Engineered circularized pegrnas and uses thereof

Abstract

The technology described herein relates to circularized prime editing guide RNAs (cpegRNAs) comprising at least a spacer, a gRNA scaffold, a primer binding site, and a template sequence with one or more nucleotide changes relative to a target sequence. The disclosure also provides compositions and prime editing systems comprising the pegRNAs and uses thereof for prime editing.

Description

Attorney Docket No.701586-000133WOPT ENGINEERED CIRCULARIZED pegRNAs AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application 63 / 631,858 filed on April 9, 2024, the content of which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The technology described herein relates to circularized prime editing guide RNAs (cpegRNAs), compositions and prime editing systems comprising same and uses thereof. BACKGROUND

[0003] Genomic modification technologies have a wide range of therapeutic and agricultural applications. Prime editors (PEs) are modular molecular machines that can engineer directed base substitution, deletion, or insertion modifications within the genome of the mammalian and plant cells. Prime editor guide RNAs (pegRNAs) direct the PE molecular machinery for the synthesis of the desired genomic alteration. The design and stability of pegRNAs play essential roles in defining PE performance and require multiple rounds of iterative screening. Nevertheless, PEs function less efficiently in Mismatch Repair (MMR) competent cells that account for most of the therapeutically relevant target cell types. Thus, there remains a need in the art for compositions and methods capable of efficient prime editing in MMR competent cells. The present disclosure addresses this need. SUMMARY

[0004] Prime editing is a cutting-edge genetic engineering technique designed to correct a wide range of human mutations. Traditional prime editing systems utilize linear prime editing guide RNA (pegRNA), which often degrades quickly within cells, leading to low efficiency, especially in therapeutic applications involving mismatch repair (MMR) competent cells. To address these challenges, a system using involving circularized pegRNA (cpegRNA) is disclosed herein. The circularized form of pegRNA is more stable within cells, evades immune recognition due to the absence of 5' and 3' ends, and overcomes safety concerns associated with the requirement for nicking gRNA. Without wishing to be bound by a theory, cpegRNA significantly enhances the functionality of prime editing proteins, with notable increases in editing efficiency in various cell types. 1 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0005] Described herein are advancements in prime editing technology through the development of a circularized pegRNA (cpegRNA) system. Prime editing has faced challenges in efficiency and stability, particularly in mismatch repair (MMR) competent cells. Traditional linear pegRNA systems degrade quickly within cells, leading to low efficiency in therapeutic applications. Without wishing to be bound by a theory, pegRNAs, e.g.,cpegRNAs and prime editing systems described herein offer a solution by enhancing stability and efficiency, evading immune recognition due to the absence of 5' and 3' ends, and addressing safety concerns associated with nicking gRNA requirements.

[0006] Without wishing to be bound by a theory, the pegRNAs and prime editing systems described herein are compatible with multiple prime editing strategies, including the split PE strategy, which eliminates the need for MCP / MS2 tethering components and allows for packaging in AAV payloads. Additionally, in an aspect of any of the embodiments described herein, is a rotated-pegRNA system to further protect the spacer and primer binding site (PBS) from exonuclease degradation, enhancing stability and editing efficiency. The use of DNA polymerases in the synthesis of circularized rotated pegRNA (cropegRNA) provides additional stability. In an aspect of any of the embodiments described herein, the stability of cpegRNAs show utility for enveloped virus-like particles (eVLP), where the stability of pegRNA is crucial for functionality. Overall, the advancements in cpegRNA technology disclosed herein represent a significant step forward in improving the efficiency and stability of prime editing for therapeutic applications.

[0007] In one aspect, provided herein is a prime editing guide RNA (pegRNA). comprising: (a) a spacer domain comprising a sequence substantially complementary to a region of a first strand of a double-stranded target nucleic acid; (b) a gRNA core domain capable of associating with a nucleic acid programmable DNA binding protein (napDNAbp); (c) a nucleic acid synthesis template domain comprising an edit template domain comprising a sequence having one or more nucleotide changes compared to a second strand of the double-stranded target nucleic acid, and optionally the nucleic acid synthesis template domain further comprises a homology arm domain comprising a sequence substantially complementary the second strand of the double-stranded target nucleic acid; and (d) a primer binding site (PBS) comprising a sequence substantially complementary to a region upstream of the region complementary to the nucleic acid synthesis template domain in the second strand of the double-stranded target nucleic acid, and wherein (i) the pegRNA is circularized, or (ii) the pegRNA comprises a first portion of the gRNA core domain at one of the 5’-end or the 3’-end, and a second portion 2 4922-1525-2775.5Attorney Docket No.701586-000133WOPT of the gRNA core domain at the other of the 5’-end or the 3’-end, and wherein the first and second portions together form the gRNA core domain; or (iii) the pegRNA comprises a first ribozyme and a first ligation sequence positioned 3’ to the first ribozyme at 5’-end, and a second ribozyme and a second ligation sequence positioned 3’ to the second ribozyme at the 3’-end, and wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme and a portion of the second ligation sequence is complementary to a portion of the second ribozyme, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence; and wherein the portion of the first ligation sequence complementary to the portion of the first ribozyme is complementary to the portion of the second ligation sequence complementary to the portion of the second ribozyme.

[0008] In another aspect, provided herein is a prime editing system comprising: (a) a pegRNA described herein or a nucleic acid encoding same; (b) a nucleic acid programmable DNA binding protein (napDNAbp); and (c) a nucleic acid modifying enzyme.

[0009] In yet another aspect, provided herein is a composition comprising a pegRNA described herein or a nucleic acid encoding same. In some embodiments, the composition further comprises napDNAbp or a nucleic acid encoding same; and / or a nucleic acid modifying enzyme or a nucleic acid encoding same.

[0010] In another aspect provided herein is a genome-editing composition comprising a cell modified using a method described herein. In some embodiments, the genome- editing composition is selected from the group consisting of: (a) an autologous, ex vivo CRISPR / Cas9 gene-edited hematopoietic stem cell therapy for the treatment of sickle cell disease or β-thalassemia; (b) an allogeneic CRISPR / Cas9 gene-edited CAR T cell therapy targeting CD19+ malignancies and autoimmune diseases; (c) an allogeneic CRISPR / Cas9 gene-edited CAR T cell therapy targeting CD70 for the treatment of solid tumors and hematological malignancies; (d) an in vivo gene-editing therapy utilizing lipid nanoparticle (LNP) delivery to target ANGPTL3 for cardiovascular disease; (e) an in vivo gene-editing therapy utilizing LNP delivery to target Lp(a) for cardiovascular disease; (f) an in vivo gene-editing therapy utilizing LNP delivery to target hepatic angiotensinogen (AGT) for refractory hypertension; (g) an in vivo gene-editing therapy utilizing LNP delivery to target ALAS1 for acute hepatic porphyria (AHP); (h) an allogeneic, gene-edited, immune-evasive, stem cell-derived beta-cell replacement therapy for Type 1 diabetes mellitus; (i) an ex vivo base editing therapy for sickle cell disease to induce fetal hemoglobin expression; (j) a multiplex base edited anti-CD7 CAR-T cell therapy for the 3 4922-1525-2775.5Attorney Docket No.701586-000133WOPT treatment of relapsed and refractory T-cell acute lymphoblastic leukemia and T-cell lymphoblastic lymphoma; (k) a liver-targeting LNP-formulated base editing therapy for glycogen storage disease type 1a; (l) a liver-targeting LNP-formulated base editing therapy for Alpha-1 antitrypsin deficiency; (m) an ex vivo autologous hematopoietic stem cell therapy for the treatment of p47^phox Chronic Granulomatous Disease; (n) an ex vivo hematopoietic stem cell therapy utilizing a prime editing approach for X-linked Chronic Granulomatous Disease; (o) an in vivo prime editing therapy targeting ATP7B for the treatment of Wilson’s Disease; and (p) an in vivo prime editing therapy targeting mutations associated with cystic fibrosis.

[0011] In still another aspect provided herein is a kit comprising a pegRNA described herein or a nucleic acid encoding same. In some embodiments, the kit further comprises napDNAbp or a nucleic acid encoding same; and / or a nucleic acid modifying enzyme or a nucleic acid encoding same.

[0012] In still yet another provided herein is a cell comprising a pegRNA described herein or a nucleic acid encoding same. In some embodiments, the cell further comprises napDNAbp or a nucleic acid encoding same; and / or a nucleic acid modifying enzyme or a nucleic acid encoding same. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a mismatch repair (MMR) deficient cell. In some embodiments, the cell is a mismatch repair (MMR) competent cell. In some embodiments, the cell is selected from the group consisting of hematopoietic stem cells, T cells, liver cells (e.g., hepatocytes, pancreatic islet beta cells, and lung epithelial cells. In some embodiments, the cell is in vitro. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vivo. In some embodiments, the cell is a modified cell. In some embodiments, the target nucleic acid is in a cell. In some embodiments, the cell is human cell.

[0013] In another aspect, provided herein is a method of introducing one or more changes in the nucleotide sequence of a target nucleic acid, the method comprises: contacting a double-stranded target nucleic acid (e.g., DNA) with a prime editing system described herein. In some embodiments, the target nucleic acid is in a cell. Thus, in some embodiments, the method comprises: contacting or administering to the cell comprising the target nucleic acid: (a) a pegRNA described herein or a nucleic acid encoding same; (b) a nucleic acid programmable DNA binding protein (napDNAbp) or a nucleic acid encoding same; and (c) a nucleic acid modifying enzyme or a nucleic acid encoding same. In some embodiments, the method is a therapeutic gene editing method. For example, the method comprises 4 4922-1525-2775.5Attorney Docket No.701586-000133WOPT administering to a target cell selected from the group consisting of: (a) hematopoietic stem cells; (b) T cells; (c) liver cells (hepatocytes); (d) pancreatic islet beta cells; (e) lung epithelial cells.

[0014] In some embodiments of any one of the aspects described herein, the spacer domain is 5’ of the gRNA core domain, the gRNA core domain is 5’ of the nucleic acid synthesis template domain, and the nucleic acid synthesis template domain is 5’ the primer binding site. In some embodiments of any one of the aspects described herein, a first portion of the gRNA core domain is 5’ of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain is 5’ of the primer binding site, the primer binding site is 5’ of the spacer domain, and the spacer domain is 5’ of a second portion of the gRNA core domain, and wherein the first and second portions together form the gRNA core domain. In some embodiments of any one of the aspects described herein, a first ligation sequence is 5’ of a portion of the gRNA core domain, the first portion of the gRNA core domain is 5’ of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain is 5’ of the primer binding site, the primer binding site is 5’ of the spacer domain, the spacer domain is 5’ of the second portion of the gRNA core domain, and a second portion of the gRNA core domain is 5’ of a second ligation sequence, and wherein the first and second portions together form the gRNA core domain, and optionally, a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

[0015] In some embodiments of any one of the aspects described herein, the first linking domain does not form a secondary structure. In some other embodiments, the first linking domain forms at least one secondary structure, (e.g., a hairpin).

[0016] In some embodiments of any one of the aspects described herein, the second linking domain does not form a secondary structure. In some other embodiments, the second linking domain forms at least one secondary structure, (e.g., a hairpin).

[0017] In some embodiments of any one of the aspects described herein, the pegRNA is a RNA:DNA chimera.

[0018] In some embodiments of any one of the aspects described herein, nucleic acid synthesis template domain is a template for an RNA-dependent polymerase (e.g., reverse transcriptase). In some embodiments of any one of the aspects described herein, the nucleic acid synthesis template domain is a template for a DNA-dependent polymerase (e.g., DNA polymerase, such as Bsu polymerase or phiDNA polymerase). In some embodiments of any one of the aspects described herein, at least a part of the nucleic acid synthesis template domain comprises a sequence substantially complementary to a 5 4922-1525-2775.5Attorney Docket No.701586-000133WOPT region downstream of a nick region in a second strand of the double-stranded target nucleic acid. In some embodiments of any one of the aspects described herein, the nucleic acid synthesis template domain and the primer binding site are directly adjacent to each other. In some embodiments of any one of the aspects described herein, the nucleic acid synthesis template domain is positioned 5’ to the primer binding site.

[0019] In some embodiments of any one of the aspects described herein, the one or more nucleotide changes comprises insertions of one or more nucleotides, substitutions of one or more nucleotides, deletions of one or more nucleotides, or a combination of any such nucleotide changes, as compared to the double-stranded target DNA sequence.

[0020] In some embodiments of any one of the aspects described herein, the primer binding site is from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, from 7 to 17 nucleotides, or from 50 nucleotides to 300 nucleotides in length. In some embodiments of any one of the aspects described herein, the primer binding site comprises a sequence having 100% complementarity to a region upstream of the nick site in the second strand of the double-stranded target nucleic acid.

[0021] In some embodiments of any one of the aspects described herein, the spacer domain is from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, from 7 to 17 nucleotides in length, or from 20 nucleotide to 200 nucleotides. In some embodiments of any one of the aspects described herein, the spacer domain comprises a sequence having 100% complementarity to the first strand of the double-stranded target nucleic acid, or the spacer domain comprises a sequence having one or more (e.g., 1, 2, 3, 4, or 5) mismatches with the first strand of the double- stranded target nucleic acid.

[0022] In some embodiments of any one of the aspects described herein, the gRNA core domain comprises one or more secondary structures. In some embodiments of any one of the aspects described herein, the gRNA core domain comprises at least one (e.g., two, three or more) hairpins. In some embodiments of any one of the aspects described herein, the gRNA core domain comprises a nucleotide sequence having at least 80% identity to a sequence selected from the group consisting of: GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 1); and 6 4922-1525-2775.5Attorney Docket No.701586-000133WOPT GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGGACCGAGTCGGTCC (SEQ ID NO: 572).

[0023] In some embodiments of any one of the aspects described herein, the gRNA core domain comprises a nucleotide sequence having 1, 2, 3, 4, 5 or more mutations relative to SEQ ID NO: 1 or 572.

[0024] In some embodiments of any one of the aspects described herein, the pegRNA comprises an RNA-binding protein recruitment domain. In some embodiments of any one of the aspects described herein, the pegRNA does not comprise an RNA-binding protein recruitment domain. In some embodiments of any one of the aspects described herein, the RNA-binding protein recruitment domain is positioned 3’ to the primer binding site. In some embodiments of any one of the aspects described herein, the RNA-binding protein recruitment domain is positioned 5’ to the primer binding site. In some embodiments of any one of the aspects described herein, the RNA-binding protein recruitment domain is positioned 3’ to the spacer. In some embodiments of any one of the aspects described herein, the RNA-binding protein recruitment domain is positioned 5’ to the spacer. In some embodiments of any one of the aspects described herein, the RNA- binding protein recruitment domain is an aptamer sequence. In some embodiments of any one of the aspects described herein, the aptamer sequence is a MS2 aptamer sequence.

[0025] In some embodiments of any one of the aspects described herein, the pegRNA is circularized. In some embodiments of any one of the aspects described herein, the pegRNA comprises a first portion of the gRNA core domain at one of the 5’-end or the 3’- end, and a second portion of the gRNA core domain at the other of the 5’-end or the 3’- end, and wherein the first and second portions together form the gRNA core domain.

[0026] In some embodiments of any one of the aspects described herein, the pegRNA comprises a first ribozyme and a first ligation sequence positioned 3’ to the first ribozyme at 5’-end, and a second ribozyme and a second ligation sequence positioned 3’ to the second ribozyme at the 3’-end, and wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme and a portion of the second ligation sequence is complementary to a portion of the second ribozyme, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence; and wherein the portion of the first ligation sequence complementary to the portion of the first ribozyme is complementary to the portion of the second ligation sequence complementary to the portion of the second ribozyme. In some embodiments of any one of the aspects described herein, each of the first ribozyme and the second ribozyme comprises a 7 4922-1525-2775.5Attorney Docket No.701586-000133WOPT sequence that may be cleaved to produce a 5′-OH end and a 2′,3′-cyclic phosphate end. In some embodiments of any one of the aspects described herein, each of the first and the second ribozyme is independently selected from the group consisting of Hammerhead, Hairpin, Hepatitis Delta Virus (“HDV”), Varkud Satellite (“VS”), Vg1, glucosamine-6- phosphate synthase (“glmS”), Twister, Twister Sister, Hatchet, Pistol ribozymes, engineered synthetic ribozymes, or derivatives thereof. In some embodiments of any one of the aspects described herein, each of the first and the second ribozyme is, independently, a split ribozyme or ligand-activated ribozyme derivative. In some embodiments of any one of the aspects described herein, the first ribozyme is a P3 Twister ribozyme and the second ribozyme is a P1 Twister ribozyme. In some embodiments of any one of the aspects described herein, each of the first ligation sequence and the second ligation sequence are substrates for an RNA ligase. In some embodiments of any one of the aspects described herein, each of the first ligation sequence and the second ligation sequence comprise a portion of a tRNA exon sequence or derivative thereof. In some embodiments of any one of the aspects described herein, the RNA ligase is RtcB.

[0027] In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein has nickase activity. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is an RNA guided DNA-binding protein, optionally the nucleic acid programmable DNA binding protein is a CRISPR Cas enzyme, an Argonaute protein, an obligate mobile element guided activity (OMEGA) enzyme, a RuVC nucleases, or a homolog, ortholog or variant thereof. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is selected from the group consisting of: Cas9 (also known as Csnl and Csxl2), Cas1, Cas100, Cas12a (Cpf1), Cas12b, Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas13a (C2c2), Cas13b (C2c6), Cas13c (C2c7), Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Casl, CaslB, CaslO, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csa5, Csa5, CsaX, Csb1, Csb2, Csb3, Csc1, Csc2, C2c5, C2c8, C2c9, C2c10, Cse1, Cse2, Csf1, Csf2, Csf3, Csf4, Csm2, Csm3, Csm4, Csm5, Csm6, Csn2, Csx1, Csx10, Csx14, Csx15, Csx16, Csx17, Csx3, Csy1, Csy2, Csy3, Ago1, Ago2, Ago3, Ago4, Fz TnpB, Fz, IS110 family recombinases (e.g., IS621, and homologs, orthologs and variants thereof. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is a Cas9. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is a mutated Cas9, optionally the mutated Cas9 comprises a dead HNH domain or a dead RuVC domain, and / or the 8 4922-1525-2775.5Attorney Docket No.701586-000133WOPT mutated Cas9 is shorter than a wildtype Cas9. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is Cas9 nickase (nCas9).

[0028] In some embodiments of any one of the aspects described herein, the nucleic acid modifying enzyme is a polymerase, an RNA deaminase, an RNA methylase, an RNA demethylase, a retrotransposon or an integrase fused with a polymerase. In some embodiments of any one of the aspects described herein, the nucleic acid modifying enzyme is a polymerase. In some embodiments of any one of the aspects described herein, the polymerase is an RNA-dependent polymerase (e.g., reverse transcriptase). In some embodiments of any one of the aspects described herein, the reverse transcriptase is a reverse transcriptase from a retrovirus or a retrotransposon. In some embodiments of any one of the aspects described herein, the reverse transcriptase is a Moloney-Murine Leukemia Virus reverse transcriptase (M-MLV RT) or a variant of M-MLV RT. In some embodiments of any one of the aspects described herein, the polymerase is a DNA- dependent polymerase (e.g., DNA polymerase, such as Bsu polymerase or phiDNA polymerase). In some embodiments of any one of the aspects described herein, the nucleic acid modifying enzyme lacks nuclease activity.

[0029] In some embodiments of any one of the aspects described herein, the pegRNA comprises at least one nucleic acid modification. In some embodiments of any one of the aspects described herein, the pegRNA comprises at least one nucleic acid modification selected from the group consisting of modified internucleoside linkages, modified nucleobases, modified sugars, and any combinations thereof.

[0030] In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is not attached or tethered to the nucleic acid modifying enzyme. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein is attached or tethered to the nucleic acid modifying enzyme. In some embodiments of any one of the aspects described herein, the nucleic acid programmable DNA binding protein and the nucleic acid modifying enzyme are comprised in a fusion protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIGS. 1A-1G show Tornado (“Twister-optimized-ribozyme for durable overexpression”) enabled circularization of pegRNA improves base-substitution on a plasmid reporter. FIG. 1 depicts the steps required for Tornado to generate circular pegRNA and alter transition (TAG->TGG) base-substitution on eGFP containing stop- 9 4922-1525-2775.5Attorney Docket No.701586-000133WOPT codon. FIG.1B, linear and Tornado pegRNA were coupled with PE2 to direct eGFP gain- of-function (GoF) and data was analyzed upon gating for mCherry and eGFP positive- cells. FIG. 1C is the histogram representation of the eGFP channel. FIG. 1D, shows a comparison of cpegRNA against epegRNA using PE2 in 293T cells. Mean ± s.d. of n = 3 independent biological replicates. FIG. 1Eshows a further comparison of cpegRNA against epegRNA using PEmax in 293T cells. Mean ± s.d. of n = 3 independent biological replicates. FIG.1F, shows accessing cpegRNA against epegRNA in HeLa cells using PE2. Mean ± s.d. of n = 3 independent biological replicates. FIG.1G, shows further accessing of cpegRNA and epegRNA in HeLa cells using PEmax system. Mean ± s.d. of n = 3 independent biological replicates.

[0032] FIGS.2A-2D show engineering of split PE system using cpegRNA. FIG.2A is a general depiction of the split PE utility using circularized pegRNA. FIG. 2B is an illustration of the pegRNA counterparts coupled with the split PE system. FIG.2C shows a comparison of PE2 and split PE system against linear and cpegRNA counterparts using the wild-type EGFP construct as an internal control. Mean ± s.d. of n = 3 independent biological replicates. FIG. 2D shows RT-PCR verification of the linear (e)pegRNA and cpegRNA using circular and linear primer pairs in HeLa cells. Mean ± s.d. of n = 3 independent biological replicates.

[0033] FIGS. 3A-3F show circularized and rotated-pegRNA enabled site-directed insertion and base-substitution within HEK3 genomic loci. FIGS.3A and 3B show results of inducing 12 types of base modification in HEK3 loci of HEK 293T and HeLa cells using PEmax and circularized pegRNA that bears functionally verified spacer, PBS and RTT domains (2). Mean ± s.d. of n = 3 independent biological replicates. FIGS. 3C and 3Dshowa examination of long-range editing in HEK3 loci of HEK 293T and HeLa cells using PE2max and circularized pegRNA that bears 34-nt RTT domain (2). Mean ± s.d. of n = 3 independent biological replicates. FIGS.3E and 3F show circularized and rotated- pegRNA enabled site-directed insertion and base-substitution within HEK3 genomic loci. Rotated-pegRNA architecture.

[0034] FIGS. 4A-4G show a comparison of circularized cpegRNA to engineered pegRNAs across multiple genomic loci. FIG. A is an illustration of the engineered pegRNA and circularized cpegRNA system. FIGS. 4B-4D show results of inducing FLAG-tag insertion within DMNT1 (FIG.4B), RUNX (FIG.4C) and VEGF (FIG.4D) loci using linear (engineered) pegRNA and circularized cpegRNA counterparts in HEK 293T cells. Mean ± s.d. of n = 3 independent biological replicates. FIGS.4E-4G shows comparison of the FLAG-tag insertion within DMNT1 (FIG.4E), RUNX (FIG.4F) and VEGF (FIG.4G) loci 10 4922-1525-2775.5Attorney Docket No.701586-000133WOPT using linear engineered pegRNA and circularized cpegRNA system in HeLa cells. Mean ± s.d. of n = 3 independent biological replicates.

[0035] FIG.5 shows sample gating using no pegRNA control construct.

[0036] FIG.6 shows the rotated-pegRNA was not able to edit alterations in HEK3 loci of HeLa cells.

[0037] FIG. 7 is a schematic representation of lentiviral based cpegRNA screen against a panel of known disease mutations. The lentiviral library is used to screen for cpegRNA functionality against mutational targets that are supplied downstream of the construct. The integration of the library into the genome, hence, provides a way to infer for the edits using a one-step PCR amplification of the genomic loci. Sample library information is provided in Table 4. The library is adopted from exiting lentiviral screen.

[0038] FIG.8 is a schematic showing coupling of tracrRNA and crRNA within a single rotated pegRNA transcript. In this strategy, the pegRNA is designed to hybridize with its 5’ and 3’ ends around the typical stem formed between the crRNA and tracrRNA. The nicked position can be varied within the tetraloop in addition to stem loop 1, 2 and 3 of the Cas9 gRNA scaffold. The ends of the pegRNA are protected by the CRISPR / Cas enzyme, while the rest of the transcript mimics the structure of the circularized pegRNAs.

[0039] FIG.9 is a schematic depicting use of circularized rotated-pegRNA for prime- editing. The circularization of the rotated pegRNA can be achieved within the tetraloop region of the Cas9 sgRNA scaffold. The circularization event can improve PE functionality due to overcoming possible degradation on the 5’ and 3’ tetraloop domains that are important for PE functionality.

[0040] FIG.10 is a schematic depicting the use of DNA Polymerase (e.g. Phi29 and Bsu) with Rotated-pegRNA for prime-editing. The rotated pegRNA can be made as a DNA:RNA chimera to accommodate DNA polymerase enabled genomic modification. Instead of the RTT domain, the pegRNA can bear DNA Polymerase Template (DPT) that can be synthesized as DNA instead of RNA. The utility of DNA within the rotated pegRNA assures that the genomic synthesis does not extend past the DPT DNA template, which omits possible synthesis of the tracrRNA domain within the genome. The 5’ and 3’ ends of rotated pegRNA can be synthesized with 2’O-methyl groups and phosphorothioate bonds on the first and last three nucleotides. The DNA polymerase mRNA can be supplied either in fusion to Cas9 nickase or supplied as a separate transcript.

[0041] FIG.11 is a schematic depicting use of DNA Polymerase (e.g. Phi29 and Bsu) with Circularized Rotated-pegRNA for prime-editing. The circularized DNA:RNA chimeric 11 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Rotated pegRNA can be used to enhance the stability of the pegRNA for DNA polymerase enabled genomic modifications.

[0042] FIG. 12 depicts the utility of the cpegRNA in Engineered virus-like particles(eVLPs). The eVLPs provide a payload for transient expression of Prime Editor and pegRNA that bears MS2 in the tetraloop domain. The eVLPs utilize fusion between Gag and MCP domain to install MS2 bearing pegRNA within the payload. The PE is embedded in the payload via engineered protease domain fused to Gag domains that bear Nuclear Export Signal (NES) to assure that the Gag domains are not delivered to nucleus with PE protein. The transient expression of the PE and pegRNA within eVLPs require prolong stability since the cargo must be generated via transduction in human cells and stored prior to delivery in vivo applications. The utility of the cpegRNA can enhance eVLPs functionality due to its higher stability.

[0043] FIGS.13A-13 depict Tornado pegRNA coupled with PEmax provides for site- directed insertion and base-substitution within functionally verified HEK3 loci in 293T cells. FIG. 13A,12 types of base modification from position +1 to +8 of the HEK3 loci were examined using Tornado pegRNA via functionally verified spacer, PBS and RTT domains (2). Mean ± s.d. of n = 3 independent biological replicates. FIG.13B depicts examination of long-range PE editing in a verified HEK3 loci using Tornado pegRNA with 34-nt RTT domain (2). Mean ± s.d. of n = 3 independent biological replicates. FIG. 13C shows a comparison of FLAG-tag insertion within HEK3 loci using Tornado and linear pegRNA counterparts in 293T cells (2). Mean ± s.d. of n = 3 independent biological replicates.

[0044] FIGS.14A-14C depict coupling of Tornado pegRNA with split PE2 system. FIG. 14 is a general depiction of the constructs used in the split PE system that either consists of PE2, nCas9, MCP-MMLV and MMLV that are combinatorially coupled to Tornado pegRNA, Tornado MS2 pegRNA and linear pegRNA counterparts. FIG.14B is depiction of the mechanism that couples (Tornado) pegRNA with the split PE system to drive eGFP GoF. FIG. 14C shows results of use of PE2 and split PE system against linear and Tornado pegRNA counterparts. Mean ± s.d. of n = 3 independent biological replicates.

[0045] FIG.15 is schematic showing coupling of tracrRNA and crRNA within a single quasi-circularized pegRNA transcript. In this strategy, the pegRNA is designed to hybridize with its 5’ and 3’ ends around the typical stem formed between the crRNA and tracrRNA. The nicked position can be varied within the tetraloop in addition to stem loop 1, 2 and 3 of the Cas9 gRNA scaffold. The ends of the pegRNA are protected by the CRISPR / Cas enzyme, while the rest of the transcript mimics the structure of the circularized pegRNAs.

[0046] FIG.16 shows sample library preparation. 12 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0047] FIG.17 shows distribution of identified alleles around the cleavage site for the sgRNA GGCCCAGACTGAGCACGTGA (SEQ ID NO: 15). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site. cpegRNA PE2max, 34-nt RT Template in 293T HEK3 cells +12 G to C. DETAILED DESCRIPTION

[0048] In one aspect of any of the embodiments, described herein is a prime editing guide RNA (pegRNA). The pegRNA comprises: (a) a spacer domain; (b) a gRNA core (scaffold) domain capable of associating with a nucleic acid programmable DNA binding protein (napDNAbp); (c) a nucleic acid synthesis template (RTT) domain; and (d) a primer binding site (PBS) comprising a sequence substantially complementary to a region upstream of the region complementary to the nucleic acid synthesis template domain in the second strand of the double-stranded target nucleic acid. In some embodiments of any one of the aspects described herein, the pegRNA is circularized. As used herein, the term “circularized pegRNA” or “circular pegRNA”, abbreviated “cpegRNA”, refers to a pegRNA the 3’- and 5’-end of which are protected against degradation, e.g., degradation by an exonuclease. For example, the cpegRNA lacks one or both of a 3’-OH and / or 5’- OH. In some embodiments, the 3’-end and the 5’-end of the pegRNA are covalently linked to each other.

[0049] The term, “prime editing guide RNA” or “pegRNA” as used herein, refers to a guide RNA molecule that encodes the crRNA-tracrRNA fused to a primer binding site (PBS) and a nucleic acid synthesis template (e.g., a polymerase template) nucleic acid sequence.

[0050] In some embodiments of any one of the aspects described herein, the pegRNA comprises a first portion of the gRNA core domain at one of the 5’-end or the 3’-end, and a second portion of the gRNA core domain at the other of the 5’-end or the 3’-end, and wherein the first and second portions together form the gRNA core domain.

[0051] In some embodiments of any one of the aspects described herein, the pegRNA comprises a first ribozyme and a first ligation sequence positioned 3’ to the first ribozyme at 5’-end, and a second ribozyme and a second ligation sequence positioned 3’ to the second ribozyme at the 3’-end, and wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme and a portion of the second ligation sequence is complementary to a portion of the second ribozyme, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence; and 13 4922-1525-2775.5Attorney Docket No.701586-000133WOPT wherein the portion of the first ligation sequence complementary to the portion of the first ribozyme is complementary to the portion of the second ligation sequence complementary to the portion of the second ribozyme.

[0052] It is noted that the spacer domain, the gRNA core domain, the nucleic acid synthesis template domain, and the primer binding site of the pegRNA can be located or oriented independently of each other in the pegRNA. In some embodiments, the spacer domain is 5’ of the scaffold domain. In some embodiments, the spacer domain is 3’ of the scaffold domain. In some embodiments, the spacer domain is 5’ of the RTT domain. In some embodiments, the spacer domain is 3’ of the RTT domain. In some embodiments, the spacer domain is 5’ of the PBD. In some embodiments, the spacer domain is 3’ of the PBS. In some preferred embodiments, 3’-end of the spacer domain is linked directly to 5’-end of the gRNA core domain, i.e., a RTT domain and / or a PBS is not present between the 3’-end of the spacer domain and the 5’-end of the gRNA core domain.

[0053] In some embodiments, the scaffold domain is 5’ of the nucleic acid synthesis template domain. In some embodiments, the scaffold domain is 3’ of the RTT domain. In some embodiments, the scaffold domain is 5’ of the PBS. In some embodiments, the scaffold domain is 3’ of the PBS. In some preferred embodiments, 3’-end of the scaffold domain is linked directly to 5’-end of the RTT domain, i.e., a spacer domain and / or a PBS is not present between the 3’-end of the gRNA core domain and the 5’-end of the nucleic acid synthesis template domain.

[0054] In some embodiments, the RTT domain is 5’ of the PBS. In some embodiments, the RTT domain is 3’ of the PBS. In some preferred embodiments, 3’-end of the RTT domain is linked directly to 5’-end of the PBS, i.e., a spacer domain and / or a gRNA core domain is not present between the 3’-end of the nucleic acid synthesis template domain and the 5’-end of the PBS.

[0055] In some embodiments of any of the aspects, the nucleic acid synthesis template domain and the primer binding site are directly adjacent to each other. In some embodiments of any of the aspects, the nucleic acid synthesis template domain is positioned 5’ to the primer binding site.

[0056] In some embodiments of any one of the aspects, the pegRNA comprises in a 5′ to 3′ orientation: the spacer domain, the gRNA core domain, the nucleic acid synthesis template domain, and the primer binding site.

[0057] It is noted that a circularized pegRNA does not have a 5’- or 3’-end per se. Thus, in the context of a circularized pegRNA, reference to a 5′ to 3′ orientation means starting with the first domain listed and proceeding in a 5’ to 3’ direction along the 14 4922-1525-2775.5Attorney Docket No.701586-000133WOPT sequence. Thus, the spacer domain is located 5’ of the gRNA core, the gRNA core is located 5’ of the nucleic acid synthesis template domain, and the nucleic acid synthesis template domain is located 5’ of the primer binding site in a pegRNA that comprises in a 5′ to 3′ orientation: the spacer domain, the gRNA core domain, the nucleic acid synthesis template domain, and the primer binding site. Stated in another way, the PBS is located 3’of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain is located 3’ of the gRNA core, and the gRNA core is located 3’ of the spacer domain in a pegRNA that comprises in a 5′ to 3′ orientation: the spacer domain, the gRNA core domain, the nucleic acid synthesis template domain, and the primer binding site.

[0058] In some embodiments of any one of the aspects, the pegRNA comprises in a 5′ to 3′ orientation: a first portion of the gRNA core domain, the nucleic acid synthesis template domain, the primer binding site, the spacer domain, and a second portion of the gRNA core domain, and wherein first and second portions together form the gRNA core domain. Stated in another way, the pegRNA comprises a first portion of the gRNA core domain located 5’ of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain located 5’ of the primer binding site, the primer binding site located 5’ of the spacer domain, and the spacer domain located 5’ of a second portion of the gRNA core domain.

[0059] In some embodiments of any one of the aspects, the pegRNA comprises in a 5′ to 3′ orientation: a first ligation sequence, a first portion of the gRNA core domain, the nucleic acid synthesis template domain, the primer binding site, the spacer domain, a second portion of the gRNA core domain, and a second ligation sequence, and wherein the first and second portions together form the gRNA core domain. For example, the pegRNA comprises in a 5′ to 3′ orientation: a first ligation sequence, a first portion of the gRNA core domain, the nucleic acid synthesis template domain, the primer binding site, the spacer domain, a second portion of the gRNA core domain, and a second ligation sequence, and wherein the first and second portions together form the gRNA core domain, and wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence. Stated in another way, the pegRNA comprises a first ligation sequence located 5’of a first portion of the gRNA core domain, the first portion of the gRNA core domain located 5’ of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain located 5’ of the primer binding site, the primer binding site located 5’ of the spacer domain, the spacer domain located 5’ of a second portion of the gRNA core domain, and the second portion of the gRNA core domain located 5’ of a second ligation sequence, and optionally the first and second portions together form the 15 4922-1525-2775.5Attorney Docket No.701586-000133WOPT gRNA core domain, and / or a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

[0060] In some embodiments of any one of the aspects, the pegRNA comprises in a 5′ to 3′ orientation: a first ribozyme, a first ligation sequence, a first portion of the gRNA core domain, the nucleic acid synthesis template domain, the primer binding site, the spacer domain, a second portion of the gRNA core domain, a second ligation sequence, and a second ribozyme, and optionally the first and second portions together form the gRNA core domain, and / or a portion of the first ligation sequence is complementary to a portion of the second ligation sequence. Stated in another way, the pegRNA comprises a first ribozyme located 5’ of a first ligation, the first ligation sequence located 5’of a first portion of the gRNA core domain, the first portion of the gRNA core domain located 5’ of the nucleic acid synthesis template domain, the nucleic acid synthesis template domain located 5’ of the primer binding site, the primer binding site located 5’ of the spacer domain, the spacer domain located 5’ of a second portion of the gRNA core domain, the second portion of the gRNA core domain located 5’ of a second ligation sequence, the second ligation sequence located 5’ of the second ribozyme, and optionally the first and second portions together form the gRNA core domain, and / or a portion of the first ligation sequence is complementary to a portion of the second ligation sequence.

[0061] In some embodiments of any of the aspects, the pegRNA comprises a first ribozyme and a first ligation sequence positioned 3’ to the first ribozyme at 5’-end, and a second ribozyme and a second ligation sequence positioned 3’ to the second ribozyme at the 3’-end, and wherein a portion of the first ligation sequence is complementary to a portion of the first ribozyme and a portion of the second ligation sequence is complementary to a portion of the second ribozyme, wherein a portion of the first ligation sequence is complementary to a portion of the second ligation sequence; and wherein the portion of the first ligation sequence complementary to the portion of the first ribozyme is complementary to the portion of the second ligation sequence complementary to the portion of the second ribozyme.

[0062] In some embodiments of any of the aspects, the pegRNA is a RNA:DNA chimera. By an “RNA:DNA chimera” is meant the pegRNA comprises both ribonucleotides (e.g., RNA) and deoxyribonucleotides (e.g., DNA). Spacer domain

[0063] Embodiments of the various aspects described herein include a spacer domain. As used herein, a “spacer domain” refers to a nucleotide sequence recognizing a target 16 4922-1525-2775.5Attorney Docket No.701586-000133WOPT sequence. A spacer domain is also referred to a guide sequence herein. Generally, the spacer domain comprises a nucleotide sequence substantially complementary to the desired target site, e.g., a nucleotide sequence complementary to the non-target strand, i.e., the non-edit strand of the double-stranded target nucleic acid.

[0064] In some embodiments, the spacer domain comprises a nucleotide sequence having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the non-edit strand of the target nucleic acid. In some embodiments, the spacer domain comprises a nucleotide sequence having at least 85% (e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to non-edit strand of the target nucleic acid. In some embodiments, the spacer domain comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the non-edit strand of the target nucleic acid. In some embodiments, the spacer domain comprises a nucleotide sequence having at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the non-edit strand of the target nucleic acid. In some embodiments, the spacer domain comprises a nucleotide sequence having 100% (i.e., complete) complementarity to the non-edit strand of the target nucleic acid.

[0065] Without wishing to be bound by a theory, conditional mismatches between the spacer domain sequence and the non-edit strand of the target nucleic acid can allow the nicking event to be solely programmed against a mutation variant of the target rather than the wild-type counterpart. In other words, the spacer can be fully cognate to the mutation but not the wild-type sequence. In some instances, the mismatch in the seed region of the Cas9 gRNA spacer can allow for conditional nicking event. Thus, in some embodiments, the spacer domain comprises a nucleotide sequence having at least 1 (e.g., 2, 3, 4, 5 or more) mismatches with the non-edit strand of the target nucleic acid.

[0066] The length of the spacer domain can range from a few nucleotides to 100s of nucleotides. For example, the spacer domain can be at least 3, at least 4, at least 5, at least 6, at least 7, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 17 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250 or more nucleotides in length. In some embodiments of any one of the aspects, the spacer domain is from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, or from 7 to 17 nucleotides in length. In some preferred embodiments, the spacer domain is from about 15 to about 25 nucleotides in length. 18 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0067] In some embodiments, the spacer domain is from about 15 to about 250 nucleotides in length. For example, from about 20 to about 200 nucleotides in length.

[0068] In some embodiments of any of the aspects, the spacer domain comprises a sequence having 100% complementarity to a first strand (e.g., the non-PAM or non-edit strand) of a double-stranded target nucleic acid, e.g., DNA. In some embodiments of any one of the aspects described herein, the spacer domain comprises one or more, e.g., 1, 2, 3, 4, 5 or more mismatches with the first strand (e.g., the non-PAM or non-edit strand) of a double-stranded target nucleic acid, e.g., DNA. gRNA core domain

[0069] Embodiments of the various aspects descried herein include a gRNA core domain. As used herein, the term “gRNA core domain” or “gRNA scaffold” refers to a nucleotide sequence that is capable of associating with or binding with a nucleic acid programmable DNA binding protein. (napDNAbp). The gRNA core domain is also referred to as a scaffold domain herein.

[0070] The gRNA core domain can be at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 19 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250 or more nucleotides in length. In some embodiments, the gRNA core domain is from about 50 nucleotides to about 250 nucleotides in length. For example, the gRNA core domain is from about 60 nucleotides to about 220 nucleotides, from about 70 nucleotides to about 200 nucleotides, from about 75 nucleotides to about 175 nucleotides, from about 80 nucleotides to about 150 nucleotides, from about 90 nucleotides to about 125 nucleotides, from about 70 nucleotides to about 120 nucleotides, from about 60 nucleotides to about 100 nucleotides, or from about 80 nucleotides to about 100 nucleotides in length.

[0071] A nucleotide sequence of the gRNA core domain can comprise one or more secondary structures, e.g., for associating or binding with a napDNAbp. For example, the gRNA core domain can comprise a nucleotide sequence that capable of forming one or more hairpin or stem-loop structures. In some embodiments, the gRNA core domain comprises 1, 2, 3, 4 or 5 hairpin or stem-loop structures. For exmample, the gRNA core domain comprises 2, 3 or 4 hairpin or stem-loop structures. In some embodiments, the gRNA core domain comprises only 3 hairpin or stem-loop structures. In some embodiments, the gRNA core domain comprises only 4 hairpin or stem-loop structures. In some preferred embodiments, the gRNA core domain comprises only 2 hairpin or stem- loop structures.

[0072] In some embodiments, the gRNA core domain comprises a hairpin or stem- loop strucutre comprising an internal loop and / or bulge loop. For example, the gRNA core domain comprises a hairpin or stem-loop strucutre comprising an internal symmetric or asymmertic loop. In some embodiments, the gRNA core domain comprises a bulge loop. In some embodiments, the gRNA core domain comprises a multi-brach loop. It is noted that a mismatch in a stem or double-stranded region of a hairpin or stem-loop structure can be considred an interanl symmetric loop or bulge.

[0073] In some embodiments, the gRNA core domain comprises a hairpin or stem- loop structure comprising from about 20 nucleotides, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 20 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 42, about 43, about 44, about 45, or about 65 nucleotides. For example, the gRNA core domain comprises a hairpin or stem-loop structure comprising from about 15 to about 45, from about 20 to about 40 or from about 25 to 35 nucleotides. In some embodiments, the gRNA core domain comprises a hairpin or stem-loop structure comprising from about about 25 to 35 (e.g., 26, 27, 28, 29, 30, 31, 32, 33, or 34, such as 28, 29, 30, 31 or 32, preferably 29, 30 or 31) nucleotides and wherein the hairpin or stem-loop structure further comprises an internal symmetric or asymmertic bulge or loop, preferably an asymmertic internal bulge or loop.

[0074] In some embodiments, the gRNA core domain comprises a hairpin or stem- loop structure comprising from about 8 nucleotides, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides. For example, the gRNA core domain comprises a hairpin or stem-loop structure comprising from about 10 to about 20, from about 12 to about 18 or from about 13 to about nucleotides. In some embodiments, the gRNA core domain comprises a hairpin or stem-loop structure comprising from about about 10 to about 20 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19, such as 13, 14, 15, 16, or 17, preferably 14, 15 or 16) nucleotides and wherein the hairpin or stem-loop structure further comprises an internal symmetric or asymmertic bulge or loop, preferably an asymmertic internal bulge or loop. In some embodiments, the gRNA core domain comprises a hairpin or stem-loop structure comprising from about about 10 to about 20 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19, such as 13, 14, 15, 16, or 17, preferably 14, 15 or 16) nucleotides and wherein the hairpin or stem-loop structure further comprises boht an internal symmetric bulge or loop (e.g., a mismatch) and an internal asymmertic bulge or loop.

[0075] In some embodiments, the gRNA core domain comprises a hairpin or stem- loop structure comprising from about about 10 to about 20 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19, such as 13, 14, 15, 16, or 17, preferably 14, 15 or 16) nucleotides and wherein the hairpin or stem-loop structure does not comprise an internal loop or bulge.

[0076] In some embodiments, the gRNA core domain comprises a hairpin or stem- loop structure comprising from about about 7 to about 17 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or 16, such as 10, 11, 12, 13, or 14, preferably 11, 12 or 13) nucleotides.

[0077] In some embodiments, the gRNA core domain comprises comprising a hairpin or stem-loop structure comprising from about about 25 to 35 (e.g., 26, 27, 28, 29, 30, 31, 32, 33, or 34, such as 28, 29, 30, 31 or 32, preferably 29, 30 or 31) nucleotides; a second hairpin or stem-loop structure comprising from about about 10 to about 20 (e.g., 11, 12, 21 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 13, 14, 15, 16, 17, 18 or 19, such as 13, 14, 15, 16, or 17, preferably 14, 15 or 16) nucleotides; a third hairpin or stem-loop structure comprising from about about 7 to about 17 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or 16, such as 10, 11, 12, 13, or 14, preferably 11, 12 or 13) nucleotides; and a fourth hairpin or stem-loop structure comprising from about about 10 to about 20 (e.g., 11, 12, 13, 14, 15, 16, 17, 18 or 19, such as 13, 14, 15, 16, or 17, preferably 14, 15 or 16) nucleotides.

[0078] In some embodiments, the gRNA core domain comprises a nucleotide sequence having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consiting of: GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO: 1); GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGGACCGAGTCGGTCC (SEQ ID NO: 572); and GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 571).

[0079] In some embodiments, the gRNA core domain comprises a nucleotide sequence having at least 85%, e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to one of SEQ ID NO: 1, 571, and 572. For example, the gRNA core domain comprises a nucleotide sequence having at least 90%, e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to one of SEQ ID NO: 1, 571, and 572. In some embodiments, the gRNA core domain comprises a nucleotide sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to one of SEQ ID NO: 1, 571, and 572. In some embodiments, the gRNA core domain comprises a nucleotide sequence having 100%, i.e., complete identity to one of SEQ ID NO: 1, 571, and 572. Nucleic acid synthesis template (RTT) domain

[0080] Embodiments of the various aspects descried herein include a nucleic acid synthesis template (RTT) domain. As used herein, the term “nucleic acid synthesis template domain” refers to the region or portion of a pegRNA that is utilized as a template 22 4922-1525-2775.5Attorney Docket No.701586-000133WOPT strand by a polymerase of a prime editor to encode a 3′ single-strand DNA flap that contains the desired edit and which then, through the mechanism of prime editing, replaces the corresponding endogenous strand of double-stranded nucleic acid at the target site. Generally, the nucleic acid synthesis template domain encodes (by the polymerase) a single-stranded DNA which, in turn, has been designed to be (a) homologous with the target nucleic acid to be edited, and (b) which comprises at least one desired nucleotide change (e.g., a transition, a transversion, a deletion, or an insertion) to be introduced or integrated into the target nucleic acid, e.g., DNA.

[0081] Generally, the nucleic acid template comprising both an edit of interest (e.g., an “edit template domain” and regions of homology (i.e., “homology arm domains”) that are homologous with the 5′ ended single stranded strand (DNA) immediately following the nick site on the PAM strand. The edit template domain can be as small as a single nucleotide substitution, or it may be an insertion, an inversion or transversion. The edit template domain can also include a deletion, which can be engineered by encoding homology arm that contains a desired deletion. It is noted that a sequence of the edit template domain comprises one or more nucleotide changes compared to the second strand (i.e., the edit- strand) of the target nucleic acid. Thus, a sequence of the edit template domain is not fully complementary to the edit-strand. For example, the edit template domain comprises a sequence that has less than 100% (e.g., less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or even) identity to the edit strand of the target nucleic acid.

[0082] The length of the edit template domain can range from a few nucleotides to 1000s of nucleotides. For example, the nucleic acid synthesis template domain can be 1 nucleotide or longer. For example, the edit template can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least at least 67, at least 68, at least 69, at least 70, at least 80, at least 23 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250, at least 275, at least 300, at least 325, at least 350, at least 375, at least 400, at least 425, at least 450, at least 475, at least 500, at least 525, at least 550, at least 575, at least 600, at least 625, at least 650, at least 675, at least 700, at least 725, at least 750, at least 775, at least 800, at least 825, at least 850, at least 875, at least 900, at least 925, at least 950, at least 975, at least 1k, at least 1.5k, at least 2k, at least 2k, at least 2.5k, at least 3k, at least 3.5k, at least 4k, at least 4.5k, at least 5k, at least 5.5k, at least 6k, at least 6.5k, at least 7k, at least 7.5k, at least 8k, at least 8.5k, at least 91k, at least 9.5k, at least 10k or more nucleotides in length. In some embodiments, the edit template can be a single nucleotide.

[0083] Generally, the homology arm domain comprises a nucleotide sequence substantially complementary to the edit-strand of the target nucleic acid. In some embodiments, the homology arm domain comprises a nucleotide sequence substantially complementary to a region of the edit-strand that is downstream of the region of the first 24 4922-1525-2775.5Attorney Docket No.701586-000133WOPT strand (i.e., the non-edit strand) of the target nucleic acid that is complementary to the spacer domain. In some embodiments, the homology arm domain comprises a nucleotide sequence substantially complementary to a region of the edit-strand that is downstream of the region of the first strand (i.e., the non-edit strand) of the target nucleic acid that is complementary to the spacer domain. In some embodiments, the homology arm domain comprises a nucleotide sequence substantially complementary to a region of the edit- strand that overlaps with the region of the first strand (i.e., the non-edit strand) of the target nucleic acid that is complementary to the spacer domain.

[0084] In some embodiments of any of the aspects, the nucleic acid synthesis template comprises a sequence substantially complementary to a region downstream of a nick region in the second strand (i.e., edit strand) of the double-stranded target nucleic acid.

[0085] In some embodiments, the homology arm domain comprises a nucleotide sequence having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the homology arm domain comprises a nucleotide sequence having at least 85% (e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to edit strand of the target nucleic acid. In some embodiments, the homology arm domain comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the homology arm domain comprises a nucleotide sequence having at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the homology arm domain comprises a nucleotide sequence having 100% (i.e., complete) complementarity to the edit strand of the target nucleic acid

[0086] Length of each homology arm can range from a few nucleotides to 10s of nucleotides. For example, each homology arm independently can be at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at 25 4922-1525-2775.5Attorney Docket No.701586-000133WOPT least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 or more nucleotides in length. In some embodiments, each homology arm independently be from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, or from 7 to 17 nucleotides in length.

[0087] In some embodiments, the nucleic acid synthesis template can also include a sequence or secondary structure that causes termination of polymerase activity.

[0088] In some embodiments, the nucleic acid synthesis template domain comprises an edit template flanked by homology arms on both sides. Stated in another way, the nucleic acid synthesis template domain comprises in series, a first homology arm, an edit template, and a second homology arm.

[0089] The length of the nucleic acid synthesis template domain comprising the edit template domain and the homology arm domain can range from a few nucleotides to 1000s of nucleotides. For example, the nucleic acid synthesis template domain can be at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least at least 67, at least 68, at least 69, at least 70, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 26 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250, at least 275, at least 300, at least 325, at least 350, at least 375, at least 400, at least 425, at least 450, at least 475, at least 500, at least 525, at least 550, at least 575, at least 600, at least 625, at least 650, at least 675, at least 700, at least 725, at least 750, at least 775, at least 800, at least 825, at least 850, at least 875, at least 900, at least 925, at least 950, at least 975, at least 1k, at least 1.5k, at least 2k, at least 2k, at least 2.5k, at least 3k, at least 3.5k, at least 4k, at least 4.5k, at least 5k, at least 5.5k, at least 6k, at least 6.5k, at least 7k, at least 7.5k, at least 8k, at least 8.5k, at least 91k, at least 9.5k, at least 10k or more nucleotides in length. For example, the nucleic acid synthesis template domain of the pegRNA can be from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, or from 7 to 17 nucleotides in length.

[0090] In some embodiments, the nucleic acid synthesis template domain comprises a sequence substantially complementary to a region downstream of the region of the first strand (that is complementary to the spacer domain (e.g., the target strand (i.e., the non- PAM strand or the non-edit strand))) in a second strand (e.g., the non-target strand (i.e., the PAM strand or the edit strand)) of the double-stranded target nucleic acid, and wherein the sequence of the nucleic acid synthesis template domain comprises one or more nucleotide changes compared to the double-stranded target nucleic acid, i.e., compared to the non-target strand (i.e., the PAM strand or the edit strand).

[0091] In some embodiments of any of the aspects, the nucleic acid synthesis template domain is a template or substrate for a nucleic acid modifying enzyme. For example, the 27 4922-1525-2775.5Attorney Docket No.701586-000133WOPT nucleic acid synthesis template domain is a template or substrate for a polymerase (e.g., an RNA-dependent polymerase or a DNA-dependent polymerase), or an enzyme that can edit a nucleotide or ribonucleotide (e.g., adenosine deaminases, ADAR family proteins, cytidine deaminases, APOBEC family proteins, and PPR proteins), those that can methylate RNA (e.g., domains from m6A methyltransferase factors such as METTL3, METTL4, METTL14, or WTAP), those that can demethylate RNA (e.g., human alkylation repair homolog 5 or ALKBH5), those that can affect splicing (e.g., the RS-rich domain of SRSF1, the Gly-rich domain of hnRNP A1, the alanine-rich motif of RBM4, or the proline- rich motif of DAZAP1), those that can activate translation (e.g., eIF4E, N-terminal domain of the YT521-B homolog domain family protein 1 (YTHDF1, a cytoplasmicm6A reader protein that recruits the translation machinery) and other translation initiation factors, a domain of the yeast poly(A)-binding protein or GLD2), those that can repress translation (e.g., Pumilio or FBF PUF proteins, deadenylases, or CAF1) and those that can affect RNA stability (e.g., tristetraprolin (TTP) or domains from UPF1, EXOSC5, and STAU1).

[0092] In some embodiments, the nucleic acid synthesis template domain is template for an RNA-dependent polymerase (e.g., reverse transcriptase).

[0093] In some other embodiments of any of the aspects, the nucleic acid synthesis template domain is a template for a DNA-dependent polymerase (e.g., DNA polymerase).

[0094] In some embodiments of any of the aspects, the nucleic acid synthesis template domain and the primer binding site are directly adjacent to each other.

[0095] In some embodiments of any of the aspects, the nucleic acid synthesis template domain is positioned 5’ to the primer binding site. Primer binding site (PBS)

[0096] Embodiments of the various aspects descried herein include a primer binding site (PBS). As used herein the “primer binding site” or “the PBS” refers to a nucleotide sequence in the pegRNA that hybridizes to a single-strand sequence (e.g., the primer sequence) that is formed after nicking of the target sequence, e.g., the edit strand by the napDNAbp. Without wishing to be bound by a theory, when the napDNAbp, e.g., Cas9 nickase nicks one strand of the double-stranded target nucleic acid, a 3′-ended single- stranded flap is formed, which serves as a primer sequence that anneals to the primer binding site on the pegRNA to prime the polymerase, e.g., a reverse transcriptase or a DNA polymerase. The PBS serves to bind the pegRNA to the primer sequence that is formed after nicking of the target sequence, e.g., the edit strand by the napDNAbp. It is noted that the primer binding site does not generally form a part of the template that is 28 4922-1525-2775.5Attorney Docket No.701586-000133WOPT used by the polymerase (e.g., reverse transcriptase or DNA polymerase) to encode the resulting 3′ single-strand flap that includes the desired edit.

[0097] Generally, the PBS comprises a sequence substantially complementary to a second stand (i.e., edit strand) of the target nucleic acid. For example, the PBS comprises a sequence substantially complementary to a region upstream of the region complementary to the nucleic acid synthesis template domain in the second strand (i.e., edit strand) of the target nucleic acid. In some embodiments of any one of the aspects, the PBS comprises a sequence substantially complementary to a region upstream of the nick site in the second strand (i.e.., the edit strand) of the target nucleic acid.

[0098] The PBS can comprise a nucleotide sequence having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the PBS comprises a nucleotide sequence having at least 85% (e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to edit strand of the target nucleic acid. In some embodiments, the PBS comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the PBS comprises a nucleotide sequence having at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%) complementarity to the edit strand of the target nucleic acid. In some embodiments, the PBS comprises a nucleotide sequence having 100% (i.e., complete) complementarity to the edit strand of the target nucleic acid.

[0099] The length of the PBS can range from a few nucleotides to 100s of nucleotides. For example, the nucleic acid synthesis template domain can be 1 nucleotide or longer. For example, the edit template can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at 29 4922-1525-2775.5Attorney Docket No.701586-000133WOPT least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least at least 67, at least 68, at least 69, at least 70, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250 or more nucleotides in length. For example, the primer binding site is from 3 to 50 nucleotides, from 4 to 45 nucleotides, from 6 to 40 nucleotides, from 7 to 35 nucleotides, from 8 to 30 nucleotides, from 9 to 25 nucleotides, from 10 to 20 nucleotides, from 10 to 16 nucleotides, from 12 to 17 nucleotides, from 8 to 15 nucleotides, from 3 to 20 nucleotides, or from 7 to 17 nucleotides in length. Linking domain

[0100] Various domains of the pegRNA, e.g., the spacer domain, the scaffold domain, the RTT domain and / or the PBS can be linked to each other via a linking domain. As used herein, a “linking domain” in reference to polynucleotide, e.g., a pegRNA refers to a 30 4922-1525-2775.5Attorney Docket No.701586-000133WOPT sequence of one or more nucleotides used to link two domains together, e.g., as a separator between two domains. A linking domain can comprise one or more nucleotides.

[0101] The length of each linking domain can range from a few nucleotides to 100s of nucleotides. For example, each linking domain independently can be a single nucleotide or longer. For example, the each linking domain independently can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least at least 67, at least 68, at least 69, at least 70, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 110, at least 111, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 121, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least 165, at least 166, at least 1at least 167, at least 168, at least 169, at least 170, at least 180, at least 181, at least 182, at least 183, at least 184, at least 185, at least 186, at least 187, at least 188, at least 189, at least 190, at least 191, at least 192, at least 193, at least 194, at least 195, at least 196, at least 197, at least 198, at least 199, at least 200, at least 201, at least 202, at least 203, at least 204, at least 205, at least 206, at least 207, at least 208, at least 209, at least 210, at least 211, at least 212, at least 213, at least 214, at least 215, at least 216, at least 217, at least 218, at least 219, at least 220, at least 221, at least 222, at least 223, at least 224, at least 225, at least 226, at least 227, at least 228, at least 229, at least 230, at least 231, at least 232, at least 233, at least 234, at least 235, at least 236, 31 4922-1525-2775.5Attorney Docket No.701586-000133WOPT at least 237, at least 238, at least 239, at least 240, at least 241, at least 242, at least 243, at least 244, at least 245, at least 246, at least 247, at least 248, at least 249, at least 250 or more nucleotides in length. In some embodiments, each linking domain is from about 5 to about 150, from about 10 to about 100, from about 15 to about 75, or from about 20 to about 50 nucleotides in length.

[0102] A nucleotide sequence of a linking domain can comprise one or more secondary structures. For example, a linking domain can comprise a nucleotide sequence that capable of forming one or more hairpin or stem-loop structures. In some embodiments, a linking domain comprises a hairpin or stem-loop strucutre comprising an internal loop and / or bulge loop. For example, the linking domain comprises a hairpin or stem-loop strucutre comprising an internal symmetric or asymmertic loop.

[0103] In some other embodiments, a linking domain does not comprise a secondary structure, e.g., a hairpin or stem-loop structure.

[0104] In some embodiments, a linking domain comprises a poly A sequence. For example, the linking domain comprises the sequence (A)n, where n is an integer from 4 to 25, e.g., n is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24,

[0105] In some embodiments of any one of the aspects, the pegRNA comprises a linking domain between the primer binding site and the spacer domain. For example, the pegRNA comprises a linking domain between the primer binding site and the spacer domain, and wherein the linking domain does not form a secondary structure. In another non-limiting example, the pegRNA comprises a linking domain between the primer binding site and the spacer domain, and wherein the linking domain can form secondary structure, e.g., at least one hairpin or stem-loop structure.

[0106] In some embodiments, the linking domain between the between the primer binding site and the spacer domain is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 in length, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 80, at least 55, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250 or more nucleotides in length.

[0107] The linking domain between the between the primer binding site and the spacer domain can comprise a nucleotide sequence that capable of forming one or more hairpin or stem-loop structures. In some embodiments, the linking domain between the between the primer binding site and the spacer domain comprises a hairpin or stem-loop strucutre 32 4922-1525-2775.5Attorney Docket No.701586-000133WOPT comprising an internal loop and / or bulge loop. For example, the linking domain comprises a hairpin or stem-loop strucutre comprising an internal symmetric or asymmertic loop. In some embodiments, the linking domain between the between the primer binding site and the spacer domain does not comprise a secondary structure, e.g., a hairpin or stem-loop structure. In some embodiments, the linking domain between the between the primer binding site and the spacer domain comprises a poly A sequence.

[0108] In some embodiments of any one of the aspects, the pegRNA comprises a linking domain between a first portion of the gRNA core domain and a second portion of the gRNA core domain, optionally, the first portion of the gRNA core domain and the second portion of the gRNA core domain together form the full gRNA core domain. For example, the pegRNA comprises a linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain, and wherein the linking domain does not form a secondary structure. In another non-limiting example, the pegRNA comprises a linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain, and wherein the linking domain can form secondary structure, e.g., at least one hairpin or stem-loop structure.

[0109] In some embodiments, the linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 in length, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 80, at least 55, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250 or more nucleotides in length.

[0110] The linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain can comprise a nucleotide sequence that capable of forming one or more hairpin or stem-loop structures. In some embodiments, the linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain comprises a hairpin or stem-loop strucutre comprising an internal loop and / or bulge loop. For example, the linking domain comprises a hairpin or stem-loop strucutre comprising an internal symmetric or asymmertic loop. In some embodiments, the linking domain between the first portion of the gRNA core domain and the second portion of the gRNA core domain does not comprise a secondary structure, e.g., a hairpin or stem-loop structure. In some embodiments, the linking domain between 33 4922-1525-2775.5Attorney Docket No.701586-000133WOPT the first portion of the gRNA core domain and the second portion of the gRNA core domain comprises a poly A sequence. Ribozymes and ligation sequences

[0111] In some embodiments of any of the aspects, the pegRNA comprises a first ribozyme and second ribozyme. As used herein, the term “ribozyme” refers to an RNA sequence that hybridizes to a complementary sequence in a substrate RNA and cleaves the substrate RNA in a sequence specific manner at a substrate cleavage site. Typically, a ribozyme contains a catalytic region flanked by two binding regions. The ribozyme binding regions hybridize to the substrate RNA, while the catalytic region cleaves the substrate RNA at a substrate cleavage site to yield a cleaved RNA product. The nucleotide sequence of the ribozyme binding regions can be completely complementary or partially complementary to the substrate RNA sequence with which the ribozyme hybridizes

[0112] In some embodiments of any one of the aspects, each of the first ribozyme and the second ribozyme comprise a sequence that can be cleaved to produce a 5′-OH end and a 2′,3′-cyclic phosphate end. In accordance with this embodiment, each of the first ribozyme and the second ribozyme is a self-cleaving ribozyme. Self-cleaving ribozymes are known in the art and are characterized by distinct active site architectures and divergent, but similar, biochemical properties. The cleavage activities of self-cleaving ribozymes are highly dependent upon divalent cations, pH, and base-specific mutations, which can cause changes in the nucleotide arrangement and / or electrostatic potential around the cleavage site. Some exemplary self-cleaving ribozymes include, but are not limited to, Hammerhead, Hairpin, Hepatitis Delta Virus (“HDV”), Neurospora Varkud Satellite (“VS”), Vgl, glucosamine-6-phosphate synthase (glmS), Twister, Twister Sister, Hatchet, Pistol, and engineered synthetic ribozymes, and derivatives thereof. See, for example, Weinberg et al., “New Classes of Self-Cleaving Ribozymes Revealed by Comparative Genomics Analysis,” Nat. Chem. Biol. 11(8): 606-610 (2015); Lee et al., “Structural and Biochemical Properties of Novel Self-Cleaving Ribozymes,” Molecules 22(4):E678 (2017); Harris et al., “Biochemical Analysis of Pistol Self-Cleaving Ribozymes,” RNA 21(11):1852-8 (2015); Roth et al., “A Widespread Self-Cleaving Ribozyme Class is Revealed by Bioinformatics,” Nature Chem. Biol. 10(1):56-60 (2014); and Gebetsberger et al., “Unwinding the Twister Ribozyme: from Structure to Mechanism,” WIREs RNA 8(3):e1402 (2017), the contents of all of which are incorporated herein by reference in their entireties. 34 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0113] In some embodiments of any one of the aspects, one of the first ribozyme and second ribozyme is a Twister ribozyme, a Twister Sister ribozyme or a Pistol ribozyme. For example, one of the first ribozyme and second ribozyme can be a P3 Twister ribozyme. In another non-limiting example one of the first ribozyme and second ribozyme can be a P1 Twister ribozyme.

[0114] In some embodiments of any one of the aspects, the first ribozyme and second ribozyme independently are a Twister ribozyme, a Twister Sister ribozyme or a Pistol ribozyme. For example, one of the first ribozyme and second ribozyme can be a P1 Twister ribozyme and the other can be a P3 Twister ribozyme.

[0115] In some embodiments of any one of the aspects, each of the first and the second ribozyme is, independently, a split ribozyme or ligand-activated ribozyme derivative.

[0116] Embodiments of the various aspects described herein include a ligation sequence. For example, the pegRNA comprises a first ligation sequence and a second ligation sequence. As used herein, the term “ligation sequence” refers to a sequence complementary to another sequence, which enables the formation of Watson-Crick base pairing to form suitable substrates for ligation by a ligase, e.g., an RNA ligase, such as RtcB. In some embodiments, each of the first ligation sequence and the second ligation sequence comprise a portion of a tRNA exon sequence or derivative thereof. The first ligation sequence and the second ligation sequence may each, independently, comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 additional nucleotides to promote base-pairing with each other. In some embodiments of the various aspects descried herein, the ligation sequences are substrates for an RNA ligase, such as RtcB.

[0117] The ligation sequences can assist in circularization of the pegRNA, and / or protect the pegRNA from degradation. Without wishing to be bound by a theory, this can enhance expression of the pegRNA. While it is thought that pegRNA of the present invention could circularize without the ligation sequences, and such an invention is hereby contemplated, the ligation sequences are also believed to cause the pegRNA ends to more efficiently come together for the RNA ligase (e.g., RtcB). In other words, the ligation sequences can help draw proper 5′ and 3′ ends of the pegRNA closer to each other to assist in the circularization of the pegRNA.

[0118] Length of a ligation sequence can range from a few nucleotides to 10s of nucleotides. For example, each homology arm independently can be at least 3, at least 4, at least 5, at least 6, at least 7, at least at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 35 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 or more nucleotides in length. Adaptor protein recruitment domain

[0119] In some embodiments of any one of the various aspects described herein, the pegRNA can comprise an adaptor protein recruitment domain. As used herein, an “adaptor protein recruitment domain” refers to a nucleotide sequence that can associate or bind with an adaptor protein, which adaptor protein can recruit a nucleic acid modifying enzyme to the pegRNA. Thus, without wishing to be bound by a theory, the adaptor protein recruitment domain can be used to recruit a nucleic acid modifying enzyme to the pegRNA. Exemplary adaptor proteins include, but are not limited to MS2, PP7, Qβ, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KUl, M11, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, ϕCb5, ϕCb8r, ϕCb12r, ϕCb23r, 7s, and PRR1. The adaptor protein recruitment domain is also referred to as an RNA-binding protein recruitment domain herein.

[0120] In some embodiments of any one of the aspects described herein, the adaptor protein recruitment domain (i.e., the RNA-binding protein recruitment domain) is an aptamer. As used herein, the term “aptamer” refers to a nucleic acid molecule that binds with high affinity and specificity to a target. It is noted that aptamers can be single- stranded, partially single-stranded, partially double-stranded, or double-stranded nucleotide sequences. In some embodiments, the adaptor protein recruitment domain is a MS2 aptamer, e.g., the adaptor protein recruitment domain comprises the sequence CGGCAUCAGUUCGGC (SEQ ID NO: 573). In some embodiments, the adaptor protein recruitment domain is a PP7 aptamer, e.g., the adaptor protein recruitment domain comprises the AUAUGG (SEQ ID NO: 573).

[0121] In some embodiments of any one of the various aspects described herein, the pegRNA does not comprise an adaptor protein recruitment domain. For example, the pegRNA does not comprise an MS2 aptamer or PP7 aptamer sequence. When present, the adaptor protein recruitment domain (i.e., the RNA-binding protein recruitment domain) can be positioned anywhere in the pegRNA. For example, the adaptor protein recruitment domain can be positioned 3’ to the primer binding site. In another non-limiting example, the adaptor protein recruitment domain can be positioned 36 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 5’ to the primer binding site. In yet another non-limiting examples, the adaptor protein recruitment domain can be positioned 3’ to the spacer. In still some other non-limiting examples, the adaptor protein recruitment domain can be positioned 5’ to the spacer. In yet still some other examples, the adaptor protein recruitment domain can be positioned 3’ to the gRNA core domain. In some cases, the adaptor protein recruitment domain is positioned 5’ to the gRNA core domain. In some examples, the adaptor protein recruitment domain can be positioned between the primer binding site and the spacer. In some other examples, the adaptor protein recruitment domain can be positioned between the spacer and the gRNA core. In yet other examples, the adaptor protein recruitment domain can be positioned between the gRNA core and the PBS or the RTT domain. Nucleic acid modifying enzyme

[0122] Embodiments of the various aspects descried herein include a nucleic acid modifying enzyme. As used herein, a “nucleic acid modifying enzyme” refers to an enzyme or a functional fragment thereof capable of modifying nucleic acids. Nucleic acid modifying enzymes include DNA modifying enzymes and RNA modifying enzymes. The term also includes nucleic acid polymerases such as RNA polymerases, DNA polymerases, retrotransposons, and integrases.

[0123] Exemplary nucleic acid modifying enzymes include, but are not limited to, polymerases (e.g., RNA polymerases and DNA polymerases) and active fragments thereof, retrotransposons and active fragments thereof, integrases and active fragments thereof, and enzymes that can edit a nucleotide or ribonucleotide (e.g., adenosine deaminases, ADAR family proteins, cytidine deaminases, APOBEC family proteins, and PPR proteins), those that can methylate RNA (e.g., domains from m6A methyltransferase factors such as METTL3, METTL4, METTL14, or WTAP), those that can demethylate RNA (e.g., human alkylation repair homolog 5 or ALKBH5), those that can affect splicing (e.g., the RS-rich domain of SRSF1, the Gly-rich domain of hnRNP A1, the alanine-rich motif of RBM4, or the proline-rich motif of DAZAP1), those that can activate translation (e.g., eIF4E, N-terminal domain of the YT521-B homolog domain family protein 1 (YTHDF1, a cytoplasmicm6A reader protein that recruits the translation machinery) and other translation initiation factors, a domain of the yeast poly(A)-binding protein or GLD2), those that can repress translation (e.g., Pumilio or FBF PUF proteins, deadenylases, or CAF1) and those that can affect RNA stability (e.g., tristetraprolin (TTP) or domains from UPF1, EXOSC5, and STAU1), and homologs, orthologs and variants thereof. 37 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0124] In some embodiments of any one of the aspects described herein, the nucleic acid modifying enzyme is an RNA-dependent polymerase. As used herein, the term “RNA-dependent polymerase” refers to an enzyme that produces a polynucleotide sequence (DNA or RNA), complementary to a pre-existing template polyribonucleotide (RNA). The RNA-dependent polymerase can be either an RNA-dependent RNA polymerase or an RNA-dependent DNA polymerase. The RNA- dependent polymerase can be either an RNA viral polymerase or replicase or an RNA- dependent cellular polymerase. Exemplary RNA polymerases include, but are not limited to, Exemplary RNA polymerases include, but are not limited to, viral RNA polymerases such as T7 RNA polymerase, T3 polymerase, SP6 polymerase, and Kll polymerase; eukaryotic RNA polymerases such as RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, and RNA polymerase V; archaeal RNA polymerases, and homologs, orthologs and variants thereof. Additional exemplary RNA polymerases are descried in U.S. Pat. No.8,460,910, contents of which are incorporated herein by reference in their entireties.

[0125] In some embodiments, the RNA dependent polymerase is a reverse transcriptase. Exemplary reverse transcriptases include, but are not limited to, reverse transcriptases from Murine Moloney Leukemia Virus (MMLV), Avian Myelomatosis Virus (AMV), and / or Human Immunodeficiency Virus (HIV), telomerase reverse transcriptases such as (hTERT), SuperScript™ III, SuperScript™ IV reverse transcriptase, and ProtoScript™ II reverse transcriptase and homologs, orthologs and variants thereof. Some specific exemplary reverse transcriptases include, but are not limited to, Murine Moloney Leukemia virus (MLV) reverse transcriptase, murine leukemia virus (MLV) reverse transcriptase, Avian Myeloblastosis Virus (AMV) reverse transcriptase, Respiratory Syncytial Virus (RSV) reverse transcriptase, Equine Infectious Anemia Virus (EIAV) reverse transcriptase, Rous-associated Virus-2 (RAV2) reverse transcriptase, SUPERSCRIPT II reverse transcriptase, SUPERSCRIPT I reverse transcriptase, THERMOSCRIPT reverse transcriptase and MMLV RNase H−reverse transcriptases, and homologs, orthologs and variants thereof.

[0126] In some preferred embodiments, the nucleic acid modifying enzyme is a MMLV reverse transcriptase (MMLV RT) or a homolog, ortholog or variant of MMLV RT. In some preferred embodiments, the nucleic acid modifying enzyme is MMLV RT.

[0127] In some embodiments of any one of the aspects described herein, the nucleic acid modifying enzyme is a DNA-dependent polymerase. As used herein, the term “DNA- dependent polymerase” refers to an enzyme that produces a polynucleotide sequence 38 4922-1525-2775.5Attorney Docket No.701586-000133WOPT (DNA or RNA), complementary to a pre-existing template polydeoxyribonucleotide (DNA). The DNA-dependent polymerase may be either a DNA-dependent RNA polymerase or a DNA-dependent DNA polymerase.

[0128] Exemplary DNA polymerases include, but are not limited to bacterial DNA polymerases, eukaryotic DNA polymerases, archaeal DNA polymerases, viral DNA polymerases and phage DNA polymerases. Bacterial DNA polymerases include E. coli DNA polymerases I, II and III, IV and V, the Klenow fragment of E. coli DNA polymerase, Clostridium stercorarium (Cst) DNA polymerase, Clostridium thermocellum (Cth) DNA polymerase and Sulfolobus solfataricus (Sso) DNA polymerase. Eukaryotic DNA polymerases include DNA polymerases α, β, y, δ, €, η,λ, σ, µ, and k, as well as the Revl polymerase (terminal deoxycytidyl transferase) and terminal deoxynucleotidyl transferase (TdT). Viral DNA polymerases include T4 DNA polymerase, phi-29 DNA polymerase, GA-l, phi-29-like DNA polymerases, PZA DNA polymerase, phi- 15 DNA polymerase, Cpl DNA polymerase, Cp7 DNA polymerase, T7 DNA polymerase, and T4 polymerase. Other useful DNA polymerases include thermostable and / or thermophilic DNA polymerases such as Thermus aquaticus (Taq) DNA polymerase, Thermus filiformis (Tfi) DNA polymerase, Thermococcus zilligi (Tzi) DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus flavusu (Tfl) DNA polymerase, Pyrococcus woesei (Pwo) DNA polymerase, Pyrococcus furiosus (Pfu) DNA polymerase and Turbo Pfu DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase, Pyrococcus sp. GB-D polymerase, Thermotoga maritima (Tma) DNA polymerase, Bacillus stearothermophilus (Bst) DNA polymerase, Pyrococcus Kodakaraensis (KOD) DNA polymerase, Pfx DNA polymerase, Thermococcus sp. JDF-3 (JDF-3) DNA polymerase, Thermococcus gorgonarius (Tgo) DNA polymerase, Thermococcus acidophilium DNA polymerase; Sulfolobus acidocaldarius DNA polymerase; Thermococcus sp. go N-7 DNA polymerase; Pyrodictium occultum DNA polymerase; Methanococcus voltae DNA polymerase; Methanococcus thermoautotrophicum DNA polymerase; Methanococcus jannaschii DNA polymerase; Desulfurococcus strain TOK DNA polymerase (D. Tok Pol); Pyrococcus abyssi DNA polymerase; Pyrococcus horikoshii DNA polymerase; Pyrococcus islandicum DNA polymerase; Thermococcus fumicolans DNA polymerase; Aeropyrum pernix DNA polymerase; the heterodimeric DNA polymerase DP1 / DP2, and homologs, orthologs and variants thereof. 39 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0129] In some embodiments, the DNA polymerase is Bsu or phi29DNA. It is noted that Bsu and phi29 DNA polymerases can operate near room temperature at isothermal condition.

[0130] In some embodiments, the nucleic acid modifying enzyme is an RNA deaminase, an RNA methylase, an RNA demethylase, or a homolog, ortholog, or variant thereof.

[0131] It is noted that retrotransposons including R2 variants as well as variants that can reverse-transcribe gene sized cargo can be used as a nucleic acid modifying enzyme. Thus, in some embodiments, the nucleic acid modifying enzyme is a retrotransposon or a homolog, ortholog or variant thereof. Exemplary retrotransposons are described, for example, in US patent publication US20240035008 and in Zhang, X., Van Treeck, B., Horton, C.A. et al. Harnessing eukaryotic retroelement proteins for transgene insertion into human safe-harbor loci. Nat Biotechnol 43, 42–51 (2025), contents of all of which are incorporated herein by reference in their entireties.

[0132] In some embodiments, the nucleic acid modifying enzyme is an integrase. For example, the nucleic acid modifying enzyme is an integrase fused with a polymerase, e.g. fused with a reverse transcriptase. Exemplary integrases are described in Fell, C.W., Schmitt-Ulms, C., Tagliaferri, D.V. et al. Precise kilobase-scale genomic insertions in mammalian cells using PASTE. Nat Protoc (2024), contents of all of which are incorporated herein by reference in their entireties.

[0133] In some embodiments, the nucleic acid modifying enzyme is attached to or tethered with an adaptor protein. For example, the nucleic acid modifying enzyme and the adaptor protein are in the form of a fusion protein. As used herein, the term "adaptor protein" means a protein having the ability to specifically bind to a certain molecule (e.g., adaptor protein recruitment domain), and which permits binding of a first (e.g., a nucleic acid modifying enzyme) and second component (e.g., pegRNA), either by modifying or interacting with (e.g., binding) the first (e.g., a nucleic acid modifying enzyme) or the second component (e.g., pegRNA) component such that it is then able to bind the other directly, or by binding both of the first and second components, thereby creating a bridge such that the first and second components are present in the same complex. Some exemplary adaptor proteins include, but are not limited to MS2, PP7, Qβ, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KUl, M11, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, ϕCb5, ϕCb8r, ϕCb12r, ϕCb23r, 7s, and PRR1. In some embodiments, the adaptor protein is MS2. 40 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0134] In some preferred embodiments, the nucleic acid modifying enzyme is not attached to or tethered with an adaptor protein Nucleic acid programmable DNA binding protein

[0135] As used herein, the term “nucleic acid programmable DNA binding protein” or “napDNAbp,” of which Cas9 is an example, refer to a proteins which use RNA:DNA hybridization to target and bind to specific sequences in a DNA molecule. Each napDNAbp is associated with at least one guide nucleic acid (e.g., guide RNA such as pegRNA), which localizes the napDNAbp to a DNA sequence that comprises a DNA strand (i.e., a target strand) that is complementary to the guide nucleic acid, or a portion thereof (e.g., the protospacer of a guide RNA such as the spacer domain of the pegRNA). In other words, the guide nucleic-acid (e.g., the pegRNA) “programs” the napDNAbp (e.g., Cas9 or equivalent) to localize and bind to a complementary sequence. Accordingly, in some embodiments, the nucleic acid programmable DNA binding protein is an RNA guided DNA- binding protein.

[0136] Without being bound by a theory, the binding mechanism of a napDNAbp— guide RNA complex, in general, can include a step of forming an R-loop whereby the napDNAbp induces the unwinding of a double-strand DNA target, thereby separating the strands in the region bound by the napDNAbp. The guide RNA protospacer (e.g., the spacer domain of the pegRNA) then hybridizes to the “target strand.” This displaces a “non-target strand” that is complementary to the target strand, which can form the single strand region of the R-loop. In some embodiments, the napDNAbp includes one or more nuclease activities, which then cut the DNA leaving various types of lesions. For example, the napDNAbp may comprises a nuclease activity that cuts the non-target strand at a first location, and / or cuts the target strand at a second location. Depending on the nuclease activity, the target DNA can be cut to form a “double-stranded break” whereby both strands are cut. In other embodiments, the target DNA can be cut at only a single site, i.e., the DNA is “nicked” on one strand.

[0137] In some embodiments of any of the aspects, the napDNAbp binding protein of the prime is not attached or tethered to the nucleic acid modifying enzyme. Alternatively, in some embodiments of any of the aspects, the napDNAbp is attached or tethered to the nucleic acid modifying enzyme.

[0138] In some embodiments, the napDNAbp is a CRISPR Cas enzyme. As used herein, the term “Cas enzyme,” or the term “CRISPR Cas enzyme,” refers to any of the enzymes involved in a CRISPR system for any form of bacteria or archaea, which 41 4922-1525-2775.5Attorney Docket No.701586-000133WOPT are nucleases capable of cutting a specific nucleic acid target by complexing with a guide RNA. Some exemplary CRISPR Cas enzymes include, but are not limited to, Cas9 (also known as Csnl and Csxl2), Cas1, Cas100, Cas12a (Cpf1), Cas12b, Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas13a (C2c2), Cas13b (C2c6), Cas13c (C2c7), Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Casl, CaslB, CaslO, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csa5, Csa5, CsaX, Csb1, Csb2, Csb3, Csc1, Csc2, C2c5, C2c8, C2c9, C2c10, Cse1, Cse2, Csf1, Csf2, Csf3, Csf4, Csm2, Csm3, Csm4, Csm5, Csm6, Csn2, Csx1, Csx10, Csx14, Csx15, Csx16, Csx17, Csx3, Csy1, Csy2, Csy3, and homologues, variants and modified versions thereof.

[0139] In some embodiments of any one of the aspects described herein, the napDNAbp has nickase activity, i.e., the napDNAbp is a nickase. As used herein, the term "nickase" refers to a napDNAbp (e.g., a Cas9) that can cleave only one strand of the duplex in a double-stranded nucleic acid molecule. Stated in another way, a “nickase” refers to a napDNAbp having only a single nuclease activity that cuts only one strand of a target DNA, rather than both strands. Thus, a nickase (e.g., nCas9) does not leave a double-strand break.

[0140] In some embodiments, the napDNABP is a Cas9. In some embodiments, a Cas9 nuclease comprises one or more mutations that partially impair or inactivate the DNA cleavage domain. For example, the Cas9 comprising one or more mutations has a dead HNH domain or a dead RuVC domain. Exemplary napDNAbp with partially impaired or inactivated DNA cleavage domain include “Cas9 nickase” (“nCas9”) and a deactivated Cas9 having no nuclease activities (“dead Cas9” or “dCas9”). In some preferred embodiments, the napDNAbp is a mutated Cas9 such as a Cas9 nickase. Exemplary mutated Cas9 enzymes are described, for example, in PCT publications WO2020191248, WO2020191241, WO2020191243, WO2020191242, WO2020191245, WO2020191171, WO2020191246, WO2020191249, WO2020191153 and WO2020191234, contents of all of which are incorporated herein by reference in their entireties.

[0141] It is noted that any direct evolved version of the Cas9 that may bear mutations that improve its catalytic function can be used. In addition, miniaturized version of Cas9 that can be packaged in AAV construct while optionally being fused to a nucleic acid modifying enzyme, e.g., a reverse transcriptase can also be used.

[0142] In some embodiments of any one of the aspects described herein, the napDNAbp is a recombinase. Exemplary recombinases include, but are not limited to, IS110 family recombinases (e.g., IS621), RecA, UvsX, RadA, Rad51, Dmcl, UvsY, Cre, Flp, Dre, SCre, VCre, Vika, B2, B3, KD, ΦC31, Bxb1, λ, HK022, HP1, γδ, ParA, Tn3, Gin, 42 4922-1525-2775.5Attorney Docket No.701586-000133WOPT R4, TP901-1, TG1, PhiRv1, PhiBT1, SprA, XisF, TnpX, R, A118, spoIVCA, PhiMR11, SCCmec, TndX, XerC, XerD, XisA, Hin, Cin, mrpA, beta, PhiFC1, Fre, Clp, sTre, FimE, HbiFm, and homologues thereof, variants thereof and modified versions thereof. For example, the napDNAbp is a IS110 family recombinase (e.g., IS621), or a homolog, ortholog, variant or modified version thereof. IS110 family recombinases are described in Hiraizumi, M., Perry, N.T., Durrant, M.G. et al. Structural mechanism of bridge RNA- guided recombination. Nature 630, 994–1002 (2024), contents of which are incorporated herein by reference in their entireties.

[0143] In some embodiments, the napDNAbp is an obligate mobile element guided activity (OMEGA) enzyme. For example, the napDNAbp is TnpB, Fz, Tnpb-IS200 / IS605- like protein, a homolog, ortholog, variant or modified version thereof. Exempalry OMEGA enzymes are described in Saito, M., Xu, P., Faure, G. et al. Fanzor is a eukaryotic programmable RNA-guided endonuclease. Nature 620, 660–668 (2023), contents of which are incorporated herein by reference in their entireties.

[0144] In some embodiments, the napDNAbp is an argonaute (Ago) protein. For example, the napDNAbp is a DNA-guided argonaute protein. For example, the napDNAbp is Ago1, Ago2, Ago 3, Ago4, PIWI1, PIWI2, PIWI3, PIWI4, or a homolog, ortholog or variant thereof. Prime Editing system

[0145] In another aspect provided herein is a prime editing system. Generally, the prime editing system comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same. Prime editing system is also referred to as a prime editor herein.

[0146] It is noted that the prime editing system can comprise any one of the various pegRNA embodiments described herein. Similarly, the prime editing system can comprise any one of the various napDNAbp embodiments described herein. Furthe, the prime editing system can comprise any one of the various nucleic acid modifying enzyme embodiments described herein.

[0147] In some embodiments of the various aspects described herein, prime editing system comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA is circularized, the napDNAbp is nCas9, and the nucleic acid modifying enzyme is a reverse transcriptase (e.g., MMLV RT). 43 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0148] In some embodiments of the various aspects described herein, prime editing system comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is attached to or tethered to the nucleic acid modifying enzyme, optionally the napDNAbp and the nucleic acid modifying enzyme are comprises in a fusion protein.

[0149] In some embodiments of the various aspects described herein, prime editing system comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is not attached to or tethered to the nucleic acid modifying enzyme.

[0150] In some embodiments of the various aspects described herein, prime editing system comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA doesnot comprise an adaptor protein recruitment domain, and optionally the pegRNA is circularized. Compositions

[0151] In another aspect provided herein is a composition comprising a pegRNA described herein or a nucleic acid encoding same. It is noted that the prime editing system can comprise any one of the various pegRNA embodiments described herein.

[0152] In some embodiments, the composition further comprises a napDNAbp or a nucleic acid encoding same. It is noted that the prime editing system can comprise any one of the various napDNAbp embodiments described herein.

[0153] In some embodiments, the composition further comprises a nucleic acid modifying enzyme or a nucleic acid encoding same. It is noted that the prime editing system can comprise any one of the various nucleic acid modifying enzyme embodiments described herein.

[0154] In some embodiments of the various aspects described herein, the composition comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA is circularized, the napDNAbp is nCas9, and the nucleic acid modifying enzyme is a reverse transcriptase (e.g., MMLV RT).

[0155] In some embodiments of the various aspects described herein, the composition comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or 44 4922-1525-2775.5Attorney Docket No.701586-000133WOPT a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is attached to or tethered to the nucleic acid modifying enzyme, optionally the napDNAbp and the nucleic acid modifying enzyme are comprises in a fusion protein.

[0156] In some embodiments of the various aspects described herein, the composition comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is not attached to or tethered to the nucleic acid modifying enzyme.

[0157] In some embodiments of the various aspects described herein, the composition comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA doesnot comprise an adaptor protein recruitment domain, and optionally the pegRNA is circularized.

[0158] In some embodiments of the various aspects described herein, the composition further comprises a nucleic acid delivery system. As used herein, “nucleic acid delivery system” refers to the composition or components employed to deliver nucleic acids to a desired target, e.g., a cell in vitro, ex vivo and / or in vivo. Exemplary nucleic acid delivery systems include, liposomes, lipid nanoparticles, biolistics, virosomes, polycation or lipid:nucleic acid conjugates and artificial virions. In some embodiments of the various aspects described herein, the nucleic acid delivery system is a virus like particle (VLP), e.g., an engineered VLP. Virus like particle (VLP)

[0159] In some embodiments, the composition comprises a virus like particle (VLP). As used herein, the term “virus-like particle” refers to a structure resembling a virus particle but which has not been demonstrated to be pathogenic. Typically, a virus- like particle does not carry genetic information encoding the proteins of the virus- like particle. In general, virus-like particles lack the viral genome and, therefore, are noninfectious. Also, virus-like particles can often be produced in large quantities by heterologous expression and can be easily purified. Some virus-like particles may contain nucleic acid distinct from their genome. As indicated, a virus-like particle in accordance with the invention is non replicative and noninfectious since it lacks all or part of the viral 45 4922-1525-2775.5Attorney Docket No.701586-000133WOPT genome, in particular the replicative and infectious components of the viral genome. A virus-like particle may contain nucleic acid distinct from their genome.

[0160] Generally, the VLP is, at a minimum, to a cell membrane-derived membrane component displaying a transmembrane viral envelope protein or a solvent-exposed portion thereof, and a nucleic acid cargo within the membrane component. In some embodiments, the nucleic acid cargo comprises a sequence that corresponds to the viral envelope protein.

[0161] A virus-like particle’s nucleic acid cargo component can encode the envelope protein and the pegRNA, the napDNAbp and / or the nucleic acid modifying enzyme. In some embodiments, a virus-like particle includes viral-derived structure that permits the packaging of the nucleic acid into the particle, and / or viral-derived structure that permits the introduction of the nucleic acid to a target cell; thus, a virus-like particle can also include a capsid protein or a capsid that permits the packaging of the nucleic acid in a form permitting delivery into a cell. In some embodiments, a virus-like particle does not include viral-derived packaging structures

[0162] A typical and preferred embodiment of a virus-like is a viral capsid such as the viral capsid of the corresponding virus, bacteriophage, or RNA-phage. The terms “viral capsid” or “capsid”, as interchangeably used herein, refer to a macromolecular assembly composed of viral protein subunits. Typically and preferably, the viral protein subunits assemble into a viral capsid and capsid, respectively, having a structure with an inherent repetitive organization, wherein said structure is, typically, spherical or tubular. For example, the capsids of RNA-phages or HBcAg's have a spherical form of icosahedral symmetry. The term “capsid-like structure” as used herein, refers to a macromolecular assembly composed of viral protein subunits reassembling the capsid morphology in the above defined sense but deviating from the typical symmetrical assembly while maintaining a sufficient degree of order and repetitiveness.

[0163] Generally, the VLP comprises a pegRNA described herein or a nucleic acid encoding same. In addition to the pegRNA, the VLP can also comprise a napDNAbp or a nucleic acid encoding same, and / or a nucleic acid modifying enzyme or a nucleic acid encoding same.

[0164] In some embodiments, the VLP is an engineered VLP (eVLP). Exemplary engineered VLPs are described, for example, in Banskota et al., Cell 185 (2): 250-265 (2022); Mangeot et al., Nature Communications (1): 1-15 (2019); Campbell, et al., Molecular Therapy 27:151-163 (2019); Campbell, et al., Molecular Therapy, 27 (2019): 151-163; and Mangeot et al Molecular Therapy, 19 (9): 1656-1666 (2011), contents of all 46 4922-1525-2775.5Attorney Docket No.701586-000133WOPT of which are incorporated herein by reference in their entireties. Exemplary eVLP are also described, for example, in PCT publication WO2024215652, WO2024254346, contents of all of which are incorporated herein by reference in their entireties. Pharmaceutical composition

[0165] In some embodiments, the composition is a pharmaceutical composition. These pharmaceutically acceptable compositions comprise one or more of the various components described herein (e.g., including, but not pegRNA, napDNbp, and nucleic acid modifying enzyme, and complexes comprising same), formulated together with one or more pharmaceutically acceptable carriers (additives) and / or diluents. As described in detail below, the pharmaceutical compositions described herein can be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), gavages, lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally; or (9) nasally. Additionally, compounds can be implanted into a patient or injected using a drug delivery system. See, for example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No.3,773,919; and U.S. Pat. No.353,270,960, content of all of which is herein incorporated by reference.

[0166] As used here, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. As used here, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier 47 4922-1525-2775.5Attorney Docket No.701586-000133WOPT must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as “excipient”, “carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein.

[0167] In some embodiments, the composition is in form of a liposome. As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. In some embodiments, the liposomes are also specifically targeted, e.g., to direct the protein effector polypeptides (or polynucleotides encoding same), fusion proteins (or polynucleotides encoding same), guide nucleic acids (or polynucleotides encoding same), and / or complexes comprising same to particular cell types. Lipid nanoparticles (LNPs) 48 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0168] In some embodiments, the composition is in form of lipid nanoparticles (NLPs). For example, the composition comprises one or more of the various components described herein (e.g., including, but not limited to, the protein effector polypeptides (or polynucleotides encoding same), fusion proteins (or polynucleotides encoding same), guide nucleic acids (or polynucleotides encoding same), and complexes comprising same) and a cationic lipid. Exemplary cationic lipids include, but are not limited to, N-[1- (2,3-dioleyloxy)propyl-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3- dioleoyloxy)propyl-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero - 3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2- dimyristoleoyl- sn-glycero-3-ethylphosphocholine (14:1), N1- [2 - ((1 S)-1 -[(3- aminopropyl)amino]-4-[di(3 -amino-propyl) aminolbutylc arboxamidoiethy11-3, 4 -di [oleyloxy]-benzamide(MVL5); Dioctadecylamido-glycylspermine (DOGS); 3b-[N-(N',N'- dimethylaminoethyl)carb amoyl] cholesterol (DC-Chol); Dioctadecyldimethylammonium Bromide (DDAB); a Saint lipid (e.g., SAINT-2, N-methy1-4-(dioleyl)methylpyridinium); 1,2- dimyristyloxypropy1-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoy1- 3-dimethyl-hydroxyethyl ammonium bromide (DORIE); 1,2-dioleoyloxypropy1-3- dimethylhydroxyethyl ammonium chloride (DORI); Di-alkylated Amino Acid (DILA2) (e.g., C18 :1 -norArg -C16) ; Dioleyldimethylammonium chloride (DODAC); 1 -p almitoy1-2 - oleoyl-sn-glycero-3 -ethylpho sphocholine (POEPC); and 1,2 -dimyristoleo yl-sn-glycero- 3 -ethylphosphocholine (MOEPC). In some variations, the condensing agent, e.g. a cationic lipid, is a lipid such as, e.g., Dioctadecyldimethylammonium bromide (DDAB), 1,2- dilinoleyloxy-3-dimethylaminopropane (DLinDMA), 2,2-dilinoley1-4- (2dimethylaminoethyl)-[1,31-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31 - tetraen-19- yl-4 -(dimethylamino)butanoate (DLin-MC3-DMA), 1,2-Dioleoyloxy-3- dimethylaminopropane (DODAP), 1,2-Dioleyloxy-3-dimethylaminopropane (DODMA), Morpholinocholesterol (Mo-CHOL), (R)-5-(dimethylamino)pentane-1,2-diy1 dioleate hydrochloride (DODAPen-C1), (R)-5-guanidinopentane-1,2-diy1 dioleate hydrochloride (DOPen-G), and (R)-N,N,N-trimethy1-4,5-bis(oleoyloxy)pentan-1-aminium chloride(DOTAPen). The cationic lipid can comprise 20-90% (mol) of the total lipid present in the lipid nanoparticle. For example, cationic lipid molar content can be 20-70% (mol), 30-60% (mol) or 40-50% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, cationic lipid comprises from about 50 mol % to about 90 mol % of the total lipid present in the lipid nanoparticle. 49 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0169] In some embodiments, the lipid nanoparticle can further comprise a non- cationic lipid. Non-ionic lipids include amphipathic lipids, neutral lipids and anionic lipids. Accordingly, the non-cationic lipid can be a neutral uncharged, zwitterionic, or anionic lipid. Non-cationic lipids are typically employed to enhance fusogenicity. The non-cationic lipid can comprise 0-30% (mol) of the total lipid present in the lipid nanoparticle. For example, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In various embodiments, the molar ratio of cationic lipid to the neutral lipid ranges from about 2:1 to about 8:1. Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (such as 16-O-monomethyl PE), dimethyl-phosphatidylethanolamine (such as 16-O-dimethyl PE), 18-1-trans PE, 1- stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG), dierucoylphosphatidylcholine (DEPC), palmitoyloleyolphosphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), 1,2-dilauroyl-sn-glycero-3 -pho sphoethanolamine (DLPE); 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPHyPE); lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof. It is to be understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24carbon chains, e.g., lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl.

[0170] Other examples of non-cationic lipids suitable for use in the lipid nanoparticles include nonphosphorous lipids such as, e.g., stearylamine, dodecylamine, 50 4922-1525-2775.5Attorney Docket No.701586-000133WOPT hexadecylamine, acetyl palmitate, glycerolricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethyl ammonium bromide, ceramide, sphingomyelin, and the like.

[0171] In some embodiments, the non-cationic lipid is a phospholipid. In some embodiments, the non-cationic lipid is selected from DSPC, DPPC, DMPC, DLPE, DMPE, DPHyPe, DOPC, POPC, DOPE, and SM. In some preferred embodiments, the non- cationic lipid is DSPC.

[0172] In some embodiments, the lipid nanoparticle can further comprise a component, such as a sterol, to provide membrane integrity. The component providing membrane integrity, such as a sterol, can comprise 0-50% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, such a component is 20-50% (mol) 30- 40% (mol) of the total lipid content of the lipid nanoparticle. Generally, the component used for providing membrane integrity is non-fusogenic, i.e., a component that does not or substantially does not fuse with a membrane or, if does fuse with a membrane, does not destabilize the membrane. Generally, the component used in the nanoparticles of the invention for providing membrane integrity does not have, or has very little, fusogenic activity at any pH.

[0173] One exemplary sterol that can be used in the lipid nanoparticle is cholesterol and derivatives thereof. Non-limiting examples of cholesterol derivatives include polar analogues such as 5α-cholestanol, 5β-coprostanol, cholesteryl-(2′-hydroxy)-ethyl ether, cholesteryl-(4′-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogues such as 5α-cholestane, cholestenone, 5α-cholestanone, 5β-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analogue such as cholesteryl-(4′-hydroxy)-butyl ether. In some embodiments, cholesterol derivative is cholestryl hemisuccinate (CHEMS).

[0174] In some embodiments, the lipid nanoparticle can further comprise a polyethylene glycol (PEG) or a conjugated lipid molecule. Generally, these are used to inhibit aggregation of lipid nanoparticles and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic-polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, conjugated lipid molecule is a PEG-lipid conjugate, for example, a (methoxy polyethylene glycol)-conjugated lipid. The PEG or the conjugated lipid can comprise 0-20% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, PEG or the 51 4922-1525-2775.5Attorney Docket No.701586-000133WOPT conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticle. Exemplary PEG-lipid conjugates include, but are not limited to, PEG- diacylglycerol (DAG) (such as l-(monomethoxy-polyethyleneglycol)-2,3- dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG- ceramide (Cer), a pegylated phosphatidylethanoloamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(w- methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbam, N- (carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3- phosphoethanolamine sodium salt, or a mixture thereof. Additional exemplary PEG-lipid conjugates are described, for example, in US5,885,613, US6,287,591, US2003 / 0077829, US2003 / 0077829, US2005 / 0175682, US2008 / 0020058, US2011 / 0117125, US2010 / 0130588, US2016 / 0376224, US2017 / 0119904, US2018 / 0028664, US2015 / 0376115 and US2016 / 0376224, contents of all which are incorporated herein by reference in their entirety.

[0175] The PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG- dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be one or more of PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG- disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG- dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(Cholest-5-en- 3[beta]-oxy)carboxamido-3',6'-dioxaoctanyl] carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-Ditetradecoxylbenzyl- [omega]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid is selected from the group consisting N-(Carbonyl-methoxypo1yethy1eneg1yco1n)-1,2-dimyristoyl-sn-glycero-3 - phosphoethanolamine (DMPE-PEGn, where n is 350, 500, 750, 1000 or 2000), N- (Carbonyl-methoxypolyethyleneglycoln)-1,2-distearoyl-sn-glycero-3- phosphoethanolamine (DSPE-PEGn, where n is 350, 500, 750, 1000 or 2000), DSPE- polyglycelin-cyclohexyl-carboxylic acid, DSPE-polyglycelin-2-methylglutar-carboxylic acid, polyethylene glycol-dimyristolglycerol (PEG-DMG), polyethylene glycol-distearoyl glycerol (PEG-DSG), or N-octanoyl-sphingosine-1- {succinyl[methoxy(polyethylene glycol)200011 (C8 PEG2000 Ceramide). In some examples of DMPE-PEGn, where n is 350, 500, 750, 1000 or 2000, the PEG-lipid is N-(Carbonyl-methoxypolyethyleneglycol 2000)-1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE-PEG 2,000). In some examples of DSPE-PEG. where n is 350, 500, 750, 1000 or 2000, the PEG-lipid is N- (Carbonyl-methoxypolyethyleneglycol 2000)-1,2-distearoyl-sn-glycero-3- 52 4922-1525-2775.5Attorney Docket No.701586-000133WOPT phosphoethanolamine (DSPE-PEG 2,000). In some preferred embodiments, the PEG- lipid is PEG-DMG.

[0176] Lipids conjugated with a molecule other than a PEG can also be used in place of PEG-lipid. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic-polymer lipid (CPL) conjugates can be used in place of or in addition to the PEG-lipid.

[0177] Generally, the lipid nanoparticles have a mean diameter selected to provide an intended therapeutic effect. Accordingly, in some embodiments, the lipid nanoparticle has a mean diameter from about 30 nm to about 150 nm, more typically from about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 85 nm to about 105nm, and preferably about 100 nm. In some embodiments, the lipid particles that larger in relative size to common nanoparticles and about 150 to 250 nm in size.

[0178] Depending on the intended use of the lipid particles, the proportions of the components can be varied and the delivery efficiency of a particular formulation can be measured using, for example, an endosomal release parameter (ERP) assay. Protein nanoparticles

[0179] In some embodiments, the composition can be inform of protein nanoparticles. Non-limiting examples of protein nanoparticles include ferritin nanoparticles (see, e.g., Zhang, Y. Int. J. Mol., 12:5406-5421, 2011, incorporated by reference herein), encapsulin nanoparticles (see, e.g., Sutter et al., Nature Struct, and Mol. Biol., 15:939- 947, 2008, incorporated by reference herein), Sulfur Oxygenase Reductase (SOR) nanoparticles (see, e.g., Urich et al., Science, 311 :996-1000, 2006, incorporated by reference herein), lumazine synthase nanoparticles (see, e.g., Zhang et al., J. Mol. Biol., 306: 1099-1114, 2001) or pyruvate dehydrogenase nanoparticles (see, e.g., Izard et al., PNAS 96: 1240-1245, 1999, incorporated by reference herein). Ferritin, encapsulin, SOR, lumazine synthase, and pyruvate dehydrogenase are monomeric proteins that self- assemble into a globular protein complexes that in some cases consists of 24, 60, 24, 60, and 60 protein subunits, respectively. Other exempalry compositons

[0180] In some embodiments, the composition is in form of lipoplexes / polyplexes. Lipoplexes may be complexes comprising lipid(s) and non-lipid components. Examples of lipoplexes and polyplexes include FuGENE-6 reagent, a non-liposomal solution containing 53 4922-1525-2775.5Attorney Docket No.701586-000133WOPT lipids and other components, zwitterionic amino lipids (ZALs), Ca2p (e.g., forming DNA / Ca2+microcomplexes), polyethylenimine (PEI) (e.g., branched PEI), and poly(L- lysine) (PLL).

[0181] In some embodiments, the composition is in form DNA nanoclews. A DNA nanoclew refers to a sphere-like structure of DNA (e.g., with a shape of a ball of yarn). The nanoclew may be synthesized by rolling circle amplification with palindromic sequences that aide in the self-assembly of the structure. The sphere may then be loaded with a payload. An example of DNA nanoclew is described in Sun W et al, J Am Chem Soc. 2014 Oct 22; 136(42): 14722-5; and Sun W et al, Angew Chem Int Ed Engl. 2015 Oct 5;54(41): 12029-33. DNA nanoclew may have a palindromic sequences to be partially complementary to the guide RNA within the IscB polypeptide nuclease:hRNA ribonucleoprotein complex. A DNA nanoclew may be coated, e.g., coated with PEI to induce endosomal escape.

[0182] In some embodiments, the composition can comprise one or more of the various components described herein (e.g., including, but not limited to, the protein effector polypeptides (or polynucleotides encoding same), fusion proteins (or polynucleotides encoding same), guide nucleic acids (or polynucleotides encoding same), and complexes comprising same) complexed with gold nanoparticles. Gold nanoparticles may be coated, e.g., coated in a silicate and an endosomal disruptive polymer, PAsp(DET). Examples of gold nanoparticles include AURASENSE Therapeutics' Spherical Nucleic Acid (SNA™) constructs, and those described in Mout R, et al. (2017). ACS Nano 11 :2452-8; Lee K, et al. (2017). Nat Biomed Eng 1 :889-901.

[0183] In some embodiments, the composition further comprises iTOP. iTOP refers to a combination of small molecules drives the highly efficient intracellular delivery of native proteins, independent of any transduction peptide. iTOP may be used for induced transduction by osmocytosis and propanebetaine, using NaCl-mediated hyperosmolality together with a transduction compound (propanebetaine) to trigger macropinocytotic uptake into cells of extracellular macromolecules. Examples of iTOP methods and reagents include those described in D'Astolfo DS, Pagliero RJ, Pras A, et al. (2015). Cell 161 :674-690.

[0184] In some embodiments, the composition is in form of polymer-based particles (e.g., nanoparticles). In one embodiment, the polymer-based particles may mimic a viral mechanism of membrane fusion. The polymer-based particles may be a synthetic copy of Influenza virus machinery and form transfection complexes with various types of nucleic acids ((siRNA, miRNA, plasmid DNA or shRNA, mRNA) that cells take up via the 54 4922-1525-2775.5Attorney Docket No.701586-000133WOPT endocytosis pathway, a process that involves the formation of an acidic compartment. The low pH in late endosomes acts as a chemical switch that renders the particle surface hydrophobic and facilitates membrane crossing. Once in the cytosol, the particle releases its payload for cellular action. This Active Endosome Escape technology is safe and maximizes transfection efficiency as it is using a natural uptake pathway. In one embodiment, the polymer-based particles may comprise alkylated and carboxyalkylated branched polyethylenimine. In some examples, the polymer-based particles are VIROMER, e.g., VIROMERRNAi, VIROMERRED, VIROMER mRNA. Example methods of delivering the systems and compositions herein include those described in Bawage SS et al., Synthetic mRNA expressed Casl3a mitigates RNA virus infections, biorxiv.org / content / 10.1101 / 370460vl.full doi: doi.org / 10.1101 / 370460, Viromer® RED, a powerful tool for transfection of keratinocytes. doi: 10.13140 / RG.2.2.16993.61281, Viromer® Transfection - Factbook 2018: technology, product overview, users' data., doi: 10.13140 / RG.2.2.23912.16642.

[0185] In some embodiments, the composition is in form of lipid-coated mesoporous silica particles. Lipid-coated mesoporous silica particles may comprise a mesoporous silica nanoparticle core and a lipid membrane shell. The silica core may have a large internal surface area, leading to high cargo loading capacities. In one embodiment, pore sizes, pore chemistry, and overall particle sizes may be modified for loading different types of cargos. The lipid coating of the particle may also be modified to maximize cargo loading, increase circulation times, and provide precise targeting and cargo release. Examples of lipid-coated mesoporous silica particles include those described in Du X, et al. (2014). Biomaterials 35:5580-90; Durfee PN, et al. (2016). ACS Nano 10:8325-45.

[0186] In some embodiments, the composition comprises inorganic nanoparticles. Examples of inorganic nanoparticles include carbon nanotubes (CNTs) (e.g., as described in Bates K and Kostarelos K. (2013). Adv Drug Deliv Rev 65:2023-33.), bare mesoporous silica nanoparticles (MSNPs) (e.g., as described in Luo GF, et al. (2014). Sci Rep 4:6064), and dense silica nanoparticles (SiNPs) (as described in Luo D and Saltzman WM. (2000). Nat Biotechnol 18:893-5).

[0187] In some embodiments, the composition is in form of exosomes. Exosomes include membrane bound extracellular vesicles, which can be used to contain and delivery various types of biomolecules, such as proteins, carbohydrates, lipids, and nucleic acids, and complexes thereof (e.g., RNPs). Examples of exosomes include those described in Schroeder A, et al., J Intern Med.2010 Jan;267(l):9-21; El-Andaloussi S, et al., Nat Protoc. 2012 Dec;7(12):2112-26; Uno Y, et al., Hum Gene Ther.2011 Jun;22(6):711-9; Zou W, et 55 4922-1525-2775.5Attorney Docket No.701586-000133WOPT al., Hum Gene Ther.2011 Apr;22(4):465-75. In some examples, the exosome may form a complex (e.g., by binding directly or indirectly) to one or more of the various components described herein (e.g., including, but not limited to, the protein effector polypeptides (or polynucleotides encoding same), fusion proteins (or polynucleotides encoding same), guide nucleic acids (or polynucleotides encoding same), and complexes comprising same). In certain examples, a molecule of an exosome may be fused with first adapter protein and a component of the cargo may be fused with a second adapter protein. The first and the second adapter protein may specifically bind each other, thus associating the cargo with the exosome. Examples of such exosomes include those described in Ye Y, et al., Biomater Sci.2020 Apr 28. doi: 10.1039 / d0bm00427h. Cells

[0188] Embodiments of the various aspects described herein include a cell. As used herein, the term “cell” refers to a single cell as well as to a population of (i.e., more than one) cells. A cell can be a prokaryotic or eukaryotic cell. Exemplary eukaryotic cells include a yeast cell, an insect cell, a fungal cell, a plant cell, and an animal cell (e.g., a mammalian cell).

[0189] It is noted a cell can be in vivo, in vitro or ex vivo. Accordingly, in some embodiments of any one of the aspects, the cell is in vitro. In some embodiments of any one of the aspects, the cell is ex vivo. In some embodiments of any one of the aspects, the cell is in vivo.

[0190] In some embodiments of any one of the aspects described herein, the cell is a mammalian cell. As used herein, “mammalian cell” “mammalian cell” includes cells derived from mammals, including humans, rats, mice, guinea pigs, chimpanzees, or macaques. Thus, suitable mammalian cells include, for example without limitation, human, non-human primate, cat, dog, sheep, goat, cow, horse, pig, rabbit, and rodent cells.

[0191] In some embodiments, the cell can be a primary cell derived from a subject. For example, primary cells that are derived from patients and expanded can be edited ex vivo using the pegRNA, composition, and / or prime editing systems described herein.

[0192] In some embodiments, the cell is an animal cell. For example, animal cells can be edited or re-engineered ex-vivo using the pegRNA, compositions, and / or prime editing systems described herein.to create edible tissues for food.

[0193] In some embodiments, the cell is a plant cell. For example, plant cells can be edited or re-engineered ex-vivo using the pegRNA, compositions, and / or prime editing 56 4922-1525-2775.5Attorney Docket No.701586-000133WOPT systems described herein.to create crops that can survive better and give nutritious benefits.

[0194] In some embodiments of any one of the aspects described herein, the cell is a mismatch repair (MMR) deficient cell. As used herein, “mismatch repair deficient cell”, also referred to as “MMR deficient cell”, refers to a cell which is incapable of correcting DNA mismatches generated during DNA replication

[0195] In some embodiments of any one of the aspects described herein, the cell is a mismatch repair (MMR) competent cell. As used herein, “mismatch repair competent cell”, also referred to as “MMR competent cell”, refers to a cell which is capable of correcting DNA mismatches generated during DNA replication.

[0196] In some embodiments of any one of the aspects described herein, the cell is a modified cell. As used herein, "modified cell" refers to a recombinant (host) cell comprising at least one genetic modification that is not present in the "parent" host cell from which the modified cell is derived.

[0197] In some embodiments of any one of the aspects described herein, the cell is liver cell. Exemplary cells of the liver include but are not limited to hepatocytes, sinusoidal endothelial cells (SEC), Kupffer cells (KC), and hepatic stellate cells (HSC), as well as various immune cells In some embodiments of the any one of the aspects described herein, the cell is a hepatocyte.

[0198] In some embodiments of any one of the aspects described herein, the cell is an immune cell. An immune cell can be a cell of the lymphoid lineage. Non-limiting examples of cells of the lymphoid lineage that can be used as immune cells include T cells and Natural Killer (NK) cells. T cells express the T cell receptor (TCR), with most cells expressing α and β chains and a smaller population expressing γ and δ chains.T cells can be CD4+ or CD8+ and can include, but are not limited to, T helper cells (CD4+),cytotoxic T cells (also referred to as cytotoxic T lymphocytes, CTL; CD8+T cells), and memory T cells, including central memory T cells, stem-cell-like memory T cells (or stem- like memory T cells), and effector memory T cells, for example, TEMcells and TEMRA(CD45RA+) cells, natural killer T cells, mucosal associated invariant T cells (MAIT), and γδ T cells. Other exemplary immune cells include, but are not limited to, macrophages, antigen presenting cells (APCs) such as dendritic cells. In some embodiments of any one of the aspects described herein, the cell is a T-cell.

[0199] In one aspect, provided herein is a cell comprising a pegRNA described herein or a nucleic acid encoding same. 57 4922-1525-2775.5Attorney Docket No.701586-000133WOPT

[0200] In some embodiments, the cell further comprises a napDNAbp or a nucleic acid encoding same. It is noted that the cell can comprise any one of the various napDNAbp embodiments described herein.

[0201] In some embodiments, the cell further comprises a nucleic acid modifying enzyme or a nucleic acid encoding same. It is noted that the cell can comprise any one of the various nucleic acid modifying enzyme embodiments described herein.

[0202] In some embodiments of the various aspects described herein, the cell comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA is circularized, the napDNAbp is nCas9, and the nucleic acid modifying enzyme is a reverse transcriptase (e.g., MMLV RT).

[0203] In some embodiments of the various aspects described herein, the cell comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is attached to or tethered to the nucleic acid modifying enzyme, optionally the napDNAbp and the nucleic acid modifying enzyme are comprises in a fusion protein.

[0204] In some embodiments of the various aspects described herein, the cell comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is not attached to or tethered to the nucleic acid modifying enzyme.

[0205] In some embodiments of the various aspects described herein, the cell comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA does not comprise an adaptor protein recruitment domain, and optionally the pegRNA is circularized.

[0206] In another aspect provided herein is an isolated cell or progeny thereof comprising a nucleic acid modified by a pegRNA and / or method descried herein.

[0207] In yet another aspect, privided herein is a nucleic acid modified by a pegRNA and / or a method described herein. Kits

[0208] In another aspect provided herein is a kit comprising a pegRNA described herein or a nucleic acid encoding same. A kit is any manufacture (e.g., a package or container) 58 4922-1525-2775.5Attorney Docket No.701586-000133WOPT comprising pegRNA described herein or a polynucleotide encoding a pegRNA described herein described herein. The manufacture can be promoted, distributed, or sold as a unit for performing the methods described herein. It is noted that the kit can comprise any one of the various pegRNA embodiments described herein.

[0209] In some embodiments, the kit further comprises a napDNAbp or a nucleic acid encoding same. It is noted that the kit can comprise any one of the various napDNAbp embodiments described herein.

[0210] In some embodiments, the kit further comprises a nucleic acid modifying enzyme or a nucleic acid encoding same. It is noted that the kit can comprise any one of the various nucleic acid modifying enzyme embodiments described herein.

[0211] In some embodiments of the various aspects described herein, the kit comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA is circularized, the napDNAbp is nCas9, and the nucleic acid modifying enzyme is a reverse transcriptase (e.g., MMLV RT).

[0212] In some embodiments of the various aspects described herein, the kit comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is attached to or tethered to the nucleic acid modifying enzyme, optionally the napDNAbp and the nucleic acid modifying enzyme are comprises in a fusion protein.

[0213] In some embodiments of the various aspects described herein, the kit comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the napDNAbp is not attached to or tethered to the nucleic acid modifying enzyme.

[0214] In some embodiments of the various aspects described herein, the kit comprises a pegRNA described herein or a nucleic acid encoding same, a napDNAbp or a nucleic acid encoding same, and a nucleic acid modifying enzyme or a nucleic acid encoding same, and wherein the pegRNA doesnot comprise an adaptor protein recruitment domain, and optionally the pegRNA is circularized.

[0215] In some embodiments of the various aspects described herein, the kit further comprises a nucleic acid delivery system.

[0216] The kits described herein can optionally comprise additional components and reagents. As will be appreciated by one of skill in the art, components of the kit can be 59 4922-1525-2775.5Attorney Docket No.701586-000133WOPT provided in any desired form, e.g., in a lyophilized form, a liquid form, a solid form, or a concentrated. In some embodiments of the various aspects described herein, the kit can comprise ampoules, syringes, or the like.

[0217] In some embodiments, the kit can comprise informational material. The informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein. The informational material of the kits is not limited in its form. In some embodiments, the informational material can include information about production of the components, concentration, date of expiration, batch or production site information, and so forth. In one embodiment, the informational material relates to methods for using or administering the components of the kit.

[0218] It is notes that the components of a kit can provided singularly or in any combination as a kit. Such a kit includes the components described herein and packaging materials thereof.

[0219] In some embodiments, the components in a kit can be provided in a watertight or gas tight container which in some embodiments is substantially free of other components of the kit. For example, the components of the kit can be supplied in more than one container, e.g., it can be supplied in a container having sufficient reagent for a predetermined number of applications, e.g., 1, 2, 3 or greater. One or more components as described herein can be provided in any form, e.g., liquid, dried or lyophilized form. Liquids or components for suspension or solution of the reagents can be provided in sterile form and should not contain microorganisms or other contaminants. When the components described herein are provided in a liquid solution, the liquid solution preferably is an aqueous solution.

[0220] The kit will typically be provided with its various elements included in one package, e.g., a fiber-based, e.g., a cardboard, or polymeric, e.g., a Styrofoam box. The enclosure can be configured so as to maintain a temperature differential between the interior and the exterior, e.g., it can provide insulating properties to keep the reagents at a preselected temperature for a preselected time. One or more nucleotide changes

[0221] As used herein, “one or more nucleotide changes” refers to an alternation in one or more nucleotides in a target sequence, such as in DNA or RNA. One or more nucleotide changes can include insertions of one or more nucleotides, substitutions of one or more nucleotides, deletions of one or more nucleotides, or a combination of any such nucleotide 60 4922-1525-2775.5Attorney Docket No.701586-000133WOPT changes, as compared to the target sequence, e.g., as compared to the double-stranded target DNA sequence.

[0222] In some embodiments of any one of the aspects described herein, the one or more nucleotide changes comprises a transition from one nucleotide to another nucleotide. As used herein, “transition” refer to the interchange of purine nucleobases (A↔G) or the interchange of pyrimidine nucleobases (C↔T). This class of interchanges involves nucleobases of similar shape. The pegRNAs. compositions and methods disclosed herein are capable of inducing one or more transitions in a target nucleic acid, e.g., DNA molecule. The pegRNA, compositions and methods disclosed herein are also capable of inducing both transitions and transversion in the same target nucleic acid, e.g., DNA molecule. These changes involve A↔G, G↔A, C↔T, or T↔C. In the context of a double-strand nucleic acid with Watson-Crick paired nucleobases, transitions refer to the following base pair exchanges: A:T↔G:C, G:G↔A:T, C:G↔T:A, or T:A↔C:G. Thus, in some embodiments, the one or more nucleotide changes comprises a transition selected from the group consisting of: (a) T to C; (b) A to G; (c) C to T; (d) G to A; and (e) A to I.

[0223] In some embodiments of any one of the aspects described herein, the one or more nucleotide changes comprises a transversion. As used herein, “transversion” refer to the interchange of purine nucleobases for pyrimidine nucleobases, or in the reverse and thus, involve the interchange of nucleobases with dissimilar shape. These changes involve T↔A, T4->G, C↔G, C↔A, A↔T, A↔C, G↔C, and G↔T. In the context of a double-strand nucleic acid with Watson-Crick paired nucleobases, transversions refer to the following base pair exchanges: T:A↔A:T, T:A↔G:C, C:G↔G:C, C:G↔A:T, A:T↔T:A, A:T↔C:G, G:C↔C:G, and G:C↔T:A. The compositions and methods disclosed herein are capable of inducing one or more transversions in a target nucleic acid, e.g., DNA molecule. Thus, in some embodiments of any one of the aspects described herein, the one or more nucleotide changes comprises a transversion selected from the group consisting of: (a) T to A; (b) T to G; (c) C to G; (d) C to A; (e) A to T; (f) A to C; (g) G to C; (h) G to T; and (i) and A to I.

[0224] In some embodiments of any of the aspects, the one or more nucleotide changes comprises a nucleotide insertion. As used herein, the term “nucleotide insertion” refers to the insertion of one or more additional nucleotides into a predetermined or native nucleotide sequence. Thus, in some embodiments, the one or more nucleotide changes comprises an insertion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, 61 4922-1525-2775.5Attorney Docket No.701586-000133WOPT at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides. For example, the one or more nucleotide changes comprises deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides.

[0225] In some embodiments of any of the aspects, the one or more nucleotide changes comprises a nucleotide deletion. As used herein, the term “nucleotide deletion” refers to the deletion of one or more nucleotides into a predetermined or native nucleotide sequence. Thus, in some embodiments, the one or more nucleotide changes comprises deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides. For example, the one or more nucleotide changes comprises deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, or at least 500 nucleotides.

[0226] The position of the desired one or more nucleotide changes, e.g., edit can be in any position following downstream of the nick site on the PAM strand, which can include position +1, +2, +3, +4, +, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24, +25, +26, +27, +28, +29, +30, +31, +32, +33, +34, +35, +36, +37, +38, +39, +40, +41, +42, +43, +44, +45, +46, +47, +48, +49, +50, +51, +52, +53, +54, +55, +56, +57, +58, +59, +60, +61, +62, +63, +64, +65, +66, +67, +68, +69, +70, +71, +72, +73, +74, +75, +76, +77, +78, +79, +80, +81, +82, +83, +84, +85, +86, +87, +88, +89, +90, +91, +92, +93, +94, +95, +96, +97, +98, +99, +100, +101, +102, +103, +104, +105, +106, +107, +108, +109, +110, +111, +112, +113, +114, +115, +116, +117, +118, +119, +120, +121, +122, +123, +124, +125, +126, +127, +128, +129, +130, +131, +132, +133, +134, +135, +136, +137, +138, +139, +140, +141, +142, +143, +144, +145, +146, +147, +148, +149, or +150, or more (relative to the downstream position of a nick site). Once the 3′ end single stranded DNA (containing the edit of interest) replaces 62 4922-1525-2775.5Attorney Docket No.701586-000133WOPT the endogenous 5′ end single stranded DNA, the DNA repair and replication processes will result in permanent installation of the edit site on the PAM strand, and then correction of the mismatch on the non-PAM strand that will exist at the edit site. In this way, the edit will extend to both strands of DNA on the target DNA site. It will be appreciated that reference to “edited strand” and “non-edited” strand only intends to delineate the strands of DNA involved in the PE mechanism. The “edited strand” is the strand that first becomes edited by replacement of the 5′ ended single strand DNA immediately downstream of the nick site with the synthesized 3′ ended single stranded DNA containing the desired edit. The “non-edited” strand is the strand pair with the edited strand, but which itself also becomes edited through repair and / or replication to be complementary to the edited strand, and in particular, the edit of interest.

[0227] used herein, the term “edit” “editing” or “edited” refers to a method of altering a nucleic acid sequence of a polynucleotide (e.g., for example, a wild type naturally occurring nucleic acid sequence or a mutated naturally occurring sequence) by selective transition, transversion, insertion and / or deletion of one or more nucleotides in a specific target nucleic acid, such as a genomic target. Exemplary genomic targets include, but are not limited to, a chromosomal region, a gene, a promoter, an open reading frame or any nucleic acid sequence.

[0228] In some embodiments of any of the aspects, the primer binding site comprises a sequence having 100% complementarity to a region upstream of the nick site in the second strand of the double-stranded target nucleic acid. Methods

[0229] In another aspect, provided herein is a method of introducing one or more changes in the nucleotide sequence of a target nucleic acid. The method comprises contacting a double-stranded target nucleic acid (e.g., DNA) with a prime editing system described herein.

[0230] In some embodiments of any one of the aspects, the target nucleic acid can be in a cell.

[0231] It is noted that when the target nucleic acid is in a cell, the method comprises administering the prime editing system or components thereof to the cell. Methods for administering a prime editing system or components thereof to a cell are well known and available to one of skill in the art. As used herein, administering the prime editing system or components thereof to the cell means contacting the cell with the prime editing system or components thereof so that the prime editing system or components thereof are taken 63 4922-1525-2775.5Attorney Docket No.701586-000133WOPT up by the cell. Generally, the cell can be contacted with the prime editing system or components thereof in a cell culture e.g., in vitro or ex vivo, or the prime editing system or components thereof can be administrated to a subject, e.g., in vivo. The term “contacting” or “contact” as used herein in connection with contacting a cell includes subjecting the cells to an appropriate culture media, which comprises the prime editing system or components thereof. Where the cell is in vivo, “contacting” or “contact” includes administering the prime editing system or components thereof, e.g., in a pharmaceutical composition to a subject via an appropriate administration route such that the prime editing system or components thereof contacts the cell in vivo.

[0232] For example, when the cell is in vitro, said administering to the cell can include subjecting the cell to an appropriate culture media which comprises the prime editing system or components thereof. Where the cell is in vivo, said administering to the cell includes administering the prime editing system or components thereof to a subject via an appropriate administration route such that the compound is administered to the cell in vivo.

[0233] The cell to be administered can be any desired cell. For example, the cell comprising the target nucleic acid can be mammalian cell. In some embodiments, the cell comprising the target nucleic acid can be a human cell. In some embodiments of any of the aspects, the cell comprising the target nucleic acid is a mismatch repair (MMR) deficient cell. In some other embodiments, the cell comprising the target nucleic acid is a mismatch repair (MMR) competent cell. In some embodiments of any of the aspects, the cell comprising the target nucleic acid is an immune cell, e.g., a T-cell. In some embodiments of any of the aspects, the cell comprising the target nucleic acid is a liver cell, e.g., a hepatocyte.

[0234] In some embodiments, the cell is selected from the group consisting of hematopoietic stem cells; T cells; liver cells (hepatocytes); pancreatic islet beta cells; and lung epithelial cells.

[0235] In some embodiments, the method is a method of therapeutic genome editing. For example, the method comprises administering to a target cell selected from the group consisting of: (a) hematopoietic stem cells; (b) T cells; (c) liver cells (hepatocytes); (d) pancreatic islet beta cells; (e) lung epithelial cells. “Disease-associated” genes

[0236] In some embodiments of any of the aspects, the one or more changes in the nucleotide sequence comprises a correction to a disease-associated gene. As used herein, a “disease-associated” gene or polynucleotide refers to any gene or 64 4922-1525-2775.5Attorney Docket No.701586-000133WOPT polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of anon disease control. It may be a gene that becomes expressed at an abnormally high level; it may be a gene that becomes expressed at an abnormally low level, where the altered expression correlates with the occurrence and / or progression of the disease. A disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease. The transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.

[0237] Examples of disease-associated genes and polynucleotides are available from McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda,. Md.), available on the World Wide Web, contents of all which are incorporated herein by reference in their entireties.

[0238] For example, the disease associated gene is associated with disorder selected from the group consisting of: **** 22q13.3 deletion syndrome, 2-methyl-3-hydroxybutyric aciduria, 3 beta-Hydroxysteroid dehydrogenase deficiency, 3 Methylcrotonyl-CoA carboxylase 1 deficiency, 3-methylcrotonyl CoA carboxylase 2 deficiency, 3- Methylglutaconic aciduria type 1, 3-Methylglutaconic aciduria type 2, 3-Methylglutaconic aciduria type 3, Optic atrophy and cataract, autosomal dominant, 3-methylglutaconic aciduria type V, 3-methylglutaconic aciduria with cataracts, neurologic involvement, and neutropenia, 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 3-methylglutaconic aciduria, type VIII, 3-Oxo-5 alpha-steroid delta 4- dehydrogenase deficiency, 46,XY sex reversal, type 3, Premature ovarian failure 7, 46,XY sex reversal, type 5, 46,XY sex reversal, type 6, Inborn genetic diseases, ABCA4-Related Disorders, Age-related macular degeneration 2, Cone-rod dystrophy 3, MACULAR DEGENERATION, AGE-RELATED, 2, SUSCEPTIBILITY TO, Mandibulofacial dysostosis with mental deficiency, Retinitis pigmentosa 19, Stargardt disease, Stargardt disease 1, Abdominal obesity-metabolic syndrome 3, Abdominal pain, Fever, Mood changes, Visual loss, Vomiting, Abetalipoproteinaemia, Abnormal bleeding, von Willebrand disease type 3, von Willebrand disorder, von Willebrand disease type 2, Abnormal blistering of the skin, Abnormal urinary color, Constipation, Migraine, Charcot-Marie-Tooth disease, type 2, Charcot-Marie-Tooth disease, type 2A2A, Hereditary motor and sensory neuropathy with optic atrophy, Abnormal cortical gyration, FACIAL DYSMORPHISM, HYPERTRICHOSIS, EPILEPSY, INTELLECTUAL / DEVELOPMENTAL DELAY, AND GINGIVAL 65 4922-1525-2775.5Attorney Docket No.701586-000133WOPT OVERGROWTH SYNDROME, Generalized hypertrichosis, Gingival overgrowth, Intellectual disability, Seizures, Abnormal macular morphology, Blindness, Pigmentary retinopathy, Rare genetic deafness, Retinal pigment epithelial atrophy, Retinitis pigmentosa 39, Rod-cone dystrophy, Usher syndrome, type 2A, Albinism, Fair hair, Horizontal nystagmus, Hypopigmentation of the skin, Ocular albinism, Strabismus, Tyrosinase-negative oculocutaneous albinism, Abnormality of brain morphology, Combined oxidative phosphorylation deficiency 7, Spastic paraplegia 55, autosomal recessive, Abnormality of cardiovascular system morphology, Congenital diaphragmatic hernia, Pancreatic agenesis and congenital heart disease, Juvenile myelomonocytic leukemia, Noonan syndrome, Noonan syndrome 1, Rasopathy, Abnormality of coagulation, Hyperammonemia, Ornithine carbamoyltransferase deficiency, Protein avoidance, Abnormality of retinal pigmentation, Cataract, Exudative retinopathy, Nystagmus, Optic disc drusen, Progressive visual loss, Retinal detachment, Retinal exudate, Rod-cone dystrophy, Unilateral strabismus, CONGENITAL HEART DEFECTS AND SKELETAL MALFORMATIONS SYNDROME, Failure to thrive, Abnormality of the anterior fontanelle, Abnormality of the cerebral white matter, Central hypotonia, Cryptorchidism, Deep plantar creases, Global developmental delay, Macrocephalus, Carious teeth, Intellectual disability, Microcephaly, Muscular hypotonia, Oral-pharyngeal dysphagia, Skeletal muscle atrophy, Cohen syndrome, Retinal dystrophy, CNS demyelination, Cerebral cortical atrophy, Difficulty walking, Dysmetria, Gait ataxia, Gait imbalance, Gout, Hypertension, Impaired vibration sensation in the lower limbs, Leukoencephalopathy with Brainstem and Spinal Cord Involvement and Lactate Elevation, Sensorimotor neuropathy, Talipes equinovarus, Aplasia of the ovary, Aplastic anemia, Atrial septal defect, Dilation of lateral ventricles, Downslanted palpebral fissures, Dry skin, Erythroid hypoplasia, Hemangioma, Hepatomegaly, Hypotelorism, Intracerebral periventricular calcifications, Low-set, posteriorly rotated ears, Pulmonary arterial hypertension, Relative macrocephaly, Vaginal hydrocele, Wide anterior fontanel, External ophthalmoplegia, OPHTHALMOPLEGIA, EXTERNAL, WITH RIB AND VERTEBRAL ANOMALIES, Scoliosis, Anonychia, Dominant dystrophic epidermolysis bullosa with absence of skin, Dystrophic epidermolysis bullosa, Epidermolysis bullosa dystrophica inversa, autosomal recessive, Epidermolysis bullosa dystrophica, AD, Epidermolysis bullosa dystrophica, AR, Epidermolysis bullosa pruriginosa, Generalized dominant dystrophic epidermolysis bullosa, Nail disorder, nonsyndromic congenital, 8, Nail dystrophy, Pretibial epidermolysis bullosa, Recessive dystrophic epidermolysis bullosa, Skin erosion, Transient bullous dermolysis of the newborn, Ptosis, Pulmonic stenosis, 66 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Short stature, Autistic disorder of childhood onset, Delayed speech and language development, Iris coloboma, Motor delay, Dominant hereditary optic atrophy, Mitochondrial diseases, Achondrogenesis, type IB, Atelosteogenesis type 2, Diastrophic dysplasia, Multiple epiphyseal dysplasia 4, Osteochondrodysplasia, SLC26A2-Related Disorders, Achondrogenesis, type II, Avascular necrosis of the head of femur, Coxa plana, Czech dysplasia metatarsal type, Epiphyseal dysplasia, multiple, with myopia and conductive deafness, Kniest dysplasia, Osteoarthritis with mild chondrodysplasia, Platyspondylic lethal skeletal dysplasia Torrance type, Spondyloepiphyseal dysplasia, Spondyloepiphyseal dysplasia, stanescu type, Spondylometaphyseal dysplasia, Spondyloperipheral dysplasia, Stickler syndrome type 1, Stickler syndrome, type I, nonsyndromic ocular, Achromatopsia, Achromatopsia 2, Achromatopsia 3, Achromatopsia 5, Achromatopsia 7, Acid-labile subunit deficiency, Acne inversa, familial, 2, Acne inversa, familial, 3, Alzheimer disease, type 3, Frontotemporal dementia, Pick's disease, Acrocephalosyndactyly type I, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Bent bone dysplasia syndrome, Craniosynostosis, Craniosynostosis, nonclassifiable autosomal dominant, Crouzon syndrome, Cutis Gyrata syndrome of Beare and Stevenson, FGFR2 related craniosynostosis, Jackson-Weiss syndrome, Levy-Hollister syndrome, Neoplasm of stomach, Pfeiffer syndrome, Saethre- Chotzen syndrome, Scaphocephaly, maxillary retrusion, and mental retardation, Acrodysostosis 2, with or without hormone resistance, Acromicric dysplasia, Cardiovascular phenotype, Ectopia lentis, isolated, autosomal dominant, Geleophysic dysplasia 2, MASS syndrome, Marfan Syndrome / Loeys-Dietz Syndrome / Familial Thoracic Aortic Aneurysms and Dissections, Marfan lipodystrophy syndrome, Marfan syndrome, Stiff skin syndrome, Thoracic aortic aneurysm and aortic dissection, Weill- Marchesani syndrome 2, ACTH resistance, Glucocorticoid Deficiency, Acute aortic dissection, Aortic aneurysm, familial thoracic 10, Familial thoracic aortic aneurysm, Acute intermittent porphyria, Thrombocytopenia, Acute myeloid leukemia, Beckwith-Wiedemann syndrome, Sotos syndrome 1, Brainstem glioma, Hepatocellular carcinoma, Neoplasm of brain, Neoplasm of the large intestine, D-2-hydroxyglutaric aciduria 2, Multiple myeloma, Myelodysplastic syndrome, Myelodysplastic syndrome progressed to acute myeloid leukemia, Myeloproliferative / lymphoproliferative neoplasms, familial (multiple types), susceptibility to, Spinocerebellar ataxia 35, Acute neuronopathic Gaucher's disease, Gaucher disease, Gaucher disease type 3C, Gaucher disease, perinatal lethal, Gaucher's disease, type 1, Lewy body dementia, Parkinson disease, late-onset, Subacute neuronopathic Gaucher's disease, Adams-Oliver syndrome 4, Adams-Oliver syndrome 5, 67 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Adams-Oliver syndrome 6, Addison's disease, Adrenoleukodystrophy, Adenine phosphoribosyltransferase deficiency, Adenocarcinoma of prostate, Adenocarcinoma of stomach, Carcinoma of colon, Chronic lymphocytic leukemia, Cutaneous melanoma, Follicular thyroid carcinoma, Lung adenocarcinoma, Malignant melanoma of skin, Malignant neoplasm of body of uterus, Neoplasm of the thyroid gland, Non-small cell lung cancer, Carcinoma of esophagus, Medulloblastoma, Pancreatic adenocarcinoma, Transitional cell carcinoma of the bladder, Cardio-facio-cutaneous syndrome, Cardiofaciocutaneous syndrome 4, Cardiomyopathy, dilated, 1NN, LEOPARD syndrome 2, Noonan syndrome 5, Noonan syndrome with multiple lentigines, Rasopathy, Adenylate kinase deficiency, hemolytic anemia due to, Adenylosuccinate lyase deficiency, Difficulty standing, Generalized myoclonic seizures, Inability to walk, Progressive neurologic deterioration, Severe global developmental delay, Adermatoglyphia, Keratoderma with scleroatrophy of the extremities, Adolescent nephronophthisis, Meckel syndrome type 7, Polycystic kidney dysplasia, Renal-hepatic-pancreatic dysplasia, Adrenal insufficiency, congenital, with 46,XY sex reversal, partial or complete, Adrenocorticotropic hormone deficiency, Adult hypophosphatasia, Childhood hypophosphatasia, Hypophosphatasia, Infantile hypophosphatasia, Adult junctional epidermolysis bullosa, Amelogenesis imperfecta, type IA, Junctional epidermolysis bullosa gravis of Herlitz, Adult neuronal ceroid lipofuscinosis, GBE1-Related Disorders, Glycogen storage disease IV, classic hepatic, Glycogen storage disease IV, nonprogressive hepatic, Glycogen storage disease, type IV, Polyglucosan body disease, adult, ADULT syndrome, Advanced sleep phase syndrome, familial, 3, Afibrinogenemia, congenital, Hypodysfibrinogenemia, congenital, Hypofibrinogenemia, Agammaglobulinemia 7, autosomal recessive, Immunodeficiency 36, SHORT syndrome, Agammaglobulinemia, non-Bruton type, X-linked agammaglobulinemia, Agenesis of corpus callosum, Cerebellar vermis hypoplasia, Intellectual developmental disorder with persistence of fetal hemoglobin, Aplastic anemia, susceptibility to, Deeply set eye, Microcephaly, Short stature, Shwachman syndrome, Splenomegaly, Age-related macular degeneration 1, Bull's eye maculopathy, Retinal dystrophy, Retinitis pigmentosa, Retinal dystrophy, early-onset severe, Aicardi Goutieres syndrome 2, Aicardi Goutieres syndrome 3, Aicardi Goutieres syndrome 4, Aicardi Goutieres syndrome 5, Singleton-Merten syndrome 1, AL KAISSI SYNDROME, Alacrima, achalasia, and mental retardation syndrome, Alagille syndrome 1, Deafness, congenital heart defects, and posterior embryotoxon, Tetralogy of Fallot, Alagille syndrome 2, Alazami syndrome, Albinism, ocular, with sensorineural deafness, Nonsyndromic Oculocutaneous Albinism, Oculocutaneous albinism type 1B, Skin / hair / eye pigmentation, variation in, 3, 68 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Aldosterone Producing Adrenal Cortex Adenoma, Alexander Disease, ALG12-congenital disorder of glycosylation, ALG9 congenital disorder of glycosylation, Alkaptonuria, Allan- Herndon-Dudley syndrome, Intellectual disability, Alpha Thalassemia, Alpha-1-antitrypsin deficiency, Chronic obstructive pulmonary disease, PI S, Hemorrhagic disease due to alpha-1-antitrypsin Pittsburgh mutation, PI NULL(BELLINGHAM), PI Q0(BELLINGHAM), PI NULL(LUDWIGSHAFEN), PI Q0(LUDWIGSHAFEN), PI S(IIYAMA), Alpha-B crystallinopathy, Dilated cardiomyopathy 1II, Alpha-methylacyl-CoA racemase deficiency, Bile acid synthesis defect, congenital, 4, Alpha-thalassemia, Hmong type, Alport syndrome, Alport syndrome 1, X-linked recessive, Alport syndrome 3, autosomal dominant, Alport syndrome, autosomal recessive, Benign familial hematuria, Alstrom syndrome, Alternating hemiplegia of childhood 2, Cerebellar ataxia, areflexia, pes cavus, optic atrophy and sensorinural hearing loss, Dystonia 12, Global developmental delay, Hemiplegia, Oculogyric crisis, Alzheimer disease, familial, 3, with spastic paraparesis and apraxia, Alzheimer disease, familial, 3, with unusual plaques, Alzheimer disease, familial, with spastic paraparesis and unusual plaques, Alzheimer disease, type 1, Alzheimer's disease, Cerebral amyloid angiopathy, APP-related, Alzheimer disease, type 4, Amelogenesis imperfecta, hypocalcification type, Amelogenesis imperfecta, hypomaturation type IIA4, Amelogenesis imperfecta, hypomaturation type IIA5, Amelogenesis imperfecta, hypomaturation type, IIA1, Amelogenesis imperfecta, type 1E, Amyloidogenic transthyretin amyloidosis, Cardiomyopathy, Carpal tunnel syndrome, Dystransthyretinemic euthyroidal hyperthyroxinemia, Amyotrophic lateral sclerosis 14 without frontotemporal dementia, Amyotrophic lateral sclerosis 14, with or without frontotemporal dementia, Inclusion body myopathy with early-onset paget disease and frontotemporal dementia, Amyotrophic lateral sclerosis 16, juvenile, Distal spinal muscular atrophy, autosomal recessive 2, Amyotrophic lateral sclerosis 17, Frontotemporal Dementia, Chromosome 3-Linked, Amyotrophic lateral sclerosis 18, Amyotrophic lateral sclerosis 21, Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, AMYOTROPHIC LATERAL SCLEROSIS 23, Amyotrophic lateral sclerosis type 1, Amyotrophic lateral sclerosis type 10, TARDBP-related frontotemporal dementia, Amyotrophic lateral sclerosis type 11, Charcot-Marie-Tooth disease, Charcot-Marie-Tooth disease type 4, Charcot-Marie-Tooth disease, type 4J, Amyotrophic lateral sclerosis type 2, Infantile-onset ascending hereditary spastic paralysis, Juvenile primary lateral sclerosis, Amyotrophic lateral sclerosis type 4, Distal spinal muscular atrophy, Spinocerebellar ataxia autosomal recessive 1, Amyotrophic lateral sclerosis type 5, Charcot-Marie-Tooth disease, axonal type 2X, Spastic paraplegia 11, autosomal recessive, Amyotrophic lateral 69 4922-1525-2775.5Attorney Docket No.701586-000133WOPT sclerosis type 6, Tremor, hereditary essential, 4, Amyotrophic lateral sclerosis type 8, Amyotrophic lateral sclerosis, typical, Spinal muscular atrophy, late-onset, finkel type, Amyotrophic lateral sclerosis type 9, Amyotrophy, hereditary neuralgic, Anauxetic dysplasia 2, Anauxetic dysplasia, Metaphyseal chondrodysplasia, McKusick type, Metaphyseal dysplasia without hypotrichosis, Andermann syndrome, Andersen Tawil syndrome, Atrial fibrillation, familial, 9, Congenital long QT syndrome, Short QT syndrome 3, Arrhythmia, Supraventricular tachycardia, Ventricular tachycardia, Androgen resistance syndrome, Bulbo-spinal atrophy X-linked, Anemia sideroblastic and spinocerebellar ataxia, Anemia without thromobocytopenia, X-linked, GATA-1-related thrombocytopenia with dyserythropoiesis, ANEMIA, CONGENITAL DYSERYTHROPOIETIC, TYPE Ib, Anemia, nonspherocytic hemolytic, due to G6PD deficiency, Susceptibility to malaria, FG syndrome 4, Mental retardation and microcephaly with pontine and cerebellar hypoplasia, Anemia, sideroblastic, 4, Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive, Anemia, Beta-plus-thalassemia, HEMOGLOBIN T (CAMBODIA), Hb SS disease, Hemoglobin E, Hemoglobin E disease, Hemoglobin E / beta thalassemia disease, Malaria, resistance to, Heinz body anemia, Splenomegaly, Angelman syndrome, Angelman syndrome-like, Atypical Rett syndrome, Early infantile epileptic encephalopathy 2, Angioedema, Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, Aniridia 1, Anomalous origin of coronary artery from the pulmonary artery, Ciliary dyskinesia, primary, 27, Clinodactyly of the 5th finger, Cough, Anonychia, Anosmia, Arhinia choanal atresia microphthalmia, Anterior segment dysgenesis 3, ANTERIOR SEGMENT DYSGENESIS 4, PETERS ANOMALY SUBTYPE, Anterior Segment Dysgenesis 5 – multiple subtypes, foveal hypoplasia 1 with or without anterior segment anomalies, anterior segment dysgenesis 7, anterior segment dysgenesis 8, Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis, Disordered steroidogenesis due to cytochrome p450 oxidoreductase deficiency, FGFR2 related craniosynostosis, Pfeiffer syndrome, Pfeiffer syndrome - type III, Aortic aneurysm, familial thoracic 4, Aortic aneurysm, familial thoracic 4, Aortic aneurysm, familial thoracic 6;Aortic aneurysm, familial thoracic 6, Cardiovascular phenotype, Connective tissue disorder, Moyamoya disease 5, Multisystemic smooth muscle dysfunction syndrome, Multisystemic smooth muscle dysfunction syndrome, Thoracic aortic aneurysm and aortic dissection, alterations of great arteries and veins, Thoracic aortic aneurysm and aortic dissection, Aortic root dilatation, Arachnodactyly, Dissecting aortic dilatation, Ectopia lentis, Ischemic stroke, Marfan Syndrome / Loeys-Dietz Syndrome / Familial Thoracic Aortic Aneurysms and Dissections, Marfan syndrome, Melanoma, Severe Myopia, Thoracic aortic aneurysm and aortic 70 4922-1525-2775.5Attorney Docket No.701586-000133WOPT dissection, not provided, Aplasia / Hypoplasia of the corpus callosum, Dyskinesia, Dystonia, Global brain atrophy, Intellectual disability, severe, Motor delay, Progressive microcephaly, Rolandic epilepsy, Severe global developmental delay, Unverricht- Lundborg syndrome, Aplastic anemia, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 2, Shwachman syndrome, APOE4(+), APOLIPOPROTEIN A-I (GIESSEN), APOLIPOPROTEIN A-I (MARBURG), APOLIPOPROTEIN A-I (MUNSTER3B), APOLIPOPROTEIN A-I (MUNSTER3C), Apolipoprotein A-I deficiency, APOLIPOPROTEIN C-II (AFRICAN), Apolipoprotein c-ii variant, Apparent mineralocorticoid excess, APRT deficiency, Japanese type, Adenine phosphoribosyltransferase deficiency, Arginase deficiency, Arginine:glycine amidinotransferase deficiency, Argininosuccinate lyase deficiency, Arhinia choanal atresia microphthalmia, Facioscapulohumeral muscular dystrophy 2, ARMC9-related Joubert syndrome, JOUBERT SYNDROME 30, Aromatase deficiency, Arrhythmia, Contractures of the joints of the lower limbs, Elbow flexion contracture, Limb-girdle muscular dystrophy, type 2A, Muscle weakness, Muscular dystrophy, Arrhythmogenic right ventricular cardiomyopathy, Arrhythmogenic right ventricular cardiomyopathy, type 10, Arrhythmogenic right ventricular cardiomyopathy, type 11, Dilated cardiomyopathy with woolly hair and keratoderma, Epidermolysis bullosa, lethal acantholytic, Keratosis palmoplantaris striata II, Skin fragility woolly hair syndrome, Primary dilated cardiomyopathy, Cardiomyopathy, dilated, with woolly hair, keratoderma, and tooth agenesis, Cardiomyopathy, Arrhythmogenic right ventricular dysplasia, familial, 11, with mild palmoplantar keratoderma and woolly hair, Arrhythmogenic right ventricular dysplasia, familial, 13, Arrhythmogenic right ventricular dysplasia, familial, 2, Cardiovascular phenotype, Catecholaminergic polymorphic ventricular tachycardia, Long QT syndrome, Ventricular fibrillation, Arterial calcification of infancy, Arthrogryposis multiplex congenita, Lethal congenital contracture syndrome 9, Arthrogryposis renal dysfunction cholestasis syndrome, ARTHROGRYPOSIS, CLEFT PALATE, CRANIOSYNOSTOSIS, AND IMPAIRED INTELLECTUAL DEVELOPMENT, ARTHROGRYPOSIS, DISTAL, TYPE 2B3, ARTHROGRYPOSIS, DISTAL, TYPE 2B4, Aspartylglucosaminuria, Aspartylglucosaminuria, finnish type, Asphyxiating thoracic dystrophy 4, Finnish congenital nephrotic syndrome, Jeune thoracic dystrophy, Nephronophthisis, Nephronophthisis 12, Type IV short rib polydactyly syndrome, Asplenia, isolated congenital, Astigmatism, Cryptorchidism, Epicanthus, Esotropia, Global developmental delay, Hypermetropia, Hypertelorism, Intellectual disability, Retrognathia, 71 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Wide nasal bridge, Astrocytoma, Brainstem glioma, Juvenile myelomonocytic leukemia, Multiple myeloma, Neoplasm of the large intestine, Neuroblastoma, Noonan syndrome, Rasopathy, Squamous cell lung carcinoma, Asymmetric septal hypertrophy, Dyspnea, Familial hypertrophic cardiomyopathy 4, Heart block, Hypertrophic cardiomyopathy, Left ventricular noncompaction 10, Noncompaction cardiomyopathy, Primary familial hypertrophic cardiomyopathy, Tachycardia, Ventricular extrasystoles, Ataxia and retinitis pigmentosa with isolated vitamin E deficiency, Ataxia with vitamin E deficiency, Ataxia, Friedreich-like, with isolated vitamin E deficiency, Ataxia, spastic, 1, autosomal dominant, Spastic paraplegia, Expressive language delay, Hypotonia, ataxia, and delayed development syndrome, Muscular hypotonia, Ataxia-oculomotor apraxia type 1, Early infantile epileptic encephalopathy 10, Ateleiotic dwarfism, Short stature with microcephaly and distinctive facies, Short stature, microcephaly, and endocrine dysfunction, Atelosteogenesis type 1, Atrial septal defect 7 with or without atrioventricular conduction defects, Atrial septal defect, Noncompaction cardiomyopathy, Ventricular fibrillation, Atrophia bulborum hereditaria, Exudative vitreoretinopathy 5, Persistent hyperplastic primary vitreous, autosomal recessive, Atrophoderma vermiculatum, Keratosis pilaris, ATR-X syndrome, Acquired hemoglobin H disease, Inborn genetic diseases, Mental retardation-hypotonic facies syndrome X-linked, 1, Attention deficit hyperactivity disorder, Hearing impairment, Obsessive-compulsive behavior, Seizures, Atypical hemolytic uremic syndrome, Hemolytic uremic syndrome, atypical, susceptibility to, 7, Nephrotic syndrome, type 7, Atypical hemolytic-uremic syndrome 1, Atypical hemolytic-uremic syndrome 2, Atypical mycobacteriosis, familial, X-linked 2, Chronic granulomatous disease, Atypical Rett syndrome, Early infantile epileptic encephalopathy 2, Auditory neuropathy, autosomal recessive, 1, Deafness, autosomal recessive 9, AU-KLINE SYNDROME, Auriculocondylar syndrome 1, Auriculocondylar syndrome 2, Autoimmune lymphoproliferative syndrome, type 1a, Autoimmune lymphoproliferative syndrome, type V, Autoimmune polyglandular syndrome type 1, autosomal dominant, Autoimmune polyglandular syndrome type 1, with reversible metaphyseal dysplasia, Polyglandular autoimmune syndrome, type 1, Autoinflammation with infantile enterocolitis, Syndrome of entercolitis and autoinflmmation caused by mutation of NLRC4 (SCAN4), Autoinflammation, panniculitis, and dermatosis syndrome, Autoinflammatory syndrome, familial, Behcet-like, Autonomic nervous system dysfunction, Autosomal dominant distal hereditary motor neuropathy, Charcot-Marie- Tooth disease type 2C, Distal spinal muscular atrophy, congenital nonprogressive, Neuromuscular Diseases, Skeletal dysplasia, Charcot-Marie-Tooth disease, axonal, type 2S, Inborn genetic diseases, Spinal muscular atrophy, distal, autosomal recessive, 1, 72 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Scapuloperoneal spinal muscular atrophy, Spinal muscular atrophy, lower extremity- predominant, 2A, autosomal dominant, Autosomal dominant hypohidrotic ectodermal dysplasia, Autosomal recessive hypohidrotic ectodermal dysplasia syndrome, Autosomal dominant intermediate Charcot-Marie-Tooth disease, Congenital myotonia, autosomal dominant form, Congenital myotonia, autosomal recessive form, Myotonia congenita, Autosomal dominant isolated somatotropin deficiency, Autosomal dominant nocturnal frontal lobe epilepsy, Epilepsy, nocturnal frontal lobe, type 1, Autosomal dominant optic atrophy plus syndrome, Mitochondrial diseases, Autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 1, Cerebellar ataxia infantile with progressive external ophthalmoplegia, Mitochondrial DNA depletion syndrome 1 (MNGIE type), Mitochondrial DNA depletion syndrome 4B, MNGIE type, Progressive sclerosing poliodystrophy, Sensory ataxic neuropathy, dysarthria, and ophthalmoparesis, Autosomal recessive congenital ichthyosis 1, Ichthyosis, Autosomal recessive congenital ichthyosis 4B, Autosomal recessive congenital ichthyosis 5, Autosomal recessive congenital ichthyosis 6, Autosomal recessive congenital ichthyosis 3, Autosomal recessive cutis laxa type 1B, Autosomal recessive cutis laxa type IA, Autosomal recessive Dejerine-Sottas syndrome, Charcot-Marie-Tooth disease type 4, Charcot-Marie-Tooth disease, demyelinating, type 4F, Autosomal recessive hearing impairment with normal menstrual cycles, Perrault syndrome 3, Autosomal recessive hypophosphatemic bone disease, Autosomal recessive hypophosphatemic vitamin D refractory rickets, Autosomal Recessive Hypotrichosis with Woolly Hair, Autosomal recessive woolly hair 3, Autosomal recessive non-syndromic intellectual disability, Autosomal recessive non-syndromic sensorineural deafness type DFNB, Autosomal recessive polycystic kidney disease, Autosomal recessive severe congenital neutropenia, Specific granule deficiency, Specific granule deficiency 2, Autosomal recessive spastic ataxia, Spastic ataxia Charlevoix- Saguenay type, Axenfeld-Rieger syndrome type 1, Axenfeld-Rieger syndrome type 3, Hereditary cancer-predisposing syndrome, B lymphoblastic leukemia lymphoma, no ICD- O subtype, LEOPARD syndrome 1, Lymphoma, Metachondromatosis, Noonan syndrome 1, Noonan syndrome 3, Bainbridge-Ropers syndrome, BAKER-GORDON SYNDROME, SYT1-associated neurodevelopmental disorder, Baller-Gerold syndrome, Inborn genetic diseases, Rapadilino syndrome, Rothmund-Thomson syndrome, BAP1 Cancer Syndrome, Tumor susceptibility linked to germline BAP1 mutations, Baraitser-Winter syndrome 1, Baraitser-Winter Syndrome 2, Deafness, autosomal dominant 20, Barakat syndrome, Bardet-Biedl syndrome, Bardet-Biedl syndrome 1, Bardet-Biedl syndrome 10, Bardet-Biedl syndrome 13, Bardet-Biedl syndrome 14, Bardet-Biedl syndrome 16, Bardet- 73 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Biedl syndrome 17, Bardet-Biedl syndrome 18, Bardet-Biedl syndrome 2, Bardet-Biedl syndrome 21, Bardet-Biedl syndrome 3, Bardet-Biedl syndrome 4, Bardet-Biedl syndrome 5, Bardet-Biedl syndrome 6, Bardet-Biedl syndrome 7, Bardet-Biedl syndrome 9, COACH syndrome, Joubert syndrome 6, Bardet-biedl syndrome 2 / 6, digenic, Bardet-biedl syndrome 6 / 10, digenic, Inborn genetic diseases, Retinitis pigmentosa, Usher syndrome, Foot polydactyly, High-frequency hearing impairment, Intellectual disability, Macular degeneration, Postaxial hand polydactyly, Retinal dystrophy, Blindness, Cystic renal dysplasia, Leber congenital amaurosis 10, Meckel syndrome type 4, Meckel-Gruber syndrome, Nephronophthisis, Occipital encephalocele, Senior-Loken syndrome 6, Senior- Loken syndrome 7, Chronic kidney disease, Global developmental delay, Joubert syndrome 28, Limb undergrowth, Rotary nystagmus, Joubert syndrome 5, Retinal dystrophy, Retinitis pigmentosa 74, Retinitis pigmentosa 55, McKusick Kaufman syndrome, Inborn genetic diseases, Senior-Loken syndrome 7, Bare lymphocyte syndrome 2, Barrett esophagus / esophageal adenocarcinoma, Bartter syndrome type 3, Bartter syndrome type 4, Bartter syndrome, type 1, antenatal, Nephrocalcinosis, Nephrolithiasis, Bartter syndrome, type 2, antenatal, Bartter syndrome, type 3, with hypocalciuria, Bartter syndrome, type 5, antenatal, transient, Basal cell carcinoma, somatic, Basal ganglia calcification, idiopathic, 4, Basal ganglia calcification, idiopathic, 6, Basal laminar drusen, Basan syndrome, Basel-Vanagaite-Smirin-Yosef syndrome, BBS2- Related Disorders, Beaded hair, Beaulieu-Boycott-Innes syndrome, Becker muscular dystrophy, Dilated cardiomyopathy 3B, Duchenne muscular dystrophy, Beckwith- Wiedemann syndrome, Sotos syndrome 1, Benign familial hematuria, Benign familial neonatal seizures 1, Benign scapuloperoneal muscular dystrophy with cardiomyopathy, Congenital muscular dystrophy, LMNA-related, Limb-girdle muscular dystrophy, type 1B, Bent bone dysplasia syndrome, Bernard-Soulier syndrome type C, Macrothrombocytopenia, Bernard-Soulier syndrome, type A1, Bestrophinopathy, autosomal recessive, beta Thalassemia, Beta thalassemia intermedia, Beta-plus- thalassemia, Beta thalassemia major, beta^0^ Thalassemia, Beta-D-mannosidosis, Beta- Houston-thalassemia, Beta-malay-thalassemia, Beta-thalassemia, dominant inclusion body type, Bethlem myopathy 1, Dystonia 27, Ullrich congenital muscular dystrophy 1, BETHLEM MYOPATHY 1, AUTOSOMAL RECESSIVE, Beukes hip dysplasia, SPONDYLOEPIMETAPHYSEAL DYSPLASIA, DI ROCCO TYPE, Bietti crystalline corneoretinal dystrophy, Stargardt disease 1, Bifunctional peroxisomal enzyme deficiency, Perrault syndrome, Perrault syndrome 1, Bilateral conductive hearing impairment, Bilateral sensorineural hearing impairment, Deafness, Deafness, autosomal dominant 3a, 74 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Deafness, autosomal recessive 1A, Deafness, digenic, GJB2 / GJB6, Hystrix-like ichthyosis with deafness, Keratitis-ichthyosis-deafness syndrome, autosomal dominant, Keratoderma palmoplantar deafness, Knuckle pads, deafness AND leukonychia syndrome, Mutilating keratoderma, Nonsyndromic Hearing Loss, Recessive, Nonsyndromic hearing loss and deafness, Rare genetic deafness, Severe sensorineural hearing impairment, Bilateral right-sidedness sequence, Bile acid synthesis defect, congenital, 1, Bile acid synthesis defect, congenital, 6, Biotinidase deficiency, Biotin- thiamine-responsive basal ganglia disease, Birk Barel mental retardation dysmorphism syndrome, Cardiac conduction disease with or without dilated cardiomyopathy, Cardiac valvular defect, developmental, Cardiac valvular dysplasia, X-linked, Cardio-facio- cutaneous syndrome, Cardiofaciocutaneous syndrome 3, Cardio-facio-cutaneous syndrome 1, Inborn genetic diseases, Rasopathy, LEOPARD syndrome 3, Lung cancer, Noonan syndrome 1, Noonan syndrome 7, Noonan syndrome and Noonan-related syndrome, Glioblastoma, Lung adenocarcinoma, Multiple myeloma, Transitional cell carcinoma of the bladder, Cutaneous melanoma, Neoplasm, Non-small cell lung cancer, Cardiomyopathy, Cardiomyopathy, dilated, with woolly hair, keratoderma, and tooth agenesis, Cardiomyopathy, familial hypertrophic, 26, Dilated Cardiomyopathy, Dominant, Myofibrillar myopathy, filamin C-related, Myopathy, distal, 4, Cardiomyopathy, familial restrictive, 5, Cardiomyopathy, mitochondrial, Cardiovascular phenotype, Familial hypertrophic cardiomyopathy 4, Hypertrophic cardiomyopathy, Left ventricular noncompaction, Familial hypertrophic cardiomyopathy 6, Glycogen storage disease of heart, lethal congenital, Primary familial hypertrophic cardiomyopathy, Wolff-Parkinson- White pattern, Dilated cardiomyopathy 1G, Hereditary myopathy with early respiratory failure, Limb-girdle muscular dystrophy, type 2J, Primary dilated cardiomyopathy, Familial dilated cardiomyopathy, Familial hypertrophic cardiomyopathy 1, Congenital long QT syndrome, Jervell and Lange-Nielsen syndrome 1, Long QT syndrome, Long QT syndrome 1, Congenital myopathy with fiber type disproportion, Dilated cardiomyopathy 1S, Myopathy, distal, 1, Myopathy, myosin storage, autosomal recessive, Myosin storage myopathy, Scapuloperoneal myopathy, MYH7-related, Primary dilated cardiomyopathy, Ebstein anomaly of the tricuspid valve, Left ventricular noncompaction 10, Familial restrictive cardiomyopathy 3, Ehlers-Danlos syndrome, hydroxylysine-deficient, Ehlers- Danlos syndrome, type 4, Fabry disease, Fabry disease, cardiac variant, Myopathy, distal, 1, MYBPC3-Related Disorders, Inborn genetic diseases, Thoracic aortic aneurysm and aortic dissection, Carney complex, type 1, Carnitine acylcarnitine translocase deficiency, Carnitine palmitoyltransferase I deficiency, Carnitine palmitoyltransferase II deficiency, 75 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Encephalopathy, acute, infection-induced, 4, susceptibility to, Carpenter syndrome 2, Carpenter syndrome 1, Cataract 1, Cataract 15, multiple types, Cataract 2, Coppock-like, Cataract 21, multiple types, Cataract 23, multiple types, Congenital cataract, Cataract 39, multiple types, Cataract 4, Cataract 44, Cataract Hutterite type, Cataract, autosomal dominant, Cataract, autosomal dominant, multiple types, with microcornea, Cataract, autosomal recessive congenital 4, Cataract, autosomal recessive congenital 5, Sengers syndrome, Cataract, congenital nuclear, autosomal recessive 2, Cataract, microphthalmia and nystagmus, Catecholaminergic polymorphic ventricular tachycardia, Catecholaminergic polymorphic ventricular tachycardia type 1, DOORS syndrome, Deafness, autosomal dominant 65, Epileptic encephalopathy, early infantile, 1, Cavernous hemangioma, CDH23-Related Disorders, Deafness, autosomal recessive 12, PITUITARY ADENOMA 5, MULTIPLE TYPES, Rare genetic deafness, Usher syndrome, type 1D, Central scotoma, Macular degeneration, Retinal atrophy, Stargardt disease 1, Visual impairment, Centromeric instability of chromosomes 1,9 and 16 and immunodeficiency, Cerebellar ataxia and mental retardation with quadrupedal locomotion 1, Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 1, Cerebellar ataxia, Cerebellar atrophy, Dysdiadochokinesis, Dysmetria, Nystagmus, Slightly reduced reflexes, Slurred speech, Global developmental delay, Microcephaly, Myoclonus, Seizures, CEREBELLAR ATROPHY WITH SEIZURES AND VARIABLE DEVELOPMENTAL DELAY, Congenital anomalies of kidney and urinary tract, Cerebellar cortical atrophy, Dystonia, Cerebellar vermis hypoplasia, Early infantile epileptic encephalopathy, Hartsfield syndrome, Xia- Gibbs syndrome, CEREBELLAR, OCULAR, CRANIOFACIAL, AND GENITAL SYNDROME, Cerebellofaciodental syndrome, CEREBRAL AMYLOID ANGIOPATHY, APP-RELATED, PIEDMONT VARIANT, CEREBRAL AMYLOID ANGIOPATHY, PRNP- RELATED, Genetic prion diseases, Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, Cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy, Cerebral calcification, Dilatation, Interstitial pneumonitis, Liver cirrhosis, Rajab syndrome, Cerebral cavernous malformation, Cerebral cavernous malformations 1, Cerebral cavernous malformations 2, Cerebral cavernous malformations 3, Distal spinal muscular atrophy, Gait ataxia, Hereditary spastic paraplegia, Memory impairment, Spastic paraparesis, Spastic paraplegia, Spastic paraplegia 7, Cerebral creatine deficiency syndrome, Deficiency of guanidinoacetate methyltransferase, Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome, Cerebral folate deficiency, Cerebral hypomyelination, Elbow flexion contracture, Intellectual disability, Knee flexion 76 4922-1525-2775.5Attorney Docket No.701586-000133WOPT contracture, Muscular hypotonia, Cerebral hypoplasia, Cerebral palsy, spastic quadriplegic, 1, Cerebral visual impairment and intellectual disability, Mental retardation, autosomal recessive 42, Cerebro-costo-mandibular syndrome, Cerebrooculofacioskeletal syndrome 2, Trichothiodystrophy 1, photosensitive, Xeroderma pigmentosum, group D, Cerebrooculofacioskeletal syndrome 3, Cerebroretinal microangiopathy with calcifications and cysts, Cerebroretinal microangiopathy with calcifications and cysts 1, Dyskeratosis congenita, Ceroid lipofuscinosis neuronal 1, Neuronal ceroid lipofuscinosis, Ceroid lipofuscinosis neuronal 10, Ceroid lipofuscinosis neuronal 2, Childhood-onset autosomal recessive slowly progressive spinocerebellar ataxia, Ceroid lipofuscinosis neuronal 4B autosomal dominant, Ceroid lipofuscinosis neuronal 5, Ceroid lipofuscinosis neuronal 6, Ceroid lipofuscinosis neuronal 7, Macular dystrophy with central cone involvement, Ceroid lipofuscinosis neuronal 8, Ceroid lipofuscinosis, neuronal, 8, northern epilepsy variant, Ceroid lipofuscinosis, neuronal, 11, Frontotemporal dementia, ubiquitin-positive, Primary progressive aphasia, Ceroid lipofuscinosis, neuronal, 13, Ceroid lipofuscinosis, neuronal, 3, protracted, Juvenile neuronal ceroid lipofuscinosis, Ceruloplasmin belfast, Deficiency of ferroxidase, CFHR5 deficiency, Chédiak-Higashi syndrome, Charcot-Marie-Tooth disease, Charcot-Marie-Tooth disease dominant intermediate 3, Charcot-Marie-Tooth disease type 2I, Charcot-Marie-Tooth disease type 2J, Charcot-Marie-Tooth disease, demyelinating, type 1b, Congenital hypomyelinating neuropathy 1, autosomal recessive, Dejerine-Sottas disease, Dejerine-Sottas syndrome, autosomal dominant, Roussy-Lévy syndrome, Charcot-Marie-Tooth disease type 2C, Neuromuscular Diseases, Parastremmatic dwarfism, Skeletal dysplasia, Spondylometaphyseal dysplasia, Kozlowski type, Charcot-Marie-Tooth disease type 2E, Distal hereditary motor neuronopathy type 2B, Charcot-Marie-Tooth disease type 2K, Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, autosomal recessive, Charcot-Marie-Tooth disease, recessive intermediate A, Charcot-Marie-Tooth disease, type 4A, Neuropathy, axonal, with vocal cord paresis, autosomal recessive, Charcot-Marie-Tooth disease type 4, Charcot-Marie-Tooth disease, demyelinating, type 4F, Charcot-Marie-Tooth disease, dominant intermediate B, Myopathy, centronuclear, Myopathy, centronuclear, 1, Charcot- Marie-Tooth disease, dominant intermediate E, Focal segmental glomerulosclerosis 5, Charcot-Marie-Tooth disease, dominant intermediate G, Charcot-Marie-Tooth disease, recessive intermediate c, Charcot-Marie-Tooth disease, type 1C, Charcot-Marie-Tooth disease, axonal type 2V, Mucopolysaccharidosis, MPS-III-B, Charcot-Marie-Tooth disease, axonal type 2X, Spastic paraplegia 11, autosomal recessive, Charcot-Marie- Tooth disease, axonal, autosomal recessive, type 2A2B, Hereditary motor and sensory 77 4922-1525-2775.5Attorney Docket No.701586-000133WOPT neuropathy with optic atrophy, Charcot-Marie-Tooth disease, axonal, type 2CC, Charcot- Marie-Tooth disease, axonal, type 2DD, MPV17-Related Disorders, Navajo neurohepatopathy, Charcot-Marie-Tooth disease, axonal, type 2O, Spinal muscular atrophy, lower extremity predominant 1, autosomal dominant, Charcot-Marie-Tooth disease, axonal, type 2Q, Charcot-Marie-Tooth disease, axonal, type 2R, Charcot-Marie- Tooth disease, axonal, type 2S, Spinal muscular atrophy, distal, autosomal recessive, 1, Werdnig-Hoffmann disease, Charcot-Marie-Tooth disease, axonal, type 2T, Charcot- Marie-Tooth disease, axonal, type 2w, Charcot-Marie-Tooth disease, axonal, type 2z, Charcot-Marie-Tooth disease, demyelinating, type 1d, Charcot-Marie-Tooth disease, type I, Charcot-Marie-Tooth disease, demyelinating, type 1f, Charcot-Marie-Tooth disease, demyelinating, type 1G, Charcot-Marie-Tooth disease, type 4B1, Charcot-Marie-Tooth disease, type 4B3, Charcot-Marie-Tooth disease, type 4C, Charcot-Marie-Tooth disease, type IA, Charcot-Marie-Tooth disease, X-linked recessive, type 5, Charcot-Marie-Tooth disease type 2, Distal spinal muscular atrophy, congenital nonprogressive, Scapuloperoneal spinal muscular atrophy, Charcot-Marie-Tooth Neuropathy X, X-linked hereditary motor and sensory neuropathy, CHARGE association, Kallmann syndrome 5, Chest pain, Child syndrome, Childhood Onset Dystonias, Optic atrophy, Childhood-Onset Schizophrenia, Cholecystitis, Cholestanol storage disease, Cholestasis, benign recurrent intrahepatic 1, Progressive intrahepatic cholestasis, Cholestasis, intrahepatic, of pregnancy 3, Progressive familial intrahepatic cholestasis 3, Cholesterol monooxygenase (side-chain cleaving) deficiency, Chondrodysplasia punctata 1, X-linked recessive, Chondrodysplasia punctata 2 X-linked dominant, Chondrodysplasia punctata 2, X-linked dominant, atypical, Chondrodysplasia with joint dislocations, GPAPP type, Chondrodysplasia with platyspondyly, distinctive brachydactyly, hydrocephaly, and microphthalmia, Chondroectodermal dysplasia, Curry-Hall syndrome, Ellis-van Creveld Syndrome, Short rib-polydactyly syndrome, Majewski type, Chorea, Epileptic encephalopathy, early infantile, 37, Progressive encephalopathy, Choreoacanthocytosis, Choreoathetosis, hypothyroidism, and neonatal respiratory distress, Choroidal dystrophy, central areolar 2, Cone / cone-rod dystrophy, Progressive cone dystrophy (without rod involvement), Choroidal sclerosis, Cone-rod dystrophy 6, Leber congenital amaurosis, Leber congenital amaurosis 1, NIGHT BLINDNESS, CONGENITAL STATIONARY, TYPE 1I, Choroideremia, Christianson syndrome, CHRNG-Related Disorders, Lethal multiple pterygium syndrome, Multiple pterygium syndrome Escobar type, Chromophobe renal cell carcinoma, Renal cysts and diabetes syndrome, Chromosome 2q32-q33 deletion syndrome, Cleft palate, isolated, History of neurodevelopmental disorder, Chromosome 78 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 9q deletion syndrome, Chromosome Xq28 deletion syndrome, Chronic granulomatous disease, autosomal recessive cytochrome b-positive, type 1, Granulomatous disease, chronic, autosomal recessive, cytochrome b-positive, type III, Chronic granulomatous disease, autosomal recessive cytochrome b-positive, type 2, Chronic granulomatous disease, X-linked, Cryopyrin associated periodic syndrome, DEAFNESS, AUTOSOMAL DOMINANT 34, WITH OR WITHOUT INFLAMMATION, Familial amyloid nephropathy with urticaria AND deafness, Familial cold urticaria, Keratitis fugax hereditaria, Chronic intestinal pseudoobstruction, Megacystis, Visceral myopathy, Visceral neuropathy, familial, autosomal dominant, Chronic myelogenous leukemia, Chronic pancreatitis, Hereditary pancreatitis, Tropical calcific pancreatitis, Chronic progressive multiple sclerosis, Ciliary dyskinesia, primary, 10, Kartagener syndrome, Ciliary dyskinesia, primary, 11, Primary ciliary dyskinesia, Ciliary dyskinesia, primary, 13, Ciliary dyskinesia, primary, 15, Ciliary dyskinesia, primary, 16, Ciliary dyskinesia, primary, 17, Ciliary dyskinesia, primary, 18, Ciliary dyskinesia, primary, 19, Ciliary dyskinesia, primary, 2, Ciliary dyskinesia, primary, 20, Ciliary dyskinesia, primary, 21, Ciliary dyskinesia, primary, 22, Ciliary dyskinesia, primary, 26, Ciliary dyskinesia, primary, 28, Ciliary dyskinesia, primary, 29, Ciliary dyskinesia, primary, 3, Ciliary dyskinesia, primary, 30, Ciliary dyskinesia, primary, 32, Cone-rod dystrophy 2, Cone-rod dystrophy 20, Cone-rod dystrophy 3, Retinal dystrophy, Retinitis pigmentosa 19, Stargardt disease 1, Progressive cone dystrophy (without rod involvement), Cone-rod dystrophy amelogenesis imperfecta, Cone-rod dystrophy and hearing loss, Juvenile retinitis pigmentosa, Cone-rod dystrophy, X-linked 1, Retinal pigment epithelial atrophy, Retinitis pigmentosa 26, Rare genetic deafness, Usher syndrome, type 2A, Retinitis pigmentosa 39, Congenital absence of salivary gland, Levy-Hollister syndrome, Congenital adrenal hypoplasia, X-linked, Congenital amegakaryocytic thrombocytopenia, MPL-Related Disorders, Myelofibrosis, Thrombocytopenia, Thrombocytosis, benign familial microcytic, essential thrombocytemia, Hematologic neoplasm, Myelofibrosis with myeloid metaplasia, Thrombocythemia 2, somatic, Congenital bilateral absence of the vas deferens, Vas deferens, congenital bilateral aplasia of, X-linked, Congenital cataract, Neurodevelopmental delay, Severe sensorineural hearing impairment, Congenital cataracts, hearing loss, and neurodegeneration, Congenital central hypoventilation, Congenital contractural arachnodactyly, Congenital contractures of the limbs and face, hypotonia, and developmental delay, Intellectual disability with episodic ataxia and congenital arthrogryposis, Congenital defect of folate absorption, Congenital diaphragmatic hernia, Cryptorchidism, Hypospadias, penile, Intrauterine growth 79 4922-1525-2775.5Attorney Docket No.701586-000133WOPT retardation, Long philtrum, Microretrognathia, Pulmonary hypoplasia, Right ventricular hypertrophy, Single umbilical artery, Congenital disorder of deglycosylation, Inborn genetic diseases, Congenital disorder of glycosylation type 1bb, Congenital disorder of glycosylation type 1C, Congenital disorder of glycosylation type 1D, Congenital disorder of glycosylation type 1E, Congenital disorder of glycosylation type 1H, Congenital disorder of glycosylation type 1I, Congenital disorder of glycosylation type 1J, Congenital disorder of glycosylation type 1K, Congenital disorder of glycosylation type 1M, Congenital disorder of glycosylation type 1N, Congenital disorder of glycosylation type 1O, Congenital disorder of glycosylation type 1P, Congenital disorder of glycosylation type 1t, Congenital disorder of glycosylation type 1y, Congenital disorder of glycosylation type 2C, Congenital disorder of glycosylation type 2J, Congenital disorder of glycosylation with defective fucosylation 2, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE IIm, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE IIn, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE IIo, Congenital disorders of glycosylation type II, CONGENITAL DISORDER OF GLYCOSYLATION, TYPE IIp, Congenital dyserythropoietic anemia, type I, Congenital dyserythropoietic anemia, type II, Cowden syndrome 7, Congenital erythropoietic porphyria, Congenital generalized lipodystrophy type 1, Congenital generalized lipodystrophy type 2, Encephalopathy, progressive, with or without lipodystrophy, Congenital glaucoma, Glaucoma 3, primary congenital, A, Congenital glucose-galactose malabsorption, Congenital heart defects and ectodermal dysplasia, Congenital heart defects, multiple types, 1, X-linked, Congenital heart defects, multiple types, 2, Congenital heart defects, multiple types, 4, Congenital heart disease, Congenital hydrocephalus 1, Congenital hyperammonemia, type I, Congenital hypomyelinating neuropathy 1, autosomal dominant, Congenital hypomyelinating neuropathy 1, autosomal recessive, Congenital hypomyelinating neuropathy 3, Congenital hypothyroidism, Hypothyroidism, congenital, nongoitrous, 1, Congenital ATN1 related disorder, Congenital lactase deficiency, Congenital long QT syndrome, Long QT syndrome, Long QT syndrome 1, Long QT syndrome 1 / 2, digenic, Long QT syndrome 2, Long QT syndrome 2 / 5, Long QT syndrome, bradycardia-induced, Long QT syndrome, LQT1 subtype, Long qt syndrome 3 / 6, digenic, Long QT syndrome 3, Congenital microvillous atrophy, Congenital muscular dystrophy due to partial LAMA2 deficiency, Laminin alpha 2-related dystrophy, Merosin deficient congenital muscular dystrophy, Congenital muscular dystrophy- dystroglycanopathy (with or without mental retardation) type B5, Difficulty climbing stairs, Difficulty standing, Difficulty walking, Gait imbalance, Headache, Limb-girdle muscular dystrophy, Limb-girdle muscular dystrophy-dystroglycanopathy, type C5, Muscle 80 4922-1525-2775.5Attorney Docket No.701586-000133WOPT weakness, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, Paresthesia, Scapular winging, Walker-Warburg congenital muscular dystrophy, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A5, FKRP-Related Disorder, Congenital muscular dystrophy- dystroglycanopathy with brain and eye anomalies, type A2, Congenital muscular dystrophy-dystroglycanopathy with mental retardation, type B2, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A3, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A4, FKTN- Related Disorders, Fukuyama congenital muscular dystrophy, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A6, Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies, type A7, Congenital muscular dystrophy-dystroglycanopathy with mental retardation, type B1, POMT1-Related Disorders, Congenital muscular hypertrophy-cerebral syndrome, Congenital myasthenic syndrome, Endplate acetylcholinesterase deficiency, Familial hyperkalemic periodic paralysis, Hyperkalemic Periodic Paralysis Type 1, Hypokalemic periodic paralysis 1, Hypokalemic periodic paralysis, type 2, Paramyotonia congenita of von Eulenburg, Paramyotonia congenita / hyperkalemic periodic paralysis, Potassium aggravated myotonia, Congenital myopathy with fiber type disproportion, Myopathy, Central Core, Congenital myotonia, autosomal dominant form, Congenital myotonia, autosomal recessive form, Myotonia congenita, Congenital NAD deficiency disorder, VERTEBRAL, CARDIAC, RENAL, AND LIMB DEFECTS SYNDROME 1, Congenital nonprogressive myopathy with Moebius and Robin sequences, Congenital omphalocele, Deafness, X-linked 2, Deafness, autosomal dominant 3a, Deafness, autosomal recessive 1A, Hearing impairment, Hearing loss, Horseshoe kidney, Hystrix-like ichthyosis with deafness, Keratitis-ichthyosis-deafness syndrome, autosomal dominant, Keratoderma palmoplantar deafness, Knuckle pads, deafness AND leukonychia syndrome, Mutilating keratoderma, Short palpebral fissure, Congenital secretory diarrhea, chloride type, Congenital stationary night blindness, Pigmentary retinal dystrophy, Retinitis pigmentosa 4, Congenital Stromal Corneal Dystrophy, Congenital titinopathy, Myopathy, early-onset, with fatal cardiomyopathy, Conotruncal anomaly face syndrome / velocardiofacial syndrome, CONTRACTURES, PTERYGIA, AND VARIABLE SKELETAL FUSIONS SYNDROME 1B, Distal arthrogryposis type 8, Spondylocarpotarsal synostosis syndrome, Cornea plana 2, Corneal dystrophy, Corneal dystrophy and perceptive deafness, Corneal dystrophy, Fuchs endothelial 1, Corneal dystrophy, posterior polymorphous, 2, Corneal dystrophy, Fuchs endothelial, 6, Cornelia de Lange syndrome 1, Cornelia de Lange 81 4922-1525-2775.5Attorney Docket No.701586-000133WOPT syndrome 3, Cornelia de Lange syndrome 4, Cornelia de Lange syndrome 5, Coronary artery disease, Diabetes, Hypertension, Hypertriglyceridemia, Coronary heart disease, Hyperalphalipoproteinemia 2, Corpus callosum agenesis, Mirror movements 1, Cortical dysplasia, complex, with other brain malformations 1, Fibrosis of extraocular muscles, congenital, 3a, with or without extraocular involvement, Cortical dysplasia, complex, with other brain malformations 2, Cortical dysplasia, complex, with other brain malformations 3, Cortical dysplasia, complex, with other brain malformations 4, Cortical dysplasia, complex, with other brain malformations 5, Cortisone reductase deficiency 1, Cowchock syndrome, Cowden syndrome 6, Cranioectodermal dysplasia, Cranioectodermal dysplasia 1, Cranioectodermal dysplasia 2, Cranioectodermal dysplasia 4, Senior-Loken syndrome 8, Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, Craniofrontonasal dysplasia, Craniometaphyseal dysplasia, autosomal dominant, Craniosynostosis 1, Saethre-Chotzen syndrome, Craniosynostosis 2, Craniosynostosis 3, Craniosynostosis 6, Craniosynostosis, nonsyndromic unicoronal, Mental retardation, autosomal dominant, CRB1-Related Disorders, Retinitis pigmentosa 12, Creatine deficiency, X-linked, Crigler Najjar syndrome, type 1, Crisponi / Cold-induced sweating syndrome, Crouzon syndrome, FGFR2 related craniosynostosis, Jackson-Weiss syndrome, Pfeiffer syndrome, Treacher Collins syndrome, Cryopyrin associated periodic syndrome, Familial amyloid nephropathy with urticaria AND deafness, Familial cold urticaria, Cryptophthalmos syndrome, Culler-Jones syndrome, Holoprosencephaly 9, Currarino triad, Cutaneous melanoma, Dysgerminoma, Gastrointestinal stroma tumor, Hematologic neoplasm, Malignant tumor of testis, Thymoma, Cutis laxa with osteodystrophy, Cutis laxa with severe pulmonary, gastrointestinal, and urinary abnormalities, Cutis laxa, autosomal dominant 3, Cutis laxa, X-linked, Distal spinal muscular atrophy, X-linked 3, Menkes kinky-hair syndrome, Cutis laxa-corneal clouding- oligophrenia syndrome, Cyclical neutropenia, Neutropenia, severe congenital 1, autosomal dominant, Cylindromatosis, familial, Cystathioninuria, Cystic fibrosis, Sweat chloride elevation without cystic fibrosis, Cystinosis, Cystinosis, ocular nonnephropathic, Juvenile nephropathic cystinosis, Nephropathic cystinosis, Cystinuria, D-2- hydroxyglutaric aciduria, D-2-hydroxyglutaric aciduria 1, Dandy-Walker like malformation with atrioventricular septal defect, Danon disease, Hypertrophic cardiomyopathy, Primary dilated cardiomyopathy, Darier disease, acral hemorrhagic type, Deafness, Deafness and myopia, Deafness enamel hypoplasia nail defects, Leber congenital amaurosis, Peroxisomal disorder, Peroxisome biogenesis disorder 1A (Zellweger), Peroxisome biogenesis disorder 1B, Peroxisome biogenesis disorders, Zellweger syndrome spectrum, 82 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Deafness with labyrinthine aplasia microtia and microdontia (LAMM), Deafness, autosomal dominant 1, Deafness, autosomal dominant 11, Deafness, autosomal dominant 12, Deafness, autosomal dominant 15, Deafness, autosomal dominant 22, Deafness, autosomal dominant 36, Deafness, autosomal dominant 40, Deafness, autosomal dominant 4b, Deafness, autosomal dominant 5, Deafness, autosomal dominant 65, Deafness, autosomal dominant 67, Deafness, autosomal dominant 69, Deafness, autosomal dominant 9, Nonsyndromic hearing loss and deafness, Deafness, autosomal dominant nonsyndromic sensorineural 17, MYH9-related disorder, Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss, Deafness, autosomal recessive, Deafness, autosomal recessive 101, Deafness, autosomal recessive 103, DEAFNESS, AUTOSOMAL RECESSIVE 106, DEAFNESS, AUTOSOMAL RECESSIVE 107, DEAFNESS, AUTOSOMAL RECESSIVE 114, Deafness, autosomal recessive 12, PITUITARY ADENOMA 5, MULTIPLE TYPES, Usher syndrome, type 1D, Deafness, autosomal recessive 15, Deafness, autosomal recessive 16, Deafness, autosomal recessive 18, Retinitis pigmentosa, Usher syndrome, Deafness, autosomal recessive 18b, Deafness, autosomal recessive 2, Deafness, autosomal recessive 21, Deafness, autosomal recessive 22, Deafness, autosomal recessive 23, Deafness, autosomal recessive 25, Deafness, autosomal recessive 28, Deafness, autosomal recessive 29, Perrault syndrome, Deafness, autosomal recessive 3, Deafness, autosomal recessive 30, Deafness, autosomal recessive 49, Deafness, autosomal recessive 53, Deafness, autosomal recessive 6, Deafness, autosomal recessive 61, Deafness, autosomal recessive 66, Deafness, autosomal recessive 68, Deafness, autosomal recessive 7, Deafness, autosomal recessive 74, Deafness, autosomal recessive 76, Deafness, autosomal recessive 77, Deafness, autosomal recessive 79, Deafness, autosomal recessive 8, Deafness, autosomal recessive 84, Deafness, autosomal recessive 86, Deafness, autosomal recessive 89, Deafness, autosomal recessive 9, Deafness, autosomal recessive 97, Deafness, X-linked 4, Deafness, Y-linked 2, Deficiency of 2- methylbutyryl-CoA dehydrogenase, Deficiency of acetyl-CoA acetyltransferase, Deficiency of alpha-mannosidase, Deficiency of aromatic-L-amino-acid decarboxylase, Deficiency of bisphosphoglycerate mutase, Deficiency of butyrylcholine esterase, Deficiency of butyryl-CoA dehydrogenase, Deficiency of ferroxidase, Hemosiderosis, systemic, due to aceruloplasminemia, Deficiency of galactokinase, Deficiency of hydroxymethylglutaryl-CoA lyase, Deficiency of iodide peroxidase, Deficiency of pyrroline- 5-carboxylate reductase, Deficiency of ribose-5-phosphate isomerase, Deficiency of 83 4922-1525-2775.5Attorney Docket No.701586-000133WOPT steroid 11-beta-monooxygenase, Hyperaldosteronism, familial, type I, Deficiency of steroid 17-alpha-monooxygenase, Deficiency of transaldolase, Deficiency of UDPglucose-hexose-1-phosphate uridylyltransferase, Deficiency of UDPglucose-hexose- 1-phosphate uridylyltransferase, Dejerine-Sottas disease, Dejerine-Sottas syndrome, autosomal dominant, Delayed gross motor development, Delayed speech and language development, Global developmental delay, Intellectual disability, Muscular hypotonia, Neonatal hypotonia, Sleep apnea, Xia-Gibbs syndrome, Early infantile epileptic encephalopathy 4, Generalized hypotonia, Horizontal nystagmus, Infantile spasms, Muscular hypotonia of the trunk, Strabismus, NEURODEVELOPMENTAL DISORDER WITH SEVERE MOTOR IMPAIRMENT AND ABSENT LANGUAGE, Hearing impairment, Microcephaly, Mental retardation, autosomal dominant 31, Seizures, delta Thalassemia, Delta-zero-thalassemia, knossos type, Dementia, Frontotemporal dementia, Memory impairment, Mental deterioration, Dendritic cell, monocyte, B lymphocyte, and natural killer lymphocyte deficiency, Dent disease 1, Dentin dysplasia, type I, with extreme microdontia and misshapen teeth, Dermatitis, atopic, 2, susceptibility to, Ichthyosis vulgaris, Dermatopathia pigmentosa reticularis, Desanto-shinawi syndrome, Desbuquois dysplasia 1, Desbuquois dysplasia 2, Desmosterolosis, Deuteranopia, DEVELOPMENTAL DELAY AND SEIZURES WITH OR WITHOUT MOVEMENT ABNORMALITIES, Retinitis pigmentosa, Retinitis pigmentosa 59, DEVELOPMENTAL DELAY WITH OR WITHOUT DYSMORPHIC FACIES AND AUTISM, DEVELOPMENTAL DELAY WITH VARIABLE INTELLECTUAL IMPAIRMENT AND BEHAVIORAL ABNORMALITIES, Inborn genetic diseases, Neurodevelopmental abnormality, DEVELOPMENTAL DELAY, INTELLECTUAL DISABILITY, OBESITY, AND DYSMORPHISM, DFNA 2 Nonsyndromic Hearing Loss, Diabetes insipidus, nephrogenic, autosomal recessive, Diabetes mellitus, permanent neonatal, with neurologic features, Permanent neonatal diabetes mellitus, Diamond-Blackfan anemia, Diamond-Blackfan anemia 1, Diamond-Blackfan anemia 10, Diamond-Blackfan anemia 13, Diamond- Blackfan anemia 14 with mandibulofacial dysostosis, Diamond-Blackfan anemia 15 with mandibulofacial dysostosis, Diamond-Blackfan anemia 19, Diamond-Blackfan anemia 3, Diamond-Blackfan anemia 4, Diamond-Blackfan anemia 7, GATA-1-related thrombocytopenia with dyserythropoiesis, Diaphanospondylodysostosis, Diaphragmatic hernia 3, Double outlet right ventricle, Diaphyseal dysplasia, Diarrhea 3, secretory sodium, congenital, syndromic, Diarrhea 4, malabsorptive, congenital, Diarrhea 7, Diarrhea 8, secretory sodium, congenital, Diastrophic dysplasia, Diastrophic dysplasia, broad bone- platyspondylic variant, Diffuse interstitial pulmonary fibrosis, Primary interstitial lung 84 4922-1525-2775.5Attorney Docket No.701586-000133WOPT disease specific to childhood due to pulmonary surfactant protein anomalies, Pulmonary arterial hypertension, Pulmonary insufficiency, Respiratory insufficiency, Surfactant metabolism dysfunction, pulmonary, 3, Diffuse mesangial sclerosis, Drash syndrome, Frasier syndrome, Meacham syndrome, Wilms tumor 1, Diffuse palmoplantar keratoderma, Bothnian type, DiGeorge sequence, Digital arthropathy-brachydactyly, familial, Dihydropteridine reductase deficiency, Dihydropyrimidine dehydrogenase deficiency, Dilatation of the ascending aorta, Dolichocephaly, High palate, Mitral valve prolapse, Myopia, Pes planus, Scoliosis, Dilated cardiomyopathy 1A, Familial partial lipodystrophy 2, Primary dilated cardiomyopathy, Dilated cardiomyopathy 1BB, Dilated cardiomyopathy 1C, Dilated cardiomyopathy 1CC, Dilated cardiomyopathy 1DD, Dilated cardiomyopathy 1E, Dilated cardiomyopathy 1FF, Dilated cardiomyopathy 1G, Distal myopathy Markesbery-Griggs type, Familial dilated cardiomyopathy, Familial hypertrophic cardiomyopathy 9, Hereditary myopathy with early respiratory failure, Limb-girdle muscular dystrophy, type 2J, Myopathy, early-onset, with fatal cardiomyopathy, Dilated cardiomyopathy 1HH, Myofibrillar myopathy, BAG3-related, Dilated cardiomyopathy 1O, Hypertrichotic osteochondrodysplasia, Dilated cardiomyopathy 1S, Left ventricular noncompaction, Left ventricular noncompaction cardiomyopathy, Dilated cardiomyopathy 1X, Dilated cardiomyopathy 1Y, Dilated cardiomyopathy 3B, Duchenne muscular dystrophy, Dilated cardiomyopathy with woolly hair and keratoderma, Dilated Cardiomyopathy, Dominant, Disordered steroidogenesis due to cytochrome p450 oxidoreductase deficiency, Disseminated atypical mycobacterial infection, Distal arthrogryposis type 1A, Nemaline myopathy 4, Distal arthrogryposis type 5D, Distal arthrogryposis type 8, Distal hereditary motor neuronopathy 2D, Distal hereditary motor neuronopathy type 5, Growth delay, Intrauterine growth retardation, Pyridoxal 5'- phosphate-dependent epilepsy, Distal spinal muscular atrophy, Distichiasis-lymphedema syndrome, Dominant dystrophic epidermolysis bullosa with absence of skin, Dystrophic epidermolysis bullosa, Epidermolysis bullosa pruriginosa, Generalized dominant dystrophic epidermolysis bullosa, Nail disorder, nonsyndromic congenital, 8, Pretibial epidermolysis bullosa, Transient bullous dermolysis of the newborn, Donnai Barrow syndrome, DOORS syndrome, Dopamine beta hydroxylase deficiency, Dowling-Degos disease 1, Dowling-Degos disease 2, Dowling-degos disease 4, Duane retraction syndrome 3 with or without deafness, Duane syndrome type 1, Duane syndrome type 2, Duane-radial ray syndrome, Dubin-Johnson syndrome, Dyggve-Melchior-Clausen syndrome, Smith-McCort dysplasia 1, Dyschromatosis universalis hereditaria 1, Dyserythropoietic anemia with thrombocytopenia, Dysferlinopathy, Limb-girdle muscular 85 4922-1525-2775.5Attorney Docket No.701586-000133WOPT dystrophy, type 2B, Miyoshi muscular dystrophy 1, Myopathy, distal, with anterior tibial onset, Dyskeratosis congenita, Dyskeratosis congenita autosomal dominant, Dyskeratosis congenita, autosomal dominant, 2, Dyskeratosis congenita, autosomal dominant, 3, Dyskeratosis congenita autosomal recessive 1, Dyskeratosis congenita, autosomal recessive 2, Dyskeratosis congenita X-linked, Hoyeraal Hreidarsson syndrome, Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis congenita, autosomal recessive 7, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Revesz syndrome, Dyskinesia, familial, with facial myokymia, Dyskinesia, limb and orofacial, infantile-onset, Dysmorphic features, Epilepsy, Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, Learning difficulty, dysmorphy, Dysostosis multiplex, Mucopolysaccharidosis type I, Mucopolysaccharidosis, MPS-I-H / S, Mucopolysaccharidosis, MPS-I-S, Dysplastic pulmonary valve, Failure to thrive, Juvenile myelomonocytic leukemia, LEOPARD syndrome 1, Metachondromatosis, Noonan syndrome, Noonan syndrome 1, Patent ductus arteriosus, Rasopathy, Right ventricular hypertrophy, Secundum atrial septal defect, Tricuspid regurgitation, Dystonia 10, Paroxysmal kinesigenic dyskinesia, Dystonia 12, Dystonia 16, Dystonia 2, torsion, autosomal recessive, Dystonia 24, Dystonia 25, Dystonia 28, childhood-onset, Dystonia 5, Dopa-responsive type, GTP cyclohydrolase I deficiency, Dystonia 9, Epilepsy, idiopathic generalized, susceptibility to, 12, GLUT1 deficiency syndrome 1, GLUT1 deficiency syndrome 1, autosomal recessive, GLUT1 deficiency syndrome 2, Stomatin-deficient cryohydrocytosis with neurologic defects, Segawa syndrome, autosomal recessive, Sepiapterin reductase deficiency, Early infantile epileptic encephalopathy, Severe myoclonic epilepsy in infancy, Early onset focal segmental glomerulosclerosis, GALLOWAY-MOWAT SYNDROME 7, Light complexion, Early-onset retinal dystrophy, Leber congenital amaurosis 8, Retinitis pigmentosa 12, Ectodermal dysplasia 13, hair / tooth type, ECTODERMAL DYSPLASIA 14, HAIR / TOOTH TYPE WITH OR WITHOUT HYPOHIDROSIS, Ectodermal dysplasia 9, hair / nail type, Ectodermal dysplasia skin fragility syndrome, Ectodermal dysplasia, anhidrotic, with T-cell immunodeficiency, autosomal dominant, Ectodermal dysplasia / short stature syndrome, Ectodermal dysplasia-syndactyly syndrome 1, Ectopia lentis, isolated autosomal recessive, Ectopic ossification, Kyphosis, Myositis, Short stature, Ectrodactyly, ectodermal dysplasia, and cleft lip / palate syndrome 3, Rapp-Hodgkin ectodermal dysplasia syndrome, TP63-Related Spectrum Disorders, EHLERS-DANLOS SYNDROME, ARTHROCHALASIA TYPE, 2, Ehlers-Danlos syndrome, autosomal recessive, cardiac valvular form, Ehlers-Danlos 86 4922-1525-2775.5Attorney Docket No.701586-000133WOPT syndrome, classic type, Osteogenesis imperfecta type I, Osteogenesis imperfecta type III, Osteogenesis imperfecta with normal sclerae, dominant form, Osteogenesis imperfecta, recessive perinatal lethal, Postmenopausal osteoporosis, Ehlers-Danlos syndrome, hydroxylysine-deficient, Ehlers-Danlos syndrome, musculocontractural type, Ehlers- Danlos syndrome, periodontal type, 2, Ehlers-Danlos syndrome, type 8, Ehlers-Danlos syndrome, procollagen proteinase deficient, Infantile cortical hyperostosis, Ehlers-Danlos syndrome, progeroid type, 2, Ehlers-Danlos syndrome, type 3, Ehlers-Danlos syndrome, type 4, POLYMICROGYRIA WITH OR WITHOUT VASCULAR-TYPE EHLERS-DANLOS SYNDROME, Thoracic aortic aneurysm and aortic dissection, Ehlers-Danlos syndrome, type vii, autosomal recessive, Eichsfeld type congenital muscular dystrophy, Elevated serum creatine phosphokinase, Elliptocytosis 1, Elliptocytosis 2, Hereditary pyropoikilocytosis, Prenatal anemia, Elliptocytosis 3, Emery-Dreifuss muscular dystrophy 1, X-linked, Emery-Dreifuss muscular dystrophy 4, autosomal dominant, Spinocerebellar ataxia, autosomal recessive 8, Emery-Dreifuss muscular dystrophy 6, EMG abnormality, Lower limb amyotrophy, Minicore myopathy, Talipes equinovarus, Enamel-renal syndrome, Encephalocele, Joubert syndrome, Joubert syndrome 9, Meckel syndrome type 6, Meckel-Gruber syndrome, Microcephaly, Narrow chest, Oligohydramnios, Encephalopathy due to defective mitochondrial and peroxisomal fission 1, Inborn genetic diseases, Optic atrophy 5, Encephalopathy, acute, infection-induced, 3, suceptibility to, ENCEPHALOPATHY, PROGRESSIVE, EARLY-ONSET, WITH BRAIN ATROPHY AND SPASTICITY, Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, Encephalopathy, progressive, early-onset, with brain edema and / or leukoencephalopathy, Encephalopathy, progressive, with amyotrophy and optic atrophy, Endometrial carcinoma, Familial adenomatous polyposis 4, Endometrial neoplasm, Endplate acetylcholinesterase deficiency, Enlarged vestibular aqueduct, Pendred syndrome, Rare genetic deafness, Enterokinase deficiency, EPIDERMODYSPLASIA VERRUCIFORMIS, Epidermolysa bullosa simplex and limb girdle muscular dystrophy, Epidermolysis bullosa dystrophica, autosomal recessive, localisata variant, Epidermolysis bullosa herpetiformis, Dowling-Meara, Epidermolysis bullosa junctionalis with pyloric atresia, Epidermolysis bullosa simplex with migratory circinate erythema, Epidermolysis bullosa simplex with mottled pigmentation, Epidermolysis bullosa simplex with pyloric atresia, Epidermolysis bullosa simplex, autosomal recessive 2, Epilepsy, early-onset, vitamin b6-dependent, Epilepsy, familial adult myoclonic, 5, Epilepsy, familial focal, with variable foci 1, Rolandic epilepsy, Seizures, Epilepsy, familial focal, with variable foci 2, Epilepsy, familial focal, with variable foci 3, Epilepsy, familial temporal lobe, 7, Epilepsy, 87 4922-1525-2775.5Attorney Docket No.701586-000133WOPT focal, with speech disorder and with or without mental retardation, Epilepsy, hearing loss, mental retardation syndrome, Epilepsy, idiopathic generalized, susceptibility to, 15; Inborn genetic diseases, Epilepsy, lateral temporal lobe, autosomal dominant, Epilepsy, nocturnal frontal lobe, 5, Epilepsy, nocturnal frontal lobe, type 3, Epilepsy, nocturnal frontal lobe, type 4, Epilepsy, progressive myoclonic 2b, Lafora disease, Epilepsy, progressive myoclonic 3, Epilepsy, progressive myoclonic 4, with or without renal failure, Epilepsy, progressive myoclonic 5, Sensory ataxic neuropathy, dysarthria, and ophthalmoparesis, Epilepsy, progressive myoclonic 6, Muscular dystrophy, GLUT1 deficiency syndrome 1, GLUT1 deficiency syndrome 1, autosomal recessive, Microcephaly, intellectual deficiency, Epileptic encephalopathy, Epileptic encephalopathy, childhood-onset, Epileptic encephalopathy, early infantile, 1, Epileptic encephalopathy, early infantile, 19, Epileptic encephalopathy, early infantile, 23, Epileptic encephalopathy, early infantile, 24, Epileptic encephalopathy, early infantile, 25, Epileptic encephalopathy, early infantile, 26, Epileptic encephalopathy, early infantile, 27, Mental retardation, autosomal dominant 6, Epileptic encephalopathy, early infantile, 28, Epileptic encephalopathy, early infantile, 30, Epileptic encephalopathy, early infantile, 31, Epileptic encephalopathy, early infantile, 32, Epileptic encephalopathy, early infantile, 33, Epileptic encephalopathy, early infantile, 42, Episodic ataxia type 2, Familial hemiplegic migraine type 1, Spinocerebellar ataxia 6, Epileptic encephalopathy, early infantile, 43, Epileptic encephalopathy, early infantile, 46, Epileptic encephalopathy, early infantile, 47, Epileptic encephalopathy, early infantile, 48, Epileptic encephalopathy, early infantile, 51, Infantile encephalopathy, Epileptic encephalopathy, early infantile, 53, Epileptic encephalopathy, early infantile, 54, Epileptic encephalopathy, early infantile, 58, Epileptic encephalopathy, early infantile, 68, Epileptic encephalopathy, early infantile, 69, Epileptic encephalopathy, early infantile, 70, Epileptic encephalopathy, early infantile, 73, Generalized epilepsy with febrile seizures plus 3, Rolandic epilepsy, Seizures, Epileptic encephalopathy, early infantile, 74, Epileptic encephalopathy, early infantile, 75, Epileptic encephalopathy, early infantile, 76, Epileptic encephalopathy, infantile or early childhood, 1, Epileptic encephalopathy, infantile or early childhood, 2, Epileptic encephalopathy, infantile or early childhood, 3, Epiphyseal dysplasia, multiple, with myopia and conductive deafness, Myopia, Episodic ataxia type 1, Episodic ataxia, type 6, Episodic pain syndrome, familial, 3, ERCC2-Related Disorders, Mixed Phenotype Acute Leukemia, T / Myeloid, Not Otherwise Specified, Erythema, Erythropoietic protoporphyria, Jaundice, Erythrocytosis 6, familial, HEMOGLOBIN CHEMILLY, HEMOGLOBIN HELSINKI, Erythroderma, congenital, with palmoplantar keratoderma, hypotrichosis, and hyper-ige, Erythroderma, ichthyosiform, congenital reticular, 88 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Erythrokeratodermia variabilis, Erythrokeratodermia variabilis et progressiva 2, Erythrokeratodermia variabilis et progressiva 4, Erythrokeratodermia variabilis et progressiva 5, Estrogen resistance, Ethylmalonic encephalopathy, Even-plus syndrome, Exfoliative ichthyosis, autosomal recessive, ichthyosis bullosa of siemens-like, Expressive language delay, Global developmental delay, NEURODEVELOPMENTAL DISORDER WITH DYSMORPHIC FACIES AND DISTAL LIMB ANOMALIES, Exudative retinopathy, Exudative vitreoretinopathy 1, Familial exudative vitreoretinopathy, Fabry disease, Fabry disease, cardiac variant, Factor V deficiency, Factor V Hong Kong, Factor VII deficiency, FACTOR VIII (OKAYAMA), Hereditary factor IX deficiency disease, Factor X deficiency, Failure of tooth eruption, primary, Familial acne inversa 1, Familial adenomatous polyposis 4, Familial amyloid nephropathy with urticaria AND deafness, Familial cold urticaria, Familial amyloid polyneuropathy, Iowa type, Familial atypical mycobacteriosis, type 1, X- linked, Familial cardiomyopathy, Familial cold autoinflammatory syndrome 2, Familial cold autoinflammatory syndrome 4, Familial dilated cardiomyopathy, Primary dilated cardiomyopathy, Familial febrile seizures 8, Familial hemiplegic migraine type 3, Familial hemophagocytic lymphohistiocytosis, Hemophagocytic lymphohistiocytosis, familial, 5, Familial hypercholesterolemia, Familial hyperinsulinism, Persistent hyperinsulinemic hypoglycemia of infancy, Familial hypertrophic cardiomyopathy 1, Familial hypertrophic cardiomyopathy 10, Familial hypertrophic cardiomyopathy 11, Familial hypertrophic cardiomyopathy 16, Familial hypertrophic cardiomyopathy 17, Familial hypertrophic cardiomyopathy 2, Familial restrictive cardiomyopathy 3, Left ventricular noncompaction 6, Primary dilated cardiomyopathy, Familial hypertrophic cardiomyopathy 20, Familial hypertrophic cardiomyopathy 3, Familial hypertrophic cardiomyopathy 4, Primary familial hypertrophic cardiomyopathy, Familial hypertrophic cardiomyopathy 6, Glycogen storage disease of heart, lethal congenital, Familial hypertrophic cardiomyopathy 7, Familial hypertrophic cardiomyopathy 8, Familial hypoalphalipoproteinemia, Familial hypobetalipoproteinemia, Familial hypocalciuric hypercalcemia, Hypocalcemia, autosomal dominant 1, Familial hypokalemia-hypomagnesemia, Familial hypoplastic, glomerulocystic kidney, Renal cysts and diabetes syndrome, Familial infantile myasthenia, Familial juvenile gout, Glomerulocystic kidney disease with hyperuricemia and isosthenuria, Medullary cystic kidney disease 2, Familial Mediterranean fever, Familial mediterranean fever, autosomal dominant, Familial partial lipodystrophy 2, Familial partial lipodystrophy 3, Familial platelet disorder with associated myeloid malignancy, Familial porphyria cutanea tarda, Familial progressive hyperpigmentation with or without hypopigmentation, Familial pulmonary capillary hemangiomatosis, Familial renal 89 4922-1525-2775.5Attorney Docket No.701586-000133WOPT glucosuria, Familial renal hypouricemia, Hereditary renal hypouricemia, Familial type 3 hyperlipoproteinemia, Familial visceral amyloidosis, Ostertag type, Familial X-linked hypophosphatemic vitamin D refractory rickets, Fanconi anemia, Fanconi anemia, complementation group A, Neuroblastoma, Fanconi anemia, complementation group B, Fanconi anemia, complementation group D2, Fanconi anemia, complementation group G, Fanconi anemia, complementation group L, Fanconi anemia, complementation group P, Fanconi anemia, complementation group Q, Pre-B-cell acute lymphoblastic leukemia, Fanconi anemia, complementation group V, FANCONI ANEMIA, COMPLEMENTATION GROUP W, Fanconi-Bickel syndrome, Farber disease, Fatal familial insomnia, Genetic prion diseases, Huntington disease-like 1, Jakob-Creutzfeldt disease, Feeding difficulties, Laryngeal hypoplasia, Ventricular septal defect, FETAL AKINESIA DEFORMATION SEQUENCE 3, Fever-associated acute infantile liver failure syndrome, FGFR2 related craniosynostosis, Jackson-Weiss syndrome, Pfeiffer syndrome, Fibrochondrogenesis, FIBROMATOSIS, GINGIVAL, 5, Gingival fibromatosis 1, Fibrosis of extraocular muscles, congenital, 1, Fibrosis of extraocular muscles, congenital, 3b, Fibrosis of extraocular muscles, congenital, 3a, with or without extraocular involvement, Fibular hypoplasia and complex brachydactyly, Type A2 brachydactyly, Filippi syndrome, Finnish congenital nephrotic syndrome, Fleck corneal dystrophy, FLNA related lung disease, Floating-Harbor syndrome, Focal cortical dysplasia type II, Lymphangiomyomatosis, Tuberous sclerosis 1, Tuberous sclerosis syndrome, Focal segmental glomerulosclerosis 2, Focal segmental glomerulosclerosis 6, Follicle-stimulating hormone deficiency, isolated, Follicular lymphoma, Follicular thyroid carcinoma, Fontaine progeroid syndrome, Foveal hypoplasia 2, FOVEAL HYPOPLASIA 2 WITH OPTIC NERVE MISROUTING AND ANTERIOR SEGMENT DYSGENESIS, Fragile X syndrome, Frank Ter Haar syndrome, FRASER SYNDROME 2, Friedreich's ataxia, Frontometaphyseal dysplasia, Melnick-Needles syndrome, Oto-palato-digital syndrome, type II, Periventricular nodular heterotopia 1, Frontonasal dysplasia 2, Frontotemporal dementia, Frontotemporal dementia, ubiquitin- positive, Parkinson disease, late-onset, Parkinson-dementia syndrome, Pick's disease, Progressive supranuclear ophthalmoplegia, Fructose-biphosphatase deficiency, Fucosidosis, Fukuyama congenital muscular dystrophy, Fulminant hepatic failure, Fundus albipunctatus, autosomal recessive, Pigmentary retinal dystrophy, G6PD COSENZA, Glucose 6 phosphate dehydrogenase deficiency, G6PD MALAGA, G6PD SANTAMARIA, Galactosialidosis, late infantile, Galactosylceramide beta-galactosidase deficiency, Galloway-Mowat syndrome 1, GALLOWAY-MOWAT SYNDROME 2, X-LINKED, GALLOWAY-MOWAT SYNDROME 3, GALLOWAY-MOWAT SYNDROME 4, GALLOWAY- 90 4922-1525-2775.5Attorney Docket No.701586-000133WOPT MOWAT SYNDROME 6, Gamma-aminobutyric acid transaminase deficiency, Gamma- glutamylcysteine synthetase deficiency, hemolytic anemia due to, Gastrointestinal stroma tumor, Polyps, multiple and recurrent inflammatory fibroid, gastrointestinal, GATA-1- related thrombocytopenia with dyserythropoiesis, Gaucher disease, Gaucher disease, atypical, due to saposin C deficiency, Gaucher disease, perinatal lethal, Gaucher's disease, type 1, Subacute neuronopathic Gaucher's disease, GBE1-Related Disorders, Glycogen storage disease IV, classic hepatic, Glycogen storage disease, type IV, Polyglucosan body disease, adult, Generalized arterial calcification of infancy 2, Pseudoxanthoma elasticum, Pseudoxanthoma elasticum, forme fruste, Generalized dominant dystrophic epidermolysis bullosa, Generalized epilepsy with febrile seizures plus, type 1, Severe myoclonic epilepsy in infancy, GENERALIZED EPILEPSY WITH FEBRILE SEIZURES PLUS, TYPE 10, Generalized epilepsy with febrile seizures plus, type 7, Hereditary sensory and autonomic neuropathy type IIA, Paroxysmal extreme pain disorder, Generalized epilepsy with febrile seizures plus, type 9, Generalized hypotonia, Gerstmann-Straussler-Scheinker syndrome, Gillespie syndrome, Gillessen-Kaesbach- Nishimura dysplasia, Gillessen-Kaesbach-Nishimura syndrome, Gingival fibromatosis 1, Inborn genetic diseases, Noonan syndrome, Noonan syndrome 4, Rasopathy, Glanzmann thrombasthenia, Glaucoma 1, open angle, a, digenic, Glaucoma 1, open angle, B, Glaucoma 1, open angle, F, Glaucoma 3, primary congenital, A, MYOC-Related Disorders, Primary open angle glaucoma juvenile onset 1, Glaucoma 3, primary congenital, d, Glaucoma, primary open angle, juvenile-onset, Glaucoma 3, primary congenital, E, GLB1- Related Disorders, GM1 gangliosidosis, Infantile GM1 gangliosidosis, Mucopolysaccharidosis, MPS-IV-B, Glioblastoma, Neoplasm of the breast, Renal cell carcinoma, papillary, 1, Smith-Kingsmore syndrome, Global developmental delay, absent or hypoplastic corpus callosum, and dysmorphic facies, Hydrocephalus, Seizures, Jaundice, Joubert syndrome 17, Orofaciodigital syndrome 6, Joubert syndrome 13, Typical Joubert syndrome MRI findings, Joubert syndrome 3, Neurodegeneration, Spastic paraplegia, Spastic paraplegia 56, autosomal recessive, Glomerulonephritis with sparse hair and telangiectases, Glomerulopathy with fibronectin deposits 2, Glomuvenous malformations, Glucocorticoid Deficiency, Glucocorticoid Deficiency 4 with Mineralocorticoid Deficiency, Glucocorticoid Deficiency 4 with or without Mineralocorticoid Deficiency, Glucocorticoid Deficiency with Achalasia, Glucocorticoid Resistance, Generalized, Glucose 6 Phosphate Dehydrogenase Deficiency, Glucose Transporter Type 1 Deficiency Syndrome, Glucose-6-Phosphate Transport Defect, Glycogen Storage Disease, Inborn Genetic Diseases, Phosphate Transport Defect, GLUT1 Deficiency 91 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Syndrome 1, GLUT1 Deficiency Syndrome 1, Autosomal Recessive, GLUT1 Deficiency Syndrome 2, Glutaric Acidemia IIA, Glutaric Aciduria, Type 2, Glutaric Aciduria, Type 1, Lipid Storage Myopathy Due to Flavin Adenine Dinucleotide Synthetase Deficiency, Glycine Encephalopathy with Normal Serum Glycine, Glycogen Storage Disease 0, Muscle, Glycogen Storage Disease II, Adult Form, Glycogen Storage Disease, Type II, Glycogen Storage Disease IIIa, Glycogen Storage Disease Type III, Glycogen Storage Disease IIIb, Glycogen Storage Disease IV, Classic Hepatic, Glycogen Storage Disease, Type IV, Glycogen Storage Disease IV, Congenital Neuromuscular, Glycogen Storage Disease IV, Fatal Perinatal Neuromuscular, Glycogen Storage Disease IXa2, Glycogen Storage Disease IXc, Glycogen Storage Disease IXd, Glycogen Storage Disease of Heart, Lethal Congenital, Glycogen Storage Disease Type 1A, GM1 Gangliosidosis Type 2, Gangliosidosis GM1 Type 3, Infantile GM1 Gangliosidosis, Mucopolysaccharidosis, MPS- IV-B, Gm2-Gangliosidosis, Adult, Tay-Sachs Disease, Gm2-Gangliosidosis, Subacute, Gnathodiaphyseal Dysplasia, Limb-Girdle Muscular Dystrophy, Type 2L, Miyoshi Muscular Dystrophy 3, GNE Myopathy, Sialuria, GNPTAB-Related Disorders, I Cell Disease, Pseudo-Hurler Polydystrophy, Gonadotropin-Independent Familial Sexual Precocity, Leydig Cell Agenesis, Precocious Puberty in Males, Gordon's Syndrome, Oculomelic Amyoplasia, Gorlin Syndrome, Hereditary Cancer-Predisposing Syndrome, Gray Platelet Syndrome, Greenberg Dysplasia, Greig Cephalopolysyndactyly Syndrome, Pallister-Hall Syndrome, Griscelli Disease, Griscelli Syndrome Type 2, Growth and Mental Retardation, Mandibulofacial Dysostosis, Microcephaly, and Cleft Palate, Growth Retardation, Intellectual Developmental Disorder, Hypotonia, and Hepatopathy, Gyrate Atrophy, Ornithine Aminotransferase Deficiency, HADHA-Related Disorders, Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency, Haemorrhagic Telangiectasia 1, Hereditary Hemorrhagic Telangiectasia, Osler Hemorrhagic Telangiectasia Syndrome, Haim-Munk Syndrome, Hair-Pulling, Tourette Syndrome, Hajdu-Cheney Syndrome, Hand Foot Uterus Syndrome, Hartsfield Syndrome, Hay-Wells Syndrome of Ectodermal Dysplasia, Hb Niigata, Beta Thalassemia, Beta^0^ Thalassemia, Hearing Impairment, Hearing Loss, Hystrix-Like Ichthyosis with Deafness, Keratitis-Ichthyosis-Deafness Syndrome, Autosomal Dominant, Mutilating Keratoderma, Heart Block, Nonprogressive, Heart-Hand Syndrome, Slovenian Type, Heimler Syndrome 2, Peroxisome Biogenesis Disorder 4B, Peroxisome Biogenesis Disorder 4a (Zellweger), Heinz Body Anemia, Hemochromatosis Type 1, Hemochromatosis Type 2A, Hemochromatosis Type 3, Hemochromatosis Type 4, Hemoglobinopathy, Hemolytic Anemia, Hemolytic Anemia Due to Hexokinase Deficiency, Hemolytic Disease of Fetus or Newborn Due to 92 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Isoimmunization, Hemophagocytic Lymphohistiocytosis, Familial, 2, Stuve-Wiedemann Syndrome, Hemophagocytic Lymphohistiocytosis, Familial, 3, Hemorrhagic Destruction of the Brain, Subependymal Calcification, and Cataracts, Hennekam Lymphangiectasia- Lymphedema Syndrome, Hennekam Lymphangiectasia-Lymphedema Syndrome 2, Hennekam Lymphangiectasia-Lymphedema Syndrome 3, Heparin Cofactor II Deficiency, Hepatic Failure, Early-Onset, and Neurologic Disorder Due to Cytochrome C Oxidase Deficiency, Hepatic Methionine Adenosyltransferase Deficiency, Hepatic Venoocclusive Disease with Immunodeficiency, Hepatoerythropoietic Porphyria, Hereditary Acrodermatitis Enteropathica, Hereditary Angioedema Type 1, Hereditary Angioneurotic Edema, Hereditary C1 Esterase Inhibitor Deficiency - Dysfunctional Factor, Hereditary Cancer-Predisposing Syndrome, Hereditary Cerebral Amyloid Angiopathy, Icelandic Type, Hereditary Diffuse Leukoencephalopathy with Spheroids, Hereditary Factor IX Deficiency Disease, Hereditary Factor VIII Deficiency Disease, Hereditary Fructosuria, Hereditary Hemochromatosis, Hereditary Hemorrhagic Telangiectasia Type 2, Hereditary Hypotrichosis Simplex, Hypotrichosis 7, Woolly Hair, Autosomal Recessive 2, with or without Hypotrichosis, Hereditary Insensitivity to Pain with Anhidrosis, Hereditary Lymphedema, Hereditary Nephrotic Syndrome, Nephrotic Syndrome, Idiopathic, Steroid- Resistant, Hereditary Pancreatitis, Trypsinogen Deficiency, Hereditary Persistence of Fetal Hemoglobin, KLF1-Related, Hereditary Pyropoikilocytosis, Hereditary Sensory and Autonomic Neuropathy Type IC, Hereditary Sensory and Autonomic Neuropathy Type IIA, Mental Retardation, Autosomal Dominant 9, Spastic Paraplegia 30, Autosomal Recessive, Hereditary Sensory Neuropathy Type 1D, Spastic Paraplegia 3, Hereditary Sensory Neuropathy Type IE, Hereditary Sideroblastic Anemia, Hereditary Spastic Paraplegia, Spastic Paraplegia 7, Hermansky Pudlak Syndrome 2, Hermansky-Pudlak Syndrome, Hermansky-Pudlak Syndrome 1, Hermansky-Pudlak Syndrome 3, Hermansky-Pudlak Syndrome 4, Hermansky-Pudlak Syndrome 5, Hermansky-Pudlak Syndrome 6, Hermansky-Pudlak Syndrome 8, Heterotaxy, Visceral, 2, Autosomal, Heterotaxy, Visceral, 8, Autosomal, Situs Inversus Totalis, Heterotaxy, Visceral, X-Linked, Heterotopia, Heterotopia, Periventricular Nodular, X-Linked Dominant, with Melnick-Needles Syndrome, Hexa, Dn Allele, Hirschsprung Disease 2, Waardenburg Syndrome Type 4A, Histiocytic Medullary Reticulosis, Severe Combined Immunodeficiency with Sensitivity to Ionizing Radiation, Severe Combined Immunodeficiency, B Cell-Negative, Severe Immunodeficiency, Autosomal Recessive, T-Cell Negative, B-Cell Negative, NK Cell- Positive, Histiocytosis-Lymphadenopathy Plus Syndrome, History of Neurodevelopmental Disorder, Mowat-Wilson Syndrome, Holocarboxylase Synthetase Deficiency, 93 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Holoprosencephaly 11, Holoprosencephaly 2, Holoprosencephaly 3, Holoprosencephaly 5, Holoprosencephaly 7, Holoprosencephaly 9, Holt-Oram Syndrome, Homocysteinemia Due to MTHFR Deficiency, Homocystinuria Due to CBS Deficiency, Homocystinuria, Pyridoxine-Responsive, Hutchinson-Gilford Progeria Syndrome, Atypical, Hutchinson- Gilford Progeria Syndrome, Childhood-Onset, Right Ventricular Cardiomyopathy, Hutchinson-Gilford Syndrome, Hyaline Fibromatosis Syndrome, Hydatidiform Mole, Hydatidiform Mole, Recurrent, 2, Hydranencephaly with Renal Aplasia-Dysplasia, Hydrocephalus Due to Aqueductal Stenosis, Spastic Paraplegia, X-Linked Hydrocephalus Syndrome, Hydrolethalus Syndrome, Hydrolethalus Syndrome 1, Hydroxykynureninuria, Hyperaldosteronism, Familial, Type II, Hyperammonemia, Type III, Hyperapobetalipoproteinemia, Hypercalcemia, Infantile, 2, Hypercalciuria, Childhood, Self-Limiting, Hyperchlorhidrosis, Isolated, Hypercholesterolemia, Autosomal Dominant, 3, Hypercholesterolemia, Autosomal Dominant, Type B, Hypercholesterolemia, Autosomal Recessive, Hyperekplexia 2, Hyperekplexia 3, Hyperekplexia Hereditary, Hyper-IgE Syndrome, Hyperimmunoglobulin E Syndrome, Hyperimmunoglobulin D with Periodic Fever, Mevalonic Aciduria, Porokeratosis, Disseminated Superficial Actinic 1, Hyperinsulinemic Hypoglycemia Familial 3, Hyperinsulinemic Hypoglycemia, Familial, 4, Hyperinsulinism-Hyperammonemia Syndrome, Hyperkalemic Periodic Paralysis Type 1, Hypokalemic Periodic Paralysis 1, Hypokalemic Periodic Paralysis, Type 2, Normokalemic Periodic Paralysis, Potassium-Sensitive, Paramyotonia Congenita of Von Eulenburg, Potassium Aggravated Myotonia, SCN4A-Related Disorder, Hyperlipoproteinemia, Type I, Hyperlipoproteinemia, Type ID, Hyperlysinemia, Hypermanganesemia with Dystonia 1, Hypermanganesemia with Dystonia 2, Hypermethioninemia Due to Adenosine Kinase Deficiency, Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome, Hyperostosis Cranialis Interna, Hyperphenylalaninemia, Non-PKU, Marfanoid Habitus and Intellectual Disability, Phenylketonuria, Hyperphosphatasemia with Bone Disease, Hyperphosphatasia with Mental Retardation Syndrome 1, Hyperphosphatasia with Mental Retardation Syndrome 4, Hyperphosphatasia with Mental Retardation Syndrome 5, Hyperproinsulinemia, Hypertelorism, Teebi Type, Opitz G / BBB Syndrome, Hypertension, Multiple Renal Cysts, Polycystic Kidney Disease, Adult Type, Hypertrophic Cardiomyopathy, Myopathy, Distal, 1, Primary Familial Hypertrophic Cardiomyopathy, Hyperuricemic Nephropathy, Familial Juvenile, 2, Hyperuricemic Nephropathy, Familial Juvenile, 4, Hypobetalipoproteinemia, Hypobetalipoproteinemia, Normotriglyceridemic, Hypocalcemia, Autosomal Dominant 1, Hypocalcemia, Autosomal Dominant 1, with Bartter Syndrome, Hypocalciuric Hypercalcemia, Familial, Type 1, Neonatal Severe 94 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Hyperparathyroidism, Hypocalciuric Hypercalcemia, Familial, Type II, Hypocalciuric Hypercalcemia, Familial, Type III, Hypocholesterolemia, Hypodysfibrinogenemia, Hypofibrinogenemia, Hypoglycemia with deficiency of glycogen synthetase in the liver, Hypogonadism, diabetes mellitus, alopecia, mental retardation and electrocardiographic abnormalities, Hypogonadotropic hypogonadism 10 with or without anosmia, Hypogonadotropic hypogonadism 10 without anosmia, Hypogonadotropic hypogonadism 12 with or without anosmia, Hypogonadotropic hypogonadism 21 with or without anosmia, Hypogonadotropic hypogonadism 22 with anosmia, Hypogonadotropic hypogonadism 4 with or without anosmia, Hypogonadotropic hypogonadism 7 with or without anosmia, Hypohidrotic ectodermal dysplasia with immune deficiency, Incontinentia pigmenti, atypical, Hypohidrotic X-linked ectodermal dysplasia, Tooth agenesis, selective, X-linked, 1, Hypokalemic periodic paralysis 1, Malignant hyperthermia susceptibility 5, Hypomagnesemia 1, intestinal, Hypomagnesemia 5, renal, with ocular involvement, HYPOMAGNESEMIA, SEIZURES, AND MENTAL RETARDATION 2, Hypomyelinating leukodystrophy 7, Hypomyelinating leukodystrophy 8, with or without oligodontia and / or hypogonadotropic hypogonadism, Hypomyelination and Congenital Cataract, Hypomyelination with brainstem and spinal cord involvement and leg spasticity, Hypoparathyroidism familial isolated, Hypoparathyroidism retardation dysmorphism syndrome, Kenny-Caffey syndrome type 1, Hypophosphatasia, perinatal lethal, Infantile hypophosphatasia, Hypophosphatemic rickets, autosomal recessive, 2, Hypoplastic left heart syndrome, Hypoplastic right heart syndrome, Wolff-Parkinson-White pattern, Hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration, Neurodegeneration with brain iron accumulation 1, atypical, Pigmentary pallidal degeneration, Hypospadias 1, X-linked, Hypospadias 2, X-linked, Hypothyroidism, central, and testicular enlargement, Hypothyroidism, congenital, nongoitrous, 1, Hypotonia, ataxia, and delayed development syndrome, Neurodevelopmental disorder, HYPOTONIA, ATAXIA, DEVELOPMENTAL DELAY, AND TOOTH ENAMEL DEFECT SYNDROME, Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, Syndromic Infantile Encephalopathy, Hypotrichosis 13, HYPOTRICHOSIS 14, Hypotrichosis 4, Hypotrichosis simplex, Hypotrichosis-lymphedema-telangiectasia syndrome, I cell disease, Ichthyosis bullosa of Siemens, Ichthyosis vulgaris, Ichthyosis, congenital, autosomal recessive 11, Ichthyosis, congenital, autosomal recessive 12, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental 95 4922-1525-2775.5Attorney Docket No.701586-000133WOPT retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood-onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease-arthritis- recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, 96 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus 97 4922-1525-2775.5Attorney Docket No.701586-000133WOPT infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, 98 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Immunodeficiency 47, Immunodeficiency 51, Immunodeficiency 99 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 52, IMMUNODEFICIENCY 55, IMMUNODEFICIENCY 58, Immunodeficiency due to defect in cd3-zeta, Immunodeficiency due to ficolin 3 deficiency, Immunodeficiency with hyper IgM type 1, Immunodeficiency with hyper IgM type 2, Immunodeficiency with hyper IgM type 3, Immunodeficiency, common variable, 12, Immunodeficiency, common variable, 13, Immunodeficiency, X-Linked, with magnesium defect, Epstein-Barr virus infection, and neoplasia, Immunodeficiency-centromeric instability-facial anomalies syndrome 2, Immunodeficiency-centromeric instability-facial anomalies syndrome 3, Immunodeficiency-centromeric instability-facial anomalies syndrome 4, Inborn genetic diseases, Ichthyosis, cyclic, with epidermolytic hyperkeratosis, Ichthyosis, leukocyte vacuoles, alopecia, and sclerosing cholangitis, Ichthyosis, spastic quadriplegia, and mental retardation, Idiopathic basal ganglia calcification 1, Idiopathic basal ganglia calcification 5, Idiopathic fibrosing alveolitis, chronic form, Pulmonary fibrosis and / or bone marrow failure, telomere-related, 1, Idiopathic hypercalcemia of infancy, Muscle cramps, Idiopathic livedo reticularis with systemic involvement, Polyarteritis nodosa, childhoood- onset, IFAP syndrome with or without BRESHECK syndrome, IL21R immunodeficiency, Immune dysfunction with T-cell inactivation due to calcium entry defect 1, Immune dysfunction with T-cell inactivation due to calcium entry defect 2, Myopathy with tubular aggregates, Stormorken syndrome, Immune dysregulation-inflammatory bowel disease- arthritis-recurrent infections syndrome, Primary immunodeficiency, Immunodeficiency 14, Immunodeficiency 15, Immunodeficiency 18, severe combined immunodeficiency variant, Immunodeficiency 23, Immunodeficiency 24, Immunodeficiency 26 with or without neurologic abnormalities, Immunodeficiency 27b, Immunodeficiency 28, Immunodeficiency 29, Immunodeficiency 30, Immunodeficiency 31C, Immunodeficiency 36, Immunodeficiency 38 with basal ganglia calcification, Immunodeficiency 39, Immunodeficiency 45, Lethal congenital contracture syndrome 11, Lethal congenital contracture syndrome 5, Lethal congenital contracture syndrome 7, Lethal multiple pterygium syndrome, Multiple pterygium syndrome Escobar type, Lethal tight skin contracture syndrome, Leukemia, megakaryoblastic, of Down syndrome, Leukemia, Philadelphia chromosome-positive, resistant to imatinib, Leukocyte adhesion deficiency, Leukocyte adhesion deficiency type 1, Leukocyte adhesion deficiency, type III, Leukodystrophy, hypomyelinating, 10, Leukodystrophy, hypomyelinating, 11, Mandibulofacial dysostosis, Treacher Collins type, autosomal recessive, Leukodystrophy, hypomyelinating, 12, Leukoencephalopathy, LEUKODYSTROPHY, HYPOMYELINATING, 14, LEUKODYSTROPHY, HYPOMYELINATING, 15, LEUKODYSTROPHY, HYPOMYELINATING, 18, Leukodystrophy, hypomyelinating, 2, 100 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Spastic paraplegia, Leukodystrophy, hypomyelinating, 6, Metachromatic leukodystrophy, severe, Leukodystrophy, hypomyelinating, 9, Leukoencephalopathy with ataxia, Leukoencephalopathy with Brainstem and Spinal Cord Involvement and Lactate Elevation, Leukoencephalopathy with vanishing white matter, Ovarioleukodystrophy, LEUKOENCEPHALOPATHY, ACUTE REVERSIBLE, WITH INCREASED URINARY ALPHA-KETOGLUTARATE, Leukoencephalopathy, brain calcifications, and cysts, Leukoencephalopathy, progressive, with ovarian failure, Levy-Hollister syndrome, Leydig cell agenesis, Limb-girdle muscular dystrophy, type 1E, Limb-girdle muscular dystrophy, type 1F, Limb-girdle muscular dystrophy, type 2A, MUSCULAR DYSTROPHY, LIMB- GIRDLE, AUTOSOMAL DOMINANT 4, Limb-girdle muscular dystrophy, type 2B, Miyoshi muscular dystrophy 1, Proximal muscle weakness, Limb-girdle muscular dystrophy, type 2D, Muscular dystrophy, Sarcoglycanopathies, Limb-girdle muscular dystrophy, type 2E, Limb-girdle muscular dystrophy, type 2F, Limb-girdle muscular dystrophy, type 2G, Limb- girdle muscular dystrophy, type 2L, Limb-girdle muscular dystrophy, type 2Q, Limb-girdle muscular dystrophy-dystroglycanopathy, type C1, Limb-girdle muscular dystrophy- dystroglycanopathy, type C2, Limb-girdle muscular dystrophy-dystroglycanopathy, type C4, Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, Limb-girdle muscular dystrophy-dystroglycanopathy, type C5, Walker-Warburg congenital muscular dystrophy, Linear skin defects with multiple congenital anomalies 2, Lipid proteinosis, Lipoyltransferase 1 deficiency, Lissencephaly 1, Lissencephaly 2, Lissencephaly 2, X-linked, Lissencephaly 3, Tubulinopathies, Lissencephaly 5, Lissencephaly 6, with microcephaly, Lissencephaly 8, Lissencephaly with decussation defect, Lissencephaly, X-linked, Subcortical laminar heterotopia, X-linked, Liver failure acute infantile, Localized epidermolytic hyperkeratosis, Loeys-Dietz syndrome 1, Loeys- Dietz syndrome 3, Loeys-Dietz syndrome 4, Long QT syndrome, Long QT syndrome 1, Long QT syndrome, LQT1 subtype, Romano-Ward syndrome, Long-chain 3-hydroxyacyl- CoA dehydrogenase deficiency, Mitochondrial trifunctional protein deficiency, Lopes- Maciel-Rodan syndrome, Lowe syndrome, Lower Urinary Tract Obstruction, Lung adenocarcinoma, Luscan-lumish syndrome, Lymphangiomyomatosis, Lymphedema, primary, with myelodysplasia, Lymphoproliferative syndrome 1, X-linked, X-Linked Lymphoproliferative Syndrome, Lymphoproliferative syndrome 2, X-linked, Lysinuric protein intolerance, Lysosomal acid lipase deficiency, Wolman disease, MacInnes syndrome, Macrocephaly, alopecia, cutis laxa, and scoliosis, Macrothrombocytopenia, Macrothrombocytopenia and granulocyte inclusions with or without nephritis or sensorineural hearing loss, Macrothrombocytopenia, familial, Bernard-Soulier type, 101 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Macular corneal dystrophy Type I, Macular corneal dystrophy, type II, Macular dystrophy, Macular dystrophy, vitelliform, adult-onset, Patterned dystrophy of retinal pigment epithelium, Retinitis pigmentosa, Retinitis pigmentosa 19, Stargardt disease 1, Majeed syndrome, Male infertility with teratozoospermia due to single gene mutation, Non- syndromic male infertility due to sperm motility disorder, SPERMATOGENIC FAILURE 33, SPERMATOGENIC FAILURE 38, Malformation of the heart and great vessels, Malignant hyperthermia, susceptibility to, 1, Minicore myopathy, Multi-minicore disease and atypical periodic paralysis, Myopathy, Central Core, Neuromuscular Diseases, RYR1-Related Disorders, Malignant neoplasm of body of uterus, Mental retardation, autosomal dominant 36, Uterine Carcinosarcoma, Malignant rhabdoid tumor, somatic, Malignant tumor of prostate, Malpuech facial clefting syndrome, Mandibuloacral dysostosis, Mandibuloacral dysplasia with type B lipodystrophy, Mandibulofacial dysostosis with alopecia, Maple syrup urine disease, Maple syrup urine disease type 1A, MAPLE SYRUP URINE DISEASE, CLASSIC, TYPE IB, Maple syrup urine disease, type 3, Marden Walker like syndrome, Marfan lipodystrophy syndrome, Marfan syndrome, Thoracic aortic aneurysm and aortic dissection, Marfan syndrome, neonatal, Marfan syndrome, severe classic, Marfan Syndrome / Loeys-Dietz Syndrome / Familial Thoracic Aortic Aneurysms and Dissections, Marshall / Stickler syndrome, Marshall-Smith syndrome, MARS-Related Disorder, Mast syndrome, Maturity onset diabetes mellitus in young, Maturity-onset diabetes of the young, type 3, Maturity-onset diabetes of the young, type 1, Maturity-onset diabetes of the young, type 2, Monogenic diabetes, Permanent neonatal diabetes mellitus, Transient neonatal diabetes mellitus 3, Maturity-onset diabetes of the young, type 13, McCune-Albright syndrome, PITUITARY ADENOMA 3, MULTIPLE TYPES, Meckel syndrome 13, Meckel syndrome type 1, Meckel syndrome type 3, Meckel syndrome type 6, Meckel syndrome type 8, Meckel syndrome, type 10, Meckel syndrome, type 11, Meckel-Gruber syndrome, Medium-chain acyl-coenzyme A dehydrogenase deficiency, Medulloblastoma, Medulloblastoma with extensive nodularity, Meesman's corneal dystrophy, Meester-loeys syndrome, Megalencephalic leukoencephalopathy with subcortical cysts 1, Megalencephaly cutis marmorata telangiectatica congenita, Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2, Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3, Megaloblastic anemia 1, Finnish type, Megaloblastic anemia due to dihydrofolate reductase deficiency, Megaloblastic anemia due to inborn errors of metabolism, Megalocornea, MEHMO syndrome, Meier-Gorlin syndrome 1, Meier-Gorlin syndrome 2, Meier-Gorlin syndrome 3, MEIER-GORLIN SYNDROME 8, Melnick-Fraser syndrome, Melnick-Needles syndrome, 102 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Oto-palato-digital syndrome, type II, Membranous cataract, MEND syndrome, Meningioma, Meningioma, familial, Neurofibromatosis, type 2, Menke-Hennekam syndrome 2, Menkes kinky-hair syndrome, Mental retardation 30, X-linked, Mental retardation 49, X-linked, Mental retardation and distinctive facial features with or without cardiac defects, Mental retardation and microcephaly with pontine and cerebellar hypoplasia, Mental retardation with language impairment and with or without autistic features, Mental retardation, autosomal dominant 1, Mental retardation, autosomal dominant 13, Mental retardation, autosomal dominant 14, Mental retardation, autosomal dominant 16, Mental retardation, autosomal dominant 18, Mental retardation, autosomal dominant 19, Mental retardation, autosomal dominant 21, Mental retardation, autosomal dominant 22, Mental retardation, autosomal dominant 23, Mental retardation, autosomal dominant 24, Mental retardation, autosomal dominant 26, Mental retardation, autosomal dominant 27, Mental retardation, autosomal dominant 30, Mental retardation, autosomal dominant 31, Mental retardation, autosomal dominant 32, Syndromic intellectual disability, Mental retardation, autosomal dominant 33, Mental retardation, autosomal dominant 35, Mental retardation, autosomal dominant 39, intellectual disability with severe speech impairment, Mental retardation, autosomal dominant 43, Mental retardation, autosomal dominant 44, MENTAL RETARDATION, AUTOSOMAL DOMINANT 46, MENTAL RETARDATION, AUTOSOMAL DOMINANT 48, Mental retardation, autosomal dominant 5, MENTAL RETARDATION, AUTOSOMAL DOMINANT 50, MENTAL RETARDATION, AUTOSOMAL DOMINANT 51, MENTAL RETARDATION, AUTOSOMAL DOMINANT 52, MENTAL RETARDATION, AUTOSOMAL DOMINANT 54, MENTAL RETARDATION, AUTOSOMAL DOMINANT 55, WITH SEIZURES, MENTAL RETARDATION, AUTOSOMAL DOMINANT 56, MENTAL RETARDATION, AUTOSOMAL DOMINANT 57, MENTAL RETARDATION, AUTOSOMAL DOMINANT 58, Mental retardation, autosomal dominant 6, Mental retardation, autosomal dominant 7, Mental retardation, autosomal dominant 9, Mental retardation, autosomal recessive 1, Mental retardation, autosomal recessive 12, Mental retardation, autosomal recessive 13, Mental retardation, autosomal recessive 15, Mental retardation, autosomal recessive 18, Mental retardation, autosomal recessive 27, Mental retardation, autosomal recessive 34, Mental retardation, autosomal recessive 36, Mental retardation, autosomal recessive 37, Mental retardation, autosomal recessive 38, Mental retardation, autosomal recessive 41, Mental retardation, autosomal recessive 44, Mental retardation, autosomal recessive 47, Mental retardation, autosomal recessive 53, Mental retardation, autosomal recessive 57, Mental retardation, autosomal recessive 58, Mental Retardation, Psychosocial, Mental retardation, stereotypic 103 4922-1525-2775.5Attorney Docket No.701586-000133WOPT movements, epilepsy, and / or cerebral malformations, Mental retardation, syndromic 14, X-linked, Mental retardation, syndromic, Claes-Jensen type, X-linked, Spastic paraplegia, Mental retardation, X-linked 1, Severe intellectual deficiency, Mental retardation, X-linked 102, Mental retardation, X-linked 105, MENTAL RETARDATION, X-LINKED 106, Mental retardation, X-linked 12, Mental retardation, X-linked 18, Mental retardation, X-linked 19, Mental retardation, X-linked 61, Mental retardation, X-linked 72, Mental retardation, X- linked 93, Mental retardation, X-linked 96, Mental retardation, X-linked 98, Mental retardation, X-linked 99, Mental retardation, X-linked 99, syndromic, female-restricted, Mental retardation, X-linked, syndromic 13, Mental retardation, X-linked, syndromic 33, Mental retardation, X-linked, syndromic 34, Mental retardation, X-linked, syndromic, Raymond type, Mental retardation, X-linked, syndromic, Turner type, Mental retardation, X-linked, syndromic, wu type, Mental retardation-hypotonic facies syndrome X-linked, 1, Merosin deficient congenital muscular dystrophy, METABOLIC CRISES, RECURRENT, WITH RHABDOMYOLYSIS, CARDIAC ARRHYTHMIAS, AND NEURODEGENERATION, METABOLIC CRISES, RECURRENT, WITH VARIABLE ENCEPHALOMYOPATHIC FEATURES AND NEUROLOGIC REGRESSION, Metachondromatosis, Metachromatic leukodystrophy, Metachromatic leukodystrophy variant, Metaphyseal anadysplasia 2, Metaphyseal chondrodysplasia, Jansen type, Metaphyseal chondrodysplasia, Schmid type, Metatrophic dysplasia, Neuromuscular Diseases, Skeletal dysplasia, Methemoglobinemia type 2, Methemoglobinemia type 4, Methemoglobinemia, type I, METHYLCOBALAMIN DEFICIENCY, cblG TYPE, Methylmalonic acidemia, Methylmalonic acidemia with homocystinuria, Methylmalonic acidemia with homocystinuria cblD, METHYLMALONIC ACIDURIA AND HOMOCYSTINURIA, cblC TYPE, DIGENIC, METHYLMALONIC ACIDURIA AND HOMOCYSTINURIA, cblJ TYPE, Methylmalonic aciduria cblA type, Methylmalonic aciduria cblB type, Methylmalonic aciduria due to methylmalonyl-CoA mutase deficiency, METHYLMALONIC ACIDURIA, mut(-) TYPE, METHYLMALONIC ACIDURIA, mut(0) TYPE, Methylmalonyl-CoA epimerase deficiency, Mevalonic aciduria, Michelin-tire baby, Microcephalic osteodysplastic primordial dwarfism type 2, Microcephaly 17, primary, autosomal recessive, MICROCEPHALY 20, PRIMARY, AUTOSOMAL RECESSIVE, MICROCEPHALY 22, PRIMARY, AUTOSOMAL RECESSIVE, Microcephaly and chorioretinopathy, autosoma...

Claims

Attorney Docket No.701586-000133WOPT [00527] Alternative Methods for Circularization: To enable gRNA circularization, we made use of Tornado that consists of a flanking P1 and P3 Twister ribozymes that undergo auto-cleavage to generate the respective substrates for the RtcB ligase (5′ hydroxyl and a 2′,3′-cyclic) and derive the self-ligation event (4,5). The Tornado system also contains flanking inner domains that bear partial complementarity and may enforce the proximity of the termini to assist with the self-ligation event. To couple the use of Tornado in our pegRNA system, we had additionally appended flanking polyA positioned upstream of the 5' spacer and downstream of the 3' PBS domains. This was done to omit possible secondary structure barriers that may interfere with the pegRNA functionality. [00528] The use of our technology however can be generalizable to different methods of RNA circularization that includes ribozyme and splicing based platforms. Ribozyme based domains are natural and (direct) evolved parts that are originally found in the non- coding RNAs. Specifically Twister ribozyme belong to a self-cleaving family of ribozymes with 2,700 known consensus (6). Alternatively self-splicing domains that belong to group I introns can also serve to derive the self-circularization in vitro (7,8). [00529] Other embodiments: The technology described herein can be used for in vitro, ex vivo and in vivo applications once coupled with the state-of-the-art CRISPR enabled technologies. In the context of ex vivo engineering, the primary cells from patients with genetic diseases can be reverted back to the wild-type sequence for further expansion in cell culture and delivered to the patient for therapeutic purposes. In addition to the 12 types of base-modification, the technology can be leveraged toward deletion and insertion within precise sites in the genome, which together can address for ~90% known human genetic abnormalities. The use of the PE has also been leveraged toward integration of gene-sized cargo. There had been several approaches that can embed gene-sized cargo within precise loci in the genome, namely TwinPE, (9) PASTE, (10) and TJ-PE, (11) and other dual pegRNA approaches that include PrimeDel (12), PEDAR (13), dual-pegRNAs (14), HOPE (15), GRAND (16) and Bi-PE (17). [00530] Another important advance within ex vivo engineering can be leveraged toward CAR-T engineering (18). The isolation of the primary T cells from patient can be followed by integration of the DNA payload at the precise genomic loci that is known to harbor safety. For these application integrase (e.g.attP or attB from Bxb1 integrase) recognition sequence can be encoded in the target loci of interest using the described circularized pegRNA system. This then can provide for site specific integration of CAR domains and larger gene size circuitry using a DNA donor that contains flanking integration motifs. For these set of applications, larger DNA payloads that are more than one gene 234 4922-1525-2775.5Attorney Docket No.701586-000133WOPT can be fine-tuned for site-directed genomic integration or multiplexed integration at different loci. For example, the integration of the SynNotch receptors and its respective downstream gene can be used for DNA cargo integration (19). [00531] Other applications of CART cell engineering can include development of allogenic CART cells that can be used as an "off-the-shelf" therapy and could be made tailored based on the patient's need (20). The existing CRISPR HDR strategies for allogenic CART cell engineering have low efficiency and often time result into heterogeneous indel formation at the targeted loci. As such, the existing methods to develop allogenic CART cells are challenging given the short life of primary T-cells. [00532] For the use of the technology described herein for in vivo applications, one can leverage the split based constructs descried herein within an AAV payload. In addition, LNP strategies can be used to deliver the system upon RNA encapsulation of the cargo. The use of LNP can also be fine-tuned for RNA delivery that harbors tissue-specific tropism and can be achieved using several LNP formulations (21). The LNP strategy can additionally provide for non-toxic mean to engineer primary cells ex vivo and provide for in vivo delivery in clinical trials. The use of the technology described herein can additionally provide for multiplexed genomic modification to address for multiple co-occuring genetic abnormalities that may arise in cancer related conditions that disrupts DNA repair pathway(s). [00533] To develop a safer delivery strategy that harbors lower off-targets, further use of the technology described herein for in vivo applications can leverage eVLPs for transient delivery of the ribonucleoprotein (RNP) (22). This technology was more recently optimized against the PE system (40) where the RNP was fused to the MLV-gag domain via a self-cleaving peptide to enable transient endosomal release of the complex. In this method, further appending of MS2 to the pegRNA and MCP on the viral particle had shown to enhance the RNP delivery per particle. Further use of the p3-p4 coiled-coil pairs was also leveraged to couple Cas9 nickase to the RT domain. In parallel, seminal work by Feng Zhang group had shown the use of antibody within the VSV-G viral surface domain to develop for an eVLP with cell-classifying capability (23). In addition, other efforts by Jennifer Doudna group developed Cas9-packaging enveloped delivery vehicles (Cas9- EDVs) that leverages mutant form of VSV-G that requires ScFv for multiplexed and orthogonal cell classification (41). 235 4922-1525-2775.5Attorney Docket No.701586-000133WOPT References 1. Nelson, J. W. et al. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol 40, 402–410 (2022).

2. Liu, B. et al. A split prime editor with untethered reverse transcriptase and circular RNA template. Nat Biotechnol 40, 1388–1393 (2022).

3. Wesselhoeft, R. A. et al. RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. Molecular Cell 74, 508-520.e4 (2019).

4. Litke, J. L. & Jaffrey, S. R. Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts. Nat Biotechnol 37, 667–675 (2019).

5. Jaffrey, S. R. & LITKE, J. L. Rna molecules, methods of producing circular rna, and treatment methods. (2021).

6. Roth, A. et al. A widespread self-cleaving ribozyme class is revealed by bioinformatics. Nat Chem Biol 10, 56–60 (2014).

7. Wesselhoeft, R. A., Kowalski, P. S. & Anderson, D. G. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun 9, 2629 (2018).

8. Liu, L. et al. Circular Guide RNA for Improved Stability and CRISPR-Cas9 Editing Efficiency in Vitro and in Bacteria. ACS Synth. Biol.12, 350–359 (2023).

9. Anzalone, A. V. et al. Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat Biotechnol 40, 731–740 (2022).

10. Yarnall, M. T. N. et al. Drag-and-drop genome insertion of large sequences without double-strand DNA cleavage using CRISPR-directed integrases. Nat Biotechnol 41, 500–512 (2023).

11. Zheng, C. et al. Template-jumping prime editing enables large insertion and exon rewriting in vivo. Nat Commun 14, 3369 (2023).

12. Choi, J. et al. Precise genomic deletions using paired prime editing. Nat. Biotechnol.40, 218–226 (2022).

13. Jiang, T., Zhang, X.-O., Weng, Z. & Xue, W. Deletion and replacement of long genomic sequences using prime editing. Nat. Biotechnol.40, 227–234 (2022).

14. Lin, Q. et al. High-efficiency prime editing with optimized, paired pegRNAs in plants. Nat. Biotechnol.39,923–927 (2021).

15. Zhuang, Y. et al. Increasing the efficiency and precision of prime editing with guide RNA pairs. Nat. Chem.Biol.18, 29–37 (2022).

16. Wang, J. Efficient targeted insertion of large DNA fragments without DNA donors. Nat. Methods 19, 25 (2022).

17. Tao, R. et al. Bi-PE: bi-directional priming improves CRISPR / Cas9 prime editing in mammalian cells. Nucleic Acids Res.50, 6423–6434 (2022).

18. Dimitri, A., Herbst, F. & Fraietta, J. A. Engineering the next-generation of CAR T- cells with CRISPR-Cas9 gene editing. Molecular Cancer 21, 78 (2022).

19. Morsut, L. et al. Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors. Cell 164, 780–791 (2016).

20. Sheridan, C. Off-the-shelf, gene-edited CAR-T cells forge ahead, despite safety scare. Nature Biotechnology 40, 5–8 (2021).

21. Wang, X. et al. Preparation of selective organ-targeting (SORT) lipid nanoparticles (LNPs) using multiple technical methods for tissue-specific mRNA delivery. Nat Protoc 18, 265–291 (2023).

22. Banskota, S. et al. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell 185, 250-265.e16 (2022).

23. Strebinger, D. et al. Cell type-specific delivery by modular envelope design. Nat Commun 14, 5141 (2023).

24. Gaudelli, N. M. et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551, 464–471 (2017). 236 4922-1525-2775.5Attorney Docket No.701586-000133WOPT 25. Neugebauer, M. E. et al. Evolution of an adenine base editor into a small, efficient cytosine base editor with low off-target activity. Nat Biotechnol 41, 673–685 (2023).

26. Cox, D. B. T. et al. RNA editing with CRISPR-Cas13. Science 358, 1019–1027 (2017).

27. Abudayyeh, O. O. et al. A cytosine deaminase for programmable single-base RNA editing. Science 365, 382–386 (2019).

28. Gootenberg, J. S. et al. Nucleic acid detection with CRISPR-Cas13a / C2c2. Science 356, 438–442 (2017).

29. Gootenberg, J. S. et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360, 439–444 (2018).

30. Broughton, J. P. et al. CRISPR–Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38, 870–874 (2020).

31. Hirano, S. et al. Structure of the OMEGA nickase IsrB in complex with ωRNA and target DNA. Nature 610, 575–581 (2022).

32. Jiang, K. et al. Programmable RNA-guided endonucleases are widespread in eukaryotes and their viruses. 2023.06.13.544871 Preprint at https: / / doi.org / 10.1101 / 2023.06.13.544871 (2023).

33. Hutvagner, G. & Simard, M. J. Argonaute proteins: key players in RNA silencing. Nat Rev Mol Cell Biol 9, 22–32 (2008).

34. Hegge, J. W., Swarts, D. C. & van der Oost, J. Prokaryotic Argonaute proteins: novel genome-editing tools? Nat Rev Microbiol 16, 5–11 (2018).

35. Gilpatrick, T. et al. Targeted nanopore sequencing with Cas9-guided adapter ligation. Nat Biotechnol 38, 433–438 (2020).

36. Liang, S.-Q. et al. Genome-wide profiling of prime editor off-target sites in vitro and in vivo using PE-tag. Nat Methods 20, 898–907 (2023).

37. Koeppel, J. et al. Prediction of prime editing insertion efficiencies using sequence features and DNA repair determinants. Nat Biotechnol 1–11 (2023) doi:10.1038 / s41587-023-01678-y.

38. Li, H.-S. et al. Multidimensional control of therapeutic human cell function with synthetic gene circuits. Science 378, 1227–1234 (2022).

39. Liang, R. et al. Prime editing using CRISPR-Cas12a and circular RNAs in human cells. Nat Biotechnol 1–9 (2024) doi:10.1038 / s41587-023-02095-x.

40. An, M. et al. Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo. Nat Biotechnol 1–12 (2024) doi:10.1038 / s41587-023-02078-y.

41. Hamilton, J. R. et al. In vivo human T cell engineering with enveloped delivery vehicles. Nat Biotechnol 1–9 (2024) doi:10.1038 / s41587-023-02085-z.

42. Mathis, N. et al.Predicting prime editing efficiency and product purity by deep learning. Nat Biotechnol 41, 1151–1159 (2023).

43. Wesselhoeft, R.A., Kowalski, P.S. & Anderson, D.G. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun 9, 2629 (2018). https: / / doi.org / 10.1038 / s41467-018-05096-6 Table 4 : Lentiviral based cpegRNA screen against a panel of known disease mutations was adopted43which varies PBS and / or RTT length against the given genetic mutation sequence to screen for the most suitable cpegRNA against the desired disease (FIG.7). The IDT oligo pool sample sequence below is used for amplification and cloning into lentiviral plasmid that bears U6 promoter, 5’ Ribozyme domain, polyA sequence, Nsil and BIpI restriction domains. Sample annotation: 5’ Primer and Nsil Restriction Sequence – 237 4922-1525-2775.5Attorney Docket No.701586-000133WOPT lowercase italics; spacer – underline, sgRNA Scaffold – UPPERCASE ITALICS; RTT – bold; PBS – underline italics; PolyA; 3’Ribozyme – bold underline, polyT, Target mutation sequence – bold underline italics; and 3’ primer BiPI Restriction sequence – lowercase italics Sequence SEQ ID NO: Phenylketon ggccaaagcatgcatGGGGTCGTAGCGAACTGAGAGTTTCAGAGCT 68 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCTCGGCCCT TCTCAGTTCGCTACGAAAAAAAAAAGCTGCCATCAGTCGGCGT GGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATA AAAGTGGAGGGTACAGTCCACGCTTTTTTTGGTTTTGGTCTTA GGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCT ACGACCCATACACCCAAAGGTCCgctaagcagcttggcgtaactagat ct Phenylketon ggccaaagcatgcatGGGGTCGTAGCGAACTGAGAGTTTCAGAGCT 69 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAATACCTCGG CCCTTCTCAGTTCGCTACGAAAAAAAAAAGCTGCCATCAGTCG GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTGGTCTTAG GAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTAC GACCCATACACCCAACAGGCAgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGGGGTCGTAGCGAACTGAGAGTTTCAGAGCT 70 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTGCCACAA TACCTCGGCCCTTCTCAGTTCGCTACGAAAAAAAAAAGCTGCC ATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCC AAGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAG GAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTAC GACCCATACACCCAAGAAGGTgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGGGTCGTAGCGAACTGAGAAGTTTCAGAGCT 71 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCTCGGCCCT TCTCAGTTCGCTACGAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTGTGGTTTTGGTCTTA GGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTA CGACCCATACACCCAGCATTGgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGGGTCGTAGCGAACTGAGAAGTTTCAGAGCT 72 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAATACCTCGG CCCTTCTCAGTTCGCTACGAAAAAAAAAGCTGCCATCAGTCGG 238 4922-1525-2775.5Attorney Docket No.701586-000133WOPT CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTTTGGTCTTAG GAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTAC GACCCATACACCCACTTAACgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGGGTCGTAGCGAACTGAGAAGTTTCAGAGCT 73 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCACAATACCTC GGCCCTTCTCAGTTCGCTACGAAAAAAAAAGCTGCCATCAGTC GGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCG GATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGGTCTTAG GAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTAC GACCCATACACCCAGCGTAAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGGGTCGTAGCGAACTGAGAAGTTTCAGAGCT 74 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTGCCACAA TACCTCGGCCCTTCTCAGTTCGCTACGAAAAAAAAAGCTGCCA TCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCA AGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTA GGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTTCGCTA CGACCCATACACCCATTCTAAgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGAGCGAACTGAGAAGGGCCAGTTTCAGAGCT 75 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCTCGGCCCT TCTCAGTTCAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGT AGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGA GGGTACAGTCCACGCTTTTTTTTCACTCAAGCCTGTGGTTTTG GTCTTAGGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGT TCGCTACGACCCATAACTAGCgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGAGCGAACTGAGAAGGGCCAGTTTCAGAGCT 76 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAATACCTCGG CCCTTCTCAGTTCAAAAAAAAAGCTGCCATCAGTCGGCGTGGA CTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAG TGGAGGGTACAGTCCACGCTTTTTTTTCAAGCCTGTGGTTTTG GTCTTAGGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGT TCGCTACGACCCATAGTAAGGgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGAGCGAACTGAGAAGGGCCAGTTTCAGAGCT 77 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCACAATACCTC GGCCCTTCTCAGTTCAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTAGCCTGTGGTTTTGG TCTTAGGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGTT CGCTACGACCCATATACAGCgctaagcAGCTTGGCGTAACTAGAT CT 239 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Phenylketon ggccaaagcatgcatGAGCGAACTGAGAAGGGCCAGTTTCAGAGCT 78 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTGCCACAA TACCTCGGCCCTTCTCAGTTCAAAAAAAAAGCTGCCATCAGTC GGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCG GATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGTGGTTTTG GTCTTAGGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGT TCGCTACGACCCATACCCCGAgctaagcAGCTTGGCGTAACTAG ATCT Hyperphenyl ggccaaagcatgcatGCCTCAATCCTTTGGGTGTAGTTTCAGAGCTA 79 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTACGACCCA pku;Phenylk TACACCCAAAGGATTGAAAAAAAAAGCTGCCATCAGTCGGCGT etonuria;not GGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAA provided AAGTGGAGGGTACAGTCCACGCTTTTTTTGCTGCCACAATACC TCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGATT GAGGTCTTGGACAACTGCAGgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCCTCAATCCTTTGGGTGTAGTTTCAGAGCTA 80 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCGCTACGA pku;Phenylk CCCATACACCCAAAGGATTGAAAAAAAAAGCTGCCATCAGTCG etonuria;not GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG provided ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTCCACAATACC TCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGATT GAGGTCTTGGACAACTGCTGgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCCTCAATCCTTTGGGTGTAGTTTCAGAGCTA 81 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCTTCTCAGTTC pku;Phenylk GCTACGACCCATACACCCAAAGGATTGAAAAAAAAAGCTGCCA etonuria;not TCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCA provided AGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTCCT CGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGATT GAGGTCTTGGACAACAGATGgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 82 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTACGACCCA pku;Phenylk TACACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTCGGCGTG etonuria;not GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA provided AGTGGAGGGTACAGTCCACGCTTTTTTTTTGCTGCCACAATAC CTCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGA TTGAGGTCTTGGACAGCACGCgctaagcAGCTTGGCGTAACTAG ATCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 83 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCGCTACGA pku;Phenylk CCCATACACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTCGG etonuria;not CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA provided TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGCCACAATAC CTCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGA 240 4922-1525-2775.5Attorney Docket No.701586-000133WOPT TTGAGGTCTTGGACAATCGGGgctaagcAGCTTGGCGTAACTAG ATCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 84 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCAGTTCGCTAC pku;Phenylk GACCCATACACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTC etonuria;not GGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCG provided GATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTCACAATACC TCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGATT GAGGTCTTGGACACGAGTTgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 85 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCTTCTCAGTTC pku;Phenylk GCTACGACCCATACACCCAAAGGATTAAAAAAAAAGCTGCCAT etonuria;not CAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAA provided GCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTACC TCGGCCCTTCTCAGTTCGCTGCGACCCATACACCCAAAGGATT GAGGTCTTGGACAGGGGGAgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGTGCCACGTAATAGAGGGGCGTTTCAGAGCT 86 alaninemia, ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT non- ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCACGGAGTT pku;Marfano CCAGCCCCTCTATTACGTGAAAAAAAAAGCTGCCATCAGTCGG id habitus CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA and TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAGAAGACAGCC intellectual ATCCAAAATTACACTGTCATGGAGTTCCAGCCCCTCTATTACG disability;Ph TGGCAGAGAGTTTTACGTTCTgctaagcAGCTTGGCGTAACTAGA enylketonuri TCT a;not provided Hyperphenyl ggccaaagcatgcatGTGCCACGTAATAGAGGGGCGTTTCAGAGCT 87 alaninemia, ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT non- ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACACTGTCAC pku;Marfano GGAGTTCCAGCCCCTCTATTACGTGAAAAAAAAAGCTGCCATC id habitus AGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAG and CCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAGCCA intellectual TCCAAAATTACACTGTCATGGAGTTCCAGCCCCTCTATTACGT disability;Ph GGCAGAGAGTTTTAAAGTTGgctaagcAGCTTGGCGTAACTAGAT enylketonuri CT a;not provided Hyperphenyl ggccaaagcatgcatGTGCCACGTAATAGAGGGGCGTTTCAGAGCT 88 alaninemia, ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT non- ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAAATTACACT pku;Marfano GTCACGGAGTTCCAGCCCCTCTATTACGTGAAAAAAAAAGCTG id habitus CCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTC and CCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTT intellectual TCCAAAATTACACTGTCATGGAGTTCCAGCCCCTCTATTACGT disability;Ph GGCAGAGAGTTTTAGATTGTgctaagcAGCTTGGCGTAACTAGAT enylketonuri CT 241 4922-1525-2775.5Attorney Docket No.701586-000133WOPT a;not provided Hyperphenyl ggccaaagcatgcatGATCCAAAATTACACTGTCAGTTTCAGAGCTAT 89 alaninemia, GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT non- CAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCGTGACAGTG pku;Marfano TAATTTTGAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTA id habitus GAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAG and GGTACAGTCCACGCTTTTTTTTTGGCATCATTAAAACTCTCTGC intellectual CACGTAATAGAGGGGCTGGAACTCCATGACAGTGTAATTTTGG disability;Ph ATGGCTGTCTTCAACACCgctaagcAGCTTGGCGTAACTAGATCT enylketonuri a;not provided Hyperphenyl ggccaaagcatgcatGATCCAAAATTACACTGTCAGTTTCAGAGCTAT 90 alaninemia, GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT non- CAACTTGAAAAAGTGGCACCGAGTCGGTGCGAACTCCGTGAC pku;Marfano AGTGTAATTTTGAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC id habitus TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT and GGAGGGTACAGTCCACGCTTTTTTTCATCATTAAAACTCTCTG intellectual CCACGTAATAGAGGGGCTGGAACTCCATGACAGTGTAATTTTG disability;Ph GATGGCTGTCTTCTATAATgctaagcAGCTTGGCGTAACTAGATC enylketonuri T a;not provided Hyperphenyl ggccaaagcatgcatGATCCAAAATTACACTGTCAGTTTCAGAGCTAT 91 alaninemia, GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT non- CAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGGAACTCCGT pku;Marfano GACAGTGTAATTTTGAAAAAAAAAGCTGCCATCAGTCGGCGTG id habitus GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA and AGTGGAGGGTACAGTCCACGCTTTTTTTCATTAAAACTCTCTG intellectual CCACGTAATAGAGGGGCTGGAACTCCATGACAGTGTAATTTTG disability;Ph GATGGCTGTCTTCCAGTCAgctaagcAGCTTGGCGTAACTAGATC enylketonuri T a;not provided Hyperphenyl ggccaaagcatgcatGATCCAAAATTACACTGTCAGTTTCAGAGCTAT 92 alaninemia, GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT non- CAACTTGAAAAAGTGGCACCGAGTCGGTGCAGGGGCTGGAAC pku;Marfano TCCGTGACAGTGTAATTTTGAAAAAAAAAGCTGCCATCAGTCG id habitus GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG and ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAAACTCTCTG intellectual CCACGTAATAGAGGGGCTGGAACTCCATGACAGTGTAATTTTG disability;Ph GATGGCTGTCTTCCACATAgctaagcAGCTTGGCGTAACTAGATC enylketonuri T a;not provided Inborn ggccaaagcatgcatGGAGAAGGGCCGAGGTATTGGTTTCAGAGCT 93 genetic ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT diseases;Ph ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTGCTGCCAC enylketonuri AATACCTCGGCCCTTAAAAAAAAAGCTGCCATCAGTCGGCGTG a;not GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA provided AGTGGAGGGTACAGTCCACGCTTTTTTTCTTCACTCAAGCCTG 242 4922-1525-2775.5Attorney Docket No.701586-000133WOPT TGGTTTTGGTCTTAGGAACTTTGTTGCCACAATACCTCGGCCC TTCTCAGTTCGCTACAGATCAgctaagcAGCTTGGCGTAACTAGA TCT Inborn ggccaaagcatgcatGGAGAAGGGCCGAGGTATTGGTTTCAGAGCT 94 genetic ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT diseases;Ph ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACTTTGCTGC enylketonuri CACAATACCTCGGCCCTTAAAAAAAAAGCTGCCATCAGTCGGC a;not GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT provided AAAAGTGGAGGGTACAGTCCACGCTTTTTTTACTCAAGCCTGT GGTTTTGGTCTTAGGAACTTTGTTGCCACAATACCTCGGCCCT TCTCAGTTCGCTACCGAGATgctaagcAGCTTGGCGTAACTAGAT CT Inborn ggccaaagcatgcatGGAGAAGGGCCGAGGTATTGGTTTCAGAGCT 95 genetic ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT diseases;Ph ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGGAACTTTG enylketonuri CTGCCACAATACCTCGGCCCTTAAAAAAAAAGCTGCCATCAGT a;not CGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCC provided GGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTCAAGCCTG TGGTTTTGGTCTTAGGAACTTTGTTGCCACAATACCTCGGCCC TTCTCAGTTCGCTACGGTCGTgctaagcAGCTTGGCGTAACTAGA TCT Inborn ggccaaagcatgcatGAGCCTGTGGTTTTGGTCTTGTTTCAGAGCTA 96 genetic TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA diseases;Ph TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTGTGGCAGCAA enylketonuri AGTTCCTAAGACCAAAACCACAGAAAAAAAAAGCTGCCATCAG a;not TCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCC provided CGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGAGAAGG GCCGAGGTATTGTGGCAACAAAGTTCCTAAGACCAAAACCACA GGCTTGAGTGAAGGGCTGGCgctaagcAGCTTGGCGTAACTAGA TCT Inborn ggccaaagcatgcatGAGCCTGTGGTTTTGGTCTTGTTTCAGAGCTA 97 genetic TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA diseases;Ph TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTATTGTGGCAG enylketonuri CAAAGTTCCTAAGACCAAAACCACAGAAAAAAAAAGCTGCCAT a;not CAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAA provided GCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAAGG GCCGAGGTATTGTGGCAACAAAGTTCCTAAGACCAAAACCACA GGCTTGAGTGAAGGAGGCTTgctaagcAGCTTGGCGTAACTAGA TCT Inborn ggccaaagcatgcatGAGCCTGTGGTTTTGGTCTTGTTTCAGAGCTA 98 genetic TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA diseases;Ph TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCGAGGTATTGT enylketonuri GGCAGCAAAGTTCCTAAGACCAAAACCACAGAAAAAAAAAGCT a;not GCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGT provided CCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTT TCCGAGGTATTGTGGCAACAAAGTTCCTAAGACCAAAACCACA GGCTTGAGTGAAGGGAATTAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGAGAAGGTCTAGATTCAGTGGTTTCAGAGCTA 99 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCACATTGAATCTA GACCTAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTAGA 243 4922-1525-2775.5Attorney Docket No.701586-000133WOPT ACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGG TACAGTCCACGCTTTTTTTCTCCTCACCCTCCCCATTCTCTCTT CTAGGAGAATGATGTAAACCTGACCCACACTGAATCTAGACCT TCTCGTTTAAAGACAAGGAgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGAGAAGGTCTAGATTCAGTGGTTTCAGAGCTA 100 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCACCCACATTGAA TCTAGACCTAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGT AGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGA GGGTACAGTCCACGCTTTTTTTTCACCCTCCCCATTCTCTCTTC TAGGAGAATGATGTAAACCTGACCCACACTGAATCTAGACCTT CTCGTTTAAAGACTGCTAgctaagcAGCTTGGCGTAACTAGATCT Phenylketon ggccaaagcatgcatGAGAAGGTCTAGATTCAGTGGTTTCAGAGCTA 101 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGACCCACATT GAATCTAGACCTAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT GGAGGGTACAGTCCACGCTTTTTTTCCCTCCCCATTCTCTCTT CTAGGAGAATGATGTAAACCTGACCCACACTGAATCTAGACCT TCTCGTTTAAAGAGCTCACgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGAGAAGGTCTAGATTCAGTGGTTTCAGAGCTA 102 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTAAACCTGACC CACATTGAATCTAGACCTAAAAAAAAAGCTGCCATCAGTCGGC GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT AAAAGTGGAGGGTACAGTCCACGCTTTTTTTCCCATTCTCTCTT CTAGGAGAATGATGTAAACCTGACCCACACTGAATCTAGACCT TCTCGTTTAAAGAGAAACTgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGTCTGATGTACTGTGTGCAGGTTTCAGAGCTA 103 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCGAGTCTTC CACTGCACACAGTACATCAAAAAAAAAGCTGCCATCAGTCGGC GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT AAAAGTGGAGGGTACAGTCCACGCTTTTTTTCTCGGGATTTCT TGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCACACAGTACAT CAGACATGGATCCAAAGTGAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGTCTGATGTACTGTGTGCAGGTTTCAGAGCTA 104 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCCTTCCGAGT CTTCCACTGCACACAGTACATCAAAAAAAAAGCTGCCATCAGT CGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCC GGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGGATTTCT TGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCACACAGTACAT CAGACATGGATCCACTTCTCgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGTCTGATGTACTGTGTGCAGGTTTCAGAGCTA 105 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGGCCTTCCG 244 4922-1525-2775.5Attorney Docket No.701586-000133WOPT AGTCTTCCACTGCACACAGTACATCAAAAAAAAAGCTGCCATC AGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAG CCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTTCT TGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCACACAGTACAT CAGACATGGATCCAACCGGTgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGTCTGATGTACTGTGTGCAGGTTTCAGAGCTA 106 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGGCCTGGCC TTCCGAGTCTTCCACTGCACACAGTACATCAAAAAAAAAGCTG CCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTC CCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTT TGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCACACAGTACAT CAGACATGGATCCATGATCGgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGCTGTGTGCAGTGGAAGACTGTTTCAGAGCTA 107 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCCGAGTCTTC CACTGCACAAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTG TAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGG AGGGTACAGTCCACGCTTTTTTTTGGCTGGCCTGCTTTCCTCT CGGGATTTCTTGGGTGGCCTGGCCTTCCAAGTCTTCCACTGC ACACAGTACATCAGACGGTCGGgctaagcAGCTTGGCGTAACTA GATCT Phenylketon ggccaaagcatgcatGCTGTGTGCAGTGGAAGACTGTTTCAGAGCTA 108 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCCTTCCGAGT CTTCCACTGCACAAAAAAAAAAGCTGCCATCAGTCGGCGTGGA CTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAG TGGAGGGTACAGTCCACGCTTTTTTTTGGCCTGCTTTCCTCTC GGGATTTCTTGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCA CACAGTACATCAGACTGGACCgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGCTGTGTGCAGTGGAAGACTGTTTCAGAGCTA 109 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGGCCTTCCG AGTCTTCCACTGCACAAAAAAAAAAGCTGCCATCAGTCGGCGT GGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAA AAGTGGAGGGTACAGTCCACGCTTTTTTTCCTGCTTTCCTCTC GGGATTTCTTGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCA CACAGTACATCAGACTAGCTAgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGCTGTGTGCAGTGGAAGACTGTTTCAGAGCTA 110 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGGCCTGGCC TTCCGAGTCTTCCACTGCACAAAAAAAAAAGCTGCCATCAGTC GGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCG GATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTTCCTCTC GGGATTTCTTGGGTGGCCTGGCCTTCCAAGTCTTCCACTGCA CACAGTACATCAGACCATAATgctaagcAGCTTGGCGTAACTAGA TCT 245 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Phenylketon ggccaaagcatgcatGCGGGATTTCTTGGGTGGCCGTTTCAGAGCT 111 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACTCGGAAGG CCAGGCCACCCAAGAAATCAAAAAAAAAGCTGCCATCAGTCG GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGTCTGATGT ACTGTGTGCAGTGGAAGACTTGGAAGGCCAGGCCACCCAAGA AATCCCGAGAGGAAAGCAGAATAgctaagcAGCTTGGCGTAACT AGATCT Phenylketon ggccaaagcatgcatGCGGGATTTCTTGGGTGGCCGTTTCAGAGCT 112 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGAAGACTCGG AAGGCCAGGCCACCCAAGAAATCAAAAAAAAAGCTGCCATCA GTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGC CCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGATGT ACTGTGTGCAGTGGAAGACTTGGAAGGCCAGGCCACCCAAGA AATCCCGAGAGGAAAGCGAACCGgctaagcAGCTTGGCGTAACT AGATCT Phenylketon ggccaaagcatgcatGCGGGATTTCTTGGGTGGCCGTTTCAGAGCT 113 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGGAAGACT CGGAAGGCCAGGCCACCCAAGAAATCAAAAAAAAAGCTGCCA TCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCA AGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGT ACTGTGTGCAGTGGAAGACTTGGAAGGCCAGGCCACCCAAGA AATCCCGAGAGGAAAGCGCGAACgctaagcAGCTTGGCGTAACT AGATCT Phenylketon ggccaaagcatgcatGCGGGATTTCTTGGGTGGCCGTTTCAGAGCT 114 uria;not ATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTT provided ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTGCAGTGGA AGACTCGGAAGGCCAGGCCACCCAAGAAATCAAAAAAAAAGC TGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGG TCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTT TTTGTGTGCAGTGGAAGACTTGGAAGGCCAGGCCACCCAAGA AATCCCGAGAGGAAAGCGATACCgctaagcAGCTTGGCGTAACT AGATCT Hyperphenyl ggccaaagcatgcatGATTCCTTACCTGGGAAAACGTTTCAGAGCTA 115 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTGCCCAGTTT pku;Phenylk TCCCAGGTAAGGAAAAAAAAAGCTGCCATCAGTCGGCGTGGA etonuria;not CTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAG provided TGGAGGGTACAGTCCACGCTTTTTTTGCTGTTGGGACATGTGC CCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAAG GAATGGATTTTTTATCAAGCgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGATTCCTTACCTGGGAAAACGTTTCAGAGCTA 116 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCAGCTTTGCCC pku;Phenylk AGTTTTCCCAGGTAAGGAAAAAAAAAGCTGCCATCAGTCGGCG etonuria;not TGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATA provided AAAGTGGAGGGTACAGTCCACGCTTTTTTTTTGGGACATGTGC CCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAAG 246 4922-1525-2775.5Attorney Docket No.701586-000133WOPT GAATGGATTTTTTAGACTACgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGATTCCTTACCTGGGAAAACGTTTCAGAGCTA 117 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCGCAGCTTTG pku;Phenylk CCCAGTTTTCCCAGGTAAGGAAAAAAAAAGCTGCCATCAGTCG etonuria;not GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG provided ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGGACATGTGC CCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAAG GAATGGATTTTTTACATAGAgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGATTCCTTACCTGGGAAAACGTTTCAGAGCTA 118 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCAGATCGCAG pku;Phenylk CTTTGCCCAGTTTTCCCAGGTAAGGAAAAAAAAAGCTGCCATC etonuria;not AGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAG provided CCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGTGC CCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAAG GAATGGATTTTTTAGATTCCgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGTTCCTTACCTGGGAAAACTGTTTCAGAGCTA 119 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTGCCCAGTTT pku;Phenylk TCCCAGGTAAGAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC etonuria;not TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT provided GGAGGGTACAGTCCACGCTTTTTTTGAGCTGTTGGGACATGTG CCCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAA GGAATGGATTTTTTTGCCTTgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGTTCCTTACCTGGGAAAACTGTTTCAGAGCTA 120 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCAGCTTTGCCC pku;Phenylk AGTTTTCCCAGGTAAGAAAAAAAAAGCTGCCATCAGTCGGCGT etonuria;not GGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAA provided AAGTGGAGGGTACAGTCCACGCTTTTTTTTGTTGGGACATGTG CCCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAA GGAATGGATTTTTTTGTCTCgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGTTCCTTACCTGGGAAAACTGTTTCAGAGCTA 121 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCGCAGCTTTG pku;Phenylk CCCAGTTTTCCCAGGTAAGAAAAAAAAAGCTGCCATCAGTCGG etonuria;not CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA provided TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGGGACATGTG CCCTTGTTTTCAGATCGCAGCTTTTCCCAGTTTTCCCAGGTAA GGAATGGATTTTTTGGAGGTgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGCCTCAATCCTTTGGGTGTAGTTTCAGAGCTA 122 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACGACCCATA pku;Phenylk CACCCAAAGGATTGAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA 247 4922-1525-2775.5Attorney Docket No.701586-000133WOPT etonuria;not AGTGGAGGGTACAGTCCACGCTTTTTTTTTGCTGCCACAATAC provided CTCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGAT TGAGGTCTTGGACAACCTGCAgctaagcAGCTTGGCGTAACTAG ATCT Hyperphenyl ggccaaagcatgcatGCCTCAATCCTTTGGGTGTAGTTTCAGAGCTA 123 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCGCTACGACC pku;Phenylk CATACACCCAAAGGATTGAAAAAAAAAGCTGCCATCAGTCGGC etonuria;not GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT provided AAAAGTGGAGGGTACAGTCCACGCTTTTTTTTGCCACAATACC TCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGATT GAGGTCTTGGACAAAACGCCgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 124 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACGACCCATA pku;Phenylk CACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTCGGCGTGG etonuria;not ACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAA provided GTGGAGGGTACAGTCCACGCTTTTTTTCTTTGCTGCCACAATA CCTCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGA TTGAGGTCTTGGACACGTTTCgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 125 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTCGCTACGACC pku;Phenylk CATACACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTCGGCG etonuria;not TGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATA provided AAAGTGGAGGGTACAGTCCACGCTTTTTTTGCTGCCACAATAC CTCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGAT TGAGGTCTTGGACAGTGGCAgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 126 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGTTCGCTACG pku;Phenylk ACCCATACACCCAAAGGATTAAAAAAAAAGCTGCCATCAGTCG etonuria;not GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG provided ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGCCACAATAC CTCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGAT TGAGGTCTTGGACACACACTgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGCTCAATCCTTTGGGTGTATGTTTCAGAGCTA 127 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTCTCAGTTCGC pku;Phenylk TACGACCCATACACCCAAAGGATTAAAAAAAAAGCTGCCATCA etonuria;not GTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGC provided CCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAATACC TCGGCCCTTCTCAGTTCGCTACAACCCATACACCCAAAGGATT GAGGTCTTGGACAAATGCAgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGAGCTGGAGGACAGTACTCAGTTTCAGAGCTA 128 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCGAACCGTG 248 4922-1525-2775.5Attorney Docket No.701586-000133WOPT AGTACTGTCCTCCAAAAAAAAAAGCTGCCATCAGTCGGCGTGG ACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAA GTGGAGGGTACAGTCCACGCTTTTTTTAGTACATCAGACATGG ATCCAAGCCCATGTATACCCCCAAACCGTGAGTACTGTCCTCC AGCTACCAGTTGCCCACTCAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGAGCTGGAGGACAGTACTCAGTTTCAGAGCTA 129 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACCCCCGAAC CGTGAGTACTGTCCTCCAAAAAAAAAAGCTGCCATCAGTCGGC GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT AAAAGTGGAGGGTACAGTCCACGCTTTTTTTCATCAGACATGG ATCCAAGCCCATGTATACCCCCAAACCGTGAGTACTGTCCTCC AGCTACCAGTTGCCGGTGGGgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGAGGACAGTACTCACGGTTTGTTTCAGAGCTA 130 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCGAACCGTG AGTACTGTAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTA GAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAG GGTACAGTCCACGCTTTTTTTTCCACTGCACACAGTACATCAG ACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTACTG TCCTCCAGCTACCACTCAAAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGAGGACAGTACTCACGGTTTGTTTCAGAGCTA 131 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACCCCCGAAC CGTGAGTACTGTAAAAAAAAAGCTGCCATCAGTCGGCGTGGA CTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAG TGGAGGGTACAGTCCACGCTTTTTTTCTGCACACAGTACATCA GACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTACT GTCCTCCAGCTACCATGAAGCgctaagcAGCTTGGCGTAACTAG ATCT Phenylketon ggccaaagcatgcatGAGGACAGTACTCACGGTTTGTTTCAGAGCTA 132 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTATACCCCCG AACCGTGAGTACTGTAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTCACACAGTACATCAG ACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTACTG TCCTCCAGCTACCAGATGTGgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGAGGACAGTACTCACGGTTTGTTTCAGAGCTA 133 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCATGTATACC CCCGAACCGTGAGTACTGTAAAAAAAAAGCTGCCATCAGTCG GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAGTACATCAG ACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTACTG TCCTCCAGCTACCAAGCCATgctaagcAGCTTGGCGTAACTAGAT CT 249 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Phenylketon ggccaaagcatgcatGGGACAGTACTCACGGTTTGGTTTCAGAGCTA 134 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCGAACCGTG AGTACTGAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTA GAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAG GGTACAGTCCACGCTTTTTTTCTTCCACTGCACACAGTACATC AGACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTAC TGTCCTCCAGCTACCCTCTATgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGGGACAGTACTCACGGTTTGGTTTCAGAGCTA 135 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTACCCCCGAAC CGTGAGTACTGAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT GGAGGGTACAGTCCACGCTTTTTTTCACTGCACACAGTACATC AGACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTAC TGTCCTCCAGCTACCGTATGGgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGGGACAGTACTCACGGTTTGGTTTCAGAGCTA 136 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTATACCCCCG AACCGTGAGTACTGAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTTGCACACAGTACATC AGACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTAC TGTCCTCCAGCTACCCCTGTTgctaagcAGCTTGGCGTAACTAGA TCT Phenylketon ggccaaagcatgcatGGGACAGTACTCACGGTTTGGTTTCAGAGCTA 137 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCATGTATACC CCCGAACCGTGAGTACTGAAAAAAAAAGCTGCCATCAGTCGG CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTACAGTACATCA GACATGGATCCAAGCCCATGTATACCCCCAAACCGTGAGTACT GTCCTCCAGCTACCATTTAGgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGCTCTGATAAGCAGTACTGTGTTTCAGAGCTA 138 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTTGGGGCCTA CAGTACTGCTTATCAAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTTGATCCTGATTTAAC AGTGATAATAACTTTTCACTTAGGGCCTACAGTACTGCTTATCA GAGAAGCCAAAGCCACCAGgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGCTCTGATAAGCAGTACTGTGTTTCAGAGCTA 139 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTCACTTGGGG CCTACAGTACTGCTTATCAAAAAAAAAAGCTGCCATCAGTCGG CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTCCTGATTTAACA 250 4922-1525-2775.5Attorney Docket No.701586-000133WOPT GTGATAATAACTTTTCACTTAGGGCCTACAGTACTGCTTATCAG AGAAGCCAAAGCTAAGCAgctaagcAGCTTGGCGTAACTAGATCT Phenylketon ggccaaagcatgcatGCTCTGATAAGCAGTACTGTGTTTCAGAGCTA 140 uria;not TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA provided TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTTTTCACTTGG GGCCTACAGTACTGCTTATCAAAAAAAAAAGCTGCCATCAGTC GGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCG GATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGATTTAACA GTGATAATAACTTTTCACTTAGGGCCTACAGTACTGCTTATCAG AGAAGCCAAAGCCAAGTGgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGTGATAATAACTTTTCACTTGTTTCAGAGCTAT 141 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCCAAGTGAAA AGTTATTAAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTA GAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAG GGTACAGTCCACGCTTTTTTTTCCAGGGGGAGAAGCTTTGGCT TCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTAT CACTGTTAAATCATCGACgctaagcAGCTTGGCGTAACTAGATCT Phenylketon ggccaaagcatgcatGTGATAATAACTTTTCACTTGTTTCAGAGCTAT 142 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCTAGGCCCCAAGT GAAAAGTTATTAAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT GGAGGGTACAGTCCACGCTTTTTTTGGGGGAGAAGCTTTGGC TTCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTA TCACTGTTAAATCATCATGgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGTGATAATAACTTTTCACTTGTTTCAGAGCTAT 143 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGTAGGCCCCA AGTGAAAAGTTATTAAAAAAAAAAGCTGCCATCAGTCGGCGTG GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA AGTGGAGGGTACAGTCCACGCTTTTTTTGGAGAAGCTTTGGCT TCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTAT CACTGTTAAATCCCGGTGgctaagcAGCTTGGCGTAACTAGATCT Phenylketon ggccaaagcatgcatGTGATAATAACTTTTCACTTGTTTCAGAGCTAT 144 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCAGTACTGTAGG CCCCAAGTGAAAAGTTATTAAAAAAAAAAGCTGCCATCAGTCG GCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGG ATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTAGCTTTGGCT TCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTAT CACTGTTAAATCCCTTCAgctaagcAGCTTGGCGTAACTAGATCT Phenylketon ggccaaagcatgcatGGATAATAACTTTTCACTTAGTTTCAGAGCTAT 145 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCCCCAAGTGAAA AGTTATTAAAAAAAAAGCTGCCATCAGTCGGCGTGGACTGTAG AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGG GTACAGTCCACGCTTTTTTTGCTCCAGGGGGAGAAGCTTTGGC TTCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTA TCACTGTTAAATGGGACAgctaagcAGCTTGGCGTAACTAGATCT 251 4922-1525-2775.5Attorney Docket No.701586-000133WOPT Phenylketon ggccaaagcatgcatGGATAATAACTTTTCACTTAGTTTCAGAGCTAT 146 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCTAGGCCCCAAGT GAAAAGTTATTAAAAAAAAAGCTGCCATCAGTCGGCGTGGACT GTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTG GAGGGTACAGTCCACGCTTTTTTTCAGGGGGAGAAGCTTTGG CTTCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTAT TATCACTGTTAAATCCATGAgctaagcAGCTTGGCGTAACTAGAT CT Phenylketon ggccaaagcatgcatGGATAATAACTTTTCACTTAGTTTCAGAGCTAT 147 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCTGTAGGCCCCA AGTGAAAAGTTATTAAAAAAAAAGCTGCCATCAGTCGGCGTGG ACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAA GTGGAGGGTACAGTCCACGCTTTTTTTGGGGAGAAGCTTTGG CTTCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTAT TATCACTGTTAAATTCTTATgctaagcAGCTTGGCGTAACTAGATC T Phenylketon ggccaaagcatgcatGGATAATAACTTTTCACTTAGTTTCAGAGCTAT 148 uria;not GCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTAT provided CAACTTGAAAAAGTGGCACCGAGTCGGTGCCAGTACTGTAGG CCCCAAGTGAAAAGTTATTAAAAAAAAAGCTGCCATCAGTCGG CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTGAAGCTTTGGC TTCTCTGATAAGCAGTACTGTAGGCCCTAAGTGAAAAGTTATTA TCACTGTTAAATTGTCCTgctaagcAGCTTGGCGTAACTAGATCT Hyperphenyl ggccaaagcatgcatGTTCCAGCCCCTCTATTACGGTTTCAGAGCTA 149 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTCTCTGCCAC pku;Phenylk GTAATAGAGGGGCTGAAAAAAAAAGCTGCCATCAGTCGGCGT etonuria;not GGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAA provided AAGTGGAGGGTACAGTCCACGCTTTTTTTCCTCACCTTACTTT CTCCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGGGGC TGGAACTCCGTGACAATTGACgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGTTCCAGCCCCTCTATTACGGTTTCAGAGCTA 150 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAAACTCTCTGC pku;Phenylk CACGTAATAGAGGGGCTGAAAAAAAAAGCTGCCATCAGTCGG etonuria;not CGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGA provided TAAAAGTGGAGGGTACAGTCCACGCTTTTTTTACCTTACTTTCT CCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGGGGCTG GAACTCCGTGACAGGCCACgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGTTCCAGCCCCTCTATTACGGTTTCAGAGCTA 151 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTAAAACTCTC pku;Phenylk TGCCACGTAATAGAGGGGCTGAAAAAAAAAGCTGCCATCAGT etonuria;not CGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCC provided GGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTACTTTCT CCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGGGGCTG 252 4922-1525-2775.5Attorney Docket No.701586-000133WOPT GAACTCCGTGACACCTGTAgctaagcAGCTTGGCGTAACTAGATC T Hyperphenyl ggccaaagcatgcatGTTCCAGCCCCTCTATTACGGTTTCAGAGCTA 152 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCATCATTAAAA pku;Phenylk CTCTCTGCCACGTAATAGAGGGGCTGAAAAAAAAAGCTGCCAT etonuria;not CAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAA provided GCCCGGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTTTCT CCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGGGGCTG GAACTCCGTGACAGAACATgctaagcAGCTTGGCGTAACTAGATC T Hyperphenyl ggccaaagcatgcatGAGCCCCTCTATTACGTGGCGTTTCAGAGCTA 153 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTCTCTGCCAC pku;Phenylk GTAATAGAGGGAAAAAAAAAGCTGCCATCAGTCGGCGTGGAC etonuria;not TGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGT provided GGAGGGTACAGTCCACGCTTTTTTTTGTCACCACCTCACCTTA CTTTCTCCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAG GGGCTGGAACTCCGTGTAACCgctaagcAGCTTGGCGTAACTAG ATCT Hyperphenyl ggccaaagcatgcatGAGCCCCTCTATTACGTGGCGTTTCAGAGCTA 154 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAAACTCTCTGC pku;Phenylk CACGTAATAGAGGGAAAAAAAAAGCTGCCATCAGTCGGCGTG etonuria;not GACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAA provided AGTGGAGGGTACAGTCCACGCTTTTTTTACCACCTCACCTTAC TTTCTCCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGG GGCTGGAACTCCGTGGACGTgctaagcAGCTTGGCGTAACTAGA TCT Hyperphenyl ggccaaagcatgcatGAGCCCCTCTATTACGTGGCGTTTCAGAGCTA 155 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTAAAACTCTC pku;Phenylk TGCCACGTAATAGAGGGAAAAAAAAAGCTGCCATCAGTCGGC etonuria;not GTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGAT provided AAAAGTGGAGGGTACAGTCCACGCTTTTTTTACCTCACCTTAC TTTCTCCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGG GGCTGGAACTCCGTAAATAGgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGAGCCCCTCTATTACGTGGCGTTTCAGAGCTA 156 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCATCATTAAAA pku;Phenylk CTCTCTGCCACGTAATAGAGGGAAAAAAAAAGCTGCCATCAGT etonuria;not CGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCC provided GGATAAAAGTGGAGGGTACAGTCCACGCTTTTTTTACCTTACT TTCTCCTTGGCATCATTAAAACTCCCTGCCACGTAATAGAGGG GCTGGAACTCCGTTGCGATgctaagcAGCTTGGCGTAACTAGAT CT Hyperphenyl ggccaaagcatgcatGGCCCCTCTATTACGTGGCAGTTTCAGAGCTA 157 alaninemia, TGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTA non- TCAACTTGAAAAAGTGGCACCGAGTCGGTGCCTCTCTGCCAC pku;Phenylk GTAATAGAGGAAAAAAAAAGCTGCCATCAGTCGGCGTGGACT GTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTG 253 4922-1525-2775.5

Images