a target DNA. The second RNA fragment comprises a sequence that can bind to an RNA-guided endonuclease or a portion or a variant thereof.
[0110] In some embodiments, to synthesize a long RNA (e.g., a target priming RNA or a gRNA with an extension sequence, e.g., at the 3’ end of the gRNA), at least a third RNA fragment and optionally a second DNA oligonucleotide can be provided. FIGs. 2A-B is a non- limiting schematic diagram showing the ligation of three RNA fragments using two splint oligonucleotides (FIG. 2A) and one splint oligonucleotide (FIG. 2B). As shown in FIGs. 2A-B, for an RNA synthesized by ligating RNA fragments I, II and III, prior to ligation, RNA fragment I can include a 3’ hydroxyl group and may or may not include a 5’ phosphate moiety, RNA fragment II can include both a 3’ hydroxyl group and a 5’ phosphate moiety, and RNA fragment III can include a 5’ phosphate moiety and may or may not include a 3’ hydroxyl group. Ligating RNA fragments I, II, and III can include formation of a phosphodiester bond between the 3’ hydroxyl group of RNA fragment I and the 5’ phosphate moiety of RNA fragment II, and a phosphodiester bond between the 3’ hydroxyl group of B and the 5’ phosphate moiety of RNA fragment III.
[0111] The length of the RNA fragments (e.g., the first, the second and the third RNA fragments) can vary. For example, the RNA fragment can be, or can be about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or a number or a range of any two of these values, nucleotides in length. For example, the length of the first, second, and third RNA fragments canbe, for example, 25 to 70 nucleotides, each. In some embodiments, the first RNA fragment and the third RNA fragment are each independently about 20 to 40 nucleotides in length (e.g., about 20, 25, 30, 35, 40, or a number or a range of any two of these values nucleotides in length). In some embodiments, the second RNA fragment is about 45 to about 65 nucleotides in length (e.g., about 45, 50, 55, 60, 65, or a number or a range of any two of these values nucleotides in length). In some embodiments, the second RNA fragments is in a length greater than that of the first and second RNA fragments.
[0112] A RNA fragment can include one or more secondary structures. The secondary structure of a RNA molecule (e.g., a RNA fragment or a full-length RNA product) can include stems and loops, or combination thereof. Non-limiting examples of secondary structures of an RNA molecule include stem loops, hairpin, hairpin loops, tetraloops, internal loops, bulges, pseudoknots, and cloverleaf. In some instances, an RNA fragment does not include any secondary structures (e.g., stem loops). The RNA synthesized by the methods provided herein can include one or more secondary structures, such as but not limited to, one or more stem loop structures, formed upon ligation of the RNA fragments. In some instances, the ligation site present between the RNA fragments correspond to a site in a secondary structure (e.g., a stem loop structure) in the synthesized RNA. The ligation site can correspond to a site in a portion of the secondary structure, including but not limited to, a tetraloop portion, a loop portion, or a helix portion of a stem loop structure. The method disclosed herein can include predicting the secondary structure(s) of an RNA fragment and / or the free energy associated with the secondary structure(s), based on the sequence of the RNA fragment. Modifications in RNA Fragments
[0113] A RNA fragment can include one or more modifications. For example, the RNA fragment can include one or more modifications in the RNA backbone. Non-limiting examples of backbone modifications include: 2’ methoxy (2’OMe), 2’ fluorine (2’fluoro), 2’-O- methoxy-ethyl (MOE), locked nucleic acids (LNA), unlocked nucleic acids (UNA), bridged nucleic acids, 2’ deoxynucleic acids (DNA), and peptide nucleic acids (PNA). Alternatively or additionally, the RNA fragment can include one or more base modifications. Non-limiting examples of base modifications include: 2-aminopurine, hypoxanthine, thymine, 2,6- diaminopurine, 2-pyrimidone, and 5-methyl cytosine. In some embodiments, a RNA fragment comprises at least one phosphorothioate linkage.
[0114] Modifications in the RNA fragment can be used to, for example, enhance stability, reduce the likelihood or degree of innate immune response, and / or enhance other attributes; and new types of modifications are regularly being developed. Non-limiting examplesof modification include one or more nucleotides modified at the 2’ position of the sugar, such as but not limited to, a 2'-O-alkyl, 2'-O-alkyl-O-alkyl, or 2'-fluoro-modified nucleotide. DNA (2’deoxy-) nucleotide substitutions are also contemplated. Non-limiting examples of RNA modifications also include 2'-fluoro, 2'-amino, 2' O-methyl modifications on the ribose of pyrimidines, and basic residues or an inverted base at the 3' end of the RNA. Such modifications can be incorporated into oligonucleotides, and these oligonucleotides have been shown to have a higher Tm (e.g., higher target binding affinity) than 2'-deoxy oligonucleotides against a given target. In some embodiments, the modification of an RNA fragment disclosed herein comprises a 2’O-methyl modification of one or more nucleosides in the RNA fragment.
[0115] The RNA fragment can include one or more modifications that increase resistance to nuclease digestion as compared to the native nucleic acid. In some embodiments, the modified nucleic acid comprises a modified backbone selected from, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages, and short chain heteroatomic or heterocyclic intersugar linkages. The nucleic acid can have a phosphorothioate backbone or a heteroatom backbone, e.g., CH2-NH-O-CH2, CH,- N(CH3)-O-CH2 (known as a methylene(methylimino) or MMI backbone), CH2-O-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)-CH2 -CH2 backbones; amide backbones; morpholino backbone structures; peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone. Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’. In some embodiments, the modification of the RNA fragment comprises one or more phosphorotioate linkages.
[0116] The RNA fragment can have a backbone that does not include a phosphorus atom, e.g., backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methyleneformacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts.
[0117] The RNA fragment can comprise one or more substituted sugar moieties including, one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3, OCH3O(CH2)nCH3, O(CH2)n NH2, or O(CH2)n CH3, where n is from 1 to 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3 ; OCF3; O-, S-, or N- alkyl; O-, S-, or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. For example, a modification can include 2’ methoxyethoxy (2’-O-CH2CH2OCH3, also known as 2’-O-(2-methoxyethyl)). Other modifications include 2'-methoxy (2'-O-CH3), 2'-propoxy (2'-OCH2CH2CH3) and 2'-fluoro (2'- F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group. In some instances, both a sugar and an internucleoside linkage, e.g., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a PNA. In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. The RNA fragment can include 2’-O-thionocarbamates MP (2'-O- methyl-3'-phosphonoacetate) and / or MSP (O-methyl-3'-thiophosphonoacetate).
[0118] The RNA fragment can include one or more modifications selected from pseudouridine, N1-methylpseudouridine, and 5-methoxyuridine. For example, one or more N1- methylpseudouridines can be incorporated into the RNA fragment to provide enhanced RNA stability and reduced immunogenicity in animal cells, such as mammalian cells (e.g., cells of human and mice). N1-methylpseudouridine modifications can also be incorporated in combination with one or more 5-methylcytidines.
[0119] The RNA fragment can include modifications designed to bypass innate antiviral responses and / or to reduce innate immune stimulation. For example, the RNA can be an enzymatically synthesized RNA incorporating 5'-Methylcytidine-5'-triphosphate (5-methyl-CTP), N6-methyl-ATP, pseudo-UTP, 2-thio-UTP, pseudoUTP, an Anti-Reverse Cap Analog (ARCA), or a combination thereof. The RNA fragment can include one or more modifications to enhance RNA stability, reduce innate immune responses, and / or achieve other benefits. Mimetics
[0120] The RNA fragment can be a nucleic acid mimetic. The term “mimetic” as it is applied to polynucleotides is intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups. Replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. In some embodiments, the RNA fragment is a PNA.
[0121] The RNA fragment can be a polynucleotide mimetic based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. Morpholino-based polynucleotides are nonionic mimics of oligonucleotides, which are less likely to form undesired interactions with cellular proteins. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.
[0122] The RNA fragment can be a polynucleotide mimetic referred to as cyclohexenyl nucleic acid (GeNA), where the furanose ring normally present in a DNA / RNA molecule is replaced with a cydohexenyl ring. GeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry.
[0123] The RNA fragment can be or comprise a locked nucleic acid (LNA), in which the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring, forming a 2'-C,4'-C- oxymethylene linkage, thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2. LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm= +3 to +10°C), stability towards 3'-exonucleolytic degradation, and good solubility properties.Modified sugar moieties
[0124] An RNA fragment can include one or more substituted sugar moieties including, for example, a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S- , or N-alkenyl; O-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO)mCH3, O(CH2)nOCH3, O(CHz)nNH2, O(CH2)CH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other RNA fragments include a suitable sugar substituent group selected from: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modification includes 2'-methoxyethoxy 2'-O-CH2-CH2OCH3, also known as -2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al. (1995) Helv. Chim. Acta, 78(2):486-504) e.g., an alkoxyalkoxy group. A further suitable modification includes 2'-dimethylaminooxyethoxy, e.g., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples herein below, and 2' dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy- ethyl or 2' DMAEOE), e.g., 2'-O-CH2-O-CH2-N(CH3)2.
[0125] Other suitable sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-O-CH2CH2CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-O-CH2-CH=CH2) and fluoro (F).2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Base modifications and Substitutions
[0126] The RNA fragment can include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC,as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine and 2,6-diaminopurine. A “universal” base known in the art, e.g., hypoxanthine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are embodiments of base substitutions.
[0127] Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other a-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0128] The RNA fragment can include nucleobases for increasing the binding affinity. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and -O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 oc.
[0129] The RNA fragment can comprise nucleobase modifications or substitutions may not have all positions uniformly modified. For example, an RNA fragment can have a modification incorporated in a single nucleoside. Synthesis of RNA Fragments and Splint Oligonucleotides
[0130] The RNA fragments and splint oligonucleotides provided by the present disclosure can be synthesized by any method suitable for oligonucleotide synthesis described herein or known in the art. Non-limiting examples include enzymatic synthesis and chemical synthesis (e.g., phosphoramidite chemistry). Methods of synthesizing RNA from a DNA template are known in the art. For example, the RNA fragments and splint oligonucleotides can be synthesized in vitro using an RNA polymerase enzyme (e.g., T7 polymerase, T3 polymerase, SP6 polymerase, etc.). Solid-phase synthesis using phosphoramidite chemistry involves assembling monomers of protected 2’-deoxynucleosides (dA, dC, dG, and T), ribonucleoside (A, C, G, and U), or chemically modified nucleosides, e.g., LNA or BNA. The monomers are sequentially coupled to the growing oligonucleotide chain in the order required by the sequence of the product.Upon the completion of the chain assembly, the product is released from the solid phase to solution, deprotected, and collected.
[0131] The RNA fragments and splint oligonucleotides can be synthesized in a 5’ to 3’ direction or a 3’ to 5’ direction. In some instances, the second RNA fragment is synthesized in a 5’ to 3’ direction. The synthesized RNA fragments and splint oligonucleotides may be purified prior to ligation in accordance with known methods in the art, such as, but not limited to: high- performance liquid chromatography (HPLC), reversed-phase HPLC, ion-exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, affinity chromatography, and polyacrylamide gel purification. Guide RNA (gRNA)
[0132] An exemplary long RNA synthesized using any of the methods described herein can be an be a guide RNA (gRNA). A gRNA can be a single gRNA (sgRNA). A gRNA can comprise a CRISPR RNA (crRNA) or a trans-activating crRNA (tracrRNA). A gRNA provides target specificity by virtue of its association with the RNA-guided endonuclease, and thus directs the activity of the RNA-guided endonuclease. RNAs of the present disclosure can be synthesized from two or more RNA molecules (termed RNA fragments) using one or more splints. An exemplary double-molecule gRNA comprises a crRNA and a transactivating crRNA (tracrRNA), and the crRNA and tracrRNA hybridize to each other to form a duplex. A double- molecule gRNA can also be a duplex of two crRNAs. The gRNA duplex can bind a RNA-guided endonuclease such that the gRNA and the RNA-guided endonuclease form a complex. A crRNA comprises both a spacer sequence capable of hybridizing to a target nucleic acid sequence of interest and a crRNA repeat sequence. TracrRNAs can be in any form (e.g., full-length tracrRNAs or active partial tracrRNAs) and of varying lengths. For example, a tracrRNA may comprise or consist of all or a portion of a wild-type tracrRNA sequence (e.g., about or at least 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include the 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. As an example, the crRNA can have, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, and a minimum CRISPR repeat sequence. The tracrRNA can have a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence, and an optional tracrRNA extension sequence. The optional tracrRNA extension may have elements that contribute additional functionality (e.g., stability) to the gRNA, and can have one or more hairpin structures. The crRNA and the tracrRNA hybridize through the minimum CRISPR repeat sequence and the minimum tracrRNA sequence to form a gRNA.
[0133] An exemplary sgRNA comprises a nucleotide sequence that is complementary to a sequence in a target DNA, and a nucleotide sequence that can bind to an RNA-guided endonuclease. As an example, an sgRNA can have, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence, and an optional tracrRNA extension sequence. In some instances, an sgRNA can have, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. In some embodiments, the single-molecule guide linker is a tetraloop.
[0134] A CRISPR repeat sequence can include any sequence that has sufficient complementarity with a tracr sequence to promote one or more of: (1) excision of a DNA targeting segment flanked by CRISPR repeat sequences in a cell containing the corresponding tracr sequence; and (2) formation of a CRISPR complex at a target sequence, wherein the CRISPR complex includes the CRISPR repeat sequence hybridized to the tracr sequence. In general, degree of complementarity is with reference to the optimal alignment of the CRISPR repeat sequence and tracr sequence, along the length of the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm and may further account for secondary structures, such as self-complementarity within either the tracr sequence or CRISPR repeat sequence. In some instances, the degree of complementarity between the tracr sequence and CRISPR repeat sequence along the 30 nucleotides length of the shorter of the two when optimally aligned is about or more than 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. The tracr sequence can be, or be about, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, 18, 19, 20, 25, 30, 40, 50, or a number or a range between any two of these values, nucleotides in length.
[0135] The spacer of a gRNA includes a nucleotide sequence that is complementary to a sequence in a target DNA. In other words, the spacer of a gRNA interacts with a target DNA in a sequence-specific manner via hybridization (e.g., base pairing). As such, the nucleotide sequence of the spacer may vary and determines the location within the target DNA that the gRNA and the target DNA will interact. The spacer of a gRNA can be selected to hybridize to any desired sequence within a target DNA.
[0136] The spacer can have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or a number or a range between any two of these values, nucleotides. For example, the spacer can have a length of from 13 to 25 nucleotides, from 15 to 23 nucleotides, from 18 to 22 nucleotides, or from 20 to 22 nucleotides.
[0137] The percent sequence complementarity between the spacer of a gRNA and a target sequence of a target DNA can be, e.g., at least about 60% (such as at least about any of65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%).
[0138] The length of the gRNA synthesized by the methods described herein can be from 30 to 160 nucleotides, including 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, or a number or a range between any two of these values, nucleotides. The gRNA synthesized by the methods described herein can include a spacer. In some embodiments, the gRNA includes a sequence that is complementary to a sequence in a target DNA, including but not limited to, a target mammalian DNA. For example, the target DNA can be human DNA. Template armed guide RNA (tagRNA) and Reverse Transcriptase Editing System
[0139] Another exemplary long RNA synthesized using any of the methods described herein can be an be a template armed guide RNA or a target priming RNA, referred as tagRNA, which together with a reverse transcriptase editor can be used in a reverse transcriptase editing system.
[0140] A reverse transcriptase editing system, also referred to as “RT editing system”, corrects a mutation using reverse transcriptase editing, and comprises a reverse transcriptase (RT) editor or an mRNA encoding the RT editor and a long guide RNA designed as “tagRNA”. The RT editing system induces programmable editing of a target DNA using an RT editor complexed with a tagRNA to incorporate an intended nucleotide edit (i.e., a nucleotide change) into the target DNA. The system can further comprise a second guide RNA designated as “egRNA” (opposite strand gRNA).
[0141] The term “tagRNA” refers to a guide polynucleotide that comprises one or more intended nucleotide edits for incorporation into the target DNA. A tagRNA associates with and directs a RT editor to incorporate the one or more intended nucleotide edits into the target gene via RT editing. A tagRNA typically comprises a spacer sequence region, an invariable scaffold sequence region, and an extended nucleotide sequence region comprising an editing template. “Intended nucleotide edit” refers to a specified deletion of one or more nucleotides at one specific position, insertion of one or more nucleotides at one specific position, substitution of a single nucleotide, or other alterations at one specific position to be incorporated into the sequence of the target gene. Intended nucleotide edit may refer to the edit on the editing template as compared to the sequence on the target strand of the target gene or may refer to the edit encoded by the editing template on the newly synthesized single stranded DNA that replaces the editing target sequence, as compared to the editing target sequence.
[0142] In some embodiments, a tagRNA comprises a spacer sequence that is complementary or substantially complementary to a search target sequence on a target strand ofthe target gene. The spacer sequence anneals with the target strand at the search target sequence. The target strand may also be referred to as the “non-Protospacer Adjacent Motif (non-PAM strand).” In some embodiments, the non-target strand may also be referred to as the “PAM strand.” In some embodiments, the PAM strand comprises a protospacer sequence and optionally a protospacer adjacent motif (PAM) sequence. In RT editing using a Cas-protein-based RT editor, a PAM sequence refers to a short DNA sequence immediately adjacent to the protospacer sequence on the PAM strand of the target gene. A PAM sequence may be specifically recognized by a programmable DNA binding protein, e.g., a Cas nickase or a Cas nuclease. In some embodiments, a specific PAM is characteristic of a specific programmable DNA binding protein, e.g., a Cas nickase or a Cas nuclease. A protospacer sequence refers to a specific sequence in the PAM strand of the target gene that is complementary to the search target sequence. In a tagRNA, a spacer sequence may have a substantially identical sequence as the protospacer sequence on the edit strand of a target gene, except that the spacer sequence may comprise Uracil (U) and the protospacer sequence may comprise Thymine (T).
[0143] In some embodiments, the double-stranded target DNA comprises a nick site on the PAM strand (or non-target strand). As used herein, a “nick site" refers to a specific position in between two nucleotides or two base pairs of the double stranded target DNA. In some embodiments, the position of a nick site is determined relative to the position of a specific PAM sequence. In some embodiments, the nick site is the particular position where a nick will occur when the double stranded target DNA is contacted with a nickase, for example, a Cas nickase, that recognizes a specific PAM sequence. In some embodiments, the nick site is upstream of a specific PAM sequence on the PAM strand of the double stranded target DNA. In some embodiments, the nick site is downstream of a specific PAM sequence on the PAM strand of the double stranded target DNA. In some embodiments, the nick site is upstream of a PAM sequence recognized by a Cas9 nickase, wherein the Cas9 nickase comprises a nuclease active RuvC domain and a nuclease inactive HNH domain. In some embodiments, the nick site is 3 nucleotides upstream of the PAM sequence, and the PAM sequence is recognized by a Streptococcus pyogenes Cas9 nickase.
[0144] In some embodiments, the nick site is 3 base pairs upstream of the PAM sequence, and the PAM sequence is recognized by a Cas9 nickase, wherein the Cas9 nickase comprises a nuclease active HNH domain and a nuclease inactive RuvC domain. In some embodiments, the nick site is 2 nucleotides upstream of the PAM sequence, and the PAM sequence is recognized by a S. thermophilus Cas9 nickase that comprises a nuclease active RuvC domain and a nuclease inactive HNH domain. In some embodiments, the Cas nick site is 4, 5, 6 or more than 6 nucleotides base pairs upstream of the PAM sequence and the PAM sequence is recognized by a Cas9 nickase wherein the Cas9 nickase comprises a nuclease active HNH domain and anuclease inactive RuvC domain.
[0145] In some embodiments, the tagRNA comprises a scaffold sequence that associates with a DNA binding domain, e.g., a CRISPR-Cas protein domain of a RT editor. The scaffold sequence (also referred to as a gRNA core, a gRNA scaffold, or gRNA backbone sequence) of a tagRNA may contain a polynucleotide sequence that binds to a DNA binding domain (e.g., Cas9) of a RT editor. The scaffold sequence may interact with a RT editor as described herein, for example, by association with a DNA binding domain, such as a DNA nickase of the RT editor. Different scaffold sequences can bind to different DNA binding proteins, and therefore to different DNA binding domains of different RT editors. In some embodiments, the scaffold sequence is capable of binding to a Cas9-based RT editor. In some embodiments, the scaffold sequence is capable of binding to a Cpfl -based RT editor. In some embodiments, the scaffold sequence is capable of binding to a Casl2b-based RT editor.
[0146] In some embodiments, the scaffold sequence comprises regions and secondary structures involved in binding with specific CRISPR Cas proteins. For example, in a Cas9 based RT editing system, the scaffold sequence of a tagRNA may comprise one or more regions of a base paired “lower stem” adjacent to the spacer sequence and a base paired “upper stem” following the lower stem, where the lower stem and upper stem may be connected by a “bulge” comprising unpaired RNAs. The scaffold sequence may further comprise a “nexus” distal from the spacer sequence, followed by a hairpin structure, e.g., at the 3’ end. In some embodiments, the scaffold sequence comprises modified nucleotides as compared to a wild type gRNA core in the lower stem, upper stem, and / or the hairpin. For example, nucleotides in the lower stem, upper stem, an / or the hairpin regions may be modified, deleted, or replaced. In some embodiments, RNA nucleotides in the lower stem, upper stem, and / or the hairpin regions may be replaced with one or more DNA sequences. In some embodiments, the scaffold sequence comprises unmodified or wild type RNA sequences in the nexus and / or the bulge regions.
[0147] In some embodiments, the tagRNA further comprises an extended nucleotide sequence comprising one or more intended nucleotide edits compared to the endogenous sequence of the target gene, wherein the extended nucleotide sequence may be referred to as an extension arm. The extended nucleotide sequence can comprise a flap binding sequence and an editing template.
[0148] A “flap binding (FB) sequence” is a single-stranded portion of the tagRNA that comprises a region of complementarity to the PAM strand (i.e., the non-target strand or the edit strand). The FB sequence is complementary or substantially complementary to a sequence on the PAM strand of the double stranded target DNA that is immediately upstream of the nick site. In some embodiments, in the process of RT editing, the tagRNA complexes with and directs a RTeditor to bind the search target sequence on the target strand of the double stranded target DNA and the RT editor generates a nick at the nick site on the non-target strand (e.g., the PAM strand) of the double stranded target DNA. In some embodiments, the FB sequence is complementary to or substantially complementary to, and can anneal to, a free 3' end on the non-target strand of the double stranded target DNA at the nick site. In some embodiments, the FB sequence annealed to the free 3' end on the non-target strand can initiate target-primed DNA synthesis. In some embodiments, the FB sequence is about 2 to 20 base pairs in length. In some embodiments, the FB sequence is about 8 to 16 base pairs in length.
[0149] An “editing template” of a tagRNA is a single-stranded portion of the tagRNA that is 5' of the FB sequence and comprises a region of complementarity to the PAM strand (i.e., the non-target strand or the edit strand), and comprises one or more intended nucleotide edits compared to the endogenous sequence of the double stranded target DNA. In some embodiments, the editing template and the FB sequence are immediately adjacent to each other. Accordingly, in some embodiments, a tagRNA in RT editing comprises a single-stranded portion that comprises the editing template sequence and the FB sequence immediately adjacent to each other. In some embodiments, the single stranded portion of the tagRNA comprising both the editing template sequence and the flap binding sequence is complementary or substantially complementary to an endogenous sequence on the PAM strand (i.e., the non-target strand or the edit strand) of the double stranded target DNA except for one or more non-complementary nucleotides at the intended nucleotide edit positions. As used herein, regardless of relative 5 -3' positioning in other contexts, the relative positions as between the FB sequence and the editing template, and the relative positions as among elements of a tagRNA, are determined by the 5' to 3' order of the tagRNA as a single molecule regardless of the position of sequences in the double stranded target DNA that may have complementarity or identity to elements of the tagRNA. In some embodiments, the editing template is complementary or substantially complementary to a sequence on the PAM strand that is immediately downstream of the nick site, except for one or more non-complementary nucleotides at the intended nucleotide edit positions. The endogenous, e.g., genomic, sequence that is complementary or substantially complementary to the editing template, except for the one or more non-complementary nucleotides at the position corresponding to the intended nucleotide edit, may be referred to as an “editing target sequence." In some embodiments, the editing template has identity or substantial identity to a sequence on the target strand that is complementary to, or having the same position in the genome as, the editing target sequence, except for one or more insertions, deletions, or substitutions at the intended nucleotide edit positions. In some embodiments, the editing template encodes a single stranded DNA, wherein the single stranded DNA has identity or substantial identity to the editing target sequenceexcept for one or more insertions, deletions, or substitutions at the positions of the one or more intended nucleotide edits.
[0150] A tagRNA may also comprise optional modifiers, e.g., 3’ end modifier region and / or an 5' end modifier region. In some embodiments, a tagRNA comprises at least one nucleotide that is not part of a spacer, a scaffold sequence, or an extension arm. The optional sequence modifiers can be positioned within or between any of the other regions of the tagRNA, and not limited to being located at the 3' and 5' ends. In some embodiments, the tagRNA comprises secondary RNA structure, such as, but not limited to, aptamers, hairpins, stem / loops, toeloops, and / or RNA-binding protein recruitment domains (e.g., the MS2 aptamer which recruits and binds to the MS2cp protein). In some embodiments, a tagRNA comprises a short stretch of uracil at the 5’ end or the 3’ end. For example, in some embodiments, a tagRNA comprising a 3’ extension arm comprises a “UUU” sequence at the 3’ end of the extension arm. In some embodiments, a tagRNA comprises a toeloop sequence at the 3’ end. In some embodiments, the tagRNA comprises a 3’ extension arm and a toeloop sequence at the 3’ end of the extension arm. In some embodiments, the tagRNA comprises a 5’ extension arm and a toeloop sequence at the 5’ end of the extension arm. In some embodiments, the tagRNA comprises a toeloop element having the sequence S’-GAAANNNNN-3’, wherein N is any nucleobase. In some embodiments, the secondary RNA structure is positioned within the spacer. In some embodiments, the secondary structure is positioned within the extension arm. In some embodiments, the secondary structure is positioned within the gRNA core. In some embodiments, the secondary structure is positioned between the spacer and the gRNA core, between the gRNA core and the extension arm, or between the spacer and the extension arm. In some embodiments, the secondary structure is positioned between the FB sequence and the editing template. In some embodiments, the secondary structure is positioned at the 3’ end or at the 5’ end of the tagRNA. In some embodiments, the tagRNA comprises a transcriptional lamination signal at the 3' end of the tagRNA. In addition to secondary RNA structures, the tagRNA may comprise a chemical linker or a poly(N) linker or tail, where “N” can be any nucleobase. In some embodiments, the chemical linker may function to prevent reverse transcription of the gRNA core.
[0151] Additional description about the RT editing system and the tagRNAs can be found, for example, in International Patent Application No. PCT / IB2025 / 052079, the content of which is incorporated herein by reference in its entirety. Modifications in the long RNAs
[0152] Long RNAs (e.g., gRNA or tagRNA) synthesized using the methods described herein can include one or more modifications useful for e.g., tracking, increasing stability,targeting the RNA to a particular subcellular location, or reducing immunogenicity. In some embodiments, modifications of RNAs can be used to enhance the formation or stability of a DNA- editing complex comprising a gRNA and an RNA-guided endonuclease (e.g., a Cas9 endonuclease or a Cas9 nickase). Modifications of gRNAs can also or alternatively be used to enhance the initiation, stability, or kinetics of interactions between a DNA-editing complex and a target sequence in a target DNA, which can be used, for example, to enhance on-target activity. Modifications of RNAs can also or alternatively be used to enhance specificity, e.g., the relative rates of DNA editing at an on-target site as compared to effects at other (off-target) sites. Modifications can also or alternatively be used to increase the stability of an RNA, e.g., by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thereby causing its half-life in the cell to be increased.
[0153] The long RNAs can include a segment at either the 5' or 3' end that provides for any of the features described above. For example, a suitable segment can include a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (e.g., a hairpin)); a sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.); a modification or sequence that provides for responses to light or radiation (e.g., UV, vis, IR optogenetic elements); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like); a modification or sequence that provides for increased, decreased, and / or controllable stability; and combinations thereof.
[0154] The long RNAs can include a modification that decreases the likelihood or degree to which the RNA, when introduced into a cell, elicits an innate immune response. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small-interfering RNAs (siRNAs), as described below and in the art, tend to be associated with reduced half-life of the RNA and / or the elicitation of cytokines or other factors associated with immune responses. The long RNAs can include one or more modifications selected from modifications that enhance the stability of the RNA (such as by decreasing its degradation by RNases, e.g., in the context of a cell) and modifications that decrease the likelihood or degree to which the RNA, when introduced into a cell, elicits an innate immune response. Combinations of modifications, such as the foregoing and others, can likewise be used.
[0155] In some embodiments, a long RNA such as a tagRNA may be modified in one or more ways to improve their overall stability and / or performance in RT editing. The tagRNA can comprise 3’ mN*mN*mN*N and 5’ mN*mN*mN* modifications, where m indicates that the nucleotide contains a 2’-O-Me modification and a * indicates the presence of a phosphorothioate bond. The tagRNA can comprise a structural motif at the 3’ terminus selected from the group consisting of: a prequeosine1-1 riboswitch aptamer (evopreQ1) and variants thereof, a frameshifting pseudoknot from Moloney murine leukemia virus (MMLV) (mpknot), G- quadruplexes, hairpin structures, xrRNA, and a P4-P6 domain of the group I intron. In some embodiments, the evopreQ1 is trimmed (TevopreQ1). In some embodiments, appending one or more RNA structural motifs to a tagRNA can protect against degradation of the tagRNA. In some embodiments, appending one or more RNA structural motifs to a tagRNA can result in improved properties, including but not limited to, increased stability and cellular lifespan, and improved binding affinity for a RT editor.
[0156] In some embodiments, a tagRNA can include a nucleic acid moiety at the 3’ end of the tagRNA. Optionally, the 3′ end of the tagRNA is fused to the nucleic acid moiety through a nucleotide linker. In general, the nucleic acid moieties that may be used to modify a tagRNA, for example, by attaching it to the 3′ end of a tagRNA, may include any nucleic acid moiety, including, for instance, a nucleic acid molecule comprising or forming a double-helix moiety, toeloop moiety, hairpin moiety, stem-loop moiety, pseudoknot moiety, aptamer moiety, G quadraplex moiety, tRNA moiety, or a ribozyme moiety. The nucleic acid moiety may be characterized as forming a secondary nucleic acid structure, a tertiary nucleic acid structure, or a quadruple nucleic acid structure. In other words, the nucleic acid moiety may form any two- dimensional or three-dimensional structure known to be formed by such structures. The nucleic acid moiety may be DNA or RNA. Stability Control Sequence
[0157] The long RNAs can include a stability control sequence that influences the stability of the RNA. A non-limiting example of a suitable stability control sequence is a transcriptional terminator segment (e.g., a transcription termination sequence). A transcriptional terminator segment of an RNA can have a total length of from about 10 nucleotides to about 100 nucleotides, for example 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or a number or a range between any two of these values, nucleotides in length.
[0158] The transcription termination sequence can be one that is functional in a eukaryotic cell, a prokaryotic cell, or both. Nucleotide sequences that can be included in a stability control sequence (e.g., transcriptional termination segment, or in any segment of the RNA to provide for increased stability) include, for example, a Rho-independent trp termination site.Conjugates
[0159] The long RNAs can include a modification involving chemically linking to the RNA one or more moieties or conjugates which enhance the activity, cellular distribution, or cellular uptake of the RNA. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Suitable conjugate groups include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a nucleic acid.
[0160] The long RNAs can include a chemically linked conjugate moieties including, but not limited to, lipid moieties such as a cholesterol moiety; cholic acid; a thioether, e.g., hexyl- S-tritylthiol; a thiocholesterol; an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g. di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac- glycero-3-H phosphonate, a polyamine or a polyethylene glycol chain; adamantane acetic acid; a palmityl moiety; or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety.
[0161] The long RNAs can include a chemically linked conjugate including a “Protein Transduction Domain” or PTD (also known as a cell penetrating peptide, or CPP), which may refer to a polypeptide, polynucleotide, carbohydrate, or organic or inorganic compound that facilitates traversing a lipid bilayer, micelle, cell membrane, organelle membrane, or vesicle membrane. A PTD attached to another molecule, which can range from a small polar molecule to a large macromolecule and / or a nanoparticle, facilitates the molecule traversing a membrane, for example going from extracellular space to intracellular space, or cytosol to within an organelle. A PTD can be covalently linked to a gRNA. Exemplary PTDs include, but are not limited to, a minimal undecapeptide protein transduction domain (corresponding to residues 47-57 of HIV-1 TAT); a polyarginine sequence comprising a number of arginines sufficient to direct entry into a cell (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or 10-50 arginines); a VP22 domain; a Drosophila antennapedia protein transduction domain; a truncated human calcitonin peptide; and polylysine. The PTD can be an activatable CPP (ACPP) which includes a polycationic CPP (e.g., Arg9 or “R9”) connected via a cleavable linker to a matching polyanion (e.g., Glu9 or “E9”), which reduces the net charge to nearly zero and thereby inhibits adhesion and uptake into cells. Upon cleavage of the linker, thepolyanion is released, locally unmasking the polyarginine and its inherent adhesiveness, thus “activating” the ACPP to traverse the membrane. The PTD can be chemically modified to increase the bioavailability of the PTD.
[0162] The long RNAs can include an applied conjugate that can enhance its delivery and / or uptake by cells, including, for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers, and aptamers. RNA-Guided Endonucleases
[0163] As described herein, one or more of the first RNA fragment, the second RNA fragment, the third RNA fragment can comprise at least a portion of a sequence that can bind to an RNA-guided endonuclease or a derivative or a variant thereof. The RNA-guided endonuclease can be naturally-occurring or non-naturally occurring. Non-limiting Examples of RNA-guided endonuclease include a Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonuclease, and functional derivatives thereof. In some instances, the RNA-guided endonuclease is a Cas9 endonuclease. The Cas9 endonuclease can be from, e.g., Streptococcus pyogenes (SpyCas9), Staphylococcus lugdunensis (SluCas9), or Staphylococcus aureus (SaCas9). In some embodiments, the RNA-guided endonuclease is a variant of Cas9, including but not limited to, a small Cas9, a dead Cas9 (dCas9), and a Cas9 nickase.
[0164] The RNA-guided endonuclease can be a small RNA-guided endonuclease. The small RNA-guided endonucleases can be engineered from portions of RNA-guided endonucleases derived from any of the RNA-guided endonucleases described herein and known in the art. The small RNA-guided endonucleases can be, e.g., small Cas endonucleases. In some cases, a small RNA-guided nuclease is shorter than about 1,100 amino acids in length.
[0165] The RNA-guided endonuclease can be a mutant RNA-guided endonuclease. For example, the RNA-guided endonuclease can be a mutant of a naturally occurring RNA-guided endonuclease. The mutant RNA-guided endonuclease can also be a mutant RNA-guided endonuclease with altered activity compared to a naturally occurring RNA-guided endonuclease, such as altered endonuclease activity (e.g., altered or abrogated DNA endonuclease activity without substantially diminished binding affinity to DNA). Such modification can allow for the sequence-specific DNA targeting of the mutant RNA-guided endonuclease for the purpose of transcriptional modulation (e.g., activation or repression); epigenetic modification or chromatin modification by methylation, demethylation, acetylation or deacetylation, or any othermodifications of DNA binding and / or DNA-modifying proteins known in the art. In some embodiments, the mutant RNA-guided endonuclease has no DNA endonuclease activity.
[0166] The RNA-guided endonuclease can be a nickase that cleaves the complementary strand of the target DNA but has reduced ability to cleave the non-complementary strand of the target DNA, or that cleaves the non-complementary strand of the target DNA but has reduced ability to cleave the complementary strand of the target DNA. In some embodiments, the RNA-guided endonuclease has a reduced ability to cleave both the complementary and the non- complementary strands of the target DNA. Reverse Transcriptase Editor (RT editor)
[0167] RNA fragments and splint DNA oligonucleotides described herein can be used to synthesize a long RNA such as a tagRNA that, together with a reverse transcriptase (RT) editor, can be used in a reverse transcriptase editing system to correct a mutation in a target DNA. The one or more of the first, second and third RNA fragments can comprise at least a portion of a sequence that can bind to a DNA-binding domain of the RT editor.
[0168] The term “RT editor” refers to the polypeptide or polypeptide components involved in RT editing, or any polynucleotide(s) encoding the polypeptide or polypeptide components. In various embodiments, a RT editor includes a polypeptide domain having DNA binding activity and a polypeptide domain having DNA polymerase activity. In some embodiments, the RT editor further comprises a polypeptide domain having nuclease activity. In some embodiments, the polypeptide domain having DNA binding activity comprises a nuclease domain or nuclease activity. In some embodiments, the polypeptide domain having nuclease activity comprises a nickase, or a fully active nuclease. As used herein, the term “nickase” refers to a nuclease capable of cleaving only one strand of a double-stranded DNA target. In some embodiments, the RT editor comprises a polypeptide domain that is an inactive nuclease. In some embodiments, the RT editor comprises a Cas nickase that can bind to the target gene in a sequence- specific manner and generate a single-strand break at a protospacer within double-stranded DNA in the target gene, but not a double-strand break. In some embodiments, a RT editor comprises a Cas nickase comprising two nuclease domains (e.g., Cas9), with one of the two nuclease domains modified to lack catalytic activity or deleted. In some embodiments, the Cas nickase of a RT editor comprises a nuclease inactive RuvC domain and a nuclease active HNH domain. In some embodiments, the Cas nickase of a RT editor comprises a nuclease inactive HNH domain and a nuclease active RuvC domain. In some embodiments, the polypeptide domain having programmable DNA binding activity comprises a nucleic acid guided DNA binding domain, for example, a CRISPR-Cas protein, for example, a Cas9 nickase, a Cpfl nickase, or another CRISPR-Cas nuclease. In some embodiments, the Cas protein domain of a RT editor is a Class 2 Cas protein. In some embodiments, the Cas protein domain is a type II Cas protein. In some embodiments, the Cas protein domain is a Cas9 protein, a modified version of a Cas9 protein, a Cas9 protein homolog, mutant, variant, or a functional fragment thereof.
[0169] The DNA polymerase domain in a RT editor may be a wild-type DNA polymerase domain, a full-length DNA polymerase protein domain, or may be a functional mutant, a functional variant, or a functional fragment thereof. In some embodiments, the polypeptide domain having DNA polymerase activity comprises a template-dependent DNA polymerase, for example, a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase. In some embodiments, the DNA polymerase is a reverse transcriptase. A RT can be a virus RT, for example, a retrovirus RT. Nonlimiting examples of virus RT include Moloney murine leukemia virus (M-MLV or MLVRT or M-MLV RT); human T-cell leukemia virus type 1 (HTLV-l) RT; bovine leukemia virus (BLV) RT; Rous Sarcoma Virus (RSV) RT; human immunodeficiency virus (HIV) RT, M-MFV RT, Avian Sarcoma-Leukosis Virus (ASLV) RT, Rous Sarcoma Virus (RSV) RT, Avian Myeloblastosis Virus (AMV) RT, Avian Erythroblastosis Virus (AEV) Helper Virus MCAV RT, Avian Myelocytomatosis Virus MC29 Helper Virus MCAV RT, Avian Reticuloendotheliosis Virus (REV-T) Helper Virus REV-A RT, Avian Sarcoma Virus UR2 Helper Virus (LJR2AV) RT, Avian Sarcoma Virus ¥73 Helper Virus YAV RT, Rous Associated Virus (RAV) RT, and Myeloblastosis Associated Virus (MAV) RT.
[0170] In some embodiments, the RT editor comprises additional polypeptides involved in RT editing, for example, a polypeptide domain having a 5’ endonuclease activity, e.g., a 5’ endogenous DNA flap endonucleases (e.g., FEN1), for helping to drive the RT editing process towards the edited product formation. In some embodiments, the RT editor further comprises an RNA-protein recruitment polypeptide, for example, a MS2 coat protein.
[0171] A RT editor may be engineered. In some embodiments, the polynucleotide or polypeptide components of a RT editor do not naturally occur in the same organism or cellular environment. In some embodiments, the polynucleotide or polypeptide components of a RT editor may be of different origins or from different organisms. In some embodiments, a RT editor comprises a DNA binding domain and a DNA polymerase domain that are derived from different species. In some embodiments, a RT editor comprises a Cas polypeptide (DNA binding domain) and a reverse transcriptase polypeptide (DNA polymerase) that are derived from different species.
[0172] In some embodiments, polypeptide domains of a RT editor may be fused or linked by a peptide linker to form a fusion protein. In other embodiments, a RT editor comprises one or more polypeptide domains provided in trans as separate proteins, which are capable of being associated to each other through non-peptide linkages or through aptamers or recruitmentsequences. For example, a RT editor may comprise a DNA binding domain and a reverse transcriptase domain associated with each other by an RNA-protein recruitment aptamer, e.g., an MS2 aptamer, which may be linked to a tagRNA. RT editor polypeptide components may be encoded by one or more polynucleotides in whole or in part, in some embodiments, a single polynucleotide, construct, or vector encodes the RT editor fusion protein. In some embodiments, multiple polynucleotides, constructs, or vectors each encode a polypeptide domain or portion of a domain of a RT editor, or a portion of a RT editor fusion protein. For example, a RT editor fusion protein may comprise an N-terminal portion fused to an intein-N and a C-terminal portion fused to an intein-C, each of which is individually encoded by an AAV vector.
[0173] Additional description about the RT editor can be found, for example, in International Patent Application No. PCT / IB2025 / 052079, the content of which is incorporated herein by reference in its entirety. Methods of Synthesizing Template Armed gRNA (tagRNA)
[0174] Provided herein also include methods for synthesizing a long RNA (e.g., tagRNA) for use with a RT editor. The RT editor can comprise, for example, a Cas protein domain (e.g., a Cas9 nickase) and a reverse transcriptase.
[0175] In some embodiments, the synthesized tagRNA comprise 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target nucleic acid (e.g., genomic DNA molecule), a scaffold sequence comprising a sequence capable of binding to a RNA-guided endonuclease or a DNA binding domain (e.g., Cas9) of the RT editor, and an extended nucleotide sequence comprising one or more intended nucleotide edits compared to the endogenous sequence of the target DNA. The scaffold sequence can comprise a lower stem loop adjacent to the spacer sequence and one or more upper stem loops adjacent to an extended nucleotide sequence. The extended nucleotide sequence can comprise an editing template complementary to a target sequence and a flap binding sequence at least partially complementary to the spacer sequence.
[0176] The method can comprise synthesizing a tagRNA using a splint-mediated ligation approach comprising three RNA fragments and one or two splint oligonucleotides. In some embodiments, the method comprises providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) a first splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; and (ii) a secondportion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, wherein the first splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 4; and (e) a second splint DNA oligonucleotide comprises (i) a first portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (ii) a second portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the second splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 5; and (f) a ligase.
[0177] In some embodiments, the method comprises providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, and (d) a splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, (iii) a third portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (iv) a fourth portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 39; and (e) a ligase.
[0178] The method further comprises hybridizing the first, second, and third RNA fragments and the splint DNA oligonucleotide(s) to form a complex having a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment; and ligating the first and second RNA fragments at the first ligation site and the second and third RNA fragments at the second ligation site using the ligase to synthesize a long RNA comprising from 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target DNA, a scaffold sequence capable of binding to an RNA-guided endonuclease or a DNA binding domain, and an extended sequence region comprising one or more intended nucleotide edits compared to the sequence of the target DNA, wherein the first and second ligation sites correspond to sites in the scaffold sequence of the RNA.
[0179] In some embodiments, DNase treatment is not conducted in a method ofsynthesizing the tagRNA herein described. For example, in some embodiments, the splint oligonucleotide(s) is no more than 27 nucleotides in length (e.g., very short splint oligonucleotides) and the method does not comprise using a DNase to digest the one or more splint DNA oligonucleotide(s). For example, the method does not comprise a DNase treatment after the ligation step and before purification. In some embodiments, the sgRNAs synthesized from the ligation reaction can dissociate from the one or more splint oligonucleotides that mediate the ligation reaction. Therefore, the method does not comprise separating the tagRNAs and the splint DNA oligonucleotides (e.g., via enzyme treatment). For example, the method does not comprise digesting the splint DNA oligonucleotide in the complex after the ligating step and before a purification step.
[0180] In some embodiments, the ligation forming a tagRNA can be carried out at a suitable temperature, for example, a temperature of, or of about, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44 °C, 45°C, or a number or a range between any two of these values. For example, ligating the first and second RNA fragments can be carried out at 37°C.
[0181] In some embodiments, the ligation forming a tagRNA can be carried out at a temperature lower than 60 ºC, optionally, lower than 55 ºC, 50 ºC, 45 ºC, 40 ºC or 35 ºC. For example, when the one or more splint oligonucleotide(s) used to ligate the RNA fragments is no more than 32 nucleotides in length (e.g., no more than 26 nucleotides in length), ligating the RNA fragments can be carried out at a temperature lower than 60 ºC, optionally, lower than 55 ºC , 50 ºC, 45 ºC, 40 ºC or 35 ºC. In some embodiments, ligating two or more RNA fragments can be carried out at about 15 ºC to about 33 ºC. In some embodiments, ligating the RNA fragments can be carried out at about, at least, at least about, at most or at most about 15 ºC, 16 ºC, 17 ºC, 18 ºC, 19 ºC, 20 ºC, 21, 22 ºC, 23 ºC, 24 ºC, 25 ºC, 26 ºC, 27 ºC, 28 ºC, 29 ºC, 30 ºC, 31 ºC , 32 ºC, 33 ºC, or a number or a range between any two of these values. For example, the ligation can be carried out at about 15 ºC, 20 ºC, 22 ºC, 24 ºC, 27 ºC, 30 ºC, or 33 ºC.
[0182] The ligation forming a tagRNA can be carried out for various duration, for example, a duration of, or of about, 0.1, 0.2, 0.3, 0.4, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, or a number or a range between any two of these values, hours. In some embodiments, ligating two or more RNA fragments can be carried out for several hours, for example, a duration of, or of about, 3, 4, 5, 6, 7, 8, 9, 10 or a number or a range between any two of these values, hours. In some embodiments, ligating two or more RNA fragments is carried out for about 6 hours.
[0183] In some embodiments, the temperature and / or reaction time used for the splint-mediated ligation reaction is independent of the number of RNA fragments used in the reaction, for example, a reaction temperature and / or reaction time suitable for a splint-mediated ligation reaction comprising two RNA fragments is suitable for a splint-mediated ligation reaction comprising three or more RNA fragments.
[0184] In some embodiments, the method can include separating the splint oligonucleotides and / or the tagRNAs after ligating the RNA fragments. The separated splint oligonucleotides and / or the tagRNAs can be isolated and / or purified in accordance to any method known in the art such as ultra-filtration and chromatographic methods.
[0185] In the embodiments, even without the DNase treatment after the ligation reaction the method can provide tagRNAs in a purity of, or a purity of about, or a purity at least about, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96%, 97%, 98%, 99%, 99.5%, 100%, or a number or a range between any two of these values.
[0186] In some embodiments, the first and second ligation sites correspond to sites in the invariable, scaffold sequence region of a tagRNA. The scaffold sequence region of a tagRNA can comprise one or more region of a base paired lower stem adjacent to the spacer sequence and a base paired upper stem proximal to the 3’ end of the tagRNA, where the lower stem and the upper stem may be connected by a bulge comprising unpaired RNAs.
[0187] In some embodiments, the first ligation site corresponds to a site in the lower stem loop adjacent to the spacer sequence in a tagRNA, which corresponds to the duplex formed between a crRNA repeat sequence and a tracrRNA anti-repeat sequence in a sgRNA. In some embodiments, the first ligation site is in the tetraloop portion of the lower stem loop, which corresponds to the tetraloop joining the crRNA repeat sequence and the tracRNA anti-repeat sequence in a sgRNA.
[0188] In some embodiments, the second ligation site corresponds to a site in an upper stem loop in the tagRNA, which can correspond to a site in the 3’ tracrRNA sequence of a sgRNA. In some embodiments, the second ligation site corresponds to a site in the loop portion of a stem loop adjacent to the 3’ extended sequence region.
[0189] In some embodiments, the first RNA fragment comprises the nucleotide sequence of the tagRNA that is 5’ the first ligation site; the second RNA fragment comprises the nucleotide sequence of the sgRNA that is 3’ the first ligation site and 5’ the second ligation site; and the third RNA fragment comprises the nucleotide sequence of the tagRNA that is 3’ the second ligation site.
[0190] In some embodiments, the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35. The second RNA fragment comprises (1) a nucleotide sequence of SEQ ID NO:36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; and / or (2) a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37. The third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38.
[0191] In some embodiments, the first RNA fragment comprises 5’ to 3’: the spacer sequence, and a terminal region comprising a 3’ hydroxyl group. The 3’ terminal region of the first RNA fragment can comprise a portion of the scaffold sequence of the tagRNA which can, for example, include a 5’ stem arm and the tetraloop (or a portion thereof) of the lower stem loop. The spacer sequence of a tagRNA includes a nucleotide sequence that is complementary or substantially complementary to a sequence in a target DNA. As such, the nucleotide sequence of the spacer may vary and determines the location within the target DNA that the tagRNA and the target DNA interact. The spacer of a tagRNA can be selected to hybridize to any desired sequence within a target DNA. The percent sequence complementarity between the spacer of a tagRNA and a target sequence of a target DNA can be, e.g., at least about 60% (such as at least about any of 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%). The spacer can have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or a number or a range between any two of these values, nucleotides. For example, the spacer can have a length of from 13 to 25 nucleotides, from 15 to 23 nucleotides, from 18 to 22 nucleotides, or from 20 to 22 nucleotides. The 3’ terminal region of the first RNA fragment can comprise a nucleotide sequence that is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or a number or a range between any two of these values, nucleotides in length. For example, the 3’ terminal region of the first RNA fragment can comprise a nucleotide sequence that is about 6 to 15 nucleotides in length. In some embodiments, the 3’ terminal region of the first RNA fragment extends from the 3’ terminus of the first RNA fragment to the 3’ terminus of the spacer sequence (e.g., wherein the 5’ terminus of the spacer sequence is aligned with the 5’ terminus of the first RNA fragment). In some embodiments, the terminal region of first RNA fragment extends from the 3’terminus of the first RNA fragment to include the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides that are present at the 3’end of the spacer sequence. In some embodiments, the first portion of the first splint oligonucleotide (or the first portion of the single splint oligonucleotide) is perfectly complementary to the terminal region of the first RNA fragment. In some embodiments, the first portion of the first splint oligonucleotide (or the first portion of the single splint oligonucleotide) has 1, 2, or 3 mismatches relative to the terminal region of first RNA fragment.
[0192] In some embodiments, the second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxylgroup. The second RNA fragment can comprise a portion of the scaffold sequence of the tagRNA. In some embodiments, the second RNA fragment comprises a portion of the tetraloop of the lower stem loop, the 3’ stem arm of the lower stem loop, one or more bulge, and one or more upper stem loops (one or two stem loops) or a portion thereof. In some embodiments, the 5’ terminal region of the second RNA fragment, which is complementary to the second portion of the first splint oligonucleotide (or the second portion of the single oligonucleotide), comprises a nucleotide sequence that is about, at least, at least about, at most, or at most about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides in length. In some embodiments, the second portion of the first splint oligonucleotide (or the second portion of the single splint oligonucleotide) is perfectly complementary to the 5’ terminal region of the second RNA fragment, or has 1, 2, or 3 mismatches relative to the 5’ terminal region of the second RNA fragment. In some embodiments, the 3’ terminal region of the second RNA fragment, which is complementary to the first portion of the second splint oligonucleotide (or the third portion of the single splint oligonucleotide), comprises a nucleotide sequence that is about, at least, at least about, at most, or at most about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the first portion of the second splint oligonucleotide (or the third portion of the single splint oligonucleotide) is perfectly complementary to the 3’ terminal region of the second RNA fragment, or has 1, 2, or 3 mismatches relative to the 3’ terminal region of the second RNA fragment.
[0193] The third RNA fragment can comprise a terminal region comprising a 5’ phosphate moiety. The third RNA fragment can comprise a portion of the 3’ scaffold sequence (i.e., that is 3’ to the second ligation site) of the tagRNA. In some embodiments, the 5’ terminal region of the third RNA fragment, which is complementary to the second portion of the second splint oligonucleotide (or the fourth portion of the single splint oligonucleotide), comprises a nucleotide sequence that is about, at least, at least about, at most, or at most about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the second portion of the second splint oligonucleotide (or the fourth portion of the single splint oligonucleotide) is perfectly complementary to the 5’ terminal region of the third RNA fragment, or has 1, 2, or 3 mismatches relative to the 5’ terminal region of the third RNA fragment. The third RNA fragment can also comprise an extended sequence region at the 3’ terminal. The extended region comprises one or more intended nucleotide edits compared to the sequence of the target DNA. Similar to the spacer sequence, the nucleotide sequence of the extended sequence region can vary, depending on the location within the target DNA and the intended nucleotide edits to be incorporated into the sequence of the target DNA. The length of extended region can also vary in different embodiments. In some embodiments, the extended sequence region can have a length ofabout, at least, at least about, at most, at most about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or a number or a range between any two of these values, nucleotides. For example, the extended sequence region can have a length of from 13 to 30 nucleotides, from 15 to 28 nucleotides, from 18 to 27 nucleotides, or from 20 to 25 nucleotides.
[0194] In some embodiments, the tagRNA synthesized using the methods described herein comprises an invariable, scaffold sequence flanked by two variable sequences. The variable sequence at the 5’ of the tagRNA comprises a spacer sequence that can be varied to hybridize to any desired sequence within a target DNA. The variable sequence at the 3’ of the tagRNA comprises an extended sequence region comprising a sequence that can also be varied to at least be partially complementary to the spacer sequence. The extended sequence can also comprise one or more intended nucleotide edits such as deletions, insertions or alterations at one or more specific positions to be incorporated into the sequence of the target DNA.
[0195] The invariable, scaffold sequence is about 60, 65, 70, 75, 80, 85, 90, 95, 100, or a number or a range between any two of these values, nucleotides in length. For example, the scaffold sequence can have a length of from about 65 to about 90 nucleotides, from about 75 to about 85 nucleotides. In some embodiments, the scaffold sequence of the tagRNA comprises 5’ to 3’: a portion (e.g., 3’ terminal region) of the first RNA fragment, the second RN fragment, and a portion (e.g., 5’ terminal region) of the third RNA fragment. The scaffold sequence of the tagRNA can comprise an invariable sequence comprising the nucleotide sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 7), or a nucleotide sequence having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide deletions, insertions, or substitutions relative to SEQ ID NO: 7. In some embodiments, the tagRNA is for use with a RT editor comprising a SpyCas9 domain.
[0196] In some embodiments, the scaffold sequence of the tagRNA resembles the invariable sequence region of a sgRNA. For example, the 3’ terminal region of the first RNA fragment can comprise a sequence region corresponding to the crRNA repeat sequence and a tetraloop (or a portion thereof) of a sgRNA. The second RNA fragment can comprise sequence regions corresponding to a portion of the tetraloop, a tracrRNA repeat sequence, and a portion of the 3’ tracrRNA sequence (i.e., a portion that is 5’ to the second ligation site) of the sgRNA. The 5’ terminal region of the third RNA fragment can comprise a sequence region corresponding to a portion of the 3’ tracrRNA sequence (i.e., a portion that is 3’ to the second ligation site) of the sgRNA.
[0197] As described herein, purified long RNAs (e.g., tagRNA) can be, be about, orbe at least about, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96%, 97%, 98%, 99%, 99.5%, 100%, or a number or a range between any two of these values.
[0198] In the methods described herein, hybridizing step can be carried out with the ligating step in some embodiments, e.g., hybridization carried out in the presence of the ligase. In some embodiments, hybridizing step starts before the ligating step or occurs (e.g., completed) before the ligating step, and optionally the hybridizing step can occur at a different temperature than the ligation step.
[0199] The methods described herein can be used to synthesize long RNA oligonucleotide molecules, and the applications in which the long RNA oligonucleotide molecules made by the synthesis methods disclosed herein can be used are not limited. For example, the long RNAs can be guide RNAs (e.g., single molecule guide RNAs (sgRNAs)), mRNAs, tRNAs, long noncoding RNAs (IncRNAs), or be used as positive controls for sensitive RNA-based diagnostic tools, or for the development of RNA-based medical therapeutics (e.g., vaccines). The long RNAs can be used in, e.g., gene expression analysis (e.g., microinjection, infection with viral transcripts, in vitro translation) or structure analysis (e.g., protein-RNA binding). The long RNAs can be unmodified, partially or fully chemically modified. EXAMPLES
[0200] Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure. Example 1 Synthesis of a Long gRNA by Splint-Mediated Ligation Approach
[0201] This example demonstrates the synthesis of a long RNA molecule comprising a spacer sequence, a scaffold sequence, and an extension region using splint-mediated ligation in the absence of DNase treatment.
[0202] To ensure the flexibility and adaptability of the method, universal ligation sites are selected to be within the loop structure of the scaffold. Such scaffold sequence is shared by regular gRNA for CRISRP-Cas nuclease-based gene knockout, as well as long gRNA for CRISPR-Cas-Reverse Transcriptase based gene knockout, correction, or insertion. If the target RNA sequence comprises a sequence that is identical or shows high homology to the scaffold sequence, the ligation strategy could be applied to generate full length sequence. DNA splint is 10-30 DNA oligonucleotides that are complementary 3’ end and 5’ end of two consecutive RNA sequences. It serves to orient the placement of the RNA fragments.
[0203] An exemplary RNA molecule that targets Wilson Disease gene wassynthesized using the splint-mediated ligation method described herein. The RNA was split into three RNA fragments (RNA 1, RNA 2 and RNA 3), the sequences of which with or without chemical modifications are shown in Table 1 below, and the three RNA fragments were used together with two DNA splint oligonucleotides (DNA Splint 1 and DNA Splint 2) also shown in Table 1 to generate the RNA. Both splints bind to the conservative regions in the scaffold. Table 1: Exemplary RNA fragments and DNA splints Component Length Sequence SEQ (nt) ID NO RNA1 33 mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGr 1 UrUrUrUrArGrAmGmCmUmAmG (modified) UUGGUGACUGCCACGCCCAAGUUUUAGAGCUAG 23 (unmodified) RNA2 54 / 5Phos / mAmAmAmUmAmGmCrArArGrUrUrArArArArUrArA 2 rGrGrCrUrArGrUrCrCrGrUrUrArUrCmAmAmCmUmUmGm AmAmAmAmAmGmUmGmGmCmAmCmCmG (modified) AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA 24 CUUGAAAAAGUGGCACCG (unmodified) RNA3 35 / 5Phos / mAmGmUmCmGmGmUmGmCrGrUrGrArArCrArCr 3 CrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU (modified) AGUCGGUGCGUGAACACCCCUUGGGCGUGGCUUUU 25 (unmodified) SpDNA1 24AAC TTG CTA TTT CTA GCT CTA AAA4SpDNA2 18GCACCGACTCGGTGCCAC5rA, rC, rG, rU : regular RNA nucleotides, mA, mC, mG, mU : 2’ O-Methyl nucleotides; ‘*’ : phosphorothioate bond backbone solid underline: variable region; ^: ligation sites; italics: splint 1 (SpDNA1) binding region; dotted underline: Splint 2 (SpDNA2) binding region.
[0204] RNA1 comprises a splint binding domain having a sequence of “UUUUAGAGCUAG” (SEQ ID NO: 35). RNA2 comprises a splint binding domain having a sequence of “AAAUAGCAAGUU” (SEQ ID NO: 36) and a splint binding domain having a sequence of “GUGGCACCG” (SEQ ID NO: 37). RNA3 comprises a splint binding domain having a sequence of “AGUCGGUGC” (SEQ ID NO: 38).
[0205] The synthesized long tagRNA has the following sequence from 5’ to 3’: 5’- mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGrUrUrUrUrArGrAmGmCmUmAm G^mAmAmAmUmAmGmCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUr CmAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG^mAmGmUmCmGmGmUmGmCrGrUrGrArArCrArCrCrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU -3’ (SEQ ID NO: 6)
[0206] The ligation sites were picked at the loop structure in the gRNA scaffold sequence. Full-length 122mer was hence divided into 3 pieces of fragments at specific sites. The three RNA fragments, namely RNA1, RNA2 and RNA3, were synthesized with conventional solid-phase synthesis approach with high purity due to their short length and served as the starting material for the ligation reaction. RNA2 and RNA3 were synthesized with an extra phosphate group at their 5’ end to provide a ligation site for the 3’ hydroxyl group of prior fragments. Sequences of RNA fragments and DNA splints are shown in Table 1. The schematic diagram of ligation site design is shown in FIG.3.
[0207] An exemplary ligation reaction was carried out at 10 nmol scale with 1mL total volume. The reaction is scalable to accommodate target yield with appropriate bioreactors and purification columns. All the components (see Table 2) were added to one well in a 1ml 96-well plate and mixed well. The plate was then incubated at 37˚C for 15 hours. The reaction mixture was quenched with 10uL of 0.5 M EDTA after completion. The crude sample was then analyzed by HPLC-MS to check the completeness of the reaction (FIG.4). Table 2. Components of an exemplary ligation mixture Component Conc. (mM) Amount µL) Final Concentration (µM) RNA1 1 10 10 RNA2 1 10 10 RNA3 1 10 10 SpDNA1 1 10 10 SpDNA2 1 10 10 10× T4 RNA Ligase2 10× 100 1x Reaction Buffer T4 RNA Ligase2 10 Units / µL 30 0.3unit / µL Water / 820 N / A Total / 1000
[0208] The HPLC column used for the analysis is DNAPacTMRP (2.1×50mm, 4µm particle size) from Thermo SCIENTIFIC. The two mobile phases used were: A: 200mM HFIP(1,1,1,3,3,3-Hexafluoroisopropanol), 8mM TEA(Triethylamine) in water; and B: Methanol.
[0209] Samples were analyzed at 70 ˚C with flow rate of 0.4 ml / min. The gradient elution used for reversed phase (RP) column is shown in Table 3. Table 3. Exemplary gradient elution Time(min) %B 0.5 10 8.0 18 13.0 21 14.0 95 15.5 9516.5 10 20.0 10
[0210] The UV signal from an exemplary ligation reaction is shown in FIG. 4. The MS spectrum of the main peak was acquired as shown in FIG.5. The main peak was confirmed to be the full-length product (FLP) by MS and the UV spectrum showed high conversion rate with minimal RNA fragments unreacted.
[0211] Next, full-length product was purified from the crude ligation reaction. The crude mixture was purified using reverse phase column – YMC – Triart C18 / S- 5µm / 12nm(100×4.6mm) from YMC on Agilent AKTA25. The two mobile phases used were: A: 100mM TEAA (Triethylammonium Acetate) in water; and B: Acetonitrile.
[0212] Samples were purified at 65 ˚C with flow rate of 1.5 ml / min. The gradient elution used for purification is shown in Table 4. The purification chromatogram is shown in FIG. 6. Table 4. Exemplary gradient elution CV %B 0 5 1 10 11 20 14 95 17 5
[0213] The FLP eluted the last (arrow), shown as the main peak in FIG.6. Its center fraction (C10) was then analyzed by HPLC-MS with the same method used for crude analysis. UV purity of the fraction was around 84% as shown in FIG.7. And its identity was confirmed by mass spectroscopy shown in FIG.8. Fractions can then be pooled with target purity and yield. The solvent in pool could be evaporated to buffer exchanged to give final gRNA product.
[0214] As alternative to the above RNA fragments and DNA splints used in Table 1, three different ligation sets with combinations of different RNA1s, RNA2s and RNA3s and corresponding DNA splints were also evaluated and compared to the initial set (set 1) used in Table 1. The sequences of the three additional sets (sets 2-4) of RNA fragments with or without chemical modifications and DNA splints are shown in Table 5. Sets 1 and 4 share the same first ligation site (between RNA1 and RNA2), while sets 2 and 3 have a first ligation site different from that of sets 1 and 4. Table 5: Exemplary RNA fragments and DNA splints Component Length Sequence SEQ (nt) ID NO Set 2 RNA1 39 mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGr 8 UrUrUrUrArGrAmGmCmUmAmGmAmAmAmUmAmG (modified)UUGGUGACUGCCACGCCCAAGUUUUAGAGCUAGAA 26 AUAG (unmodified) RNA2 46 / 5Phos / mCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUr 9 CrCrGrUrUrArUrCmAmAmCmUmUmGmAmAmAmAmA mGmUmGmGmCmAmC (modified) CAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA 27 AAAAGUGGCAC (unmodified) RNA3 37 / 5Phos / mCmGmAmGmUmCmGmGmUmGmCrGrUrGrArAr 10 CrArCrCrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU (modified) CGAGUCGGUGCGUGAACACCCCUUGGGCGUGGCUU 28 UU (unmodified)SpDNA1 28CCTTATTTTAACTTGCTATTTCTAGCTC11SpDNA2 20CACCGACTCGGTGCCACTTT12Set 3 RNA1 30 mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGr 13 UrUrUrUrArGrAmGmC (modified) UUGGUGACUGCCACGCCCAAGUUUUAGAGC 29 (unmodified) RNA2 55 / 5Phos / mUmAmGmAmAmAmUmAmGmCrArArGrUrUrAr 14 ArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCmAmA mCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmC (modified) UAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUA 30 UCAACUUGAAAAAGUGGCAC (unmodified) RNA3 37 / 5Phos / mCmGmAmGmUmCmGmGmUmGmCrGrUrGrArAr 15 CrArCrCrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU (modified) CGAGUCGGUGCGUGAACACCCCUUGGGCGUGGCUU 31 UU (unmodified)SpDNA1 22TTGCTATTTCTAGCTCTAAAAC16SpDNA2 20CACCGACTCGGTGCCACTTT17Set 4 RNA1 33 mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGr 18 UrUrUrUrArGrAmGmCmUmAmG (modified) UUGGUGACUGCCACGCCCAAGUUUUAGAGCUAG 32 (unmodified) RNA2 52 / 5Phos / mAmAmAmUmAmGmCrArArGrUrUrArArArArUrA 19 rArGrGrCrUrArGrUrCrCrGrUrUrArUrCmAmAmCmUmUm GmAmAmAmAmAmGmUmGmGmCmAmC (modified) AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA 33 ACUUGAAAAAGUGGCAC (unmodified)RNA3 37 / 5Phos / mCmGmAmGmUmCmGmGmUmGmCrGrUrGrArAr 20 CrArCrCrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU (modified) CGAGUCGGUGCGUGAACACCCCUUGGGCGUGGCUU 34 UU (unmodified) SpDNA1 24AACTTGCTATTTCTAGCTCTAAAA21SpDNA2 20CACCGACTCGGTGCCACTTT22rA, rC, rG, rU : regular RNA nucleotides, mA, mC, mG, mU : 2’ O-Methyl nucleotides; ‘*’ : phosphorothioate bond backbone
[0215] The UV signals from the ligation reactions using the RNA fragments and DNA splints in Table 5 as well as in Table 1 are shown in FIG.9. Set 4 (the bottom panel) generated a comparable amount of full-length product (FLP) with respect to the initial set (set 1, top panel), while sets 2 and 3 (the second and third panels from the top) generated little or none FLP. The data suggested that changing the first ligation site (between RNA1 and RNA2) can decrease ligation efficiency. Example 2 Synthesis of a Long gRNA by Single Splint-Mediated Ligation
[0216] This example demonstrates the synthesis of a long RNA molecule comprising a spacer sequence, a scaffold sequence, and an extension region using splint-mediated ligation. In particular, a single splint oligonucleotide is used in this example to ligate three RNA fragments.
[0217] Similar to Example 1, an exemplary RNA molecule that targets Wilson Disease gene was synthesized using the splint-mediated ligation method described herein. The RNA was split into three RNA fragments (RNA 1, RNA 2 and RNA 3), the sequences of which with or without chemical modifications are shown in Table 6 below. Different from Example 1 in which three RNA fragments were used together with two DNA splint oligonucleotides (DNA Splint 1 and DNA Splint 2; see Table 1), in this example, a single splint oligonucleotide was used to generate the RNA (see FIG.2B). The schematic diagram of ligation site design is shown in FIG. 2B. DNA Splint 1 (SEQ NO: 4) and DNA Splint 2 (SEQ NO: 5) used in Example 1 were linked to form a single splint (SEQ ID NO: 39) to facilitate ligation reaction. The length of the single splint can be flexible as long as there is sufficient binding between the splint and both ligation sites. Sequences of the RNA fragments and the single DNA splint are shown in Table 6. Table 6: Exemplary RNA fragments and DNA splints Component Length Sequence SEQ (nt) ID NORNA1 33 mU*mU*mG*rGrUrGrArCrUrGrCrCrArCrGrCrCrCrArArGr 1 UrUrUrUrArGrAmGmCmUmAmG (modified) UUGGUGACUGCCACGCCCAAGUUUUAGAGCUAG 23 (unmodified) RNA2 54 / 5Phos / mAmAmAmUmAmGmCrArArGrUrUrArArArArUrAr 2 ArGrGrCrUrArGrUrCrCrGrUrUrArUrCmAmAmCmUmUm GmAmAmAmAmAmGmUmGmGmCmAmCmCmG (modified) AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA 24 ACUUGAAAAAGUGGCACCG (unmodified) RNA3 35 / 5Phos / mAmGmUmCmGmGmUmGmCrGrUrGrArArCrArC 3 rCrCrCrUrUrGrGrGrCrGrUrGrGrCmU*mU*mU*mU (modified) AGUCGGUGCGUGAACACCCCUUGGGCGUGGCUUUU 25 (unmodified) SpDNA 42 GCACCGACTCGGTGCCACAACTTGCTATTTCTAGCTCTAA 39 AA rA, rC, rG, rU : regular RNA nucleotides, mA, mC, mG, mU : 2’ O-Methyl nucleotides; ‘*’ : phosphorothioate bond backbone solid underline: variable region; ^: ligation sites; italics: splint 1 (SpDNA1) binding region; dotted underline: Splint 2 (SpDNA2) binding region. bold dotted underline: SpDNA2 (SEQ NO: 5) bold italics: SpDNA1 (SEQ NO: 4)
[0218] An exemplary ligation reaction was carried out at 10 nmol scale with 1mL total volume. The reaction is scalable to accommodate target yield with appropriate bioreactors and purification columns. All the components (see Table 7) were added to one well in a 1ml 96- well plate and mixed well. The plate was then incubated at 37˚C for 15 hours. The reaction mixture was quenched with 10uL of 0.5 M EDTA after completion. The crude sample was then analyzed by HPLC-MS to check the completeness of the reaction (FIG.10). Table 7. Components of an exemplary ligation mixture Component Conc. (mM) Amount (µL) Final Concentration RNA1 1 10 10 RNA2 1 10 10 RNA3 1 10 10 SpDNA 1 10 10 T4 RNA Ligase 2 10 × 100 1 × Reaction Buffer T4 RNA Ligase 2 10 Units / µL 30 0.3 Unit / µL Water / 830 N / ATotal / 1000 Terminology
[0219] In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
[0220] With respect to the use of substantially any plural and / or singular terms herein, those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application. The various singular / plural permutations may be expressly set forth herein for sake of clarity. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and / or” unless otherwise stated.
[0221] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (e.g., “a” and / or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (e.g., the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or twoor more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, or C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., “ a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
[0222] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
[0223] As will be understood by one skilled in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
[0224] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.
Claims
WHAT IS CLAIMED IS:
1. A method of synthesizing a RNA, the method comprising: hybridizing a first RNA fragment, a second RNA fragment, a third RNA fragment, a first splint DNA oligonucleotide, and a second first splint DNA oligonucleotide to form a complex, wherein (a) the first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) the second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) the third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) the first splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; and (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, wherein the first splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 4; and (e) the second splint DNA oligonucleotide comprises (i) a first portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (ii) a second portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the second splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 5, wherein the complex comprises (i) a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and (i) a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment, and ligating the first and second RNA fragments, and the second and third RNA fragments, respectively, with a ligase at the first and second ligation sites in the complex, thereby synthesizing a RNA.
2. A method of synthesizing a RNA, the method comprising: hybridizing a first RNA fragment, a second RNA fragment, a third RNA fragment,a splint DNA oligonucleotide to form a complex, wherein (a) the first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) the second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) the third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, and (d) the splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, (iii) a third portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (iv) a fourth portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 39; and wherein the complex comprises (i) a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and (i) a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment, and ligating the first and second RNA fragments, and the second and third RNA fragments, respectively, with a ligase at the first and second ligation sites in the complex, thereby synthesizing a RNA.
3. The method of claim 1 or 2, wherein the RNA comprises in 5’ to 3’ order: a spacer sequence, a scaffold sequence, and an extension sequence.
4. The method of claim 3, wherein the scaffold sequence comprises an invariable sequence comprising a stem loop formed between a crRNA repeat sequence and a tracrRNA anti- repeat sequence, and a 3’ tracrRNA sequence comprising at least one stem-loop.
5. The method of claim 3 or 4, wherein the extension sequence region comprises an editing template complementary to a target sequence and a flap binding sequence at least partially complementary to the spacer sequence.
6. The method of any one of claims 3-5, wherein the first ligation site and the second ligation site correspond to sites in the scaffold sequence.
7. The method of any one of claims 3-6, wherein the first ligation site corresponds to a site in a stem-loop structure formed between the crRNA repeat sequence and the tracrRNA anti- repeat sequence; and optionally wherein the site in the first stem-loop structure is in a tetraloop portion of the stem-loop structure.
8. The method of any one of claims 3-7, wherein the second ligation site corresponds to a site in the loop portion of a stem-loop structure in the tracrRNA sequence of the scaffold sequence.
9. The method of any one of claims 1-8, wherein the RNA comprises in 5’ to 3’ order the first RNA fragment linked to the second RNA fragment by a first phosphodiester bond, and the second RNA fragment linked to the third RNA fragment by a second phosphodiester bond.
10. The method of claim 9, wherein the first phosphodiester bond is formed between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and wherein the second phosphodiester bond is formed between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment.
11. The method of any one of claims 1-10, wherein the first RNA fragment comprises a nucleotide sequence that is 5’ to the first ligation site.
12. The method of any one of claims 1-11, where the second RNA fragment comprises a nucleotide sequence that is between the first ligation site and the second ligation site.
13. The method of any one of claims 1-12, wherein the third RNA fragment comprises a nucleotide sequence that is 3’ to the second ligation site.
14. The method of any one of claims 1-13, wherein the terminal region of the first RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 3’end of the first RNA fragment.
15. The method of any one of claims 1-14, wherein (i) the first portion of the first splint DNA oligonucleotide is perfectly complementary to the terminal region of the first RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the terminal region of the first RNA fragment.
16. The method of any one of claims 1-15, wherein the first terminal region of the second RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 5’end of the second RNA fragment.
17. The method of any one of claims 1-16, wherein the second portion of the first splint DNA oligonucleotide is perfectly complementary to the first terminal region of the second RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the first terminal region of the second RNA fragment.
18. The method of any one of claims 1-17, wherein the second terminal region of thesecond RNA fragment comprises a nucleotide sequence of about 10 to about 30 nucleotides located at the 3’end of the second RNA fragment.
19. The method of any one of claims 1-18, wherein the first portion of the second splint DNA oligonucleotide is perfectly complementary to the second terminal region of the second RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the second terminal region of the second RNA fragment.
20. The method of any one of claims 1-19, wherein the second RNA fragment comprises a center sequence region between the first terminal region and the second terminal region, and optionally wherein the center sequence region does not comprise a nucleotide sequence complementary to the first splint oligonucleotide and / or the second splint oligonucleotide, and further optionally wherein the center sequence region is about 10 to about 60 nucleotides in length.
21. The method of any one of claims 1-20, wherein the terminal region of the third RNA fragment comprises a nucleotide sequence of about 10 to about 40 nucleotides located at the 5’end of the third RNA fragment.
22. The method of any one of claims 1-20, wherein the second portion of the second splint DNA oligonucleotide is perfectly complementary to the terminal region of the third RNA fragment or a portion thereof, or has 1, 2, or 3 mismatches relative to the terminal region of the third RNA fragment.
23. The method of any one of claims 1-22, wherein the first RNA fragment comprises a spacer sequence that is complementary to a sequence in a target DNA; and optionally wherein the target DNA is mammalian DNA or human DNA.
24. The method of any one of claims 1-23, wherein the second RNA fragment comprises a scaffold sequence capable of binding to an RNA-guided endonuclease or a variant thereof.
25. The method of claim 24, wherein the RNA-guided endonuclease is a small Cas nuclease or a small RNA-guided endonuclease.
26. The method of claim 24 or 25, wherein the RNA-guided endonuclease is selected from the group consisting of: a Cas9, a Cas12, aCas13, and variants thereof; and optionally wherein the RNA-guided endonuclease is a Streptococcus pyogenes Cas9 (SpyCas9) or a Staphylococcus aureus (SaCas9).
27. The method of any one of claims 24-26, wherein the RNA-guided endonuclease is a variant of Cas9, and the variant of Cas9 is selected from the group consisting of: a small Cas9, a dead Cas9 (dCas9), a Cas9 nickase, or a Cas9 fusion protein.
28. The method of any one of claims 1-27, wherein the third fragment comprises anextension region, and optionally wherein the extension region comprises an editing template that comprises a region of complementarity to a target sequence.
29. The method of claim 28, wherein the third fragment comprises a flap binding sequence at least partially complementary to the spacer.
30. The method of claim 29, wherein the flap binding sequence is 3’ of the editing template.
31. The method of any one of claims 1-30, wherein the first RNA fragment, the second RNA fragment, and the third RNA fragment are each independently about 10 to about 90 nucleotides in length, and optionally wherein the first RNA fragment, the second RNA fragment, and the third RNA fragment are each independently about 25 to about 70 nucleotides in length, and further optionally wherein the first RNA fragment and the third RNA fragment are each independently about 20 to 40 nucleotides in length and the second RNA fragment is about 45 to about 65 nucleotides in length.
32. The method of any one of claims 1-31, wherein the RNA is about 100 to about 150 nucleotides in length, and optionally wherein the RNA is about 110 to about 140 nucleotides in length.
33. The method of any one of claims 1-32, wherein the hybridizing step and the ligating step occur simultaneously.
34. The method of any one of claims 1-32, wherein the hybridizing step and ligating step occur at different temperature.
35. The method of any one of claims 1-32, wherein the hybridizing step occurs in the presence of the ligase.
36. The method of any one of claims 1-35, wherein hybridizing is performed in a solution, and wherein the hybridizing is performed with or without an annealing step, and optionally wherein the annealing step comprises (i) heating the solution to about 80°C to about 95°C for a period of time less than about 10 minutes; and / or (ii) cooling the solution at a rate of about 0.1°C to about 2°C per second to a temperature used for the ligation.
37. The method of any one of claims 36, wherein two or more of the first splint oligonucleotide, the second splint oligonucleotide, the first RNA fragment, the second RNA fragment, and the third RNA fragment are present in the solution in an about equal concentration.
38. The method of any one of claims 1-37, the ligating is carried out at about 15 ºC to about 45 ºC, and optionally the ligating is carried out at about 15 ºC, 20 ºC, 22 ºC, 24 ºC, 27 ºC, 30 ºC, or 33 ºC.
39. The method of any one of claims 1-38, wherein the complex has a melting temperature (Tm) greater than 15 ºC and lower than 60 ºC, and optionally the Tm of the complexis lower than 55 ºC, 50 ºC, 45 ºC, 40 ºC or 35 ºC.
40. The method of any one of claims 1-39, wherein the ligase is a T4 DNA ligase, T4 RNA ligase I, or T4 RNA ligase II.
41. The method of any one of claims 1-40, wherein the ligating is carried out for about 0.1 to about 48 hours, optionally 6 hours.
42. The method of any one of claims 1-41, wherein the ligating further comprises using one or more of a protease, a chelating agent, and a crowding agent.
43. The method of claim 42, wherein the chelating agent comprises EDTA, EGTA, or both.
44. The method of claim 42 or 43, wherein the crowding agent comprise polyethylene glycol (PEG), Ficoll®, ethylene glycol, dextran, or any combination thereof.
45. The method of any one of claims 1-44, comprising isolating and / or purifying the gRNA.
46. The method of claim 45, wherein the purified gRNA is at least 80%, 85%, 90%, 95%, or 98% in purity.
47. The method of any one of claims 1-46, comprising after ligating, separating the RNA and one or more of the splint DNA oligonucleotides.
48. The method of claim 47, further comprising isolating and / or purifying one or more of the splint DNA oligonucleotides.
49. The method of any one of claims 45-48, wherein the isolating and / or purifying comprises using a chromatographic method, a size-based separation method, an affinity-based method, a charge-based separation method, or a combination thereof.
50. The method of claim 49, wherein the chromatographic method comprises reversed- phase HPLC, ion-exchange chromatography, size exclusion chromatography, hydrophobic interaction chromatography, affinity chromatography, or polyacrylamide gel purification, or any combination thereof.
51. The method of any one of claims 1-50, wherein the method does not comprise using any DNase.
52. The method of any one of claims 1-50, wherein the method does not comprise digesting one or more of the first and second splint DNA oligonucleotides after the ligating step.
53. The method of claim 52, wherein the method does not comprise digesting one or more of the first and second splint DNA oligonucleotides in the complex after the ligating step.
54. The method of any one of claims 1-53, wherein the method does not comprise separating the RNA and one or more of the first and second splint DNA oligonucleotides enzymatically.
55. The method of any one of claims 1-54, wherein the hybridizing step is carried out in the presence of one or more RNase inhibitors.
56. The method of any one of claims 1-55, wherein one or more of the first RNA fragment, the second RNA fragment, and the third RNA fragment comprises at least one secondary structure, and wherein the complex formed by hybridizing the first, second, and third RNA fragments and the first and second splint oligonucleotides has a lower free energy than that of the secondary structure with the lowest free energy.
57. The method of any one of claims 1-56, wherein the RNA is a guide RNA (gRNA), optionally a single gRNA (sgRNA).
58. The method of any one of claims 1-57, further comprising providing the first, second and third RNA fragments and the first and second splint oligonucleotides.
59. The method of claim 58, wherein providing the first, second and third RNA fragments and the first and second splint oligonucleotides comprises synthesis of the RNA fragments and the oligonucleotides using enzymatic synthesis or phosphoramidite chemistry, optionally comprising purifying the RNA fragments and the oligonucleotides after synthesis.
60. The method of any one of claims 1-59, wherein the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises one or more modifications in the RNA backbone; and optionally wherein at least one of the one or more modifications is selected from the group consisting of 2’ methoxy (2’OMe), 2’ fluorine (2’fluoro), 2’-O-methoxy-ethyl (MOE), Locked Nucleic Acids (LNA), Unlocked Nucleic Acids (UNA), bridged nucleic acids, 2’deoxynucleic acids (DNA), and peptide nucleic acids (PNA).
61. The method of any one of claims 1-60, wherein the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises one or more base modifications; and optionally wherein at least one of the one or more base modifications is selected from the group consisting of 2-aminopurine, hypoxanthine, thymine, 2,6-diaminopurine, 2-pyrimidone, and 5- methyl cytosine.
62. The method of any one of claims 1-61, wherein the first RNA fragment, the second RNA fragment, and / or the third RNA fragment, comprises at least one phosphorothioate linkage.
63. The method of any one of claims 1-62, wherein the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
35.
64. The method of any one of claims 1-63, wherein the second RNA fragment comprises (1) a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; and / or (2) a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37.
65. The method of any one of claims 1-64, wherein the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
38.
66. The method of any one of claims 1-65, wherein the terminal region of the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35; the first terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; the second terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37; and / or the terminal region of the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
38.
67. A method of synthesizing a long RNA, the method comprising: providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) a first splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; and (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, wherein the first splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 4; and (e) a second splint DNA oligonucleotide comprises (i) a first portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (ii) a second portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the second splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 5; and (f) a ligase; hybridizing the first, second, and third RNA fragments and the first and second splint DNA oligonucleotides to form a complex having a first ligation site present betweenthe 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment; and ligating the first and second RNA fragments at the first ligation site and the second and third RNA fragments at the second ligation site using the ligase to synthesize a long RNA comprising from 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target DNA, a scaffold sequence capable of binding to an RNA-guided endonuclease or a DNA binding domain, and an extended sequence region comprising one or more intended nucleotide edits compared to the sequence of the target DNA, wherein the first and second ligation sites correspond to sites in the scaffold sequence of the RNA.
68. A method of synthesizing a long RNA, the method comprising: providing: (a) a first RNA fragment comprises a terminal region comprising a 3’ hydroxyl group, (b) a second RNA fragment comprises a first terminal region comprising a 5’ phosphate moiety and a second terminal region comprising a 3’ hydroxyl group, (c) a third RNA fragment comprises a terminal region comprising a 5’ phosphate moiety, (d) a splint DNA oligonucleotide comprises (i) a first portion complementary to the terminal region comprising the 3’ hydroxyl group of the first RNA fragment; (ii) a second portion complementary to the first terminal region comprising the 5’ phosphate moiety of the second RNA fragment, (iii) a third portion complementary to the second terminal region comprising the 3’ hydroxyl group of the second RNA fragment; and (iv) a fourth portion complementary to the terminal region comprising the 5’ phosphate moiety of the third RNA fragment, wherein the splint DNA oligonucleotide has a nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence having one mismatch or two mismatches relative to SEQ ID NO: 39; and (e) a ligase; hybridizing the first, second, and third RNA fragments and the splint DNA oligonucleotides to form a complex having a first ligation site present between the 3’ hydroxyl group of the first RNA fragment and the 5’ phosphate group of the second RNA fragment, and a second ligation site present between the 3’ hydroxyl group of the second RNA fragment and the 5’ phosphate group of the third RNA fragment; and ligating the first and second RNA fragments at the first ligation site and the secondand third RNA fragments at the second ligation site using the ligase to synthesize a long RNA comprising from 5’ to 3’: a spacer sequence that is complementary or substantially complementary to a sequence in a target DNA, a scaffold sequence capable of binding to an RNA-guided endonuclease or a DNA binding domain, and an extended sequence region comprising one or more intended nucleotide edits compared to the sequence of the target DNA, wherein the first and second ligation sites correspond to sites in the scaffold sequence of the RNA.
69. The method of claim 67 or 68, wherein the long RNA is capable of binding to a reverse transcriptase editor comprising a DNA binding domain and a DNA polymerase domain.
70. The method of claim 68, wherein the DNA polymerase domain comprises a reverse transcriptase and the DNA binding domain comprises a Cas9 nickase.
71. The method of any one of claims 67-70, wherein the extended sequence region comprising an editing template complementary to a target sequence and a flap binding sequence at least partially complementary to the spacer sequence.
72. The method of any one of claims 67-71, wherein the long RNA is a target priming RNA for use in a reverse transcriptase editing system.
73. The method of any one of claims 67-72, wherein the long RNA is about 100 to about 140 nucleotides in length.
74. The method of any one of claims 67-73, wherein the first ligation site corresponds to a site in a lower stem loop formed adjacent to the spacer sequence.
75. The method of any one of claims 67-74, wherein the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
35.
76. The method of any one of claims 67-75, wherein the second RNA fragment comprises (1) a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; and / or (2) a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
37.
77. The method of any one of claims 67-76, wherein the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO:
38.
78. The method of any one of claims 67-77, wherein the terminal region of the first RNA fragment comprises a nucleotide sequence of SEQ ID NO: 35 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 35; the first terminal region of the second RNA fragment comprises a nucleotide sequence of SEQ ID NO: 36 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 36; the second terminal region of thesecond RNA fragment comprises a nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 37; and / or the terminal region of the third RNA fragment comprises a nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence having one or two mismatches relative to SEQ ID NO: 38.
Citation Information
Patent Citations
Process for the synthesis of methionine and analogs thereof
WO2025052079A1
Methods of synthesizing RNA molecules
WO2021108647A1
Synthetic guide RNA, compositions, methods, and uses thereof
WO2021113494A1
HIGH PURITY gRNA SYNTHESIS PROCESS
WO2023047340A1
Split synthesis of long rnas
WO2024112876A2