Erbb4-targeting composition for preventing, treating or diagnosing neurodegenerative diseases

Abstract

The present invention relates to: a composition comprising an ErbB4 expression inhibitor or activity inhibitor for preventing or treating neurodegenerative diseases; and a biomarker composition comprising an ErbB4 protein or a gene encoding same for diagnosing neurodegenerative diseases. The present invention can be effectively used in the prevention, improvement, or treatment of neurodegenerative diseases through the inhibition of expression or activity of ErbB4, and can be effectively used for early diagnosis of neurodegenerative diseases according to whether the ErbB4 protein or gene is expressed.

Description

Composition for preventing, treating or diagnosing neurodegenerative diseases targeting ERBB4

[0001] The present invention relates to a composition for preventing or treating a neurodegenerative disease, comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient; and a biomarker composition for diagnosing a neurodegenerative disease, comprising an ErbB4 protein or a gene encoding the same.

[0002]

[0003] As the global population rapidly ages, the number of patients with neurodegenerative diseases such as cognitive impairment, Alzheimer's disease, and Parkinson's disease is rapidly increasing. Current treatments for Alzheimer's disease include tacrine, rivastigmine, donepezil, and galantamine. These are all acetylcholinesterase inhibitors (AChIs), which inhibit the activity of the enzyme acetylcholinesterase (AChE) and enhance cognitive function. However, these treatments only provide temporary symptom relief in some patients, and their effects are short-lived. Furthermore, despite the disease's characteristic need for long-term use, AChIs, which have been developed, are associated with various side effects, including hepatotoxicity. Therefore, the development of drugs that fundamentally treat or slow the progression of the disease is urgently needed.

[0004] Furthermore, the best approach currently is to diagnose neurodegenerative diseases early and slow their progression. However, despite research into various methods for early diagnosis of neurodegenerative diseases, no biomarker has been discovered that can accurately diagnose them early.

[0005] In particular, Alzheimer's disease, which is the most studied of the neurodegenerative diseases, is being diagnosed using brain imaging diagnostic methods such as magnetic resonance imaging (MRI) or computed tomography (CT); diagnostic methods such as measuring the amount of tau protein or amyloid-beta in cerebrospinal fluid (CSF) or blood; or analyzing the APOE-e4 gene as a genetic risk factor. However, there is a limitation in that it is not reliable compared to clinical results in diagnosing neurodegenerative diseases at an early stage.

[0006] Accordingly, the inventors of the present invention confirmed that ErbB4 (erb-b2 receptor tyrosine kinase 4) is related to the onset of neurodegenerative diseases, and confirmed the possibility of early diagnosis of neurodegenerative diseases using it, and completed the present invention by developing an expression inhibitor or activity inhibitor thereof as a treatment for Alzheimer's disease.

[0007]

[0008] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating a neurodegenerative disease, which comprises an expression inhibitor or activity inhibitor of ErbB4 (erb-b2 receptor tyrosine kinase 4) as an active ingredient.

[0009] Another object of the present invention is to provide a health functional food for preventing or improving a degenerative neurological disease, which contains an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0010] Another object of the present invention is to provide a method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising a therapeutically effective amount of an expression inhibitor or an activity inhibitor of ErbB4.

[0011] Another object of the present invention is to provide a composition for improving cognitive ability comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0012] Another object of the present invention is to provide a method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising an expression inhibitor or activity inhibitor of ErbB4.

[0013] Another object of the present invention is to provide a biomarker composition for diagnosing a neurodegenerative disease comprising the ErbB4 protein or a gene encoding the same.

[0014] Another object of the present invention is to provide a composition for diagnosing a neurodegenerative disease, comprising a preparation capable of measuring the expression level of ErbB4 protein or a gene encoding the same.

[0015] Another object of the present invention is to provide a diagnostic kit for a neurodegenerative disease comprising the diagnostic composition for the neurodegenerative disease.

[0016] Another object of the present invention is to provide a method for providing information for diagnosing a neurodegenerative disease, comprising the steps of (a) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from a biological sample; and (b) comparing the expression level of the ErbB4 protein or the gene encoding the same with a reference value obtained from a control sample.

[0017] Another object of the present invention is to provide a method for producing an animal model of a neurodegenerative disease, comprising administering to an animal an overexpression vector containing an ErbB4 protein or a gene encoding the protein.

[0018] Another object of the present invention is to provide an animal model of a degenerative neurological disease produced by the method for producing the animal model of a degenerative neurological disease.

[0019] Another object of the present invention is to provide a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) administering a candidate substance to an animal model of a neurodegenerative disease; (b) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from the animal model of a neurodegenerative disease to which the candidate substance has been administered; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0020] Another object of the present invention is to provide a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) treating a candidate substance to a cell in which the ErbB4 protein or a gene encoding the same is overexpressed; (b) measuring the expression level of the ErbB4 protein or the gene encoding the same in the cell treated with the candidate substance; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0021]

[0022] To achieve the above purpose, the present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0023] In one embodiment of the present invention, the expression inhibitor may be selected from the group consisting of miRNA (microRNA), siRNA (small interfering RNA), shRNA (small hairpin RNA), sgRNA (single guide RNA), gRNA (guide RNA), antisense oligonucleotide, and ribozyme that specifically bind to the mRNA of ErbB4, but is not limited thereto.

[0024] In one embodiment of the present invention, the activity inhibitor may be selected from the group consisting of antibodies, aptamers, PNA (peptide nucleic acid), peptides, peptide mimetics, and compounds that specifically bind to the ErbB4 protein, but is not limited thereto.

[0025] In one embodiment of the present invention, the ErbB4 expression inhibitor or activity inhibitor may be one that inhibits the expression or activity of ErbB4 in excitatory neurons, and preferably, may be one that inhibits the expression or activity of ErbB4 in excitatory neurons of the brain. The brain may be selected from the group consisting of the cerebrum, hippocampus, cerebellum, thalamus, and brain stem, but is not limited thereto.

[0026] In one embodiment of the present invention, the expression inhibitor or activity inhibitor of ErbB4 may reduce phagocytosis of excitatory synapses.

[0027] In one embodiment of the present invention, the ErbB4 expression inhibitor or activity inhibitor may reduce the activity of glial cells, and the glial cells may be selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells, but are not limited thereto. That is, the ErbB4 expression inhibitor or activity inhibitor may reduce the activity of glial cells selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells.

[0028] In one embodiment of the present invention, the expression inhibitor or activity inhibitor of ErbB4 may increase the number of excitatory synapses and decrease the number of inhibitory synapses.

[0029] In one embodiment of the present invention, the ErbB4 expression inhibitor or activity inhibitor may reduce amyloid plaque.

[0030] In one embodiment of the present invention, the neurodegenerative disease may be selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, amyloidosis, frontotemporal dementia, senile dementia, presenile dementia, mild cognitive impairment, fragile X syndrome, and multiple sclerosis, but is not limited thereto.

[0031] In addition, the present invention provides a health functional food for preventing or improving a degenerative neurological disease, which contains an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0032] Additionally, the present invention provides a method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising a therapeutically effective amount of an expression inhibitor or activity inhibitor of ErbB4.

[0033] In addition, the present invention provides a composition for improving cognitive ability comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0034] In addition, the present invention provides a method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising an expression inhibitor or activity inhibitor of ErbB4.

[0035] In addition, the present invention provides a biomarker composition for diagnosing a neurodegenerative disease comprising the ErbB4 protein or a gene encoding the same.

[0036] In one embodiment of the present invention, the ErbB4 protein or a gene encoding the same may be expressed in an excitatory neuron, and preferably, may be expressed in an excitatory neuron of the brain. The brain may be selected from the group consisting of the cerebrum, hippocampus, cerebellum, thalamus, and brain stem, but is not limited thereto.

[0037] In one embodiment of the present invention, the ErbB4 protein or the gene encoding it may increase the activity of glial cells, and the glial cells may be selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells, but are not limited thereto. That is, the ErbB4 protein or the gene encoding it may increase the activity of glial cells selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells.

[0038] In one embodiment of the present invention, the ErbB4 protein or a gene encoding the same may decrease the number of excitatory synapses and increase the number of inhibitory synapses.

[0039] In one embodiment of the present invention, the ErbB4 protein or a gene encoding the same may increase amyloid plaques.

[0040] In one embodiment of the present invention, the neurodegenerative disease may be selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, amyloidosis, frontotemporal dementia, senile dementia, presenile dementia, mild cognitive impairment, fragile X syndrome, and multiple sclerosis, but is not limited thereto.

[0041] In addition, the present invention provides a composition for diagnosing a neurodegenerative disease, comprising a preparation capable of measuring the expression level of ErbB4 protein or a gene encoding the same.

[0042] In one embodiment of the present invention, the ErbB4 protein or a gene encoding the same may be expressed in an excitatory neuron.

[0043] In one embodiment of the present invention, the agent capable of measuring the expression level of the protein may be selected from the group consisting of antibodies, oligopeptides, ligands, aptamers, and PNA (peptide nucleic acid) that specifically bind to the protein or a fragment thereof, but is not limited thereto.

[0044] In one embodiment of the present invention, the agent capable of measuring the expression level of the gene may be selected from the group consisting of a primer, a probe, and an antisense oligonucleotide that specifically bind to the mRNA of the gene, but is not limited thereto.

[0045] In addition, the present invention provides a diagnostic kit for a degenerative neurological disease comprising the diagnostic composition for the degenerative neurological disease.

[0046] In one embodiment of the present invention, the kit may be selected from the group consisting of an RT-PCR kit, a real-time qRT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, and a rapid kit, but is not limited thereto.

[0047] In addition, the present invention provides a method for providing information for diagnosing a neurodegenerative disease, comprising the steps of (a) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from a biological sample; and (b) comparing the expression level of the ErbB4 protein or the gene encoding the same with a reference value obtained from a control sample.

[0048] In one embodiment of the present invention, the method may further include a step of determining that a neurodegenerative disease is present when the expression level of the ErbB4 protein or a gene encoding the same is higher than a reference value obtained from a control sample.

[0049] In one embodiment of the present invention, the biological sample may be selected from the group consisting of tissue, cell, blood, serum, plasma, lymph, cerebrospinal fluid, saliva, and urine, and preferably may be selected from the group consisting of brain tissue, blood, serum, plasma, and cerebrospinal fluid, but is not limited thereto.

[0050] In addition, the present invention provides a method for producing an animal model of a neurodegenerative disease, comprising administering to an animal an overexpression vector containing an ErbB4 protein or a gene encoding the protein.

[0051] In addition, the present invention provides an animal model of a degenerative neurological disease manufactured by the method for manufacturing the animal model of the degenerative neurological disease.

[0052] In addition, the present invention provides a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) administering a candidate substance to an animal model of a neurodegenerative disease; (b) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from the animal model of a neurodegenerative disease to which the candidate substance has been administered; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0053] In one embodiment of the present invention, the method may further include a step of measuring the expression level of the ErbB4 protein or a gene encoding the same before and after administration of the candidate substance.

[0054] In addition, the present invention provides a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) treating a candidate substance to a cell in which an ErbB4 protein or a gene encoding the same is overexpressed; (b) measuring the expression level of the ErbB4 protein or the gene encoding the same in the cell treated with the candidate substance; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0055] In one embodiment of the present invention, the method may further include a step of measuring the expression level of the ErbB4 protein or a gene encoding the same before and after administration of the candidate substance.

[0056]

[0057] The composition comprising the ErbB4 expression suppression or activity suppression according to the present invention has the effect of reducing the activity of glial cells by suppressing the expression or activity of ErbB4 in excitatory neurons, reducing phagocytosis, i.e., removal, of excitatory synapses, increasing the number of excitatory synapses, reducing the number of inhibitory synapses, restoring normal neural network balance, reducing amyloid beta production and amyloid plaques, and restoring cognitive ability, and thus can be usefully used for the prevention, improvement, or treatment of neurodegenerative diseases.

[0058] In addition, the biomarker for diagnosing neurodegenerative diseases according to the present invention is an ErbB4 protein expressed in excitatory neurons or a gene encoding the same, and can be usefully used for early diagnosis of neurodegenerative diseases through the expression of the protein or gene thereof.

[0059]

[0060] Figure 1 shows the clustering results of snRNAseq analysis performed on the hippocampus of 2- or 3-month-old 5xFAD mice and control (WT) mice (red dotted line: indicates the excitatory neuron population).

[0061] Figure 2a shows the result of clustering only the excitatory neuron population in the snRNAseq results (red dotted line: indicates Cluster 6), and Figure 2b shows the result showing the proportion of Cluster 6 in the entire excitatory neuron population (red dotted line: proportion occupied by Cluster 6).

[0062] Figures 3a and 3b are the results of DEG (differentially expressed genes) analysis for other clusters in Cluster 6, showing that genes related to Alzheimer's disease are upregulated in the KEGG Pathway.

[0063] Figure 4a shows the results of Co-regulated Gene Network Analysis performed in an excitatory neuron cluster, and Figure 4b shows the results of analyzing highly expressed genes among genes belonging to Module 4.

[0064] Figure 5a shows the results of immunohistochemical (IHC) analysis confirming the protein expression of ErbB4 in the hippocampal CA1 of 4-month-old 5xFAD mice (white arrow: the area of ​​ErbB4 protein expression overlapping with PV (Parvalbumin) interneuron; and yellow arrow: the area of ​​ErbB4 protein expression only in NeuN (Neuronal nuclear antigen) but not overlapping with PV), and Figure 5b shows the results of immunohistochemical (IHC) analysis confirming that ErbB4 is overexpressed in excitatory neurons located near neurons containing excessive amounts of amyloid-beta in the cerebral region of 4-month-old 5xFAD mice (yellow arrow: the area of ​​ErbB4 protein expression not overlapping with PV (Parvalbumin) interneuron; pink arrow: the area of ​​ErbB4 protein expression in Pyr (Pyramidal) excitatory neurons. (blue arrows: overlapping areas with neurons); and blue arrows: amyloid-beta plaques).

[0065] Figure 6 shows the experimental process of delivering an overexpression vector of the ErbB4 gene through AAV (adeno-associated virus) and the results of confirming whether the virus was expressed through the HA tag linked to ErbB4.

[0066] Figure 7 shows the results of examining the degree of phagocytosis of excitatory synapses by astrocytes and microglia after injecting an ErbB4 overexpression vector into mice.

[0067] Figure 8 shows the results of confirming the degree of activity of glial cells in the S100β (astrocyte), GFAP (astrocyte), and IBA1 (microglia) regions after injecting an ErbB4 overexpression vector into a mouse.

[0068] Figure 9 shows the results of confirming AXL expression in microglia after injecting an ErbB4 overexpression vector into a mouse.

[0069] Figure 10 shows the experimental process of delivering a vector capable of knocking out ErbB4 via AAV using the CRISPR-Cas9 system and the results of confirming the expression of ErbB4 via the HA tag linked to Cas9.

[0070] Figure 11 shows the results of examining the degree of phagocytosis of excitatory synapses by astrocytes and microglia after injecting control RNA or guide RNA into 4-month-old 5xFAD mice or control (WT) mice.

[0071] Figure 12 shows the results of examining the degree of glial cell activity in the S100β (astrocyte), GFAP, and IBA1 (microglia) regions after injecting control RNA or guide RNA into 4-month-old 5xFAD mice or control (WT) mice.

[0072] Figure 13a shows the results of confirming the number of excitatory presynapses and excitatory postsynapses through the expression of vGLUT1 and PSD95 in the SR layer of the hippocampus CA1 of 4-month-old 5xFAD mice or control (WT) mice, and confirming the number of inhibitory presynapses and inhibitory postsynapses through the expression of vGAT and Gephyrin in the SLM layer. Figure 13b shows the results of confirming the number of excitatory presynapses and excitatory postsynapses through the expression of vGLUT1 and PSD95 in the SR layer of the hippocampus CA1, and confirming the number of inhibitory presynapses and inhibitory postsynapses through the expression of vGAT and Gephyrin in the SLM layer after injecting control RNA or guide RNA into 4-month-old 5xFAD mice.

[0073] Figure 14 shows the results of confirming the activation of excitatory neurons and inhibitory neurons in control (WT) mice, 4-month-old 5xFAD mice, and 4-month-old 5xFAD mice injected with control RNA or guide RNA.

[0074] Figure 15 shows the results of confirming AXL expression and amyloid plaques in microglia after injection of control RNA or guide RNA into 4-month-old 5xFAD mice.

[0075] Figure 16 shows the results of three behavioral experiments performed to examine cognitive ability in control (WT) mice, 4-month-old 5xFAD mice injected with control RNA or guide RNA.

[0076] Figure 17 shows the results of confirming ErbB4 expression in excitatory neurons after injection of Control RNA or shRNA into 4-month-old 5xFAD mice.

[0077] Figure 18 shows the results of confirming the number of excitatory pre-synapses and excitatory postsynapses through the expression of vGLUT1 and PSD95 in the SR layer of the hippocampal CA1 after injecting Control RNA or shRNA into 4-month-old 5xFAD mice, and confirming the number of inhibitory pre-synapses and inhibitory postsynapses through the expression of vGAT and Gephyrin in the SLM layer.

[0078]

[0079] Hereinafter, the present invention will be described in detail.

[0080] The terms used in this invention have been selected from widely used, common terms, taking into account the functionality of the invention. However, these terms may vary depending on the intentions of those skilled in the art or the emergence of new technologies. Furthermore, in certain cases, terms may be arbitrarily selected, and in such cases, their meanings will be described in detail in the description of the relevant embodiments. Therefore, the terms used in this invention should not be defined simply as names, but rather based on their meanings and the overall content of the invention.

[0081] When the present invention says that a component or a step "includes", this does not mean that other components or other steps are excluded, but rather that other components or other steps may be further included, unless specifically stated otherwise.

[0082]

[0083] <Pharmaceutical composition>

[0084] The present invention provides a pharmaceutical composition for preventing or treating a neurodegenerative disease, comprising an expression inhibitor or activity inhibitor of ErbB4 (erb-b2 receptor tyrosine kinase 4) as an active ingredient.

[0085] In the present invention, the ErbB4 may be expressed in excitatory neurons, and preferably, may be expressed in excitatory neurons of the brain. The brain may be selected from the group consisting of the cerebrum, hippocampus, cerebellum, thalamus, and brain stem, but is not limited thereto.

[0086] In the present invention, the ErbB4 protein may be a peptide comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, a subtype thereof, or a peptide having 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology with the peptide. The SEQ ID NO: 1 is the amino acid sequence of human (Homo sapiens) ErbB4 protein (NCBI Reference Sequence: NP_001036064.1), and the SEQ ID NO: 2 is the amino acid sequence of mouse (Mus musculus) ErbB4 protein (NCBI Reference Sequence: NP_034284.1).

[0087] In the present invention, the expression inhibitor is a substance that inhibits the expression of the ErbB4 gene, and may be selected from the group consisting of miRNA (microRNA), siRNA (small interfering RNA), shRNA (small hairpin RNA), sgRNA (single guide RNA), gRNA (guide RNA), antisense oligonucleotide, and ribozyme that specifically bind to the mRNA of ErbB4, but is not limited thereto.

[0088] The term "miRNA" refers to a single-stranded RNA molecule of 21-25 nucleotides that controls gene expression in eukaryotes by disrupting target mRNA fragments or inhibiting their translation. These miRNAs undergo a two-step process. The first miRNA transcript (primary miRNA) is cleaved in the nucleus by an RNase III-type enzyme called Drosha into a stem-loop structure of approximately 70-90 bases, called a pre-miRNA. This pre-miRNA then migrates to the cytoplasm and is cleaved by an enzyme called Dicer to form a mature miRNA of 21-25 bases. These miRNAs complementarily bind to target mRNAs and act as post-transcriptional gene suppressors, inducing translational inhibition and mRNA destabilization. miRNAs are involved in various physiological phenomena and diseases.

[0089] The above term, "siRNA", refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing, and refers to a small RNA fragment of 21 to 25 nucleotides in size. The siRNA of the present invention may have a double-stranded structure in which a sense strand (a sequence corresponding to an mRNA sequence) and an antisense strand (a sequence complementary to an mRNA sequence) are positioned on opposite sides, and may have a single-stranded structure having self-complementary sense and antisense strands. The siRNA of the present invention is not limited to a double-stranded RNA portion in which RNAs are paired completely, and may include a portion that does not pair due to a mismatch (a corresponding base is not complementary), a bulge (a base corresponding to one strand is missing), etc.

[0090] The above term, "shRNA", is intended to overcome the shortcomings of siRNA, such as high biosynthesis cost, short-term persistence of RNA interference effect due to low cell transfection efficiency, etc., and it uses a method of introducing it into cells and expressing it using adenovirus, lentivirus, and plasmid expression vector systems from the promoter of RNA polymerase III. It is widely known that such shRNA is converted into siRNA with a precise structure by siRNA processing enzyme (Dicer or Rnase III) present in the cell, thereby inducing silencing of the target gene.

[0091] The above term, "gRNA" or "sgRNA" is a substance that suppresses the expression of a gene using a genome editing technology based on the CRISPR / Cas system, and is any polynucleotide sequence that has sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and guide the sequence-specific binding of the CRISPR complex to the target sequence.

[0092] The CRISPR / Cas9 system collectively refers to a sequence encoding a Cas9 gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or active portion tracrRNA), a tracr pairing sequence, a guide sequence (i.e., gRNA), or other sequences from a CRISPR locus, and elements involved in the expression of or guiding the activity of the Cas9 enzyme gene, including transcripts. In addition to the above Cas9 (e.g., dCas9 and nCas9), saCas9 (e.g., saCas9d, saKKH Cas9), CasX, CasY, Cpf1, C2c1, C2c2, C2c3, Argonaute and any other suitable protein, or variants thereof, are included, but are not limited thereto. Methods for using Cas9 are known in the art (see, e.g., Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013)), and the Cas9 nuclease sequence and structure are well known to those skilled in the art (see, e.g., Ferretti et al., Proc. Natl. Acad. Sci. 98:4658-4663 (2001)).

[0093] The term "antisense oligonucleotide" refers to a DNA or RNA or derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into protein. An antisense oligonucleotide sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the above genes and is capable of binding to the mRNA.

[0094] The term "ribozyme" refers to an enzymatic RNA molecule capable of catalyzing specific RNA cleavage. Endolytic cleavage can be induced by specific hybridization of the ribozyme's molecular sequence with a complementary target RNA, and the ribozyme may comprise a known sequence responsible for cleaving one or more complementary sequences or functionally equivalent sequences to the target RNA. Furthermore, the ribozyme may be a hammerhead ribozyme or a Cech-type ribozyme, which is an endoribonuclease RNA, and may be formed using modified oligonucleotides to improve safety, targeting, etc.

[0095] In the present invention, the activity inhibitor is a substance that inhibits the expression or activity of the ErbB4 protein, and may be selected from the group consisting of antibodies, aptamers, PNA (peptide nucleic acid), peptides, peptide mimetics, and compounds that specifically bind to the ErbB4 protein, but is not limited thereto.

[0096] The term "antibody" as used herein refers to a specific immunoglobulin directed against an antigenic site, and includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof. It also includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and complete forms having two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules, such as Fab, F(ab'), F(ab')2, and Fv. Antibodies can be readily produced using techniques well known in the art, and antibodies that have been produced and sold commercially can be utilized.

[0097] The above antibodies can be produced by injecting the immunogen, the ErbB4 protein, into a foreign host using conventional methods known to those skilled in the art. Foreign hosts include mammals such as mice, rats, sheep, and rabbits. The immunogen is injected intramuscularly, intraperitoneally, or subcutaneously, and is typically administered with an adjuvant to enhance antigenicity. Blood can be collected periodically from the foreign host, and serum exhibiting titer and antigen-specificity can be collected to isolate antibodies.

[0098] The above term, "aptamer", refers to a type of polynucleotide composed of a special type of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and the characteristic of being able to bind to a target molecule with high affinity and specificity. Aptamers can bind specifically to an antigenic substance in the same way as antibodies, but are composed of polynucleotides that are more stable than proteins, have a simpler structure, and are easy to synthesize, and thus can be used as a substitute for antibodies. Aptamers can be easily produced using techniques well known in the art to which the present invention pertains, and antibodies that are manufactured and sold commercially can be used.

[0099] The above term, "PNA" refers to an artificially synthesized DNA or RNA-like polymer, in which DNA has a phosphate-ribose sugar backbone, whereas PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding affinity and stability to DNA or RNA, and is used in molecular biology, diagnostic analysis, and antisense therapy. The PNA can be further specified by referring to the literature [Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991) "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254(5037): 1497-1500].

[0100] The above "peptide mimetic" is a substance that inhibits the activity of the ErbB4 protein by inhibiting the binding domain of the protein. The peptide mimetic may be a peptide or a non-peptide, and may be composed of amino acids linked by non-peptide bonds, such as psi bonds. In addition, it may be a "conformationally constrained" peptide, a cyclic mimetic, or a cyclic mimetic comprising at least one exocyclic domain, a binding portion (binding amino acids), and an active site. The peptide mimetic may be a novel small molecule that is structured similarly to the secondary structure characteristics of a protein and may mimic the inhibitory properties of a large molecule such as an antibody or a soluble receptor, and may act with an effect equivalent to that of a natural antagonist.

[0101] The above peptide or compound may be any substance that inhibits the activity of the ErbB4 protein, and is not particularly limited.

[0102] In the present invention, the term "prevention" refers to any action that suppresses or delays the onset of a disease by administering a composition according to the present invention. "Treatment" refers to any action that improves or beneficially alters the symptoms of a disease by administering a composition according to the present invention. "Improvement" refers to any action that improves or restores a pathological condition to a near-normal state by administering or ingesting a composition according to the present invention to a subject.

[0103] In the present invention, the ErbB4 expression inhibitor or activity inhibitor may be one that suppresses the expression or activity of ErbB4 in excitatory neurons, and preferably, may be one that suppresses the expression or activity of ErbB4 in excitatory neurons of the brain. The brain may be selected from the group consisting of the cerebrum, hippocampus, cerebellum, thalamus, and brain stem, but is not limited thereto.

[0104] In the present invention, the expression inhibitor or activity inhibitor of ErbB4 may reduce phagocytosis of excitatory synapses.

[0105] In the present invention, the expression inhibitor or activity inhibitor of ErbB4 may reduce the activity of glial cells, and the glial cells may be selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells, but are not limited thereto. That is, the expression inhibitor or activity inhibitor of ErbB4 may reduce the activity of glial cells selected from the group consisting of astrocytes, microglia, oligodendrocytes, ependymocytes, and radial glia cells.

[0106] In the present invention, the expression inhibitor or activity inhibitor of ErbB4 may increase the number of excitatory synapses and decrease the number of inhibitory synapses.

[0107] In the present invention, the expression inhibitor or activity inhibitor of ErbB4 may reduce amyloid plaque.

[0108] In the present invention, it was confirmed that the ErbB4 protein or the gene encoding it has the characteristic of increasing the elimination of excitatory synapses and decreasing the elimination of inhibitory synapses, thereby reducing the number of excitatory synapses and increasing the number of inhibitory synapses. In addition, it was confirmed that the ErbB4 protein or the gene encoding it has the characteristic of increasing the activity of inflammatory glial cells such as glial cells, causing a breakdown in the neural network balance through overactivation of excitatory neurons and underactivation of inhibitory neurons, and causing increased production of amyloid beta and amyloid plaque formation due to increased neural activity, thereby deteriorating cognitive ability.

[0109] Therefore, in the present invention, it was confirmed that the ErbB4 expression inhibitor or activity inhibitor can be used for the prevention, improvement, or treatment of the above-mentioned neurodegenerative diseases, as it has the effect of (i) reducing phagocytosis, i.e., removal, of excitatory synapses through inhibition of expression or activity of ErbB4; (ii) reducing the activity of glial cells; (iii) increasing the number of excitatory synapses and reducing the number of inhibitory synapses; (iv) restoring the neural network balance to normal; (v) reducing amyloid beta production and amyloid plaques; and (vi) restoring cognitive ability.

[0110] In the present invention, the degenerative neurological disease may be selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, amyloidosis, frontotemporal dementia, senile dementia, presenile dementia, mild cognitive impairment, fragile X syndrome, and multiple sclerosis, but is not limited thereto.

[0111] The pharmaceutical composition according to the present invention may contain the active ingredient of the present invention alone or may be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may additionally contain an excipient or diluent. As used herein, "pharmaceutically acceptable" refers to a non-toxic composition that is physiologically acceptable and does not typically cause allergic reactions or similar reactions, such as gastrointestinal upset or dizziness, when administered to humans.

[0112] Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc. In addition, various drug delivery materials used for oral administration of peptide formulations may be included. In addition, carriers for parenteral administration may include water, suitable oils, saline solution, aqueous glucose, and glycols, etc., and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, etc. Other pharmaceutically acceptable carriers and formulations may be found in reference to the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

[0113] The composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, rectal, mucosal delivery, or administration in the form of eye drops, and mucosal delivery, transdermal, topical, or eye drop administration is preferred.

[0114] The pharmaceutical composition of the present invention can be formulated as a preparation for oral or parenteral administration, depending on the administration route as described above, and is preferably formulated as a preparation for parenteral administration. For example, in the case of preparations for parenteral administration, they can be formulated in the form of injections, creams, lotions, ointments for external use, oils, moisturizers, gels, aerosols, nasal inhalants, and eye drops by methods known in the art. These formulations are described in a literature (Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995), which is a generally known prescription manual in all fields of pharmaceutical chemistry.

[0115] The total effective amount of the composition of the present invention can be administered to a patient as a single dose, or can be administered by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. Preferably, the preferred total dosage of the pharmaceutical composition of the present invention may be about 0.01 ㎍ to 10,000 mg per 1 kg of patient body weight per day, and most preferably 0.1 ㎍ to 500 mg. However, since the dosage of the pharmaceutical composition is determined by taking into consideration various factors such as the formulation method, administration route, and number of treatments, as well as the patient's age, weight, health status, sex, severity of the disease, diet, and excretion rate, a person having ordinary skill in the art will be able to determine an appropriate effective dosage of the composition of the present invention considering these points. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effects of the present invention.

[0116]

[0117] <Food Composition>

[0118] In addition, the present invention provides a health functional food for preventing or improving a degenerative neurological disease, which contains an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0119] In addition, the present invention provides a composition for improving cognitive ability comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

[0120] The above health functional food may include all foods in the conventional sense, and may be used interchangeably with terms known in the art, such as functional food.

[0121] The term "functional food" of the present invention means a food manufactured and processed using raw materials or ingredients having functionality useful to the human body according to Act No. 6727 on Health Functional Foods, and "functionality" means consumption for the purpose of obtaining a useful effect for health purposes such as regulating nutrients for the structure and function of the human body or physiological action.

[0122] The term "health functional food" of the present invention refers to a food manufactured or processed by using a specific ingredient as a raw material or extracting, concentrating, refining, mixing, etc. a specific ingredient contained in a food raw material for the purpose of health supplementation, and refers to a food designed and processed so that the above-mentioned ingredient can sufficiently exert a bioregulatory function on the body, such as biodefense, regulation of biological rhythm, prevention and recovery from disease, etc., and the above-mentioned health food composition can perform functions related to disease prevention and disease recovery.

[0123] There is no limitation on the types of foods in which the composition of the present invention can be used. In addition, the composition of the present invention can be prepared by mixing other appropriate auxiliary ingredients that can be included in foods and known additives according to the selection of a person skilled in the art. Examples of foods to which the composition can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and the extract according to the present invention and its fractions can be prepared by adding them to juice, tea, jelly, and juice, etc. made with the extract and its fractions as main ingredients.

[0124] In addition, foods applicable to the present invention may include all foods, such as special nutritional foods (e.g., formula milk, infant and toddler food, etc.), processed meat products, fish products, tofu, starch, noodles (e.g., ramen, noodles, etc.), health supplements, seasoned foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery (e.g., snacks), processed dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickled vegetables, etc.), beverages (e.g., fruit and vegetable beverages, soy milk, fermented beverages, etc.), natural seasonings (e.g., ramen soup, etc.).

[0125] When the health functional food composition of the present invention is used in the form of a beverage, it may contain various sweeteners, flavoring agents, or natural carbohydrates as additional ingredients, just like conventional beverages. In addition to the above, the health functional food composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.

[0126]

[0127] Treatment Methods

[0128] Additionally, the present invention provides a method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising a therapeutically effective amount of an expression inhibitor or activity inhibitor of ErbB4.

[0129] The present invention also provides a method for improving cognitive ability, comprising administering to a subject a composition comprising a therapeutically effective amount of an expression inhibitor or an activity inhibitor of ErbB4.

[0130] The above therapeutically effective amount is preferably applied differently depending on various factors including the type and degree of the response to be achieved, the specific composition including whether other agents are used in some cases, the age, body weight, general health, sex and diet of the subject, the time of administration, the route of administration and the secretion rate of the composition, the treatment period, drugs used together or simultaneously with the specific composition, and similar factors well known in the medical field. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned matters.

[0131] The above object is applicable to any mammal, which includes not only humans and primates, but also livestock such as cows, pigs, sheep, horses, dogs and cats.

[0132]

[0133] <Diagnostic composition>

[0134] The present invention provides a biomarker composition for diagnosing a neurodegenerative disease comprising an ErbB4 protein or a gene encoding the same.

[0135] The term "diagnosis" in the present invention refers to confirming the presence or characteristics of a pathological condition. In the present invention, the diagnosis can be interpreted as confirming the progression or onset of a neurodegenerative disease.

[0136] In the present invention, the degenerative neurological disease may be selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, amyloidosis, frontotemporal dementia, senile dementia, presenile dementia, mild cognitive impairment, fragile X syndrome, and multiple sclerosis, but is not limited thereto.

[0137] In addition, the present invention provides a composition for diagnosing a neurodegenerative disease, comprising a preparation capable of measuring the expression level of ErbB4 protein or a gene encoding the same.

[0138] In the present invention, the ErbB4 protein or a gene encoding the same may be expressed in an excitatory neuron.

[0139] In the present invention, the agent capable of measuring the expression level of the protein may be selected from the group consisting of antibodies, oligopeptides, ligands, aptamers, and PNA (peptide nucleic acid) that specifically bind to the protein or a fragment thereof, but is not limited thereto.

[0140] The term "antibody" as used herein refers to a specific immunoglobulin directed against an antigenic site, and includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and combinations thereof. It also includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, and complete forms having two full-length light chains and two full-length heavy chains, as well as functional fragments of antibody molecules, such as Fab, F(ab'), F(ab')2, and Fv. Antibodies can be readily produced using techniques well known in the art, and antibodies that have been produced and sold commercially can be utilized.

[0141] The above term, "aptamer", refers to a type of polynucleotide composed of a special type of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and the characteristic of being able to bind to a target molecule with high affinity and specificity. Aptamers can bind specifically to an antigenic substance in the same way as antibodies, but are composed of polynucleotides that are more stable than proteins, have a simpler structure, and are easy to synthesize, and thus can be used as a substitute for antibodies. Aptamers can be easily produced using techniques well known in the art to which the present invention pertains, and antibodies that have been manufactured and sold commercially can be used.

[0142] The above term, "PNA" refers to an artificially synthesized DNA or RNA-like polymer, in which DNA has a phosphate-ribose sugar backbone, whereas PNA has a repeated N-(2-aminoethyl)-glycine backbone linked by peptide bonds, which greatly increases binding affinity and stability to DNA or RNA, and is used in molecular biology, diagnostic analysis, and antisense therapy. The PNA can be further specified by referring to the literature [Nielsen PE, Egholm M, Berg RH, Buchardt O (December 1991) "Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide". Science 254(5037): 1497-1500].

[0143] In the present invention, the agent capable of measuring the expression level of the gene may be selected from the group consisting of a primer, a probe, and an antisense oligonucleotide that specifically bind to the mRNA of the gene, but is not limited thereto.

[0144] The term "primer" as used herein refers to a short sequence of bases with a free 3' hydroxyl group at the terminal end, capable of forming base pairs with a complementary template and serving as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a polymerization reagent (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art to which the present invention pertains.

[0145] The term "probe" above refers to a nucleic acid fragment, such as RNA or DNA, that can specifically bind to a gene and is labeled to enable detection of the presence or absence of a specific gene and its expression level. The probe can be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc. The selection of an appropriate probe and hybridization conditions can be appropriately selected according to techniques known in the art to which the present invention pertains.

[0146] The term "antisense oligonucleotide" refers to a DNA or RNA or derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence within the mRNA and inhibits the translation of the mRNA into protein. An antisense oligonucleotide sequence refers to a DNA or RNA sequence that is complementary to the mRNA of the above genes and is capable of binding to the mRNA.

[0147] In addition, the present invention provides a diagnostic kit for a degenerative neurological disease comprising the diagnostic composition for the degenerative neurological disease.

[0148] In the present invention, the kit may be selected from the group consisting of an RT-PCR kit, a real-time qRT-PCR kit, a DNA chip kit, an ELISA kit, a protein chip kit, and a rapid kit, but is not limited thereto.

[0149] The above RT-PCR kit may include, in addition to each primer set specific for a marker gene, a test tube or other appropriate container, a reaction buffer (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC water, sterile water, etc. In addition, it may include a primer set specific for a gene used as a quantitative control.

[0150] The above real-time qRT-PCR kit may include each primer set and probe specific for a marker gene, and may also include a test tube or other appropriate container, a reaction buffer (with varying pH and magnesium concentrations), deoxynucleotides (dNTPs), DNA polymerase, DNase, RNAse inhibitors, DEPC-water, sterile water, etc. In addition, it may include a primer set specific for a gene used as a quantitative control.

[0151] The above DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, preparations, enzymes, etc. for producing a fluorescent label probe. In addition, the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof.

[0152] The ELISA kit may include a monoclonal antibody, polyclonal antibody or recombinant antibody specific for a protein, and may also include reagents capable of detecting the bound antibody, such as labeled secondary antibodies, chromophores, enzymes (e.g., conjugated to the antibody) and their substrates or other substances capable of binding to the antibody.

[0153] The above protein chip kit may include a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, a chromogenic substrate, etc. for immunological detection of antibodies. In the above, the substrate may be a nitrocellulose membrane, a 96-well plate synthesized with a polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, a glass slide glass, etc., the chromogenic enzyme may be peroxidase or alkaline phosphatase, the fluorescent substance may be FITC, RITC, etc., and the chromogenic substrate solution may be ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)), OPD (o-phenylenediamine), or TMB (tetramethyl benzidine).

[0154] The above rapid kit is a kit that can quickly conduct a test using a small amount of sample, and a substance that can bind to the analyte contained in the sample, i.e. an antibody that can specifically bind to a protein, can be used.

[0155] In addition, the present invention provides a method for providing information for diagnosing a neurodegenerative disease, comprising the steps of (a) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from a biological sample; and (b) comparing the expression level of the ErbB4 protein or the gene encoding the same with a reference value obtained from a control sample.

[0156] In the present invention, a step of determining that a neurodegenerative disease is present when the expression level of the ErbB4 protein or the gene encoding it is higher than the reference value obtained from a control sample may be additionally included.

[0157] In the present invention, the expression level of the ErbB4 protein or the gene encoding it being higher than the reference value obtained from the control sample may mean that it is higher than the average expression level in the control sample. In particular, the expression level of the ErbB4 protein or the gene encoding it may be at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, or 21% higher than the average expression level in the control sample. 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 400%, If it increases by 500%, 600%, 700%, 800%, or 900% or more, it can be judged as a degenerative neurological disease.

[0158] That is, the expression level of the ErbB4 protein or the gene encoding it is at least 1.05 times, 1.06 times, 1.07 times, 1.08 times, 1.09 times, 1.1 times, 1.11 times, 1.12 times, 1.13 times, 1.14 times, 1.15 times, 1.16 times, 1.17 times, 1.18 times, 1.19 times, 1.2 times, 1.21 times, 1.22 times, 1.23 times, 1.24 times, 1.25 times, 1.26 times, 1.27 times, 1.28 times, 1.29 times, 1.3 times, 1.35 times, 1.4 times, 1.45 times, 1.5 times, 1.55 times, 1.6 times, If it increases by 1.65 times, 1.7 times, 1.75 times, 1.8 times, 1.85 times, 1.9 times, 1.95 times, 2 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6 times, 2.7 times, 2.8 times, 2.9 times, 3 times, 3.1 times, 3.2 times, 3.3 times, 3.4 times, 3.5 times, 3.6 times, 3.7 times, 3.8 times, 3.9 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times or more, it can be judged to be a degenerative neurological disease.

[0159] In the present invention, the expression level of the ErbB4 protein or the gene encoding it being higher than the reference value obtained from the control sample may mean that it is higher than the maximum expression level in the control sample. In this case, the expression level of the ErbB4 protein or the gene encoding it is at least 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, or 21% higher than the average expression level in the control sample. 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 400%, If it increases by 500%, 600%, 700%, 800%, or 900% or more, it can be judged as a degenerative neurological disease.

[0160] That is, the expression level of the ErbB4 protein or the gene encoding it is at least 1.05 times, 1.06 times, 1.07 times, 1.08 times, 1.09 times, 1.1 times, 1.11 times, 1.12 times, 1.13 times, 1.14 times, 1.15 times, 1.16 times, 1.17 times, 1.18 times, 1.19 times, 1.2 times, 1.21 times, 1.22 times, 1.23 times, 1.24 times, 1.25 times, 1.26 times, 1.27 times, 1.28 times, 1.29 times, 1.3 times, 1.35 times, 1.4 times, 1.45 times, 1.5 times, 1.55 times, 1.6 times, If it increases by 1.65 times, 1.7 times, 1.75 times, 1.8 times, 1.85 times, 1.9 times, 1.95 times, 2 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6 times, 2.7 times, 2.8 times, 2.9 times, 3 times, 3.1 times, 3.2 times, 3.3 times, 3.4 times, 3.5 times, 3.6 times, 3.7 times, 3.8 times, 3.9 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times or more, it can be judged to be a degenerative neurological disease.

[0161] In the present invention, the biological sample may be selected from the group consisting of tissue, cell, blood, serum, plasma, lymph, cerebrospinal fluid, saliva, and urine.

[0162] The mRNA expression level is measured using reverse transcriptase polymerase reaction (RT-PCR), competitive RT-PCR, real-time quantitative RT-PCR, RNase protection method, Northern blotting or DNA chip technology, and the protein expression level is measured using western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radial immunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, It can be measured using immunofluorescence, immunochromatography, fluorescence-activated cell sorter analysis (FACS), or protein chip technology.

[0163]

[0164] Animal Model

[0165] In addition, the present invention provides a method for producing an animal model of a neurodegenerative disease, comprising administering to an animal an overexpression vector containing an ErbB4 protein or a gene encoding the protein.

[0166] In addition, the present invention provides an animal model of a degenerative neurological disease manufactured by a method for manufacturing an animal model of a degenerative neurological disease.

[0167] The above animal refers to all animals other than humans, such as mice, rats, and pigs. Preferably, it may be a mammal other than humans.

[0168] The ErbB4 protein can be delivered to animals using any protein delivery method widely known to those skilled in the art, and the method is not particularly limited. The overexpression vector can also be delivered to animals using any vector delivery method widely known to those skilled in the art, and the method is not particularly limited, but is preferably delivered via adeno-associated virus (AAV).

[0169] The above ErbB4 protein or overexpression vector may be delivered to the brain, and may be delivered via stereotaxic injection, but is not limited thereto.

[0170] The above overexpression vector may be a vector including a CaMKIIa promoter (SEQ ID NO: 3) and an ErbB4 gene (SEQ ID NO: 4). The CaMKIIa promoter is linked so as to be specifically expressed only in excitatory neurons. In addition, an HA tag (SEQ ID NO: 5) linked to the ErbB4 gene may be used to confirm expression of the virus. The CaMKIIa promoter and the ErbB4 gene may be linked directly or through a linker, and the ErbB4 gene and the HA tag may also be linked directly or through a linker. Preferably, the above overexpression vector may include the base sequence of SEQ ID NO: 6, but is not limited thereto.

[0171]

[0172] Screening Method

[0173] In addition, the present invention provides a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) administering a candidate substance to an animal model of a neurodegenerative disease; (b) measuring the expression level of an ErbB4 protein or a gene encoding the same isolated from the animal model of a neurodegenerative disease to which the candidate substance has been administered; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0174] In the present invention, a step of measuring the expression level of the ErbB4 protein or the gene encoding it before and after administration of the candidate substance may be additionally included.

[0175] In addition, the present invention provides a method for screening a therapeutic agent for a neurodegenerative disease, comprising the steps of: (a) treating a candidate substance to a cell in which an ErbB4 protein or a gene encoding the same is overexpressed; (b) measuring the expression level of the ErbB4 protein or the gene encoding the same in the cell treated with the candidate substance; and (c) selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding the same is reduced below a reference value.

[0176] In the present invention, a step of measuring the expression level of the ErbB4 protein or the gene encoding it before and after administration of the candidate substance may be additionally included.

[0177]

[0178] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to more specifically illustrate the present invention, and the scope of the present invention is not limited to these examples.

[0179]

[0180] Example 1. Results of snRNAseq (single nucleus RNA sequencing) analysis

[0181] 5xFAD mice, an animal model of Alzheimer's disease (AD), and control (WT) mice were sacrificed at 2 or 3 months of age, and their brains were immediately harvested. Only the hippocampus was isolated and subjected to snRNAseq analysis. snRNAseq analysis was performed in R using the Seurat v3 Vignette, and co-regulated gene network analysis was performed using monocle3.

[0182] First, we performed snRNAseq analysis on the mouse hippocampus and clustered the results, which revealed that 3-month-old 5xFAD mice had a new excitatory neuron population compared to 2-month-old 5xFAD mice or control (WT) mice (Fig. 1). Subsequently, we clustered only the excitatory neuron population from the above results, and confirmed the presence of Cluster 6 in 3-month-old 5xFAD mice, a population that did not exist in 2-month-old 5xFAD mice or control (WT) mice (Fig. 2a). In particular, Cluster 6 accounted for approximately 10% of the total excitatory neuron population in 3-month-old 5xFAD mice, whereas it accounted for less than 1% in 2-month-old 5xFAD mice or control (WT) mice (Fig. 2b).

[0183] Next, we performed DEG (differentially expressed genes) analysis on other clusters in Cluster 6. As a result, it was confirmed that Cluster 6, which exists only in 3-month-old 5xFAD mice, had upregulated genes related to Alzheimer's disease in the KEGG Pathway (Fig. 3). In addition, as a result of performing Co-regulated Gene Network Analysis on the excitatory neuron cluster, it was confirmed that the genes belonging to Module 4 were co-regulated in Cluster 6 of excitatory neurons (Fig. 4a). In addition, compared to other clusters, the most highly expressed gene among the genes belonging to Module 4 was confirmed to be ErbB4 (Erb-B2 Receptor Tyrosine Kinase 4) (Fig. 4b).

[0184]

[0185] Example 2. Analysis of ErbB4 protein expression in excitatory neurons

[0186] To determine whether ErbB4 protein expression was present in the brain tissue of an animal model of Alzheimer's disease, immunohistochemistry (IHC) analysis was performed. Briefly, 4-month-old 5xFAD mice, an animal model of Alzheimer's disease, or control (WT) mice were anesthetized with tribromoethanol, perfused whole-body with phosphate-buffered saline (PBS) into the left ventricle, and fixed by perfusion with 4% PFA (paraformaldehyde). The brains were then collected, placed in 4% PFA, and fixed overnight at 4°C. The solution was replaced with a 30% sucrose-PBS solution and incubated at 4°C for at least 24 hours. The brains were then placed in OCT compound, frozen, sectioned at 30 μm thickness, and stored in PBS containing 0.01% sodium azide.

[0187] For immunohistochemical (IHC) analysis, brain sections were placed in Blocking Solution (4% bovine serum albumin, 0.3% Triton-X100 in PBS) and left at room temperature for 1 hour and 30 minutes. Afterwards, primary antibodies against PV (Parvalbumin), NeuN (Neuronal nuclear antigen), and ErbB4 were added to the Blocking Solution and left overnight at 4°C. The following day, the brain sections were washed five times with PBST (0.1% Tween-20 in PBS), and secondary antibodies were added in PBST and left at room temperature for 2 hours. After washing five times with PBST, the brain sections were mounted on slide glass and treated with Trueblack (Biotium, 23007) for 2 minutes at room temperature to eliminate autofluorescence. Afterwards, the cells were washed three times with 1 mL of DW, washed three times, mounted with Antifade Mounting Media (VectorLab, H-1400), covered with a cover glass, and observed with an LSM880 confocal microscope (Carl Zeiss).

[0188] The results of immunohistochemical (IHC) analysis were quantified by distinguishing the areas of ErbB4 protein expression in CA1 neurons of the hippocampus into areas overlapping with PV (Parvalbumin) interneurons (PV-positive, white) and areas that do not overlap with PV but are only within NeuN (PV-negative, yellow). As a result, the expression of ErbB4 protein was significantly increased in 4-month-old 5xFAD mice compared to control (WT) mice, and it was confirmed that the expression of ErbB4 protein was particularly significantly increased in excitatory neurons (Fig. 5a).

[0189] In addition, immunohistochemical (IHC) analysis confirmed that the area of ​​ErbB4 protein expression in the cerebral region of 4-month-old 5xFAD mice overlapping with Pyr (Pyramidal) excitatory neurons was significantly increased compared to control (WT) mice, and that it was overexpressed particularly in the area near amyloid-beta (Fig. 5b).

[0190] From the above results, the present invention confirmed that an increase in ErbB4 protein in the brain hippocampus and excitatory neurons including it is related to the onset of degenerative neurological diseases such as Alzheimer's disease.

[0191]

[0192] Example 3. Confirmation of the onset of neurodegenerative diseases through overexpression of the ErbB4 gene.

[0193] We conducted an experiment to confirm the onset of neurodegenerative diseases through overexpression of ErbB4 in an animal model. Briefly, an overexpression vector containing the CaMKIIa promoter, the open reading frame (ORF) of the ErbB4 gene, and an HA tag was constructed, and the constructed overexpression vector was delivered via adeno-associated virus (AAV) to induce overexpression of the ErbB4 gene in an animal model (Fig. 6). In particular, the CaMKIIa promoter was linked to the overexpression vector to induce overexpression of ErbB4 only in excitatory neurons.

[0194] First, we conducted an experiment to determine whether there was a change in the phagocytosis of excitatory synapses by glial cells when the ErbB4 gene was overexpressed in an animal model. AAV9 was delivered into the CA1 of the hippocampus via stereotaxic injection, and 21 days after stereotaxic injection, the mouse brains were collected and immunohistochemical (IHC) analysis was performed. As a result, it was confirmed that in mice overexpressing the ErbB4 gene, phagocytosis of excitatory synapses by both astrocytes and microglia was significantly increased compared to when control RNA was injected (Fig. 7).

[0195] In addition, an experiment was performed to determine whether there was a change in the activity level of glial cells when the ErbB4 gene was overexpressed. As in the knockout of the ErbB4 gene, the activity of glial cells was confirmed by the S100β, GFAP, and IBA1 regions. As a result, it was confirmed that the overexpression of the ErbB4 gene had the effect of increasing all of the S100β, GFAP, and IBA1 regions (Fig. 8). In addition, it was confirmed that the expression level of AXL, a damage-associated microglia (DAM) marker, was significantly increased despite the absence of amyloid plaques (Fig. 9).

[0196] From the above results, the present invention confirmed that overexpression of ErbB4 is associated with the development of neurodegenerative diseases. Furthermore, it was confirmed that an animal model of neurodegenerative diseases can be created by administering the ErbB4 protein of the present invention or an overexpression vector containing the ErbB4 gene.

[0197]

[0198] Example 4. Therapeutic efficacy of neurodegenerative diseases through inhibition of ErbB4 expression

[0199] 4.1. Construction of a CRISPR-Cas9 construct to suppress the expression of the ErbB4 gene

[0200] Knockout (KO) of the ErbB4 gene was produced by delivering a vector capable of knocking out ErbB4 using the CRISPR-Cas9 system via adeno-associated virus (AAV) (Fig. 10). The vector has a structure in which Cas9 is specifically expressed only in excitatory neurons through the CaMKIIa promoter (SEQ ID NO: 3) and the guide RNA of ErbB4 is expressed through the U6 promoter (SEQ ID NO: 7). Control RNA (GGGTCGGGGCGTATGCGTCTA: SEQ ID NO: 8), sgErbB4 guide 1 (TCTGACCTGGAACAGCAGTA: SEQ ID NO: 9), and sgErbB4 guide 2 (TTAGCGATATTCTTAAACTA: SEQ ID NO: 10) were delivered to control (WT) mice and 4-month-old 5xFAD mice, respectively. That is, the vector contains CaMKIIa - NLS-SaCas9-NLS - HA - bGH poly(A) tail - U6 - guide RNA - Sa gRNA scaffold in the 5' to 3' order. It was confirmed that the vector was well expressed through the HA tag linked to Cas9 (Fig. 10).

[0201]

[0202] 4.2. Effect of ErbB4 gene expression inhibitor on decreased phagocytosis of excitatory synapses

[0203] We performed an experiment to determine whether knockout of the ErbB4 gene through Cas9 in an animal model of neurodegenerative diseases changes the phagocytosis pattern of excitatory synapses by glial cells. For this purpose, expression viruses (AAV9::hSyn-Synaptophysin1-mCherry-EGFP) were used together. The Cas9 virus packaged with AAV9 was delivered to CA1 of the hippocampus, and the expression viruses were delivered to CA3 of the hippocampus. Each virus was delivered via stereotaxic injection, and the coordinates for CA1 were (-2.0, -1.25, -1.5) mm based on the anterior-posterior, medial-lateral, and dorsal-ventral coordinate system, and the coordinates for CA3 were (-2.0, -2.5, -2.2) mm based on the same coordinate system. Twenty-one days after stereotaxic injection, mouse brains were collected and immunohistochemical (IHC) analysis was performed.

[0204] As a result, in the control (WT) mice, there was no difference in the phagocytosis pattern of excitatory synapses by glial cells when the two guide RNAs were injected compared to when the control RNA was injected, whereas in the 5xFAD mice, it was confirmed that the phagocytosis of excitatory synapses by both astrocytes and microglia was significantly reduced when the two guide RNAs were injected compared to when the control RNA was injected (Fig. 11).

[0205] Accordingly, it was confirmed that the present invention has the effect of reducing the elimination of excitatory synapses by suppressing ErbB4 expression.

[0206]

[0207] 4.3. Effect of ErbB4 gene expression inhibitor on the reduction of glial cell activity

[0208] We conducted an experiment to determine whether there were changes in glial cell activity levels when the ErbB4 gene was knocked out using Cas9 in an animal model of neurodegenerative disease. Glial cell activity was determined by astrocyte area measured by S100β, glial fibrillary acidic protein (GFAP) area, an activation marker, and microglia area measured by IBA1 (ionized calcium-binding adaptor molecule 1).

[0209] As a result, in the control (WT) mice, the level of glial cell activity was hardly affected when the two guide RNAs were injected compared to when the control RNA was injected, whereas in the 5xFAD mice, the level of glial cell activity was significantly reduced when the two guide RNAs were injected compared to when the control RNA was injected (Fig. 12).

[0210] Accordingly, it was confirmed that the present invention has the effect of reducing the activity of inflammatory glial cells by suppressing ErbB4 expression.

[0211]

[0212] 4.4. Effects of increasing excitatory synapses and decreasing inhibitory synapses by inhibitors of ErbB4 gene expression

[0213] We conducted an experiment to determine whether there were changes in the number of synapses when the ErbB4 gene was knocked out using Cas9 in an animal model of neurodegenerative diseases. First, in 5xFAD mice, compared to control (WT) mice, the numbers of both excitatory pre-synapses and excitatory postsynapses in the SR (Stratum Radiatum) layer of the hippocampus CA1 decreased through vesicular glutamate transporter 1 (vGLUT1) and postsynaptic density protein 95 (PSD95), respectively, and the numbers of inhibitory pre-synapses and inhibitory postsynapses in the SLM (Stratum Lacunosum Moleculare) layer of the hippocampus increased through vesicular GABA transporter (vGAT) and Gephyrin, respectively (Fig. 13a).

[0214] On the other hand, in 5xFAD mice injected with sgErbB4 guide 2 (SEQ ID NO: 10), the number of both excitatory pre-synapses and excitatory post-synapses was significantly increased, and the number of inhibitory pre-synapses was decreased compared to 5xFAD mice injected with control RNA (sgControl) (Fig. 13b). However, the number of inhibitory post-synapses was not reduced by guide RNA (sgErbB4).

[0215] Accordingly, it was confirmed that the present invention has the effect of increasing the number of excitatory synapses and decreasing the number of inhibitory synapses through suppression of ErbB4 expression.

[0216]

[0217] 4.5. Effect of neural network balance restoration by ErbB4 gene expression inhibitor

[0218] We conducted an experiment to determine whether there were changes in the neural network when the ErbB4 gene was knocked out using Cas9 in an animal model of a neurodegenerative disease. First, in 5xFAD mice, Fos was significantly increased compared to control (WT) mice. + A significant increase in excitatory neurons and SST + Fos in neurons + As neurons were significantly reduced, excitatory neurons were hyperactivated and inhibitory neurons were hypoactivated (Fig. 15). In contrast, 5xFAD mice injected with guide RNA (sgErbB4) showed increased Fos + Decreased excitatory neurons, SST + Fos in neurons + As neurons increased, the neuronal network balance that was disrupted in the excitatory neurons of Alzheimer's disease was restored to normal (Fig. 14).

[0219] Accordingly, the present invention confirmed that neural network balance can be restored to normal by suppressing ErbB4 expression in excitatory neurons.

[0220]

[0221] 4.6. Amyloid plaque reduction effect by ErbB4 gene expression inhibitor

[0222] We conducted an experiment to determine whether knockout of the ErbB4 gene via Cas9 in an animal model of neurodegenerative disease would alter indicators associated with amyloid plaques. As a result, we confirmed that the expression of AXL, a damage-associated microglia marker, in microglia was significantly reduced in 5xFAD mice injected with two guide RNAs compared to when injected with control RNA (Fig. 15). In addition, we confirmed that amyloid plaques were also significantly reduced in 5xFAD mice injected with sgErbB4 guide 2 compared to when injected with control RNA (Fig. 15).

[0223] Accordingly, it was confirmed that the present invention has the effect of reducing amyloid plaques by suppressing ErbB4 expression.

[0224]

[0225] 4.7. Cognitive ability recovery effect by ErbB4 gene expression inhibitor

[0226] We conducted experiments to determine whether knocking out the ErbB4 gene via Cas9 in an animal model of a neurodegenerative disease alters cognitive abilities. Three weeks after knocking out ErbB4 in excitatory neurons, behavioral tests were conducted, in the following order: spontaneous alternation, novel object location, and novel object recognition.

[0227] Voluntary alternation is an experiment in which a rat is placed in a Y-shaped maze and the order in which the rat explores the arms is observed for 8 minutes. This test is used to assess short-term spatial working memory and indirectly reflects the rat's sequential memory retention and executive function. Normal rats remember the arms they have already entered, so they explore the three arms of the Y maze alternately. Rats with poor spatial working memory repeatedly enter arms they have already entered or exhibit irregular exploration order.

[0228] The novel object location experiment begins with a habituation process in which rats become accustomed to a square chamber measuring 30cm x 30cm x 30cm (width x length x height). Tape indicating the direction of the chamber is attached to the walls at a height that the rats cannot reach so that they know the direction. Habituation lasts for 10 minutes. 24 hours later, a training process is conducted. During this process, two identical objects are placed in the chamber and the rats are allowed to interact with the objects for 10 minutes. 24 hours after the training process, a test process begins. During this process, the location of one of the two objects is switched and the rats are allowed to interact with each object for 10 minutes. This experiment is used to determine the spatial memory ability of rats. Normal rats interact more with objects that have been moved to a new location and spend a relatively longer time interacting with them. In contrast, mice with impaired spatial memory are less responsive to changes in the position of objects and show similar levels of interest in both objects.

[0229] The novel object recognition experiment, like the novel object location experiment, involves the same habituation and training process in the same chamber. Twenty-four hours after training, a test is initiated, during which one of the objects is replaced with a novel object. Furthermore, the rats' interactions with the novel object are assessed over a 10-minute period. This test primarily assesses long-term memory and cognitive responses to novel stimuli. Normal rats spend relatively longer interacting with the novel object, but in rats with impaired memory, the interaction time for each object is similar, and the difference disappears.

[0230] As a result, in 5xFAD, all three behavioral aspects, Spontaneous Alternation, Novel Object Location, and Novel Object Recognition, were found to be impaired compared to control (WT) mice, whereas in 5xFAD mice injected with sgErbB4 guide 2, all three behavioral aspects were significantly recovered to a level similar to that of control (WT) mice (Fig. 16).

[0231] Accordingly, the present invention confirmed that reduced cognitive ability can be restored by suppressing ErbB4 expression in excitatory neurons.

[0232]

[0233] 4.8. Conclusion

[0234] From the above results, the present invention has the effect of (i) reducing phagocytosis, i.e., removal, of excitatory synapses through suppression of ErbB4 expression; (ii) reducing the activity of inflammatory glial cells; (iii) increasing the number of excitatory synapses and reducing the number of inhibitory synapses; (iv) restoring normal neural network balance; (v) reducing amyloid plaques; and (vi) restoring cognitive ability, and thus it was confirmed that an ErbB4 expression or activity inhibitor can be usefully used for the prevention, improvement, or treatment of neurodegenerative diseases.

[0235]

[0236] Example 5. Further verification of the therapeutic efficacy of ErbB4 expression suppression for neurodegenerative diseases.

[0237] An experiment was conducted to further verify the therapeutic efficacy of shRNA that can reduce or suppress the expression of the ErbB4 gene in an animal model of neurodegenerative disease. Briefly, shRNA (shErbB4, Origene TR519049 product: TGCGGTCTATCCGAGAAGTCACAGGCTAC, SEQ ID NO: 11) was delivered to the neuronal neurons of the animal model via stereotaxic injection, and 21 days after stereotaxic injection, the mouse brains were collected and immunohistochemical (IHC) analysis was performed.

[0238] As a result, it was confirmed that ErbB4 in excitatory neurons was significantly reduced in 5xFAD mice injected with shRNA (shErbB4) compared to the control group (Fig. 17). In addition, it was confirmed that in 5xFAD mice injected with shRNA (shErbB4), the number of excitatory pre-synapses (vGLUT1) significantly increased and the number of inhibitory pre-synapses (vGAT) significantly decreased compared to 5xFAD mice injected with control RNA (shControl) (Fig. 18).

[0239] Accordingly, it was confirmed that the present invention has the effect of restoring synapse changes that appear in neurodegenerative diseases, such as increasing the number of excitatory synapses and decreasing the number of inhibitory synapses, by suppressing the expression of the ErbB4 gene by shRNA in addition to sgRNA or gRNA.

[0240] From the above results, it was confirmed that the present invention can be usefully used to prevent, improve or treat neurodegenerative diseases by suppressing ErbB4 expression and inhibiting ErbB4 expression.

[0241]

[0242] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. For example, each component described as a single entity may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined manner.

[0243] The scope of the present invention is indicated by the claims set forth below, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

Claims

1. A pharmaceutical composition for the prevention or treatment of a neurodegenerative disease, comprising an expression inhibitor or activity inhibitor of ErbB4 (erb-b2 receptor tyrosine kinase 4) as an active ingredient.

2. In paragraph 1, A pharmaceutical composition wherein the above expression inhibitor is selected from the group consisting of miRNA (microRNA), siRNA (small interfering RNA), shRNA (small hairpin RNA), sgRNA (single guide RNA), gRNA (guide RNA), antisense oligonucleotide, and ribozyme that specifically bind to the mRNA of ErbB4.

3. In paragraph 1, A pharmaceutical composition, wherein the above-mentioned activity inhibitor is selected from the group consisting of antibodies, aptamers, PNA (peptide nucleic acid), peptides, peptide mimetics and compounds that specifically bind to the ErbB4 protein.

4. In paragraph 1, A pharmaceutical composition wherein the above ErbB4 expression inhibitor or activity inhibitor inhibits the expression or activity of ErbB4 in excitatory neurons.

5. In paragraph 1, A pharmaceutical composition wherein the above ErbB4 expression inhibitor or activity inhibitor reduces phagocytosis of excitatory synapses.

6. In paragraph 1, A pharmaceutical composition wherein the above ErbB4 expression inhibitor or activity inhibitor reduces the activity of glial cells.

7. In paragraph 1, A pharmaceutical composition wherein the above ErbB4 expression inhibitor or activity inhibitor increases the number of excitatory synapses and decreases the number of inhibitory synapses.

8. In paragraph 1, A pharmaceutical composition wherein the above ErbB4 expression inhibitor or activity inhibitor reduces amyloid plaque.

9. In paragraph 1, A pharmaceutical composition, wherein the above-mentioned neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, amyloidosis, frontotemporal dementia, senile dementia, presenile dementia, mild cognitive impairment, fragile X syndrome, and multiple sclerosis.

10. A health functional food for the prevention or improvement of degenerative neurological diseases, containing an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

11. A method for preventing or treating a neurodegenerative disease, comprising administering to a subject a composition comprising a therapeutically effective amount of an expression inhibitor or activity inhibitor of ErbB4.

12. A composition for improving cognitive ability comprising an expression inhibitor or activity inhibitor of ErbB4 as an active ingredient.

13. A biomarker composition for diagnosis of a neurodegenerative disease comprising the ErbB4 protein or a gene encoding the same.

14. In paragraph 13, A biomarker composition wherein the ErbB4 protein or a gene encoding the same is expressed in an excitatory neuron.

15. In paragraph 13, A biomarker composition wherein the ErbB4 protein or a gene encoding the same increases phagocytosis of excitatory synapses.

16. In paragraph 13, A biomarker composition wherein the ErbB4 protein or a gene encoding the same increases the activity of glial cells.

17. In paragraph 13, A biomarker composition wherein the ErbB4 protein or a gene encoding the same reduces the number of excitatory synapses and increases the number of inhibitory synapses.

18. In paragraph 13, A biomarker composition wherein the ErbB4 protein or a gene encoding the same increases amyloid plaque.

19. A composition for diagnosing a neurodegenerative disease, comprising a preparation capable of measuring the expression level of ErbB4 protein or a gene encoding the same.

20. In paragraph 19, A diagnostic composition wherein the ErbB4 protein or a gene encoding the same is expressed in an excitatory neuron.

21. In paragraph 19, A diagnostic composition, wherein the agent capable of measuring the expression level of the protein is selected from the group consisting of antibodies, oligopeptides, ligands, aptamers, and PNAs (peptide nucleic acids) that specifically bind to the protein or a fragment thereof.

22. In paragraph 19, A diagnostic composition, wherein the agent capable of measuring the expression level of the gene is selected from the group consisting of a primer, a probe, and an antisense oligonucleotide that specifically bind to the mRNA of the gene.

23. A diagnostic kit for a neurodegenerative disease comprising a diagnostic composition according to any one of claims 19 to 22.

24. In paragraph 23, The above kit is selected from the group consisting of RT-PCR kit, real-time qRT-PCR kit, DNA chip kit, ELISA kit, protein chip kit and rapid kit. 25.(a) a step of measuring the expression level of ErbB4 protein or a gene encoding the same isolated from a biological sample; and (b) A method for providing information for diagnosing a neurodegenerative disease, comprising a step of comparing the expression level of the ErbB4 protein or the gene encoding it with a reference value obtained from a control sample.

26. In paragraph 25, An information providing method, further comprising a step of determining that a neurodegenerative disease is present when the expression level of the ErbB4 protein or the gene encoding it is higher than the reference value obtained from a control sample.

27. In paragraph 25, A method for providing information, wherein the biological sample is selected from the group consisting of tissue, cell, blood, serum, plasma, lymph, cerebrospinal fluid, saliva, and urine.

28. A method for producing an animal model of a neurodegenerative disease, comprising administering to an animal an overexpression vector containing an ErbB4 protein or a gene encoding the protein.

29. An animal model of a neurodegenerative disease manufactured by the manufacturing method according to Article 28. 30.(a) A step of administering a candidate substance to an animal model of a neurodegenerative disease according to Article 29; (b) a step of measuring the expression level of the ErbB4 protein or the gene encoding it isolated from an animal model of a neurodegenerative disease to which the candidate substance has been administered; and (c) A screening method for a treatment agent for a neurodegenerative disease, comprising a step of selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding it is reduced below a reference value.

31. In paragraph 30, A screening method, further comprising a step of measuring the expression level of the ErbB4 protein or the gene encoding it before and after administration of the candidate substance. 32.(a) A step of treating a candidate substance to a cell in which the ErbB4 protein or a gene encoding the same is overexpressed; (b) a step of measuring the expression level of ErbB4 protein or a gene encoding it in cells treated with the candidate substance; and (c) A screening method for a treatment agent for a neurodegenerative disease, comprising a step of selecting a candidate substance in which the expression level of the ErbB4 protein or the gene encoding it is reduced below a reference value.

33. In paragraph 32, A screening method, further comprising a step of measuring the expression level of the ErbB4 protein or the gene encoding it before and after administration of the candidate substance.

Images