Method for determining responsiveness to bleach therapy

A method for determining responsiveness to bleaching therapy in atopic dermatitis by analyzing Staphylococcus aureus strains' specific gene sequences and bacterial abundances accurately predicts treatment success, addressing the uncertainty in bleaching therapy effectiveness.

WO2025220433A1PCT designated stage Publication Date: 2025-10-23JSR CORPORATION +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/011370
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-19
Filing Date
2025-03-24
Publication Date
2025-10-23

AI Technical Summary

Technical Problem

There is a lack of a reliable method to determine whether a person will respond to bleaching therapy for atopic dermatitis, as the effectiveness of bleaching therapy on Staphylococcus aureus is unclear, leading to inconsistent treatment outcomes.

Method used

A method is developed to determine responsiveness to bleaching therapy by analyzing the skin flora of atopic dermatitis patients, identifying specific base sequences in Staphylococcus aureus strains using DNA sequencing, and comparing their abundance to other bacteria like Cutibacterium acnes and Cutibacterium granulosum, which involves separating bacteria, determining the presence of specific genes, and assessing amino acid sequences.

Benefits of technology

This method accurately identifies individuals likely to respond to bleaching therapy, distinguishing between treatment success, worsening, recurrence, and non-susceptible groups, thereby guiding effective treatment decisions for atopic dermatitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-M000043
    Figure JPOXMLDOC01-APPB-M000043
  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
Patent Text Reader

Abstract

The present invention addresses the problem of providing a method for determining a person showing responsiveness to bleach therapy. The present invention encompasses a method for determining responsiveness to bleach therapy, the method involving a determination step a in which, when a bacterium contained in a subject sample has one or more selected from the base sequences described in SEQ ID NO:1 to SEQ ID NO:173 and base sequences showing 80% or greater identity with said base sequences, it is determined that the subject shows responsiveness to bleach therapy.
Need to check novelty before this filing date? Find Prior Art

Description

Method for determining response to bleaching therapy

[0001] The present invention relates to a method for determining responsiveness to bleaching therapy.

[0002] Atopic dermatitis (AD) is a disease characterized by pruritic eczema that repeatedly worsens and improves. The pathogenesis of AD is related to a complex combination of various etiologies, including atopic predisposition and hypersensitivity of organs, including the skin, due to a weakened barrier function.

[0003] In order to select an appropriate treatment for atopic dermatitis, it is necessary to correctly evaluate its severity. SCORAD (Severity Scoring of Atopic Dermatitis) is one of the severity classification methods that has been verified for its statistical reliability and validity.

[0004] The basic treatment methods for atopic dermatitis, based on the pathology, include drug therapy, topical therapy and skin care for physiological abnormalities of the skin, and the identification and treatment of aggravating factors.

[0005] For example, bleach bath therapy, which involves soaking in a bath containing hypochlorous acid, is a common treatment for atopic dermatitis in Europe and the United States. Another treatment involves soaking clothing in a hypochlorous acid solution and then wearing the clothes. Hereinafter, such treatments using hypochlorous acid solutions will be collectively referred to as bleach therapy. Meanwhile, there have been reports of both effective and ineffective treatments (Non-Patent Document 1).

[0006] Furthermore, research has been conducted focusing on atopic dermatitis and Staphylococcus aureus (S. aureus), but the effect of bleaching therapy on S. aureus is still unknown (Non-Patent Documents 2 and 3).

[0007] Atopic Dermatitis Clinical Practice Guidelines 2021: Journal of the Japanese Dermatological Association: 131 (13), 2691-2777, 2021 Nature Medicine, vol. 27, April 2021, 700-709 Archives of Dermatological Research (2023) 315: 2883-2892

[0008] An object of the present invention is to provide a method for determining whether a person will respond to bleaching therapy.

[0009] The present inventors conducted extensive research to solve the above-mentioned problems. They analyzed the skin flora of atopic dermatitis patients who had undergone bleach bath therapy and were classified into four groups (treatment response group, non-susceptible group, worsening group, and relapse group) based on changes in SCORAD. As a result, they found that each group contained Staphylococcus aureus carrying a specific gene, which made it possible to determine who would respond to bleach therapy, and thus completed the present invention.

[0010] Aspects of the present invention relate to the following [1] to

[10] , for example. [1] A method for determining responsiveness to bleaching therapy, comprising a determining step a of determining that a subject is responsive to bleaching therapy when bacteria contained in a sample from the subject have one or more base sequences selected from the base sequences set forth in SEQ ID NOs: 1 to 173 and base sequences having 80% or more identity to said base sequences. [2] The method of [1], wherein said base sequences are any of the base sequences set forth in SEQ ID NOs: 1 to 107 and base sequences having 80% or more identity to said base sequences. [3] The method of [1] or [2], comprising a separating step of separating bacteria contained in a sample from the subject. [4] The method of any of [1] to [3], wherein the subject is a patient with atopic dermatitis. [5] The method of any of [1] to [4], wherein the bacteria is Staphylococcus aureus. [6] The method of any of [1] to [5], comprising a determining step (b) of determining that the subject is responsive to bleaching therapy when the abundance of Staphylococcus aureus in the sample from the subject is significantly greater than that of a control group and the abundance of Cutibacterium acnes and Cutibacterium granulosum is significantly less than that of the control group. [7] The method of any of [1] to [6], wherein the bleaching therapy is a therapy involving a bath containing 0.0001 to 0.02% sodium hypochlorite once to four times a week. [8] The method of any of [1] to [7], wherein the bleaching therapy is a therapy involving wearing clothes soaked in a 0.0001 to 0.02% aqueous solution of sodium hypochlorite. [9] The method of any of [1] to [8], comprising a determining step c of determining that the subject is responsive to bleaching therapy when the bacterium has one or more selected from amino acid sequences translated from the base sequences set forth in SEQ ID NOs: 1 to 173 and amino acid sequences having 80% or more identity to said amino acid sequences.

[10] The method of any of [1] to [9], wherein the base sequence is an amino acid sequence translated from the base sequence set forth in SEQ ID NOs: 1 to 107 and a sequence having 80% or more identity to said amino acid sequence.

[0011] One embodiment of the present invention can provide a method for determining who will be responsive to bleaching therapy.

[0012] Figure 1 is a graph illustrating the change over time in SCORAD scores (SCORAD.ABC) for the treatment success group (Improvement), non-susceptibility group (No-change), exacerbation group (Examination), and recurrence group (Recurrence). Figure 2 is a graph showing the objective SCORAD, itch, and TARC (Th2 chemokine) scores immediately before bleach bath treatment (0M) for atopic dermatitis patients divided into four groups. Figure 3 is a graph showing the change over time in objective SCORAD, itch, and TARC scores for atopic dermatitis patients divided into four groups after bleach bath treatment. The vertical axis of the top graph represents the rate of change in objective SCORAD values, the vertical axis of the middle graph represents itch values, and the vertical axis of the bottom graph represents TARC values, with the horizontal axis of each graph representing time (months). Figure 4 is a graph showing the time-dependent changes in WBC (white blood cell), LDH (lactate dehydrogenase), EOS (eosinophils), and CRP (C-reactive protein) values ​​following bleach bath treatment in atopic dermatitis patients classified into four groups. The horizontal axis of each graph represents time (months). Figure 5 shows a phylogenetic tree of 72 strains isolated from 22 atopic dermatitis patients in the treatment response group. The legend of the phylogenetic tree indicates Mash distance. Figure 6 is a heat map of the 81 genes shown in the phylogenetic tree of Figure 5. Figure 7 shows the distribution of the number of 81 genes possessed by Staphylococcus aureus isolated from the four groups. * indicates p<0.05, ** indicates p<0.001. Figure 8 shows the results of strain / gene clustering for the presence or absence of the 81 genes for 58 strains isolated from the treatment-successful or non-susceptible groups.

[0013] FIG. 9 is a diagram showing the number of genes that differ between the treatment response group and the other three groups in comparative genomic analysis using PHROGs. In the figure, for example, "vs. No-change" represents a comparison between the treatment response group and the non-responsive group. FIG. 10 is a diagram showing the number of genes that differ between the treatment response group and the other three groups in comparative genomic analysis using UNIREF90. In the figure, for example, "vs. No-change" represents a comparison between the treatment response group and the non-responsive group. FIG. 11 is a diagram showing a compilation of gene ontology of genes that are significantly conserved in the treatment response group compared to the non-responsive group among the genes detected in the comparative analysis using UNIREF90. In the figure, BP represents Biological Process, CC represents Cellular Component, and MF represents Molecular Function, as in FIGS. 12 to 17. Figure 12 shows a summary of gene ontology of genes detected in comparative analysis using UNIREF90 that are significantly conserved in the treatment success group compared to the worsening group. Figure 13 shows a summary of gene ontology of genes detected in comparative analysis using UNIREF90 that are significantly conserved in the treatment success group compared to the worsening group. Figure 14 shows a summary of gene ontology of genes detected in comparative analysis using UNIREF90 that are significantly conserved in the treatment success group compared to the recurrence group. Figure 15 shows a summary of gene ontology of genes detected in comparative analysis using UNIREF90 that are significantly conserved in the recurrence group compared to the treatment success group. 16 shows a summary of gene ontologies of genes detected by comparative analysis using UNIREF90 that are significantly conserved in the non-sensitive group compared to the exacerbated group. FIG. 17 shows a summary of gene ontologies of genes detected by comparative analysis using UNIREF90 that are significantly conserved in the exacerbated group compared to the exacerbated group.

[0014] FIG. 18 is a diagram showing the locus of the phage gene of SA0462 derived from an atopic dermatitis patient in the treatment success group. FIG. 19 is a diagram showing characteristic genes among the phage genes of SA0462 derived from an atopic dermatitis patient in the treatment success group. FIG. 20 is a diagram showing the locus of the phage gene of SA0859 derived from an atopic dermatitis patient in the treatment success group. FIG. 21 is a diagram showing characteristic genes among the phage genes of SA0859 derived from an atopic dermatitis patient in the treatment success group. FIG. 22 is a diagram showing the locus of the phage gene of SA0407 derived from an atopic dermatitis patient in the non-susceptible group. FIG. 23 is a diagram showing the locus of the phage gene of SA0537 derived from an atopic dermatitis patient in the non-susceptible group. FIG. 24 is a diagram showing the locus of the phage gene of SA0538 derived from an atopic dermatitis patient in the non-susceptible group.

[0015] Figure 25 shows the skin bacterial loads of Staphylococcus aureus, Cutibacterium acnes, and Cutibacterium granulosum derived from four groups of atopic dermatitis patients. Figure 26 shows the results of principal component analysis of Shapley values ​​when predicted using a machine learning model. In Figures 26 to 31, PC1 to PC3 represent principal components 1 to 3, respectively. In Figures 26 to 28, black circles represent the treatment response group, crosses represent the non-susceptible group, and triangles represent the other groups. Figure 27 shows the results of principal component analysis of Shapley values ​​when predicted using a machine learning model. Figure 28 shows the results of principal component analysis of Shapley values ​​when predicted using a machine learning model. Figure 29 shows the results of principal component analysis of Shapley values ​​when predicted using a machine learning model. FIG. 30 shows the results of principal component analysis of Shapley values ​​when making predictions using a machine learning model. FIG. 31 shows the results of principal component analysis of Shapley values ​​when making predictions using a machine learning model. FIG. 32 shows the distribution of clinical scores for each sample in each prediction group based on the classification results using the machine learning model. From left to right, the distributions of SCORAD.ABC, objective SCORAD, itch, and TARC values ​​are shown. FIG. 33 shows the distribution of clinical scores for each patient in each prediction group based on the classification results using the machine learning model. The average value was calculated for multiple clinical score measurements for each patient, and this was used as the clinical score for each patient. From left to right, the distributions of SCORAD.ABC, objective SCORAD, and itch values ​​are shown. FIG. 34 is a graph showing the results of a susceptibility test to sodium hypochlorite of Staphylococcus aureus derived from atopic dermatitis patients in the treatment success group (top) and the non-susceptible group (bottom).

[0016] Preferred embodiments for carrying out the present invention will be described below. Note that the embodiment described below shows one example of a typical embodiment of the present invention, and the scope of the present invention should not be interpreted narrowly by this. Note that the expression "A to B" regarding a numerical range means A or more and B or less, unless otherwise specified. For example, the expression "1 to 5%" means 1% or more and 5% or less.

[0017] <Method for determining responsiveness to bleach therapy> One embodiment of the present invention is a method for determining responsiveness to bleach therapy, comprising a determination step a of determining that a subject is responsive to bleach therapy when bacteria contained in a sample from the subject have one or more base sequences selected from the base sequences set forth in SEQ ID NOs: 1 to 173 and base sequences having 80% or more identity to said base sequences.

[0018] The determination method preferably includes a separation step of separating bacteria contained in a sample from the subject.

[0019] The bleaching therapy may be a therapy in which a bath containing 0.0001 to 0.02%, preferably 0.005%, sodium hypochlorite is carried out once to four times a week, preferably twice a week, or a therapy in which clothes soaked in a 0.0001 to 0.02%, preferably 0.005%, aqueous solution of sodium hypochlorite are worn.

[0020] [Determination step a] The determination step a is a step of determining that a subject is responsive to bleaching therapy when bacteria contained in a sample from the subject have one or more base sequences selected from the base sequences set forth in SEQ ID NOs: 1 to 173, preferably SEQ ID NOs: 1 to 107, and base sequences that have identities to said base sequences of 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 96% or more, even more preferably 97% or more, particularly preferably 98% or more, and most preferably 99% or more. When bacteria in a sample have the above-mentioned base sequence, it can be determined that the subject is at least responsive to bleaching therapy, which is different from that of the non-susceptible group and similar to that of the treatment-successful group.

[0021] As will be described later in the Examples, when changes in SCORAD.ABC values ​​of atopic dermatitis patients over time were examined, as shown in Figure 1, and the patients were classified into four groups: a "treatment success group" (Improvement), which shows a responsiveness in which values ​​decreased over time; a "worsening group" (Examination), which shows a responsiveness in which values ​​increased over time; a "recurrence group" (Recurrence), which shows a responsiveness in which values ​​initially decreased and then increased over time; and a "non-susceptible group" (No-change), which shows a responsiveness in which values ​​remained almost unchanged over time. The base sequences of SEQ ID NOs: 1 to 173 are the base sequences of 81 characteristic genes (hereinafter also simply referred to as "81 genes") that distinguish bacteria derived from atopic dermatitis patients in the treatment success group and the non-susceptible group.

[0022] SCORAD (Severity Scoring of Atopic Dermatitis) is a severity classification method that has been verified for its statistical reliability and validity in correctly assessing the severity of atopic dermatitis in order to select an appropriate treatment for the condition. Objective SCORAD, which omits subjective symptoms from SCORAD, is also used. SCORAD values ​​can be calculated by calculating the skin symptoms of a subject described in the above-mentioned atopic dermatitis treatment guidelines, by calculating the area of ​​the rash (A) (percentage of body surface area) and the sum (B) of the severity (0 = none, 1 = mild, 2 = moderate, 3 = severe) of each rash, including erythema, infiltration / rash, exudate / crust, excoriation, lichenification, and dry skin, and then evaluating the subject's subjective symptoms using a visual analogue scale (C), and then calculating the score by the formula A / 5 + 7B / 2 + C. The SCORAD value calculated by the formula using the values ​​of (A) to (C) is represented as "SCORAD.ABC." The objective SCORAD value can be calculated by A / 5 + 7B / 2.

[0023] The base sequences of all genes carried by bacteria in a sample are obtained by extracting genomic DNA from the bacteria, determining the sequence using a DNA sequencer, reconstructing the entire genome sequence using a mathematical algorithm, and predicting gene regions.

[0024] The identity of a base sequence means the percentage (%) of the number of matching bases relative to the length of the alignment region in the optimal alignment when two base sequences are aligned using a mathematical algorithm known in the art, and can be calculated using, for example, NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool).

[0025] Tables 1 to 39 show the names of 81 genes (gene_id) and the nucleotide sequences of SEQ ID NOs. 1 to 173. In Tables 1 to 39, TRUE indicates a sequence contained in 58 genes described below, and FALSE indicates a sequence contained in other genes. In this specification, "a bacterium has a certain gene" means that the bacterium has at least one of the nucleotide sequence or amino acid sequence corresponding to the certain gene.

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] When the bacteria in the sample contain one or more, preferably two to six or more, more preferably 15 to 19 or more, and even more preferably 42 to 46 or more genes out of the 81 genes, and particularly when the bacteria contain one or more, preferably two or more, more preferably three or more, and even more preferably four or more genes out of the 58 genes corresponding to SEQ ID NOs: 1 to 107, it can be determined that the subject has a responsiveness to bleaching therapy that is at least different from that of the non-susceptible group and similar to that of the treatment-successful group.

[0066] When detecting multiple genes, it is preferable to select genes belonging to different groups, such as one or more groups selected from the group consisting of C3, C4, C5, and C7 shown in Figure 8.

[0067] In addition to a method of reconstructing the entire genome sequence of the bacterium in the sample, the presence or absence of the 81 gene can also be detected by PCR of genomic DNA extracted from the bacterium using primers specific to the base sequence of the 81 gene.

[0068] In this case, a mixture of genomic DNA extracted from multiple strains in a combination covering all 81 genes from the 72 strains shown to have the 81 genes in Figure 6 may be used as a positive control. Genomic DNA extracted from a strain that does not have any of the 81 genes from the 72 strains in Figure 6 may be used as a negative control. The PCR cycle number is preferably such that it is detected in the positive control but not in the negative control.

[0069] [Separation Step] The separation step is a step of separating bacteria in a sample from a subject. The subject is preferably an atopic dermatitis patient, and may be a person who has previously suffered from atopic dermatitis and is at risk of experiencing a recurrence of symptoms. The subject may also be a person suspected of having atopic dermatitis before being diagnosed or determined to have atopic dermatitis by a doctor or the like. The subject may be a person who is currently undergoing bleaching therapy, a person who has previously undergone bleaching therapy, or a person who has never undergone bleaching therapy, but a person who has never undergone bleaching therapy is preferred.

[0070] The bacteria in the specimen can be obtained from, but is not limited to, the subject's skin (skin tissue, skin cells), skin secretions (sweat, sebum, suppuration, exudate, etc.), a swab sample from the skin, washed skin, etc. The collection site can be, but is not limited to, the upper back (mid-upper back), between the eyebrows, the cubital fossa, the inside of the forearm, and the like.

[0071] The bacteria in the specimen is preferably Staphylococcus aureus (hereinafter also referred to as "S. aureus" or S. aureus). S. aureus can be inoculated into a staphylococcus selective medium by standard methods, for example, and the single colonies that grow on the medium can be visually confirmed. Alternatively, as described below in the Examples, the bacteria are inoculated into a staphylococcus selective medium (trade name: Mannitol Salt Medium, Nissui Pharmaceutical) and cultured at 37°C for 48 hours. Up to 10 single colonies that grow on the medium are selected from each specimen and replated onto tryptic soy agar (TSA). The colonies that grow on the medium may be confirmed to be S. aureus by PCR using femA and femB gene-specific primers (SEQ ID NOs: 174-177).

[0072] [Determination step b] The present invention preferably includes a determination step b. The determination step b is a step of determining that the subject is responsive to bleach therapy when the amount of Staphylococcus aureus present in a sample from the subject is significantly greater than that in a control group and the amounts of Cutibacterium acnes and Cutibacterium granulosum present are significantly less than that in the control group.

[0073] The abundance of Staphylococcus aureus, Cutibacterium acnes, and Cutibacterium granulosum (hereinafter also referred to as "three bacterial species") can also be confirmed by the skin flora m16s rRNA analysis technique described later in the Examples.

[0074] Alternatively, the abundance of the three bacterial species may be confirmed by standard methods, such as culturing each strain on a selective medium for that strain and visually inspecting the colonies, amplifying each strain by PCR using a base sequence characteristic of that strain, etc. Examples of selective media for Staphylococcus aureus include mannitol salt agar medium, egg yolk-added mannitol salt agar medium, Baird-Parker agar medium, and ChromoagarStaff aureus medium.

[0075] In the case of Cutibacterium acnes and Cutibacterium granulosum, for example, the presence or absence of the bacteria can be confirmed by smearing them on GAM agar medium (Nissui Pharmaceutical) or blood agar medium (Japan BD), sealing them in an airtight container together with Anaeropack (registered trademark, Mitsubishi Gas Chemical), and culturing them anaerobically.Furthermore, the presence of each bacterium can be confirmed by amplifying the observed colonies by PCR (colony PCR method) using a base sequence characteristic of each bacterium.

[0076] The abundance of the three bacterial species obtained by the above method can be determined by, for example, obtaining control values ​​for each group from patients who participated in the bleach bath treatment cohort shown in the Examples, and comparing them with the control values ​​to determine whether there is a significant difference.

[0077] As described later in the Examples, the above three bacterial species are bacteria whose abundance differs significantly among the four groups. Among the atopic dermatitis patients classified into four groups, Staphylococcus aureus is a bacterium whose abundance differs significantly between the treatment-successful group and the non-susceptible group. Furthermore, Cutibacterium acnes and Cutibacterium granulosum are bacteria whose abundance differs significantly between the non-susceptible group and the recurrence group.

[0078] Although it is possible to select a treatment success group from atopic dermatitis patients classified into four groups by the above-mentioned determination step a, the treatment success group can be selected with high accuracy by the determination step a and determination step b. Furthermore, the treatment success group can be selected with even higher accuracy by the determination step a, determination step b, and the determination step c described below. Effective response means the response observed in the treatment success group to the bleach therapy selected in this way. If it is determined that the subject shows an effective response, the subject is expected to achieve therapeutic effects for atopic dermatitis by undergoing bleach therapy.

[0079] [Determination Step c] The present invention preferably includes a determination step c. The determination step c is a step of determining that a subject is responsive to bleaching therapy when bacteria contained in a sample from the subject have one or more amino acid sequences selected from amino acid sequences translated from the base sequences set forth in SEQ ID NOs: 1 to 173 and amino acid sequences that share 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity with the amino acid sequence.

[0080] The amino acid sequences of all genes possessed by the bacterium are obtained by extracting genomic DNA from the isolated strain, determining the sequence using a DNA sequencer, reconstructing the entire genome sequence using a mathematical algorithm, and predicting gene regions.

[0081] The identity of amino acid sequences means the percentage (%) of matching amino acid residues in optimal alignment relative to the length of the alignment region when two amino acid sequences are aligned using a mathematical algorithm known in the art, and examples of such algorithms include NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool), DIAMOND (B. Buchfink, K. Reuter and H-G. Drost, 2021, Nature Methods), USearch (R. C. Edgar, 2010, Bioinformatics), and LAST (S. M. Kielbasa et. al., 2011, Genome Research), MMSeqs2 (M. Steinegger and J. Soding, 2017, Nature Biotechnology), etc.

[0082] When the bacterium has one or more amino acid sequences selected from amino acid sequences translated from the base sequences set forth in SEQ ID NOs: 1 to 173 and amino acid sequences that have 80% or more, preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity to said amino acid sequences, it can be determined that the subject has a responsiveness to bleaching therapy that is at least different from that of a non-susceptible group and similar to that of a treatment-successful group.

[0083] When the bacterium has one or more, preferably two to six or more, more preferably 15 to 19 or more, and even more preferably 42 to 46 or more of the 81 genes, a particularly suitable condition is when the genes possessed by the bacterium are one or more, preferably two or more, more preferably three or more, and even more preferably four or more of the 58 genes corresponding to SEQ ID NOs: 1 to 107, in which case the subject can be determined to have a responsiveness to bleaching therapy that is at least different from that of the non-susceptible group and similar to that of the treatment-successful group.

[0084] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples and can be practiced with appropriate modifications within the scope of the present invention. The following examples were performed at Keio University School of Medicine or the National Institute of Infectious Diseases with the consent of patients with atopic dermatitis and with the approval of the Keio University School of Medicine Ethics Committee (approval number: 2013-0384).

[0085] Experimental Example 1 Atopic dermatitis patients were stratified according to clinical scores (objective SCORAD) using the following method.

[0086] [1] Human Skin Swab Collection for S. aureus Genome Analysis. Twenty-six patients with atopic dermatitis who underwent bleach bath treatment (0.005% hypochlorous acid, twice weekly) for three months, as well as healthy volunteers (see Table 40 below for age and gender), were swabbed at four primary sampling sites: the glabella, cubital fossa, inner forearm, and midline of the upper back. For patients with atopic dermatitis, swabs were collected at seven time points: one month before (-1M), immediately before (0M), once a month during treatment (1-3M), one month after treatment completion (4M), and two months after treatment completion (5M). Hereinafter, this prospective study conducted from before to after bleach bath treatment is referred to as the bleach bath treatment cohort.

[0087] When collecting swabs, if there was a rash (or a characteristic rash) near each site, samples were taken from the same site in addition to non-lesional areas (minimum of four, maximum of eight). The sampling area was 2 x 2 cm or 5 x 5 cm. Swabs were collected by rubbing the area with a sterile cotton swab soaked in PBS for 30 seconds, and the obtained swab samples were placed in tubes containing 1 mL of PBS and stored.

[0088]

[0089] [2] Quantification of bacterial load The bacterial cells in the swab sample were suspended in sterile water and then centrifuged (3,000 × g, 4 minutes, room temperature) to recover the bacterial cells. Genomic DNA of the whole bacterial cells was extracted from the obtained bacterial cells using Maxwell (registered trademark) RSC Blood DNA Kit [AS1400] (Promega). PCR was performed using the obtained genomic DNA as a template and the following primers. The PCR temperature and cycle conditions were as follows:

[0090] Forward primer: AGRGTTTGATYMTGGCTCAG (SEQ ID NO: 178) Reverse primer: TGCTGCCTCCCCGTAGGAGT (SEQ ID NO: 179)

[0091] (a) 96°C, 2 minutes (b) 96°C, 30 seconds (c) 55°C, 45 seconds (d) 72°C, 60 seconds 30 cycles of (b) to (d) (e) 72°C, 10 minutes (f) Hold at 4°C.

[0092] The obtained genomic DNA was used as a template. TM SYBR TM Quantitative PCR was performed using Green Master Mix (Thermo Fisher Scientific) and the following primers:

[0093] Forward primer: AGRGTTTGATYMTGGCTCAG (SEQ ID NO: 180) Reverse primer: TGCTGCCTCCCGTAGGAGT (SEQ ID NO: 181)

[0094] (a) 50°C, 2 minutes (b) 95°C, 2 minutes (c) 95°C, 3 seconds (d) 60°C, 45 seconds 40 cycles of (c) to (d)

[0095] Table 40 shows the bacterial load (logarithmic scale) of Staphylococcus aureus in each group in the midline of the upper back (B in Table 40), between the eyebrows (G in Table 40), cubital fossa (C in Table 40), and inside the forearm (V in Table 40) immediately before the start of bleach bath treatment (0 M) based on the PCR measurement results.

[0096] [3] Itch The itching (itch) state of the atopic dermatitis patients in each group described below was evaluated using an 11-point score (Numerical Rating Scale (NRS)) ranging from "no itching: 0" to "the worst itching imaginable: 10." The results are shown in Figures 2 and 3.

[0097] [4] TARC The TARC value, which is an inflammation score, was obtained by the CLEIA method from blood collected from each group of atopic dermatitis patients described below. The results are shown in Table 40 and Figures 2 and 3.

[0098] [5] IgE IgE values, which are inflammation scores, were obtained from blood samples taken from each group of atopic dermatitis patients described below by the CLEIA or FEIA method. The results are shown in Table 40.

[0099] [6] WBC, LDH, EOS, and CRP: Blood samples were collected from each group of atopic dermatitis patients, as described below, and the values ​​were obtained by flow cytometry, IFCC standardized method, and latex agglutination turbidimetry. The results are shown in Figure 4.

[0100] [7] Stratification: Atopic dermatitis patients were stratified based on the changes in objective SCORAD scores at six of the seven time points: immediately before treatment (0M), once a month during treatment (1-3M), one month after treatment completion (4M), and two months after treatment completion (5M). The objective SCORAD scores at the six time points were treated as a six-dimensional vector, and hierarchical clustering was performed using the Ward method with cosine similarity. The results are shown in Figure 1. As a result, the atopic dermatitis patients were classified into four groups: the "treatment success group" (Improvement), which indicates a group whose values ​​tended to decrease over time; the "exacerbation group" which indicates a group whose values ​​tended to increase over time; the "recurrence group" which indicates a group whose values ​​tended to decrease once and then increase over time; and the "non-change group" which indicates a group whose values ​​tended to remain almost unchanged over time.

[0101] [8] Isolation of Staphylococcus aureus from Patients with Atopic Dermatitis Swab samples taken from the skin of atopic dermatitis patients and healthy individuals stratified into four groups in Experimental Example 1 immediately prior to the start of bleach bath treatment (0M) were applied to Staphylococcus selective medium (trade name: Mannitol Salt Medium, Nissui Pharmaceutical Co., Ltd.) and cultured at 37°C for 48 hours. Single clones that grew on the medium were selected, with up to 10 colonies selected from each sample, and replated onto tryptic soy agar (TSA). Colonies growing on the medium were confirmed to be Staphylococcus aureus by PCR using femA and femB gene-specific primers (SEQ ID NOs: 174-177). Glycerin stocks were prepared for colonies identified as Staphylococcus aureus.

[0102] These results showed that Staphylococcus aureus was isolated from all four groups of patients with atopic dermatitis.

[0103] Example 1 Genomic and phylogenetic analyses of Staphylococcus aureus derived from patients stratified into the four groups were performed as follows. [1] Extraction of genomic DNA from Staphylococcus aureus. Each strain of Staphylococcus aureus in the glycerin stock was cultured in 1 mL of tryptic soy broth (TSB) at 37°C for 24 hours, then centrifuged to collect the cells. The cells were suspended in 400 μL of CS buffer (10 mM Tris-HCl, 10 mM EDTA, pH 8.0) containing lysostaphin and DNase and incubated at 37°C for 1 hour. 10 μL of 10 mg / mL proteinase K and 50 μL of 10% SDS were added, and the mixture was incubated at 55°C for at least 3 hours. 400 μL of saturated phenol was added, mixed, and centrifuged. The supernatant was then transferred to tube a. Next, 400 μL of phenol / chloroform was added to tube a, mixed, and centrifuged, and the supernatant was transferred to a new tube b. 1 mL of 99% ethanol was added to tube b, mixed, and centrifuged to precipitate DNA. 400 μL of 70% ethanol was added to this, and the mixture was centrifuged to remove the supernatant. The precipitated DNA was dried and dissolved in 50 μL of sterilized Milli-Q water. The DNA concentration was measured using a nanodrop (Thermo Fisher Scientific).

[0104] [2] Short-read genome sequencing of Staphylococcus aureus. Using 100 ng of the purified genomic DNA from each strain of Staphylococcus aureus obtained above, a sequence library was prepared using the TruSeq DNA PCR-Free Sample Preparation Kit (Illumina; FC-121-3003). The concentration of the pooled sequence library was accurately measured by qPCR, and DNA sequencing was performed using the MiSeq System (Illumina; SY-410-1003). Sequencing was performed using the MiSeq Sequence Reagent Kit v2 (600 cycles) (MS-102) in paired-end mode according to the accompanying protocol. As a result, short-read genome sequence data for a total of 901 strains was obtained.

[0105] [3] Short-read assembly: The short-read genome sequence data of 901 strains obtained from the MiSeq system were subjected to removal of Illumina sequencing adapter sequences and low-quality sequences using FASTX Tool Kit (v0.0.13) and Trimmomatic (v0.39). The obtained quality-controlled sequences were then assembled using Unicycler (v0.4.8). The obtained contig sequences were evaluated using CheckM (v1.1.3), BUSCO (v5.1.3), GTDB-Tk (v1.5.0; rs202), and Prokka (v1.14.0). Sequences that satisfy all three of the following criteria (A) to (C) were defined as strains for which the genome sequence of Staphylococcus aureus could be reconstructed: (A) Shows fastANI ≥ 95% homology with known representative genome sequences of Staphylococcus aureus (GTDB-Tk) (B) ≥ 90% completeness and ≤ 10% contamination (CheckM) (C) ≥ 90% core gene conservation (BUSCO) As a result, the genome sequences of 738 strains were reconstructed.

[0106] [4] Phylogenetic Analysis A Mash distance matrix was obtained using Mash (v2.2.2) for a total of 739 strains, including the genome sequences of 738 Staphylococcus aureus strains obtained by the short read assembly and a representative genome sequence of Staphylococcus aureus registered with NCBI (Staphylococcus aureus subsp. Aureus NCTC 8325; RefSeq ID: GCF_000013425.1). A phylogenetic tree was created using the neighbor-joining method based on this distance matrix. Furthermore, a phylogenetic tree was created in the same manner for the genome sequences of 72 strains isolated from 22 patients who underwent bleach bath treatment. The results are shown in Figure 5 and Table 41.

[0107] [5] Comparative Genomic Analysis Of the 72 strains, 58 strains were isolated from patients belonging to the two groups to identify factors derived from Staphylococcus aureus that distinguish between the treatment-responsive and non-susceptible groups. The results are shown in Table 42. Comparative genomic analysis was performed on the 58 isolated strains to identify genes that distinguish the two groups.

[0108]

[0109]

[0110] First, for each genome sequence, gene region prediction was performed using Prodigal (v2.6). For each gene, amino acid sequence information was obtained based on the codon table, and diamond blastp (v2.0.15) was used to annotate genes using four databases: KEGG (2022 / 04 / 19 download), COG (2021 / 05 / 19 download), UNIREF90 (2022 / 05 / 24 download), and PHROGs (2023 / 06 / 19 download). In this case, the thresholds were % identity> 80% and qcovhsp> 80% and e-value< 0.00001. Gene annotations were tallied for each database, and a matrix representing the gene presence status of the 58 strains was created for each database, with a value of 1 if the strain had a certain gene annotation and a value of 0 if it did not. As a result, four gene presence / absence matrices corresponding to each of the four databases were obtained. Using these matrices, a logistic regression analysis was performed based on the following regression equation (1).

[0111]

[0112] In formula (1), y group The two groups, the treatment response group and the non-response group, are divided into x gene indicates the presence or absence of a gene, x age is the age of the patient from whom the isolate was obtained, and x gender represents the sex of the patient from whom the isolate was obtained, and x region represents the body part from which the virus was isolated, and xinflammatory represents the presence or absence of inflammation in the source of the virus. The coefficient β 1A likelihood ratio test was performed on the 81 genes, and a False Discovery Rate of <1% by the Benjamini-Hochberg method was used as the significance level to detect genes that distinguish between the two groups. As a result, a total of 89 genes were detected, as shown in Table 43. Of these 89 genes, 8 genes that were detected in duplicate between databases were excluded, and a total of 81 genes were identified as significant discriminant genes. The results are shown in Figure 6, Tables 41, and Table 44. Table 41 shows the row contents of the cells in the heat map of Figure 6, and Table 44 shows the column contents of the cells in the heat map of Figure 6. Information on these 81 genes is shown in Tables 45 to 47, and representative base sequences (SEQ ID NOs: 1 to 173) of the 81 genes possessed by 72 strains clustered using cd-hit -c 0.95 -s 0.95 -n 5 -G 1 -g 1 are shown in Tables 1 to 39.

[0113]

[0114]

[0115]

[0116]

[0117]

[0118] Of the 81 genes constituting the heat map in FIG. 6, the number of genes possessed by each of the cell lines isolated from the four groups is shown in FIG.

[0119] Furthermore, for the 58 strains isolated from the treatment-response and non-susceptibility groups, a binary matrix based on the presence or absence of 81 genes was created, and hierarchical clustering of the 58 strains and the 81 genes was performed, respectively. Hierarchical clustering was performed using the complete linkage method with Jaccard distance, using an 81-dimensional binary vector for clustering the 58 strains and a 58-dimensional binary vector for clustering the 81 genes. The results are shown in Figure 8. In the figure, rows represent strains (see Table 48) and columns represent genes (see Table 49), and eight gene clusters were defined based on the gene hierarchical tree. Bold white lines represent cluster boundaries, and clusters 1 to 8 (C1 to C8) were defined from the left. As a result, it was revealed that the 58 genes belonging to clusters 3, 4, 5, and 7 were characteristic of the treatment-response group (Improvement).

[0120]

[0121]

[0122] Next, using a similar comparative genomics approach, we compared two of the four groups, for a total of six combinations, to search for genes of Staphylococcus aureus that differed between the groups. The results from PHROGs are shown in Table 50 and Figure 9, and the results from UNIREF90 are shown in Table 51 and Figure 10.

[0123]

[0124]

[0125] For genes detected by analysis using UNIREF90, the gene ontology of each gene was obtained from UNIREF90, converted to Level 4 hierarchy using GO.db (version 3.16.0), and tabulated. The results are shown in Figures 11 to 17.

[0126] [6] Long-read genome sequencing of Staphylococcus aureus Library samples were prepared using 500 ng of the purified genomic DNA obtained in [1] above using a Native barcoding genomic DNA kit (Oxford Nanopore Technologies). The resulting library samples were subjected to concentration measurement using Qubit (Thermo Fisher Scientific) and molecular weight evaluation using Tapestation (Agilent Technology). DNA sequencing was performed using a GridION system (Oxford Nanopore Technologies) with multiplex sequencing using a FLO-MIN114 flow cell to obtain sequence information. As a result, long-read genome sequence data for a total of 10 strains was obtained.

[0127] [7] Hybrid Assembly For the 10 strains for which both long-read and short-read genome sequencing were performed, genome sequences were reconstructed by hybrid assembly combining these data. First, for the short-read data, Illumina sequence adapter sequences and low-quality sequences were removed using fastp (v0.23.4). Random sampling of sequences with a coverage of ×150 was used for the estimated genome length (3 Mbp) of Staphylococcus aureus. Next, quality control of the long-read data was performed using Seqkit (v2.3.1), poreshop (v0.2.4), and filtlong (v0.2.1), and hybrid assembly was performed using Unicycler (v0.4.9). Evaluation was performed using CheckM, BUSCO, GTDB-Tk, and Prokka, as in the case of assembly using only short-read data. As a result, high-quality reconstructed circular genome sequences were obtained for a total of five strains.

[0128] Among these, the locus of the phage gene of SA0462 derived from an atopic dermatitis patient in the treatment success group is shown in Figure 18, and characteristic genes thereof are shown in Figure 19. Similarly, the locus of the phage gene of SA0859 derived from an atopic dermatitis patient in the treatment success group is shown in Figure 20, and characteristic genes thereof are shown in Figure 21.

[0129] The phage gene loci of SA0407, derived from atopic dermatitis patients in the non-susceptible group, are shown in Figure 22, the phage gene loci of SA0537 in Figure 23, and the phage gene loci of SA0538 in Figure 24. No characteristic genes were observed in SA0407, SA0537, and SA0538, derived from atopic dermatitis patients in the non-susceptible group. This indicates that the phage genes were integrated into the autosomes in all of the Staphylococcus aureus isolated from the treatment-successful and non-susceptible groups, suggesting that differences in the structure and insertion site of the phage genes, rather than the presence or absence of the phage, may be related to treatment success.

[0130] [Example 2] Analysis of the skin flora of four groups of atopic dermatitis patients was performed using the following method. [1] Skin flora m16S rRNA sequencing The bacterial cells in the swab sample obtained in Experimental Example 1 were suspended in sterile water and then centrifuged (3,000 × g, 4 minutes, room temperature) to recover the bacterial cells. Genomic DNA of the whole bacterial cells was extracted from the obtained bacterial cells using a Maxwell (registered trademark) RSC Blood DNA Kit [AS1400] (Promega). PCR was performed using the obtained genomic DNA as a template and the following primers. The PCR temperature and cycle conditions were as follows:

[0131] Forward primer: AGRGTTTGATYMTGGCTCAG (SEQ ID NO: 180) Reverse primer: TGCTGCCTCCCGTAGGAGT (SEQ ID NO: 181)

[0132] (a) 96°C, 2 minutes (b) 96°C, 30 seconds (c) 55°C, 45 seconds (d) 72°C, 60 seconds 30 cycles of (b) to (d) (e) 72°C, 10 minutes (f) Hold at 4°C.

[0133] The amplified DNA fragment (approximately 300 bp) encoding the V1-V2 region of 16S rRNA was purified using AMPure (Beckman Coulter). The resulting amplified fragment (amplicon) was subjected to DNA sequencing using the Miseq system (Illumina). Sequencing was performed in paired-end mode using the Miseq Reagent Kit v2 (500-cycle, Illumina) according to the accompanying protocol.

[0134] [2] Skin flora m16S rRNA analysis. The paired-end reads derived from the 16S rRNA were filtered using cutadapt (v1.13) to remove primer sequences, followed by filtering using the filterAndTrim function in the dada2 R package (v1.14.1) under the conditions maxEE = c(2,2) and truncLen = c(200,180). The denoised paired-end reads were merged using dada2, and chimeras were removed using removeBimeraDenovo to create an Amplicon Sequence Variant (ASV) table. The ASV table was normalized to 3,000 reads per sample by random sampling. Taxonomic assignments of each ASV were performed by searching for homology to the Ribosomal Database Project (RDP) (rekaese 11) and the National Center for Biotechnology Information (NCBI) genome database using GLSEARCH (v36.3.8e). This search and assignment were performed based on the database acquired on June 18, 2019. This resulted in a table of the relative abundance of each species in each sample.

[0135] Next, bacterial species with an average relative abundance of 1% or more were extracted from samples from 26 atopic dermatitis patients who underwent bleach bath treatment. At time 0, bacterial species with significantly different abundances among the four groups were detected using a Kruskal-Wallis test and a BH-corrected FDR < 5% criterion. As a result, Staphylococcus aureus, Cutibacterium acnes, and Cutibacterium granulosum were detected. The logarithmic values ​​of the relative abundances of these three bacteria are shown in Figure 25 for each sample collection time point for participants in the bleach bath treatment cohort.

[0136] Example 3: Treatment sensitivity prediction for bleach bath treatment was performed on atopic dermatitis patients who had not received bleach bath treatment using the following method. A machine learning model for discriminating between bleach bath treatment successors was created using three explanatory variables: 81 genes that significantly distinguish between the bleach bath treatment successor and non-susceptible groups, the relative abundance of the three bacterial species that significantly differed in proportion to the bacterial flora among the four groups, and the bacterial load obtained by qPCR in Experimental Example 1. Of the four groups, a two-class classification model was created to stratify the treatment successor and others, and a multi-class classification model was created to stratify the treatment successor, non-susceptible, and others. Random Forest was used for the models. The optimal number of features was determined using tuneRF in the R package randomForest (version 4.7.1.1), and a two-class or three-class logistic regression model was created.

[0137] First, explanatory variables were examined using a two-class classification model. Sixty-seven samples from patients in the bleach bath treatment cohort, in which both skin flora analysis and S. aureus isolation and genomic analysis were performed, were used as training data. The predictive accuracy of this training data was evaluated to identify the types of variables that contribute to bleach bath susceptibility prediction. Seven models were prepared for evaluation: a model using only 81 genes, a model using only the relative abundance of three bacterial species, a model using only bacterial load measured by qPCR, a model using two of these three types of variables, and a model using all three. Model accuracy was evaluated using true positive rate (TPR), false positive rate (FPR), positive predictive value (PPV), F1 score, and accuracy (ACC). Table 52 shows the accuracy evaluation results for these seven models, with the column names indicating the type of variables used. This shows that when a total of 84 variables, consisting of 81 genes and three bacterial species, were used, high accuracy was demonstrated for all indicators.

[0138]

[0139] Table 53 shows the accuracy of multi-class classification using 84 variables, with each column representing the prediction accuracy for the group indicated in the column name. It was shown that classification was possible with the same accuracy as two-class classification.

[0140]

[0141] Next, a multi-class classification model with 84 variables was used to predict bleach bath treatment sensitivity in atopic dermatitis patients who had not received bleach bath treatment. Similar to the accuracy assessment, the training data was 67 samples from patients who participated in the bleach bath treatment cohort. Using the trained model, bleach bath treatment sensitivity prediction was performed on 531 samples (119 individuals) who had not received bleach bath or other systemic treatment. In this case, the Shapley values ​​of each variable in the prediction for each sample were calculated using the R package iml (version 0.11.1), and principal component analysis was performed on the resulting Shapley value matrix. The results are shown in Figures 26 to 31.

[0142] For the 531 samples for which prediction was performed, swabs were collected in the same manner as described above, and the differences in clinical scores between the predicted groups were evaluated using the Wilcoxon Rank Sum Exact Test. Clinical scores were evaluated using SCORAD, objective SCORAD, itch, and TARC. Furthermore, differences between groups were evaluated for 119 patients. Patients predicted to be in the treatment response group in at least one sample were defined as the treatment response predicted group, while patients not classified as the treatment response predicted group were defined as the non-response group in at least one sample, and the rest were defined as others. For each clinical score, only patients who were measured multiple times were analyzed, and the average value of the multiple measurements was used as the patient's clinical score, resulting in a single value for each patient. As with the analysis of each sample, differences between groups were evaluated using the Wilcoxon Rank Sum Exact Test. The significance level for both was set at p-value<0.05. The results are shown in Figures 32 and 33.

[0143] Example 4: A sodium hypochlorite sensitivity test was performed on Staphylococcus aureus from atopic dermatitis patients in the treatment response group and non-susceptible group using the following method. A colony of Staphylococcus aureus was inoculated into TSB medium (product name: Tryptocasein Soy Broth: Fujifilm Wako Pure Chemical Industries, Ltd.) and cultured overnight at 37°C. The OD 600 =1 (approximately 10 9 CFU / mL) and 1.6 x 10 5The mixture was diluted 1:1 and 100 μL was inoculated onto six TSA plates. The bacteria were allowed to settle on the medium by culturing at 37°C for 3-4 hours. Next, tap water was filter-sterilized and warmed to 42°C. Milton (Kyorin Pharmaceutical) was added to this 42°C sterilized water so that the hypochlorous acid concentration was 0.005%, creating a 0.005% hypochlorous acid solution. Of the six TSA plates (product name: Tryptocasein Soy Agar: Fujifilm Wako Pure Chemical Industries) inoculated with the bacteria, three were treated by gently adding 5 mL of 0.005% hypochlorous acid solution to the TSA medium, and the remaining three were left as an untreated group. A total of six TSA plates, including the Milton-treated and Milton-untreated groups, were incubated at 42°C for 15-20 minutes. The liquid on the TSA medium was then discarded, and the dish was left to dry in a clean bench with the lid open. After drying, the dish was cultured overnight at 37°C, the number of colonies was counted, and the ratio of the number of colonies in the Milton-treated group to the number in the Milton-untreated group was calculated. The results are shown in Figure 34.

[0144] [Results] Examination of the skin microbiota of the four groups before bleach bath treatment showed differences in the relative abundance of three bacterial species between the groups, suggesting a correlation between bleach bath treatment and the skin microbiota. In particular, the proportion of Staphylococcus aureus in the skin microbiota was significantly higher in the treatment-response and non-susceptibility groups. Comparison of the genome sequences of S. aureus isolated from the treatment-response and non-susceptibility groups revealed that 81 genes significantly distinguished between the two groups, demonstrating that these 81 genes could be used to identify patients in the bleach bath treatment response group 1 of the four groups. Furthermore, by considering the relative abundance of the three bacterial species Staphylococcus aureus, Cutibacterium acnes, and Cutibacterium granulosum in addition to the 81 genes, bleach bath treatment response groups could be identified with greater accuracy.

Claims

1. A method for determining responsiveness to bleaching therapy, comprising a determination step a) of determining that a subject is responsive to bleaching therapy if bacteria contained in a sample from the subject have one or more base sequences selected from the base sequences set forth in SEQ ID NOs: 1 to 173 and base sequences having 80% or more identity to said base sequences.

2. The method according to claim 1, wherein the base sequence is a base sequence set forth in SEQ ID NOs: 1 to 107 or a base sequence having an identity of 80% or more to said base sequence.

3. The method according to claim 1, further comprising a step of separating bacteria contained in the sample from the subject.

4. The method of claim 1, wherein the subject is a patient with atopic dermatitis.

5. The method of claim 1, wherein the bacterium is Staphylococcus aureus.

6. The method of claim 1, further comprising a determining step (b) of determining that the subject will respond effectively to bleach therapy if the amount of Staphylococcus aureus present in the subject's sample is significantly greater than that of a control group and the amounts of Cutibacterium acnes and Cutibacterium granulosum present in the subject's sample are significantly less than that of the control group.

7. The method of claim 1, wherein the bleaching regimen is a regimen that involves a bath containing 0.0001 to 0.02% sodium hypochlorite, performed 1 to 4 times per week.

8. The method according to claim 1, wherein the bleaching treatment is a treatment in which clothes soaked in a 0.0001 to 0.02% aqueous solution of sodium hypochlorite are worn.

Citation Information

Patent Citations

  • Diagnosis method for atopic dermatitis

    JP2020182435A