Catechol o-methyltransferase inhibitors

Abstract

Dirofilaria immitis (heartworm), is a filarial worm causing dirofilariasis in dogs. We have identified a gene encoding an S-adenosyl-Methionine dependent methyltransferase protein in heartworm, we named DiMT, that has orthologs in other filarial worms. RNAi silencing assays of a gene orthologous to DiMT in Caenorhabditis elegans have shown that knockdown of the orthologous gene is lethal to the worms. We discovered compounds that have an inhibitory effect against the catalytic activity of DiMT protein also consistently have lethal antiparasitic efficacy against the D. immitis microfilariae. Consequently, inhibiting enzymatic activity of DiMT led to the accumulation of catecholamines in the microfilariae which then led to paralysis and death of the parasites.

Description

[0001] CATECHOL O-METHYL TRANSFERASE INHIBITORS

[0002] RELATED APPLICATIONS

[0003] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 639,435, filed April 26, 2024, which is incorporated herein by reference.

[0004] BACKGROUND OF THE INVENTION

[0005] V adenosyl - / .-methionine (SAM)-dependent methyltransferases catalyze methyl transfer reactions. There are several structurally distinct families of SAM-dependent methyltransferases, with each family representing a series of enzymes with structurally similar active sites. Methylation is integral to maintenance of life. For instance, DNA methylation is a prerequisite for gene expression and mutation repair, and subsequent post-translational methylation of expressed proteins modifies their functional activity. Methylation reactions also play important roles in the metabolic inactivation of many molecules that contain an amino functionality. Examples of some well characterized SAM- dependent methyltransferases include: Catechol-O-methyltransferase (COMT) which catalyzes the methylation of catecholamine neurotransmitters leading to their inactivation; Histamine N- methyltransferase that catalyzes inactivation of histamine through methylation; Thiol methyltransferase that detoxifies gut-derived xenobiotics through 5-methylation; and Thiopurine methyltransferase that catalyzes 5-methylation of thiopurine, thiopyrimidines and thiophenols leading to their inactivation.

[0006] Catecholamines including dopamine and serotonin, are expressed in the nematode Caenorhabditis elegans in which they function as neurotransmitters or neuromodulators. However, elevated activity of catecholamines has been shown to inhibit C. elegans" locomotion, pharyngeal pumping and fecundity. Because locomotion and pharyngeal pumping are essential activities for the survival of nematode worms, while fecundity is critical for the production of worm progeny, the catecholamines in nematodes are considered as important modulators of worm activity and survival. Catecholamines are degraded by methylation catalyzed by COMTs. Therefore, the methylation of catecholamines in nematodes would serve to abrogate their deleterious activities in nematode worms.

[0007] Dirofilaria immitis (heartworm), is a filarial worm that infects dogs, which if untreated, leads to death as a result of secondary congestive heart failure. D. immitis is transmitted by mosquitoes and continues to spread across the United States at alarming rates. There is no vaccine, and current drugs in use have only modest effect, and are prone to complications. Therefore, there is urgent need to identify strategies for developing new efficacious and safe drugs for treating D. immitis infection in dogs. SUMMARY

[0008] Herein, we describe the functional characterization of a unique Dirofilaria immitis COMT (DiMT) that has conserved orthologs in other filarial nematodes, but not in mammals. D. immitis, commonly called heartworm, is a mosquito-bome parasitic filarial nematode that causes a fatal disease called dirofilariasis in dogs. Current drugs in use against heartworm have only modest effect. Therefore, in this study, we endeavored to explore the inhibition of the molecular functional activity of DiMT and to explore the implication of its inhibitors for development of novel therapeutics against filarial nematodes.

[0009] Accordingly, this disclosure provides a method for killing parasitic microfilariae comprising: contacting parasitic microfilariae and an inhibitor that specifically inhibits a methyl transferase expressed in the parasitic microfilariae, wherein the parasitic microfilariae are thereby killed.

[0010] This disclosure also provides a method for treating a dog infected with Dirofilaria immitis microfilariae (heartworm), comprising administering a therapeutically effective amount of an inhibitor to a dog infected with heartworm, wherein the inhibitor specifically inhibits catechol O- methyl transferase expressed by a heartworm gene and causes a lethal accumulation of catecholamines in the heartworm, thereby treating the dog infected with the heartworm.

[0011] The invention provides for the use of the compounds or compositions described herein for use in medical therapy. The medical therapy can be treating infections, for example, infections from parasitic microfilariae. The invention also provides for the use of a compound or composition as described herein for the manufacture of a medicament to treat a disease in a mammal, for example, a heartworm infection in dogs. The medicament can include a pharmaceutically acceptable diluent, excipient, or carrier.

[0012] BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The following drawings form part of the specification and are included to further demonstrate certain embodiments or various aspects of the invention. In some instances, embodiments of the invention can be best understood by referring to the accompanying drawings in combination with the detailed description presented herein. The description and accompanying drawings may highlight a certain specific example, or a certain aspect of the invention. However, one skilled in the art will understand that portions of the example or aspect may be used in combination with other examples or aspects of the invention.

[0014] Figure 1A-B. Analysis of Dirofilaria immitis putative catechol-O-methyltransferase (DiMT) amino acid sequence. (A) Multiple sequence alignment of DiMT protein with its orthologs in other filarial nematodes including Brugia malayi (XP 001898718.1), Onchocerca flexuosa (0ZCO7346.1), Loa loa (XP_003138136.1), and Wuchereria bancrofti (VDM10472.1). The catecholamine substrate- binding amino acid residues are boxed, while the 5-adenosyl-L-methionine catalytic site, that is a conserved domain of the AdoMet_MTases superfamily of methyltransferases, is underlined. Asterisks (*) indicate positions with a single, fully conserved residue. (B) Phylogenetic construct showing that DiMT protein sequence and its orthologs in filarial nematodes (B. malayi, O.fexuosa, L. loa and W. bancrofii) are closely related while being distant from catechol -O-methy 1 transferases from mammalian species and other organisms. The phylogeny robustness was assessed using bootstrap resampling of 500 replicates and is depicted by nodal values.

[0015] Figure 2A-B. Predicted 3 -dimensional structure of DiMT protein (UniParc ID. nDi.2.2.2.t06229) and its substrate binding site. (A) The AlphaFold-2 predicted DiMT protein structure with model confidence elaborated by the local distance difference test (pLDDT scores) and representative color codes. Dark blue: very high confidence with pLDDT > 90; sky blue: confident with 90 > pLDDT > 70; yellow: low confidence with 70 > pLDDT > 50; red: very low confidence with pLDDT < 50). (B) Docking prediction of the binding of co-substrate 5-adenosyl-L-methionine (SAM) and substrate (dopamine) to amino acid residues within the DiMT methyltransferase domain, respectively. Docking results were visualized using Discovery Studio visualizer (BIOVIA Discovery Studio 2020 Client). Enlarged views of docked SAM and dopamine at the DiMT catalytic model are depicted on the right. Green dashed lines indicate hydrogen bonds with amino acid residues. The central thick stick green color structure indicates SAM whereas the stick yellow color indicates the dopamine substrate, respectively.

[0016] Figure 3A-D. Analysis of purified recombinant DiMT protein and enzyme kinetics. (A) SDS-PAGE analysis of the nickel affinity column chromatography-purified DiMT protein stained with coomassie blue (Lane M: protein ladder; Lane P: DiMT protein shown as a band of ~33 kDa). (B) Titration of purified recombinant DiMT protein in the MTase-Glo methyltransferase assay for the methylation of dopamine (360 pM) with SAM (30 pM) as methyl donor. (C and D) Enzyme kinetics of DiMT protein on co-substrate SAM and substrate dopamine, respectively. The data shown represent the mean of three independent experiments with standard error bars.

[0017] Figure 4A-B. Analysis of the substrate specificity of DiMT protein catalytic activity. (A) Comparative in silico binding affinities (-kcal / mol) of various methyltransferase substrates at the catalytic site of DiMT protein. (B) In vitro enzymatic activity of DiMT protein using various types of methyltransferase substrates with luminescence as a readout. Activity of DiMT with dopamine as substrate was significantly higher (*P < 0.0001) than those with other non-catecholamine substrates. The data shown is representative of the means from three independent experiments with standard error bars.

[0018] Figure 5A-I. In vitro culture analysis of the effect on live D. immitis microfilariae of varying concentrations of (A) Dimethyl sulfoxide (DMSO), (B) Ivermectin (C) NSC 177383, (D) NSC145612, (E) NSC56410, (F) NSC35676, (G) NSC62709, (H) NSC133100, and (I) NSC87511. At different time points of culture (24, 28, 72, 96, and 120 h post-treatment), 100 microfilariae in each culture were randomly counted, and the percentage of completely immotile microfilariae normalized to the cultures treated with corresponding volumes of DMSO was determined. The data shown represent means of three independent experiments with standard error bars.

[0019] Figure 6A-D. Analysis of the anti -parasite activity of DiMT inhibitors and their molecular interactions with the enzyme. (A) Comparison of the effect of varying concentrations of ivermectin, NSC177383, NSC145612 and NSC56410 on motility of D. immitis microfilariae after 96 h of culture. For each culture, 100 microfilariae were randomly counted, and the percentages of completely immotile microfilariae normalized to cultures treated with corresponding volumes of DMSO were determined. The data shown represent means of three independent experiments with standard error bars. NSC177383 had significantly higher efficacy (*, P < 0.05) than ivermectin at concentrations between 10 and 40 pM. The data shown represent the means from triplicate assays with standard error bars. (B-D) Docking prediction of the binding of (B) NSC145612, (C) NSC177383, and (D) NSC56410 to amino acid residues within the DiMT methyltransferase catalytic domain. Close-up views of the compounds at the DiMT catalytic model with the estimated binding energy are depicted at the bottom of each model. Structure of bound inhibitor is depicted by yellow stick structure with its interacting hydrogen bonds elaborated with green dashes. Red circle: hydrogen atom; Gray circle: carbon atom; Green circle: nitrogen atom).

[0020] Figure 7A-B. The Ramachandran plot of DiMT protein by PROCHECK server. (A) Plotting colors represent phi-psi backbone conformational areas: red represents the most favored regions, brown and yellow represent additional and generously allowed regions, while light-yellow patches represent regions that are not allowed. The sky-blue dots represent (cp, y) angles for each residue of the predicted structure. The a-helical (around 0, -45° and -75°, -45°) and P-sheet (near 135° and 180°) regions are highlighted with red color. Majority of the blue dots amino acid residues lie within the P-sheet and right-handed a-helix regions. (B) The Ramachandran plot statistics reveal that 92.7% of residues he within the most favored region, indicating the reliability of the predicted model.

[0021] Figure 8A-B. Structural topology of the human COMT and DiMT proteins. (A) PDBsum- predicted secondary structural topology of human COMT (PDB code: 3BWM) (SEQ ID NO:9). 3-D structure of human COMT (right side) displaying the arrangement of P-strands (order 3214576) and the overall fold of the enzyme. (B) DiMT protein's structural topology and 3-D structure displaying similar number of P-strands and arrangement of the overall fold of the human COMT protein structure (SEQ ID NO: 10). PyMoL (www.pymol.org) was used to visualize P-strands within the 3- D structure of COMT and DiMT. DETAILED DESCRIPTION

[0022] Dirofilaria immitis is a parasitic filarial worm that causes congestive heart failure in canines. There is no vaccine, and current drugs in use against heartworm have only modest effect and are prone to complications. We identified a gene (herein called DiMT) encoding an 5-adenosyl-L- methionine (SAM)-dependent methyltransferase with orthologs in filarial worms but not in mammals. By in silico analysis, DiMT possesses catalytic sites for binding SAM and catecholamines with high affinity. We expressed and purified recombinant DiMT protein and used it as an enzyme in a series of SAM-dependent methylation assays. DiMT acted specifically as a catechol -O- methyltransferase (COMT), catalyzing the catabolic methylation of dopamine, and depicted Michaelis Menten kinetics on substrate and co-substrate. Among a set of SAM-dependent methyltransferase inhibitors, we identified compounds that bound with high affinity to DiMT’s catalytic sites and inhibited its enzymatic activity. By testing the efficacy of the DiMT inhibitors against D. immitis microfilariae cultured in vitro, we identified three inhibitors that possessed concentration- and time-dependent effect of killing D. immitis microfilariae. Importantly, RNAi silencing of a gene orthologous to DiMT in Caenorhabditis elegans has been shown to be lethal, likely as a result of excessive accumulation of active catecholamines, which is associated with inhibition of worm locomotion, pharyngeal pumping and fecundity. Together, our findings have unveiled DiMT as an essential COMT that is conserved in parasitic filarial nematodes, but is structurally significantly different from mammalian COMTs and, therefore, is a viable molecular drug target for the development of novel drugs against filarial nematode infections.

[0023] Additional information and data that can be used with aspects of the invention described herein is found in the following publication by the inventors: PLoS Negl Trop Dis 18(8): e0012473 and its Supporting Information, which are incorporated herein by reference.

[0024] Definitions.

[0025] The following definitions are included to provide a clear and consistent understanding of the specification and claims. As used herein, the recited terms have the following meanings. All other terms and phrases used in this specification have their ordinary meanings as one of skill in the art would understand. Such ordinary meanings may be obtained by reference to technical dictionaries, such as Hawley ’s Condensed Chemical Dictionary 14thEdition, by R.J. Lewis, John Wiley & Sons, New York, N.Y., 2001.

[0026] References in the specification to "one embodiment", "an embodiment", etc., indicate that the embodiment described may include a particular aspect, feature, structure, moiety, or characteristic, but not every embodiment necessarily includes that aspect, feature, structure, moiety, or characteristic. Moreover, such phrases may, but do not necessarily, refer to the same embodiment referred to in other portions of the specification. Further, when a particular aspect, feature, structure, moiety, or characteristic is described in connection with an embodiment, it is within the knowledge of one skilled in the art to affect or connect such aspect, feature, structure, moiety, or characteristic with other embodiments, whether or not explicitly described.

[0027] The singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a compound" includes a plurality of such compounds, so that a compound X includes a plurality of compounds X. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for the use of exclusive terminology, such as "solely," "only," and the like, in connection with any element described herein, and / or the recitation of claim elements or use of "negative" limitations.

[0028] The term "and / or" means any one of the items, any combination of the items, or all of the items with which this term is associated. The phrases "one or more" and "at least one" are readily understood by one of skill in the art, particularly when read in context of its usage. For example, the phrase can mean one, two, three, four, five, six, ten, 100, or any upper limit approximately 10, 100, or 1000 times higher than a recited lower limit. For example, one or more substituents on a phenyl ring refers to one to five, or one to four, for example if the phenyl ring is disubstituted.

[0029] As will be understood by the skilled artisan, all numbers, including those expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, are approximations and are understood as being optionally modified in all instances by the term "about." These values can vary depending upon the desired properties sought to be obtained by those skilled in the art utilizing the teachings of the descriptions herein. It is also understood that such values inherently contain variability resulting from the standard deviations found in their respective testing measurements. When values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value without the modifier "about" also forms a further aspect.

[0030] The terms "about" and "approximately" are used interchangeably. Both terms can refer to a variation of ± 5%, ± 10%, ± 20%, or ± 25% of the value specified. For example, "about 50" percent can in some embodiments carry a variation from 45 to 55 percent, or as otherwise defined by a particular claim. For integer ranges, the term "about" can include one or two integers greater than and / or less than a recited integer at each end of the range. Unless indicated otherwise herein, the terms "about" and "approximately" are intended to include values, e.g., weight percentages, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, composition, or embodiment. The terms "about" and "approximately" can also modify the endpoints of a recited range as discussed above in this paragraph.

[0031] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges recited herein also encompass any and all possible subranges and combinations of sub-ranges thereof, as well as the individual values making up the range, particularly integer values. It is therefore understood that each unit between two particular units are also disclosed. For example, if 10 to 15 is disclosed, then 11, 12, 13, and 14 are also disclosed, individually, and as part of a range. A recited range (e.g., weight percentages or carbon groups) includes each specific value, integer, decimal, or identity within the range. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art, all language such as "up to", "at least", "greater than", "less than", "more than", "or more", and the like, include the number recited and such terms refer to ranges that can be subsequently broken down into sub-ranges as discussed above. In the same manner, all ratios recited herein also include all sub-ratios falling within the broader ratio. Accordingly, specific values recited for radicals, substituents, and ranges, are for illustration only; they do not exclude other defined values or other values within defined ranges for radicals and substituents. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.

[0032] This disclosure provides ranges, limits, and deviations to variables such as volume, mass, percentages, ratios, etc. It is understood by an ordinary person skilled in the art that a range, such as “number 1” to “number ”, implies a continuous range of numbers that includes the whole numbers and fractional numbers. For example, 1 to 10 means 1, 2, 3, 4, 5, ... 9, 10. It also means 1.0, 1.1, 1.2. 1.3, ... , 9.8, 9.9, 10.0, and also means 1.01, 1.02, 1.03, and so on. If the variable disclosed is a number less than “number 10”, it implies a continuous range that includes whole numbers and fractional numbers less than number 10, as discussed above. Similarly, if the variable disclosed is a number greater than “number 10”, it implies a continuous range that includes whole numbers and fractional numbers greater than number 10. These ranges can be modified by the term “about”, whose meaning has been described above.

[0033] The recitation of a), b), c), ... or i), ii), iii), or the like in a list of components or steps do not confer any particular order unless explicitly stated.

[0034] One skilled in the art will also readily recognize that where members are grouped together in a common manner, such as in a Markush group, the invention encompasses not only the entire group listed as a whole, but each member of the group individually and all possible subgroups of the main group. Additionally, for all purposes, the invention encompasses not only the main group, but also the main group absent one or more of the group members. The invention therefore envisages the explicit exclusion of any one or more of members of a recited group. Accordingly, provisos may apply to any of the disclosed categories or embodiments whereby any one or more of the recited elements, species, or embodiments, may be excluded from such categories or embodiments, for example, for use in an explicit negative limitation. The term "contacting" refers to the act of touching, making contact, or of bringing to immediate or close proximity, including at the cellular or molecular level, for example, to bring about a physiological reaction, a chemical reaction, or a physical change, e.g., in a solution, in a reaction mixture, in vitro, or in vivo.

[0035] An "effective amount" refers to an amount effective to treat a disease, disorder, and / or condition, or to bring about a recited effect. For example, an effective amount can be an amount effective to reduce the progression or severity of the condition or symptoms being treated. Determination of a therapeutically effective amount is well within the capacity of persons skilled in the art. The term "effective amount" is intended to include an amount of a compound described herein, or an amount of a combination of compounds described herein, e.g., that is effective to treat or prevent a disease or disorder, or to treat the symptoms of the disease or disorder, in a host. Thus, an "effective amount" generally means an amount that provides the desired effect.

[0036] Alternatively, the terms "effective amount" or "therapeutically effective amount," as used herein, refer to a sufficient amount of an agent or a composition or combination of compositions being administered which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result can be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, an "effective amount" for therapeutic uses is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in disease symptoms. An appropriate "effective" amount in any individual case may be determined using techniques, such as a dose escalation study. The dose could be administered in one or more administrations. However, the precise determination of what would be considered an effective dose may be based on factors individual to each patient, including, but not limited to, the patient's age, size, type or extent of disease, stage of the disease, route of administration of the compositions, the type or extent of supplemental therapy used, ongoing disease process and type of treatment desired (e.g., aggressive vs. conventional treatment).

[0037] The terms "treating", "treat" and "treatment" include (i) preventing a disease, pathologic or medical condition from occurring (e.g., prophylaxis); (ii) inhibiting the disease, pathologic or medical condition or arresting its development; (iii) relieving the disease, pathologic or medical condition; and / or (iv) diminishing symptoms associated with the disease, pathologic or medical condition. Thus, the terms "treat", "treatment", and "treating" can extend to prophylaxis and can include prevent, prevention, preventing, lowering, stopping or reversing the progression or severity of the condition or symptoms being treated. As such, the term "treatment" can include medical, therapeutic, and / or prophylactic administration, as appropriate.

[0038] As used herein, "subject" or “patient” means an individual having symptoms of, or at risk for, a disease or other malignancy. A patient may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, the patient may include either adults or juveniles (e.g., children). Moreover, patient may mean any living organism, preferably a mammal (e.g., human or non-human) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish and the like. In one embodiment of the methods provided herein, the mammal is a canine such as a dog.

[0039] As used herein, the terms “providing”, “administering,” “introducing,” are used interchangeably herein and refer to the placement of a compound of the disclosure into a subject by a method or route that results in at least partial localization of the compound to a desired site. The compound can be administered by any appropriate route that results in delivery to a desired location in the subject.

[0040] The compound and compositions described herein may be administered with additional compositions to prolong stability and activity of the compositions, or in combination with other therapeutic drugs.

[0041] The terms "inhibit", "inhibiting", and "inhibition" refer to the slowing, halting, or reversing the growth or progression of a disease, infection, condition, or group of cells. The inhibition can be greater than about 20%, 40%, 60%, 80%, 90%, 95%, or 99%, for example, compared to the growth or progression that occurs in the absence of the treatment or contacting.

[0042] The term “substantially” as used herein, is a broad term and is used in its ordinary sense, including, without limitation, being largely but not necessarily wholly that which is specified. For example, the term could refer to a numerical value that may not be 100% the full numerical value. The full numerical value may be less by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, or about 20%.

[0043] Wherever the term “comprising” is used herein, options are contemplated wherein the terms “consisting of’ or “consisting essentially of’ are used instead. As used herein, “comprising” is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of' excludes any element, step, or ingredient not specified in the aspect element. As used herein, "consisting essentially of' does not exclude materials or steps that do not materially affect the basic and novel characteristics of the aspect. In each instance herein any of the terms "comprising", "consisting essentially of' and "consisting of' may be replaced with either of the other two terms. The disclosure illustratively described herein may be suitably practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein.

[0044] This disclosure provides methods of making the compounds and compositions of the invention. The compounds and compositions can be prepared by any of the applicable techniques described herein, optionally in combination with standard techniques of organic synthesis. Many techniques such as etherification and esterification are well known in the art. However, many of these techniques are elaborated in Compendium of Organic Synthetic Methods (John Wiley & Sons, New York), Vol. 1, Ian T. Harrison and Shuyen Harrison, 1971; Vol. 2, Ian T. Harrison and Shuyen Harrison, 1974; Vol. 3, Louis S. Hegedus and Leroy Wade, 1977; Vol. 4, Leroy G. Wade, Jr., 1980; Vol. 5, Leroy G. Wade, Jr., 1984; and Vol. 6; as well as standard organic reference texts such as March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th Ed., by M. B. Smith and J. March (John Wiley & Sons, New York, 2001); Comprehensive Organic Synthesis. Selectivity, Strategy & Efficiency in Modem Organic Chemistry. In 9 Volumes, Barry M. Trost, Editor-in-Chief (Pergamon Press, New York, 1993 printing); Advanced Organic Chemistry, Part B: Reactions and Synthesis, Second Edition, Cary and Sundberg (1983); for heterocyclic synthesis see Hermanson, Greg T., Bioconjugate Techniques, Third Edition, Academic Press, 2013.

[0045] The formulas and compounds described herein can be modified using protecting groups. Suitable amino and carboxy protecting groups are known to those skilled in the art (see for example, Protecting Groups in Organic Synthesis, Second Edition, Greene, T. W., and Wuts, P. G. M., John Wiley & Sons, New York, and references cited therein; Philip J. Kocienski; Protecting Groups (Georg Thieme Verlag Stuttgart, New York, 1994), and references cited therein); and Comprehensive Organic Transformations, Larock, R. C., Second Edition, John Wiley & Sons, New York (1999), and referenced cited therein.

[0046] The term "halo" or "halide" refers to fluoro, chloro, bromo, or iodo. Similarly, the term "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0047] The term "alkyl" refers to a branched or unbranched hydrocarbon having, for example, from 1-20 carbon atoms, and often 1-12, 1-10, 1-8, 1-6, or 1-4 carbon atoms; or for example, a range between 1-20 carbon atoms, such as 2-6, 3-6, 2-8, or 3-8 carbon atoms. As used herein, the term “alkyl” also encompasses a “cycloalkyl”, defined below. Examples include, but are not limited to, methyl, ethyl, 1 -propyl, 2-propyl (Ao-propyl), 1 -butyl, 2-methyl-l -propyl (isobutyl), 2-butyl (secbutyl), 2-methyl-2-propyl (Lbutyl), 1 -pentyl, 2-pentyl, 3 -pentyl, 2-methyl-2-butyl, 3-methyl-2-butyl,

[0048] 3 -methyl- 1 -butyl, 2-methyl-l -butyl, 1 -hexyl, 2-hexyl, 3 -hexyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl,

[0049] 4-methyl-2-pentyl, 3-methyl-3-pentyl, 2-methyl-3 -pentyl, 2,3-dimethyl-2-butyl, 3,3-dimethyl-2-butyl, hexyl, octyl, decyl, dodecyl, and the like. The alkyl can be unsubstituted or substituted, for example, with a substituent described below or otherwise described herein. The alkyl can also be optionally partially or fully unsaturated. As such, the recitation of an alkyl group can include an alkenyl group or an alkynyl group. The alkyl can be a monovalent hydrocarbon radical, as described and exemplified above, or it can be a divalent hydrocarbon radical (i.e., an alkylene).

[0050] An alkylene is an alkyl group having two free valences at a carbon atom or two different carbon atoms of a carbon chain. Similarly, alkenylene and alkynylene are respectively an alkene and an alkyne having two free valences at two different carbon atoms, or an alkenylene can have the two free valences on the same carbon.

[0051] The term "cycloalkyl" refers to cyclic alkyl groups of, for example, from 3 to 10 carbon atoms having a single cyclic ring or multiple condensed rings. Cycloalkyl groups include, by way of example, single ring structures such as cyclopropyl, cyclobutyl, cyclopentyl, cyclooctyl, and the like, or multiple ring structures such as adamantyl, and the like. The cycloalkyl can be unsubstituted or substituted. The cycloalkyl group can be monovalent or divalent and can be optionally substituted as described for alkyl groups. The cycloalkyl group can optionally include one or more cites of unsaturation, for example, the cycloalkyl group can include one or more carbon-carbon double bonds, such as, for example, 1 -cyclopent- 1-enyl, 1 -cyclopent-2-enyl, 1 -cyclopent-3 -enyl, cyclohexyl, 1- cyclohex-l-enyl, 1 -cyclohex-2-enyl, 1 -cyclohex-3 -enyl, and the like.

[0052] The term “heteroatom” refers to any atom in the periodic table that is not carbon or hydrogen. Typically, a heteroatom is O, S, N, P. The heteroatom may also be a halogen, metal or metalloid.

[0053] The term "heterocycloalkyl" or “heterocyclyl” refers to a saturated or partially saturated monocyclic, bicyclic, or polycyclic ring containing at least one heteroatom selected from nitrogen, sulfur, oxygen, preferably from 1 to 3 heteroatoms in at least one ring. Each ring is preferably from 3- to 10-membered, more preferably 4 to 7 membered. Examples of suitable heterocycloalkyl substituents include pyrrolidinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, piperidinyl, piperazinyl, tetrahydropyranyl, morpholinyl, 1,3-diazapanyl, 1,4-diazapanyl, 1 ,4-oxazepanyl, and 1,4- oxathiapanyl. The group may be a terminal group or a bridging group.

[0054] The term "aryl" refers to an aromatic hydrocarbon group derived from the removal of at least one hydrogen atom from a single carbon atom of a parent aromatic ring system. The radical attachment site can be at a saturated or unsaturated carbon atom of the parent ring system. The aryl group can have from 6 to 30 carbon atoms, for example, about 6-10 carbon atoms. The aryl group can have a single ring (e.g., phenyl) or multiple condensed (fused) rings, wherein at least one ring is aromatic (e.g., naphthyl, dihydrophenanthrenyl, fluorenyl, or anthryl). Typical aryl groups include, but are not limited to, radicals derived from benzene, naphthalene, anthracene, biphenyl, and the like. The aryl can be unsubstituted or optionally substituted with a substituent described below. For example, a phenyl moiety or group may be substituted with one or more substituents Rxwhere Rxis at the ortho-, meta-, or / % / ra-position, and X is an integer variable of 1 to 5.

[0055] The term "heteroaryl" refers to a monocyclic, bicyclic, or tricyclic ring system containing one, two, or three aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring. The heteroaryl can be unsubstituted or substituted, for example, with one or more, and in particular one to three, substituents, as described in the definition of "substituted". Typical heteroaryl groups contain 2-20 carbon atoms in the ring skeleton in addition to the one or more heteroatoms, wherein the ring skeleton comprises a 5-membered ring, a 6-membered ring, two 5- membered rings, two 6-membered rings, or a 5 -membered ring fused to a 6-membered ring. Examples of heteroaryl groups include, but are not limited to, 2H-pyrrolyl, 3H-indolyl, 4H- quinolizinyl, acridinyl, benzo[b]thienyl, benzothiazolyl, 0-carbolinyl, carbazolyl, chromenyl, cinnolinyl, dibenzo[b,d]furanyl, furazanyl, furyl, imidazolyl, imidizolyl, indazolyl, indolisinyl, indolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthyridinyl, oxazolyl, perimidinyl, phenanthridinyl, phenanthrolinyl, phenarsazinyl, phenazinyl, phenothiazinyl, phenoxathiinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, thiadiazolyl, thianthrenyl, thiazolyl, thienyl, triazolyl, tetrazolyl, and xanthenyl. In one embodiment the term "heteroaryl" denotes a monocyclic aromatic ring containing five or six ring atoms containing carbon and 1, 2, 3, or 4 heteroatoms independently selected from non-peroxide oxygen, sulfur, and N(Z) wherein Z is absent or is H, O, alkyl, aryl, or (Ci-C6)alkylaryl. In some embodiments, heteroaryl denotes an ortho-fused bicyclic heterocycle of about eight to ten ring atoms derived therefrom, particularly a benzo-derivative or one derived by fusing a propylene, trimethylene, or tetramethylene diradical thereto.

[0056] As used herein, the term "substituted" or “substituent” is intended to indicate that one or more (for example, in various embodiments, 1-10; in other embodiments, 1-6; in some embodiments 1, 2, 3, 4, or 5; in certain embodiments, 1, 2, or 3; and in other embodiments, 1 or 2) hydrogens on the group indicated in the expression using “substituted” (or “substituent”) is replaced with a selection from the indicated group(s), or with a suitable group known to those of skill in the art, provided that the indicated atom’s normal valency is not exceeded, and that the substitution results in a stable compound. Suitable indicated groups include, e.g., alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, hydroxyalkyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, alkanoyl, alkoxycarbonyl, amino, alkylamino, dialkylamino, carboxyalkyl, alkylthio, alkylsulfinyl, and alkylsulfonyl. Substituents of the indicated groups can be those recited in a specific list of substituents described herein, or as one of skill in the art would recognize, can be one or more substituents selected from alkyl, alkenyl, alkynyl, alkoxy, halo, haloalkyl, hydroxy, hydroxyalkyl, aryl, heteroaryl, heterocycle, cycloalkyl, alkanoyl, alkoxycarbonyl, amino, alkylamino, dialkylamino, trifluoromethylthio, difluoromethyl, acylamino, nitro, trifluoromethyl, trifluoromethoxy, carboxy, carboxyalkyl, keto, thioxo, alkylthio, alkylsulfinyl, alkylsulfonyl, and cyano. Suitable substituents of indicated groups can be bonded to a substituted carbon atom include F, Cl, Br, I, OR', OC(O)N(R')2, CN, CF3, OCF3, R', O, S, C(O), S(O), methylenedioxy, ethylenedioxy, N(R')2, SR', SOR', SO2R', SO2N(R')2, SO3R', C(O)R', C(O)C(O)R', C(O)CH2C(O)R', C(S)R', C(O)OR', OC(O)R', C(0)N(R')2, 0C(0)N(R')2, C(S)N(R')2, (CH2)O-2NHC(0)R', N(R')N(R')C(O)R', N(R')N(R')C(O)OR', N(R')N(R')C0N(R')2, N(R')SO2R', N(R')SO2N(R')2, N(R')C(O)OR', N(R')C(O)R', N(R')C(S)R', N(R')C(0)N(R')2, N(R')C(S)N(R')2, N(COR')COR', N(OR')R', C(=NH)N(R')2, C(O)N(OR')R', or C(=NOR')R' wherein R’ can be hydrogen or a carbon-based moiety (e.g., (Ci-Ce)alkyl), and wherein the carbon-based moiety can itself be further substituted. When a substituent is monovalent, such as, for example, F or Cl, it is bonded to the atom it is substituting by a single bond. When a substituent is divalent, such as O, it is bonded to the atom it is substituting by a double bond; for example, a carbon atom substituted with O forms a carbonyl group, C=O.

[0057] Stereochemical definitions and conventions used herein generally follow S.P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., “Stereochemistry of Organic Compounds”, John Wiley & Sons, Inc., New York, 1994. The compounds of the invention may contain asymmetric or chiral centers, and therefore exist in different stereoisomeric forms. It is intended that all stereoisomeric forms of the compounds of the invention, including but not limited to, diastereomers, enantiomers and atropisomers, as well as mixtures thereof, such as racemic mixtures, which form part of the present invention. Many organic compounds exist in optically active forms, i.e., they have the ability to rotate the plane of plane- polarized light. In describing an optically active compound, the prefixes D and L, or R and S. are used to denote the absolute configuration of the molecule about its chiral center(s). The prefixes d and 1 or (+) and (-) are employed to designate the sign of rotation of plane-polarized light by the compound, with (-) or 1 meaning that the compound is levorotatory. A compound prefixed with (+) or d is dextrorotatory. For a given chemical structure, these stereoisomers are identical except that they are mirror images of one another. A specific stereoisomer may also be referred to as an enantiomer, and a mixture of such isomers is often called an enantiomeric mixture. A 50:50 mixture of enantiomers is referred to as a racemic mixture or a racemate (defined below), which may occur where there has been no stereoselection or stereospecificity in a chemical reaction or process.

[0058] The term “ICso” is generally defined as the concentration required to inhibit a specific biological or biochemical function by half, or to kill 50% of the cells in a designated time period, typically 24 hours.

[0059] Statements of the Technology.

[0060] 1. A method for killing parasitic microfilariae comprising: contacting parasitic microfilariae and an inhibitor that specifically inhibits a methyl transferase expressed by a gene in the parasitic microfilariae, wherein the parasitic microfilariae are thereby killed.

[0061] 2. The method of statement 1, wherein the inhibitor specifically inhibits an S-adenosyl methionine dependent methyl transferase expressed by the gene in parasitic microfilariae. 3. The method of statement 1 or 2, wherein the gene does not have orthologs in mammals and / or the gene has orthologs in parasitic microfilariae.

[0062] 4. The method of any one of statements 1-3, wherein the gene is conserved in different parasitic microfilariae.

[0063] 5. The method of any one of statements 1-4, wherein the gene comprises the coding sequence: ATGATTGGTTATTTAATGGATATTTTACATCGACTTTATTATTTCTTATTTGATCGATTAA TACTATATCCATTGCTAAGTTTACTACGCGATAAACTTAATATACGATTCATGAATCTCG GATATCAGCGAAAAGATGATGAAAATTTTCCAGTCTTGGAAAAATTATCCGAAACGGAC AATTGTTGTAAAGCTAATATTACACTTTACGAAAAAGCATTAAATTTATGCCCGAAATAT CCTAATTTTAACGGATTACGATTGCTTGAAGTTGGATGCGGTCAAGGTGGTGGTATCGAA TGGATTTTGAAGGCGCACTCGTTCGCAGTCGTAAATGGTATTGATCCGATCGTAGTCAAT TCATGTTCTGGTAATATTATCAGGGGAAGTGCGGAAAAATTGCCATTTGCTAACAATTCA TTTGATATTATAATAAATATCGAAAGCAGTCATTTATACGGAAATTGCGGGCACTTTTTC TTGGAATGTTCCAGAGTTTTATGTGAAAATGGATTCTTGTGCTGGGCTGATCTTCGCTAT ACTCACCAGTTAGAGGCAACCATGATTGAAGCACAAAAATCCAGCTTAAACTTAATCAC GATGGAAGATATCACAGAACAAGTATTGCGAGGTATTGAATCAACAACAGTAAGATAC GATGCAATGCTTCAAAATGCACCTTATTTTATTCGTCTTTTTCAAAACTCCATTCGGACA ACATATTGCGCACCAGGAACAAAAAGTTATGAAAGACTTCTTAAACATGAAAAAACATA CGTTTGTGCATGCTGGCAAAATCACAAGAGAATCAAAGAGCTTGATTAA (SEQ ID NO: 1), wherein the start codon is ATG and the stop codon is TAA, wherein the start codon and the stop codon are optionally present. In one embodiment, the gene expresses Dirofilaria immitis COMT.

[0064] 6. The method of any one of statements 1-5, wherein the inhibitor specifically inhibits a catechol O-methyl transferase expressed by the gene in parasitic microfilariae.

[0065] 7. The method of statement 6, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal accumulation of catecholamines.

[0066] 8. The method of statement 6 or 7, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal accumulation of dopamine, octopamine, tyramine, serotonin, or a combination thereof.

[0067] 9. The method of any one of statements 6-8, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal inhibition of parasitic microfilariae locomotion, pharyngeal pumping, fecundity, or a combination thereof.

[0068] 10. The method of any one of statements 6-9, wherein the inhibitor has an ICso value of about 10 pM to about 200 pM at an inhibition site of the catechol O-methyl transferase.

[0069] 11. The method of any one of statements 6-10, wherein the inhibitor has an antiparasitic ECso value of about 10 pM to about 40 pM. 12. The method of any one of statements 1-11, wherein the parasitic microfilariae causes dirofilariasis in canines.

[0070] 13. The method of any one of statements 1-12, wherein the parasitic microfilariae comprise Dirofilaria immitis. 14. The method of any one of statements 1-13, wherein the inhibitor is more effective at killing parasitic microfilariae than ivermectin.

[0071] 15. The method of any one of statements 1-14, wherein the inhibitor is any one of compounds shown in Chart 1: Chart 1. Chemical structures of the inhibitors for DiMT enzyme.

[0072] Rifamycin Streptonigrin Tetrahydrooxime

[0073] NSC87511

[0074] Stictic Acid NSC35676 or a derivative or pharmaceutically acceptable salt thereof. 16. A method for treating a dog infected with Dirofilaria immitis microfilariae (heartworm), comprising administering a therapeutically effective amount of an inhibitor to a dog infected with heartworm, wherein the inhibitor specifically inhibits catechol O-methyl transferase expressed by a heartworm gene and causes a lethal accumulation of catecholamines in the heartworm, thereby treating the dog infected with the heartworm.

[0075] 17. The method of statement 16, wherein the compound is [(9E,22Z)-2,15,17-trihydroxy-28-(6- hy droxy-2-methyloxan-3 -yl)imino- 11 -methoxy-3 ,7, 12,14,16,23 -hexamethyl-6,21 ,24,30-tetraoxo- 8,31-dioxa-25-azapentacyclo[24.3.1.14,7.05,29.018,20]hentriaconta-l(29),2,4,9,22,26-hexaen-13-yl] acetate (NSC177383).

[0076] 18. The method of statement 16, wherein the compound is [26-[(dimethylamino)methyl]- 2,15,17,27,29-pentahy droxy- 11 -methoxy-3 ,7, 12,14,16,18,22-heptamethyl-6,23 -dioxo-8,30-dioxa-24- azatetracyclo[23.3.1.14,7.05,28]triaconta-l(29),2,4,9,19,21,25,27-octaen-13-yl] acetate (NSC145612), or any one of the compounds of statement 15.

[0077] 19. The method of statement 16, wherein the compound is (1 l-amino-7-methoxy-5,12-dimethyl- 10,13-dioxo-2,5-diazatetracyclo[7.4.0.02,7.04,6]trideca-l(9),l l-dien-8-yl)methyl carbamate (NSC56410).

[0078] 20. The method of any one of statements 16-19, wherein the gene comprises the coding sequence according to SEQ ID NO: 1.

[0079] 21. The method of statement 16, according to any one of statements 1-15 or statements 17-20.

[0080] Results.

[0081] DiMT coding sequence analysis and phylogeny. The transcript sequence of DiMT from D. immitis retrieved from the WormBase ParaSite with identification number nDi.2.2.2406229 contained an 825 bp coding sequence that translated into a 275 amino acids protein sequence. BLAST search analysis revealed that the DiMT protein sequence has orthologs sequences in other filarial nematodes including Onchocerca flexuosa, Brugia malayi, Loa loa, and Wuchereria bancrofti (with accession numbers 0ZCO7346.1, XP_001898718.1, XP_003138136.1 and VDM10472.1, respectively) that showed 88.32%, 81.92%, 81.55% and 81.55% sequence homology, respectively (Fig. 1A). Corroboratively, phylogenetic analysis demonstrated that DiMT is closely related to its putative catechol-O-methyltransferase (COMT) orthologs in various filarial nematodes but is distant from those in mammalian hosts, including humans and canines (Fig. IB). By homology comparison to mammalian COMTs, DiMT was 23.6 % and 12.2 % similar to human COMT (Accession number A0A7I2V370) and canine COMT (Accession number A0A8C0Z488), respectively.

[0082] In silico modelling of DiMT protein depicts COMT configuration. To determine the 3D- structure of DiMT protein, we performed in silico modelling employing local distance difference test (pLDDT) scores and color codes for residues to delineate the model’s AF2-predicted configuration (Fig. 2A). In the AF2 model, residues with pLDDT > 90 indicated exceptionally high model confidence, whereas residues with pLDDT < 50 showed very low confidence. For the DiMT protein model, the majority of structural residues had pLDDT > 90. The model accuracy was further verified using a Ramachandran plot generated with PROCHECK system which showed that out of 274 amino acid residues, 230 residues (92.7%) were in the most favored region, while 15 residues (6.0%) were in the allowed region (Fig. 7A and 7B). With over 90% of amino acid residues being placed in the most favored region, our findings suggest that the generated model was accurate and reliable. By utilizing the PDBsum protein analysis system, we found that the secondary structure of DiMT protein possesses seven P-strands, with six of them being arranged in parallel, while one was coupled to the C -terminal in the antiparallel direction (Fig. 8B). Importantly, the P-strands of DiMT were ordered in a 3214576 format, consistent with that displayed by the validated human COMT (PDB code: 3BWM) (Fig. 8A). By COAH system analysis, the 3D-structure of DiMT possessed an 5-adenosyl-L- methionine (SAM)-dependent methyltransferase catalytic domain, with residues 58-238 being the ligand binding amino acids (Fig. 2B). Further, by blind docking, SAM and dopamine (a catecholamine substrate) were found to dock at distinct sites in close proximity to each other within the catalytic domain (Fig. 2B) with high binding affinities (kcal / mol) of -9.3, and -6.9, respectively (Table 1) SAM formed hydrogen bonds with Asp-115 and Glu-148 amino acid residues, whereas dopamine formed hydrogen bonds with Arg-36, Met-38, Cys-93, Gln-95, Gly-96, Gly-97, Gly-98 amino acid residues. These findings supported the presence of two separate active sites for substrate and co-substrate, respectively, within the SAM-dependent methyltransferase catalytic domain.

[0083] Table 1. Docking parameters for substrate, co-substrate and inhibitors on DiMT catalytic domain.

[0084] Recombinant DiMT protein possesses COMT catalytic activity. To determine the in vitro enzymatic activity and kinetic parameters of DiMT, we expressed the His-tagged (at c-terminus) recombinant DiMT protein in the PichiaPink eukaryotic expression system and purified it by affinity column chromatography in its native form. Analysis of the purified recombinant by SDS-PAGE showed that the protein was abundantly expressed and gel-fractionated into a band of approximately 33 kDa (Fig. 3A), consistent with its expected molecular weight. To determine the enzymatic activity of the recombinant DiMT protein, we customized the commercial MTase-Glo Methyltransferase Activity Assay kit (Promega) in which we used recombinant DiMT protein as enzyme, SAM as the methyl donor and a catecholamine (dopamine) as substrate. We found that DiMT catalyzed the transfer of a methyl group from SAM to dopamine in a protein concentration-dependent manner, with 90 pg / ml of DiMT in the reaction being optimal (Fig. 3B). Subsequently, kinetic parameters of DiMT on SAM and dopamine were determined by varying the SAM concentration, while maintaining a fixed concentration of dopamine and vice versa. DiMT showed catalytic activities following the Michaelis-Menten kinetics on the substrate dopamine (Fig. 3C) and on the co-substrate SAM (Fig. 3D). The obtained enzyme kinetic parameters of DiMT are summarized in Table 2.

[0085] To determine the substrate specificity of DiMT’s catalytic activity, we initially performed molecular docking using DiMT as a macromolecule and different types of methyltransferase substrates as ligands. Dopamine showed higher binding affinity to the DiMT catalytic domain than non-catecholamine substrates (Octopamine, tyramine, 2-mercaptoethanol, phosphoethanolamine and histamine) (Fig. 4A). Corroboratively, in vitro COMT enzymatic assays using DiMT as enzyme and SAM as co-substrate showed that, while DiMT readily catalyzed the methylation of dopamine, it did not depict catalytic activity for the methylation of non-catecholamine substrates (histamine, 2- mercaptol ethanol and phosphoethanolamine) that are more structurally distant from catecholamines but did show modest activity with octopamine and tyramine that are structurally very similar to catecholamines (Fig. 4B). Collectively, these findings suggest that DiMT has substrate specificity for catecholamines.

[0086] Table 2. DiMT enzyme kinetics on substrate and co-substrate.

[0087] Inhibitors for DiMT enzymatic activity. We have previously reported a set of seven broadspectrum inhibitors for nematode phosphoethanolamine methyltransferases (PMTs). PMTs function by catalyzing the transfer of a methyl group from SAM (co-substrate) to phosphoethanolamine (substrate), which is similar to the COMT catalytic activity, except for the difference in the substrate. Noteworthy, while PMTs are conserved in round worms, there are no orthologs of PMTs in filarial nematodes. Therefore, we screened the 7 PMTs inhibitors (Chart 1) against the activity of DiMT and found that they depicted concentration-dependent inhibition which facilitated the derivation of their inhibitory ICso values against the enzymatic activity of DiMT (Table 3). Table 3. ICso values for the inhibitors of DiMT catalytic activity.

[0088] DiMT inhibitors with efficacy against D. immitis microfilariae. The 7 DiMT inhibitors (Table 3) were next tested for in vitro efficacy against D. immitis microfilariae freshly extracted from dog peripheral blood. In our previous work, we had derived the PMT inhibitors’ cytotoxicity ICso values in mammalian cells. Therefore, for each compound, the highest concentration tested against microfilariae was at least 50% less than the respective compound’s cytotoxicity ICso. Initially, the effect of varying DMSO volumes (solvent used for reconstituting the compounds) on microfilariae were tested. We found that treatment of microfilariae with varying concentrations of DMSO in culture, up to a maximum used in compound-treated cultures (2%, v / v) had no effect on the motility, activity, and survival of microfilariae for 120 h in culture (Fig. 5A). This indicated that DMSO was non-toxic to microfilariae at the concentrations it was used as a solvent for the test compounds. Analysis of the effect of varying concentrations of ivermectin (the positive control drug) depicted both a dose-dependent and time-dependent effect on the inactivation of microfilariae, with 100% completely immotile microfilariae being attained after 120 h of culture with 30 pM of ivermectin (Fig. 5B). Among the 7 compounds tested, 3 (NSC177383, NSC155612, and NSC56410) were found to have inactivation effect against microfilariae. NSC177383 showed the most robust concentrationdependent and time-dependent effect at relatively lower concentrations, with 25 pM making 100% of the microfilariae completely immotile after 120 h of culture (Fig. 5C). Compound NSC145612 also had both concentration-dependent and time-dependent effect, with 50 pM making 100% of the microfilariae being completely immotile after 120 h of culture (Fig. 5D). Compound NSC56410 was found to have a concentration-dependent and time-dependent effect, with 50 pM making 100% of the microfilariae completely immotile after 120 h of culture (Fig. 5E). The rest of the compounds (NSC35676, NSC62709, NSC133100 and NSC87511) had insignificant effect on microfilariae (Fig. 5F-I).

[0089] Because the compound with the highest efficacy (NSC177383) did not show a significant difference in the percentage of immotile microfilariae between 96 h and 120 h time-points (Fig. 5C), data at 96 h post-treatment time point for all compounds was compared in a single plot. The results indicated that compound NSC 177383 was more effective than the positive control drug (ivermectin) in inactivating microfilariae at lower concentrations (Fig. 6A). On the other hand, compounds NSC145612 and NSC56410 were also effective, though at higher concentrations than that of ivermectin (Fig. 6A). Data from this time-point was also used to derive the compounds’ antiparasitic ECso concentrations using nonlinear regression analysis by Graph pad Prism software version 9.0 program. NSC177383 had a lower anti-parasite ECso (11.65 pM) than ivermectin (ECso = 17.61 pM), indicating that it was more efficacious than ivermectin against / ), immitis microtilanae (Table 4). On the other hand, NSC145612 and NSC56410 had anti-parasitie ECso values of 32.16 and 32.15 pM, respectively (Table 4). Based on the cytotoxicity ICso concentrations of NSC177383, NSC145612, NSC56410, and ivermectin in mammalian cells, we derived their Selectivity Indexes (SI). We found that the three test compounds (NSC177383, NSC145612, and NSC56410) all had SI values that were greater than 1 and several-fold larger than that of ivermectin (Table 4). This indicated that NSC177383, NSC145612, and NSC56410 are nontoxic to mammalian cells at their effective concentrations and are significantly more tolerable at higher concentrations than ivermectin. To determine whether the non-motile microfilariae in the treated cultures were dead, after observation at 120 h post-treatment, the test compounds were washed out of the cultures using medium without compounds and cultured for a further 72 h while observing them every 12 h to determine if they showed any sign of motility. Throughout the observation period, the microfilariae remained completely immotile and showed signs of disintegrating, indicating that they were dead, and that the inhibitors had a killing or parasiticidal effect against the microfilariae.

[0090] Table 4. Cytotoxicity ICso, anti-parasitic ECso and Selectivity index values for test compounds. aReported by Zhang et al., (Antimicrob Agents Chemother. 2023; 67: e0000823); bReported by Tan et al., (Front Cell Infect Microbiol. 2021; 11:700502).

[0091] Inhibitors with anti-parasite efficacy bind DiMT catalytic site with high affinity. To determine the molecular interactions between the inhibitors and the DiMT protein’s catalytic domain, we performed molecular docking of the inhibitors with efficacy against D. immitis microfilariae. The ligand-receptor interactions were assessed using binding energy score, and hydrogen bond formation. The lower the number of binding affinity, the stronger the binding interactions. Compounds NSC177383, NSC145612, and NSC56410 were found to bind favorably at the DiMT catalytic domain (Fig. 6B and 6C). NSC145612 bound at the DiMT catalytic domain with the highest binding energy of -14.5 kcal / mol and hydrogen-bonded with residue lys-257 (Fig. 6B). NSC177383 had the second highest binding energy of -14.3 kcal / mol and hydrogen-bonded with residues Asp-177 and Ile-147 (Fig. 6C). NSC56410 had the least binding energy of - 9.9kcal / mol, and hydrogen-bonded with DiMT residues Ile-147, Glu-148, Met-38, Gly-92, and Asp-115 (Fig. 6D). Other docking interactions parameters for the compounds at the catalytic domain of DiMT including pi- cation / anion / alkyl binding are shown in Table 1. Discussion.

[0092] D. immitis is a mosquito-bome filarial nematode that causes a serious and potentially fatal disease in dogs called dirofilariasis. The low efficacy of existing treatments, combined with the growing threat of drug-resistant filarial nematodes, necessitates the urgent development of new anti- filarial treatments. Catecholamines including dopamine and serotonin, are expressed in nematodes and have been shown to function as neurotransmitters or neuromodulators. However, excess amounts of dopamine and serotonin have been shown to inhibit nematode worm locomotion, pharyngeal pumping and fecundity. Locomotion and pharyngeal pumping are essential activities for the survival of nematodes, while fecundity is critical for the production of new progeny,. Therefore, unregulated accumulation of catecholamines in nematodes would be deleterious to worm survival and reproduction. Catabolism of catecholamines in eukaryotic cells is achieved by methylation catalyzed by catechol -( -methy I transferases (COMT). Thus, the COMT-catalyzed methylation of catecholamines in nematodes would serve to abrogate the accumulation of active catecholamines and their deleterious effects on worms.

[0093] Herein, we describe the cloning, functional characterization and validation of a unique COMT (DiMT) as a viable drug molecular target in D. immitis. While COMT activity is also present in mammals, DiMT was selected based on presence of an ortholog in C. elegans that has an RNAi phenotype that is lethal, absence of a significant BLAST match (A- value < 10'5) in the predicted proteomes of Homo sapiens, and predicted function as an enzyme. Those parameters were corroborated by phylogenetic and homology analyses of DiMT that showed that it has conserved orthologs in other parasitic filarial nematodes including B. malayi, L. loa, and O. flexuous, but is very distant from COMTs in mammalian species. Analysis of the DiMT amino acid sequence showed that it possesses a class-I SAM-dependent methyltransferase (SDMT) domain. The class-I SDMT domain fold has been shown to be highly conserved in COMTs, thus qualifying DiMT as a COMT. Importantly, DiMT showed significant disparities from mammalian COMTs, indicating that it can be a viable molecular drug target in parasitic filarial nematodes.

[0094] To gain insights into the molecular structure of DiMT and the configuration of its catalytic sites, we utilized structural bioinformatics tools and resources to predict its 3D structure. The AF2 software that we used has capability to predict protein structures using primary amino acid sequences with appreciable accuracy. Additionally, we employed a robust metric, the pLDDT, which depicted a very high confidence for the location of the amino acid residues within the DiMT structure. The accuracy of the model was corroborated by the use of the Ramachandran plot statistics, which indicated that 92.7% of the residues in the model were located in the favored position. By comparison to the structure of human COMT that has been determined by crystallography, the secondary structure of DiMT depicted a structural fold similar to the one observed in human (PDB code: 3BWM). Further, DiMT exhibits a structural arrangement with seven beta-strands that is a conserved in COMTs. To determine the specific molecular interactions between DiMT and ligands, we performed in silico molecular docking of SAM and dopamine (as co-substrate and substrate, respectively) within the catalytic domain of DiMT. We found that dopamine bound to the glycine- rich G-loop (motif-I) and Asp or Glu-rich D-loop (motif-II) that are highly conserved within the SAM-dependent methyltransferase domain. On the other hand, SAM bound to a distinct but proximal site to that of dopamine, indicating that DiMT protein possesses two functional active sites.

[0095] Collectively, these predicted structural configurations and ligand interactions within DiMT’s catalytic domain strongly indicate that it is indeed a COMT.

[0096] To perform enzymatic functional characterization of DiMT, we used a eukaryotic expression system (Pichia pastoris) that facilitates post-translational protein processing and folding into native functional conformations. Using an in vitro COMT assay in which the natively purified recombinant DiMT protein served as enzyme, the methylation of the substrate (dopamine) was readily catalyzed in an enzyme concentration-dependent manner. Additionally, DiMT protein depicted Michaelis Menten kinetic parameters on the substrate and co-substrate, consistent with an active COMT. Intriguingly, DiMT showed Kmvalue on dopamine that was 3 -fold lower than those reported for mammalian COMTs, suggesting that DiMT has different substrate affinities from those of its mammalian counterparts. Because eukaryotes express several structurally distinct families of SAM-dependent methyltransferases with varied substrates, we endeavored to compare DiMT’s activities on catecholamine and non-catecholamine substrates. While DiMT lacked activity of methylating noncatecholamine methyltransferase substrates (histamine, phosphoethanolamine, and 2- mercaptoethanol), it depicted very high activity for dopamine. Interestingly, DiMT possessed activity for octopamine and tyramine, but those activities were 3 -fold and 6-fold lower than that of dopamine, respectively, which can be attributed to their close structural similarities with dopamine. Intriguingly, by using in silico molecular docking to compare the substrate binding energies at DiMT catalytic site, we found that dopamine had the highest binding affinity followed by octopamine, tyramine, histamine, phosphoethanolamine and 2-mercaptoethanol, in that order, consistent with the observed in vitro enzymatic assay activities. Collectively, those observations underscored the specificity of DiMT as a COMT enzyme with a strict criterion that the substrate must possess a catechol structure.

[0097] Since motility is the most common phenotype used in screening systems for anthelmintic activity, and potent commercially available anthelmintic drugs that induce paralysis of the body wall muscle of nematodes often exert a dose-response on motility, we used a motility assay to evaluate the DiMT inhibitors for efficacy against live D. immitis. Among the 7 inhibitors, we identified NSC177383, NSC145612 and NSC56410 that possessed efficacy against D. immitis microfilariae in a concentration-dependent manner. Among the three, NSC177383 showed an ECso value for killing D. immitis that was about 1.5-fold lower than ivermectin and possessed a Selectivity Index (SI) that was 3.5-folds higher than that of ivermectin, indicating that it had better efficacy at lower tolerable concentrations in mammalian cells. On the other hand, while NSC145612 and NSC56410 both had ECso values against D. immitis microfilariae that were 1.8-fold higher than ivermectin, they still possessed SI values that were 4.4-fold and 2.8-fold than ivermectin, respectively, suggesting that they were more tolerable than ivermectin in mammalian cells.

[0098] By in silico molecular docking of NSC177383, NSC145612 and NSC56410 onto the DiMT protein model, NSC145612 and NSC177383 showed a similar binding affinity that was 1.5-fold stronger than that shown by NSC56410. This suggested that NSC145612 and NSC177383 were more stable in their bound configuration to DiMT which can translate into better inhibitory activity than that of NSC56410. Interestingly, NSC56410 was found to bind to some of the amino acid residues that bound to SAM at the catalytic site of DiMT, indicating that its mode of action is through competing with SAM for binding. On the other hand, while compounds NSC145612 and NSC177383 were found to bind within the catalytic domain of DiMT, they neither bound to SAM nor catecholamine substrate-specific amino acid residues, indicating that their mode of inhibiting DiMT catalytic activity is non-competitive. Non-competitive inhibition patterns are common with bisubstrate enzymes to which DiMT belongs (because it has a catecholamine as substrate and SAM as co-substrate). Importantly, non-competitive inhibitors tend to alter the enzyme’s active site conformation irrespective of its substrate Kmvalues, which in turn affects the enzyme’s activity. Besides the binding affinity, hydrogen bond formation between receptor and ligand can contribute to the stability of the enzyme-ligand complex. All three compounds (NSC177383, NSC145612 and NSC56410) were found to form varying degrees of hydrogen bonds at the DiMT catalytic domain that could have enhanced the stability of the complex.

[0099] The inhibition of DiMT’s catalytic activity of catabolizing catecholamines through methylation would lead to excessive accumulation of active catecholamines in D. immitis microfilariae that would then disrupt cellular homeostasis, arrest pharyngeal pumping and locomotion, leading to death of the worms, as previously shown in the nematode C. elegans. Importantly, NSC177383 and NSC145612 have been shown to possess drug-like properties. NSC177383, also known as tolypomycin-Y, is a natural antibiotic produced by Streptomyces tolypophorus that has strong antimicrobial activities against Gram-positive bacteria in vitro and in vivo and shows low toxicity in mice. NSC145612 and NSC177383, are structurally similar to rifampin and its derivatives that are semisynthetic antibiotics with major activity against mycobacteria.

[0100] Collectively, our findings show that DiMT is an essential COMT that is conserved in parasitic filarial nematodes, but is structurally significantly different from mammalian COMTs and, therefore, is a viable molecular drug target for the development of novel drugs against filarial nematode infections. Pharmaceutical Formulations.

[0101] The compounds described herein can be used to prepare therapeutic pharmaceutical compositions, for example, by combining the compounds with a pharmaceutically acceptable diluent, excipient, or carrier. The compounds may be added to a carrier in the form of a salt or solvate. For example, in cases where compounds are sufficiently basic or acidic to form stable nontoxic acid or base salts, administration of the compounds as salts may be appropriate. Examples of pharmaceutically acceptable salts are organic acid addition salts formed with acids that form a physiologically acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, a-ketoglutarate, and -glycerophosphate. Suitable inorganic salts may also be formed, including hydrochloride, halide, sulfate, nitrate, bicarbonate, and carbonate salts.

[0102] Pharmaceutically acceptable salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid to provide a physiologically acceptable ionic compound. Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example, calcium) salts of carboxylic acids can also be prepared by analogous methods.

[0103] The compounds of the formulas described herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient, in a variety of forms. The forms can be specifically adapted to a chosen route of administration, e.g., oral or parenteral administration, by intravenous, intramuscular, topical or subcutaneous routes.

[0104] The compounds described herein may be systemically administered in combination with a pharmaceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier. For oral administration, compounds can be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or incorporated directly into the food of a patient's diet. Compounds may also be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations typically contain at least 0.1% of active compound. The percentage of the compositions and preparations can vary and may conveniently be from about 0.5% to about 60%, about 1% to about 25%, or about 2% to about 10%, of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions can be such that an effective dosage level can be obtained.

[0105] The tablets, troches, pills, capsules, and the like may also contain one or more of the following: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; and a lubricant such as magnesium stearate. A sweetening agent such as sucrose, fructose, lactose or aspartame; or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring, may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propyl parabens as preservatives, a dye and flavoring such as cherry or orange flavor. Any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.

[0106] The active compound may be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can be prepared in glycerol, liquid polyethylene glycols, triacetin, or mixtures thereof, or in a pharmaceutically acceptable oil. Under ordinary conditions of storage and use, preparations may contain a preservative to prevent the growth of microorganisms.

[0107] Pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions, dispersions, or sterile powders comprising the active ingredient adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and / or antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by agents delaying absorption, for example, aluminum monostearate and / or gelatin.

[0108] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, optionally followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation can include vacuum drying and freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the solution.

[0109] For topical administration, compounds may be applied in pure form, e.g., when they are liquids. However, it will generally be desirable to administer the active agent to the skin as a composition or formulation, for example, in combination with a dermatologically acceptable carrier, which may be a solid, a liquid, a gel, or the like.

[0110] Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina, and the like. Useful liquid carriers include water, dimethyl sulfoxide (DMSO), alcohols, glycols, or water-alcohol / glycol blends, in which a compound can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using a pump-type or aerosol sprayer.

[0111] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses, or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

[0112] Examples of dermatological compositions for delivering active agents to the skin are known to the art; for example, see U.S. Patent Nos. 4,992,478 (Geria), 4,820,508 (Wortzman), 4,608,392 (Jacquet et al.), and 4,559,157 (Smith et al.). Such dermatological compositions can be used in combinations with the compounds described herein where an ingredient of such compositions can optionally be replaced by a compound described herein, or a compound described herein can be added to the composition.

[0113] Useful dosages of the compounds described herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Patent No. 4,938,949 (Borch et al.). The amount of a compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular compound or salt selected but also with the route of administration, the nature of the condition being treated, and the age and condition of the patient, and will be ultimately at the discretion of an attendant physician or clinician.

[0114] In general, however, a suitable dose will be in the range of from about 0.5 to about 100 mg / kg, e.g., from about 10 to about 75 mg / kg of body weight per day, such as 3 to about 50 mg per kilogram body weight of the recipient per day, preferably in the range of 6 to 90 mg / kg / day, most preferably in the range of 15 to 60 mg / kg / day.

[0115] The compound is conveniently formulated in unit dosage form; for example, containing 5 to 1000 mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of active ingredient per unit dosage form. In one embodiment, the invention provides a composition comprising a compound of the invention formulated in such a unit dosage form.

[0116] The compound can be conveniently administered in a unit dosage form, for example, containing 5 to 1000 mg / m2, conveniently 10 to 750 mg / m2, most conveniently, 50 to 500 mg / m2of active ingredient per unit dosage form. The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations.

[0117] The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.

[0118] The compounds described herein can be effective anti-infective agents and have higher potency and / or reduced toxicity as compared to melarsomine. Preferably, compounds of the invention are more potent and less toxic than melarsomine, and / or avoid a potential site of catabolic metabolism encountered with melarsomine, i.e., have a different metabolic profile than melarsomine.

[0119] The invention provides therapeutic methods of treating parasitic infections in a mammal, which involve administering to a mammal having an infection an effective amount of a compound or composition described herein. A mammal includes a primate, human, rodent, canine, feline, bovine, ovine, equine, swine, caprine, bovine and the like.

[0120] The following Examples are intended to illustrate the above invention and should not be construed as to narrow its scope. One skilled in the art will readily recognize that the Examples suggest many other ways in which the invention could be practiced. It should be understood that numerous variations and modifications may be made while remaining within the scope of the invention.

[0121] EXAMPLES

[0122] Example 1. Methods and Materials.

[0123] DiMT gene identification, analysis and phylogeny construction. Using the D. immitis genome data that lists the predicted proteome filtered based on presence of an ortholog in C. elegans that has an RNAi phenotype that is lethal, lacks a significant BLAST match ( / / -value < 10'5) in the predicted proteomes of Homo sapiens, and has predicted function as an enzyme, the DiMT gene coding sequence was retrieved from the WormBase ParaSite (wormbase.sanger.ac.uk) with transcript identification number nDi.2.2.2.t06229. To identify similar sequences BLASTP (blast.ncbi.nlm.nih.gov / Blast.cgi) was performed using DiMT as the query sequence. NCBI CDD and the InterProScan server were used to determine the functional domain and motif of the DiMT protein. To identify the conserved regions, sequence alignments of different SAM-dependent methyltransferases (SDMTs) domain proteins were generated using ClutalW. The phylogenetic analysis was performed using MEGA X version 6.0 followed by phylogenetic reconstructions by the neighbor-joining methods (Parameters: 500 bootstrap replications). Trees were thereafter manually labeled using the MEGA view option.

[0124] Model prediction for DiMT protein. In the absence of a solved 3 -dimensional (3D) structure of DiMT protein, a highly accurate model of the AlphaFold2 (AF2) protein prediction tool (github.com / deepmind / alphafold / AlphaFold.ipynb) was used to predict the structure of the DiMT protein. The coding sequence of the DiMT protein was retrieved from the UniParc database (nDi.2.2.2.t06629) and used as input in the AF2 software. The AF2 software generates a multiple sequence alignment (MSA) by querying various protein sequence databases with the input amino acid sequence, yielding a per-residue local distance difference test (pLDDT) confidence score. The accuracy of the AF2 predicted structure was further evaluated using a Ramachandran plot from PDBsum with the help of a PROCHECK server. Furthermore, binding site amino acid residues of DiMT protein were predicted using the COACH server. For in silico dock simulations, catecholamine (dopamine) and non-catecholamines (octopamine, tyramine, histamine, 2-mercaptoethanol and phosphoethanolamine) were used as ligands. For prediction of co-substrate, 5-adenosyl-E-methionine (SAM) was used as ligand. A blind docking simulation using AutoDock Vina was performed to determine the amino acid residues to which the ligands are bound. The grid box was set as 64x64x64 A with -5.333, -1.306, and 18.333(x, y, z) dimensions. The receptor-ligand interactions were visualized using Discovery Studio 3.0.

[0125] Cloning, expression, and purification of putative DiMT protein. The coding sequence of the DiMT protein (Accession number nDi.2.2.2.t06229) was synthesized by Integrated DNA Technologies (IDT, USA) and supplied cloned in pUCIDT (AMP) vector. Before use, the lyophilized vector was reconstituted in sterile molecular-grade nuclease-free water. The following primers were used for PCR amplification of the coding sequence of DiMT for directional cloning in the pPink-HC expression vector (PichiaPink Expression System, Invitrogen): 5'- GAATTCGCCATGATTGGTTATTTAATGGATATTTTAGATCGACT-3' (Forward primer with the EcoRI restriction site italicized, Kozak sequence underlined, and start codon in bold) (SEQ ID NO: 7) and 5 '-GGE4CCTTAATGATGATGATGATGATGATCAAGCTCTTTGATTC-3 ' (Reverse primer with the Kpnl restriction site italicized, stop codon in bold, and the added C-terminal His-tag underlined) (SEQ ID NO: 8). The recombinant pPink-HC expression vector was sequenced to confirm identity of the DiMT insert followed by transformation into PichiaPink Strain- 1 expression yeast (Pichia pastoris). The transformed PichiaPink were grown on Pichia Adenine Dropout (PAD) agar (Invitrogen) for selecting transformants at 30°C for 3 days. Positive transformant colonies were confirmed by colony PCR using a combination of insert- and vector-specific primers. The positive white colonies were propagated and cryopreserved for protein expression.

[0126] For protein expression, transformed PichiaPink was cultured for 2-3 days (ODeoo of ~4) in 25 mL of MGY medium (1% glycerol; 1.34% YNB, and 0.00004% biotin) at 28°C with shaking. The 25 mL culture was inoculated in 300 mL of fresh MGY medium and cultured for 3 days at 28°C with shaking. Yeast cells were harvested by centrifugation and pellets resuspended in fresh 200 mL MM medium (1.34% YNB; 0.00004% and biotin) containing 0.5% methanol for induction of protein expression. The yeast was cultured at 28°C with shaking and supplementation with 0.5% methanol every 24 h for a total of 3 days. Yeast cells were harvested by centrifugation and pellets stored at - 80°C for protein purification. To purify the recombinant DiMT protein, yeast pellets from -80°C were thawed on ice and resuspended in lysis buffer (300 mM NaCl; 50 mM NaHiPO-i. and 10 mM Imidazole, pH 8.0) supplemented with EDTA-free protease inhibitor cocktail (Thermo Scientific), 600 units of benzonase (EMD Millipore), and 30 kU of lysozyme and incubated for 30 minutes on ice. The suspension was sonicated to lyse the cells and the supernatant collected by centrifugation at 20,000 rpm for 20 minutes at 4°C. Pre- washed 2 ml of Ni-NTA His-bind resin suspension (Novagen) was added to 10 ml of yeast cell extract supernatant and incubated for 2 h at 4°C with agitation. The His-tagged recombinant proteins were purified under native conditions by nickel-affinity chromatography following the resin manufacturer’s instructions (Novagen). The eluted protein was dialyzed overnight using a dialysis buffer containing 10 mM Hepes-KOH (pH 7.8) and 1 mM dithiothreitol. The integrity and purity of the protein was determined using SDS-PAGE. A Qubit 3.0 fluorometer (Life Technologies) was used to quantify protein concentration.

[0127] Enzyme activity and kinetics assays. To determine the enzymatic activity and kinetics, a commercially available MTase-Glo methyltransferase activity assay kit (Promega) was customized for use with DiMT protein as enzyme, SAM as methyl-donor, and dopamine as substrate. Initially, enzyme activity of DiMT was determined using a reaction mixture containing 1.5 pL SAM (final concentration of 30 pM), 1.8 pL dopamine (final concentration 360 pM), and varied concentrations of DiMT purified protein. For all enzymatic experiments, the dialysis buffer was used to make up the final reaction volume to 50 pL. To determine the enzyme kinetics on SAM, a fixed concentration of optimized DiMT protein concentration (90 ng / pL) and dopamine as substrate (360 pM) were used with varying concentrations of SAM (0 to 60 pM). Likewise, to evaluate the enzyme kinetics on dopamine as a substrate, fixed concentrations of DiMT purified protein (90 ng / pL) and SAM (40 pM) were utilized, with varying concentrations of dopamine (0 to 600 pM). A negative control reaction without DiMT protein, but with an equal volume of dialysis buffer was included. The reactions were performed in a flat-bottomed opaque white 96 well plate and incubated at 23 °C for 30 minutes in the dark, following which 12.5 pL of 5x MTase-Glo Reagent was added to each reaction and incubated for a further 30 minutes. Next, 62.5 pL of MTase-Glo Detection Solution was added to each reaction and the plate incubated for 30 minutes at 23 °C in the dark. Luminescence was read using a SpectraMax ID5 Microplate Reader (Molecular Devices, United States) microplate reader. Sample readouts were normalized with the negative control. GraphPAD PRISM v9 software was used to fit the Michaelis-Menten model to the substrate-velocity data to determine the enzymatic kinetic parameters of DiMT. To determine DiMT's substrate specificity, non-catecholamines (octopamine, tyramine, histamine, 2-mercaptoethanol and phosphoethanolamine) were used as substrates in the assay using fixed concentration of DiMT (90 ng / pL), SAM (40 pM) and substrate (300 pM).

[0128] Identification of inhibitors for enzymatic activity of DiMT. To identify inhibitors for DiMT enzymatic activity, an optimized small library of seven natural compounds with inhibitory activity against methyltransferases reported previously (Antimicrob Agents Chemother. 2023; 67: e0000823) was used. The compounds were from the Natural Products Set IV obtained from the National Cancer Institute / Developmental Therapeutics Program Open Chemical Repository. The compounds were reconstituted in DMSO. The test MTase-Glo reaction mixtures consisted of 50 pM test compounds, 40 pM SAM, 400 pM substrate (dopamine), and 90 ng / pL of DiMT protein, with the final volume made up to 50 pL with protein dialysis buffer. The volume of DMSO (test compound solvent) in the reactions was limited to less than 1% (v / v) of the total reaction volume. Positive control reaction mixtures did not contain a test compound but contained an equal volume of DMSO. For negative control reactions, instead of DiMT protein, an equal volume of dialysis buffer was added to the reaction mixture. The MTase-Glo reactions were carried out exactly as stated above. The mean percent inhibition (MPI) of the activity of DiMT by the compounds was derived using the following formula:

[0129] MPI ARLUpositive ARLU compound / ARLU positivex100 where,

[0130] • ARLU positive is the relative luminescence units (RLU) for the positive control reaction minus that of the negative control reaction RLU; and

[0131] • ARLUcompound is the relative RLU value for the reaction with test compound minus the negative control reaction RLU.

[0132] Compounds that showed inhibitory activity against DiMT at the initial 50 pM were further tested at varying concentrations and their half maximal inhibitory concentration (ICso) values derived by applying the non-linear regression analysis curve fit to the mean dose-response data for varying concentrations of each compound using GrahPad PRISM v9.

[0133] Analysis of the effect of DiMT inhibitors against microfilariae of D. immitis. Candidate inhibitors were tested for in vitro efficacy against live D. immitis microfilariae. Specifically, live D. immitis microfilariae were extracted from freshly drawn heparinized blood from a naturally infected dog diagnosed by the Teaching Animal Hospital at the College of Veterinary Medicine, University of Illinois Urbana-Champaign, USA. All experiments involving the use of animals in this study were approved by the University of Illinois Urbana-Champaign Institutional Animal Care and Use Committee under protocol number 21144. About 10 ml of heparinized blood was drawn from the external jugular vein and maintained at 4 °C until use. To confirm the presence of D. immitis microfilariae in the blood, 20 pL of the blood was used to make a wet smear that was then immediately examined under a light microscope using a lOx objective. To purify the live microfilariae, 2 ml of blood was diluted at a ratio of 1:10 with lx eBioscience RBC Lysis Buffer (Multi-species; Thermo Fisher Scientific) and mixed by inverting the tube three times. The mixture was incubated at room temperature for 15 minutes followed by centrifugation at 350 xg at room temperature for 10 minutes. The supernatant was decanted, and the pellet (microfilariae) was resuspended in 20 ml of PBS. After mixing, the suspension was centrifuged at 300 xg for 10 minutes, the supernatant decanted and the microfilariae resuspended in pre-warmed RPMI medium supplemented with 10% fetal calf serum, 2.05 mM 1-glutamine, 1 mM sodium pyruvate, 1.5 g / L sodium bicarbonate, 1% (v / v) penicillin-streptomycin-amphotericin B (Fungizone) (Life Technologies). The microfilariae were seeded at 100 worms per well in 0.5 ml of medium in 24-well plates. For each test inhibitor, three sets of microfilariae cultures were maintained as follows: Negative control wells without inhibitor but containing a volume of DMSO equivalent to that contained in the solution of the reconstituted inhibitor to be tested; Positive control wells treated with ivermectin (Sigma- Aldrich) at varying concentrations as a standard drug; Test wells treated with varying concentrations of the test inhibitors. The cultures were incubated at 37°C with 5% CO2. At time intervals of 24, 48, 72, 96, and 120 h after start of treatment of the cultures, the percentage of immotile microfilariae was determined in each well using an inverted phase contrast light microscope with a heated base. The percentage values of the completely immotile parasites at varying concentrations of the test inhibitor relative to the DMSO-treated cultures were used to derive the antiparasitic half-minimal effective concentrations (ECso) using nonlinear regression analysis by Graph pad Prism software version 9.0 program. To determine if immotile microfilariae in the cultures were dead, at 120 h post-treatment with compounds, the microfilariae were washed 4 times with fresh medium without compound. Briefly, the cultures were transferred to 15 ml conical tubes and centrifuged to pellet the microfilariae. The supernatant was discarded, and the microfilariae resuspended in fresh medium without compound. The wash process was repeated 3 times and the microfilariae were re-seeded in 24 well plates and cultured for a further 72 h with observation every 12 h to determine if they show any sign of motility.

[0134] Molecular docking of inhibitors on DiMT protein. Inhibitor binding affinities and stability on the catalytic sites of DiMT protein were determined by in silico docking using Autodock Vina (Scripps Institute, USA). PubChem database (pubchem.ncbi.nlm.nih.gov) was used to obtain the inhibitors’ 3D structures that were used as ligands for docking using PyMoL and Autodock MGL tools. The predicted DiMT protein structure was prepared as a macromolecule and saved in PDBQT file format. To make the docking amenable, the DiMT protein structure was placed in the Autodock MGL tool, and the water molecules were eliminated. Hydrogen bond interactions in the receptor- ligand complex were elaborated. Finally, Kollman charges were added to exhibit the electrostatic interactions between receptor and ligand. Blind docking with a grid box (64x64x64 A) and the active site center set as -5.333, -1.306, and 18.333 (x, y, z) with a value of 10 for exhaustiveness was employed. Discovery Studio 3.0 was used to visualize and process the receptor-ligand interactions.

[0135] Statistical analyses. All in vitro experiments were performed using 3 technical replicates, and all assays were repeated 3 times using independent biological samples. All statistical analyses were performed using GraphPad PRISM® v9. Normality of data distribution was assessed using Q-Q normal probability plots and the Shapiro-Wilk normality test. Statistical comparisons between the treatment groups and the vehicle control group were done by a non-parametric Kruskal-Wallis test or a parametric one-way analysis of variance (ANOVA) test with the Dunn’s or the Dunnett’s multiple comparison post hoc tests respectively, as appropriate for the data. P values of 0.05 or less were considered significant.

[0136] Abbreviations. The abbreviations used are: COMT, Catechol -G-methy I transferase; DiMT, Dirofilaria immitis methyltransferase; DMSO, dimethyl sulfoxide; MPI, mean percent inhibition; PAD, Pichia adenine dropout; PMT, phosphoethanolamine methyltransferase; RNAi, RNA interference; ARLU, change in relative luminescence units; SAM, S- adenosyl - / .-methionine; SDMT, 5-adenosyl-L-methionine-dependent methyltransferase; SDS-PAGE, Sodium dodecyl sulfate polyacrylamide gel electrophoresis.

[0137] Example 2. Pharmaceutical Dosage Forms.

[0138] The following formulations illustrate representative pharmaceutical dosage forms that may be used for the therapeutic or prophylactic administration of a compound of a formula described herein, a compound specifically disclosed herein, or a pharmaceutically acceptable salt or solvate thereof (hereinafter referred to as 'Compound X'):

[0139] (i) Tablet 1 mg / tablet

[0140] 'Compound X' 100.0

[0141] Lactose 77.5

[0142] Povidone 15.0

[0143] Croscarmellose sodium 12.0

[0144] Microcrystalline cellulose 92.5

[0145] Magnesium stearate 3,0

[0146] 300.0

[0147] (ii) Tablet 2 mg / tablet

[0148] 'Compound X' 20.0

[0149] Microcrystalline cellulose 410.0

[0150] Starch 50.0

[0151] Sodium starch glycolate 15.0

[0152] Magnesium stearate 5,0

[0153] 500.0 (in) Capsule mg / capsule

[0154] 'Compound X' 10.0 Colloidal silicon dioxide 1.5 Lactose 465.5

[0155] Pregelatinized starch 120.0 Magnesium stearate 3,0

[0156] 600.0

[0157] (iv) Injection 1 (1 mg / mL) mg / mL

[0158] 'Compound X' (free acid form) 1.0 Dibasic sodium phosphate 12.0 Monobasic sodium phosphate 0.7 Sodium chloride 4.5

[0159] 1.0 N Sodium hydroxide solution q.s. (pH adjustment to 7.0-7.5) Water for injection q.s. ad 1 mL

[0160] (v) Injection 2 (10 mg / mL) mg / mL

[0161] 'Compound X' (free acid form) 10.0 Monobasic sodium phosphate 0.3 Dibasic sodium phosphate 1.1 Polyethylene glycol 400 200.0 0.1 N Sodium hydroxide solution q.s. (pH adjustment to 7.0-7.5) Water for injection q.s. ad 1 mL

[0162] (vi) Aerosol mg / can

[0163] 'Compound X' 20 Oleic acid 10

[0164] T ri chloromonofluoromethane 5,000 Dichlorodifluoromethane 10,000 Dichlorotetrafluoroethane 5,000

[0165] (vii) Topical Gel 1 wt.%

[0166] 'Compound X' 5% Carbomer 934 1.25% Triethanolamine q.s. (pH adjustment to 5-7) Methyl paraben 0.2% Purified water q.s. to 100g

[0167] (viii) Topical Gel 2 wt.%

[0168] 'Compound X' 5% Methylcellulose 2% Methyl paraben 0.2% Propyl paraben 0.02% Purified water q.s. to 100g (ix) Topical Ointment

[0169] 'Compound X'

[0170] Propylene glycol

[0171] Anhydrous ointment base

[0172] Polysorbate 80

[0173] Methyl paraben

[0174] Purified water

[0175] (x) Topical Cream 1 wt.%

[0176] 'Compound X' 5% White bees wax 10% Liquid paraffin 30% Benzyl alcohol 5% Purified water q.s. to 100g

[0177] (xi ) Topical Cream 2 wt.%

[0178] 'Compound X' 5%

[0179] Stearic acid 10%

[0180] Glyceryl monostearate 3%

[0181] Polyoxyethylene stearyl ether 3%

[0182] Sorbitol 5%

[0183] Isopropyl palmitate 2 %

[0184] Methyl Paraben 0.2%

[0185] Purified water q.s. to 100g

[0186] These formulations may be prepared by conventional procedures well known in the pharmaceutical art. It will be appreciated that the above pharmaceutical compositions may be varied according to well-known pharmaceutical techniques to accommodate differing amounts and types of active ingredient 'Compound X'. Aerosol formulation (vi) may be used in conjunction with a standard, metered dose aerosol dispenser. Additionally, the specific ingredients and proportions are for illustrative purposes. Ingredients may be exchanged for suitable equivalents and proportions may be varied, according to the desired properties of the dosage form of interest.

[0187] While specific embodiments have been described above with reference to the disclosed embodiments and examples, such embodiments are only illustrative and do not limit the scope of the invention. Changes and modifications can be made in accordance with ordinary skill in the art without departing from the invention in its broader aspects as defined in the following claims.

[0188] All publications, patents, and patent documents are incorporated by reference herein, as though individually incorporated by reference. No limitations inconsistent with this disclosure are to be understood therefrom. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention.

Claims

CLAIMSWhat is claimed is:

1. A method for killing parasitic microfilariae comprising: contacting parasitic microfilariae and an inhibitor that specifically inhibits a methyl transferase expressed by a gene in the parasitic microfilariae, wherein the parasitic microfilariae are thereby killed.

2. The method of claim 1, wherein the inhibitor specifically inhibits an S- adenosyl methionine dependent methyl transferase expressed by the gene in parasitic microfilariae.

3. The method of claim 1, wherein the gene does not have orthologs in mammals.

4. The method of claim 1, wherein the gene is conserved in different parasitic microfilariae.

5. The method of claim 1, wherein the gene comprises the coding sequence:ATGATTGGTTATTTAATGGATATTTTACATCGACTTTATTATTTCTTATTTGATCGATTAA TACTATATCCATTGCTAAGTTTACTACGCGATAAACTTAATATACGATTCATGAATCTCGGATATCAGCGAAAAGATGATGAAAATTTTCCAGTCTTGGAAAAATTATCCGAAACGGAC AATTGTTGTAAAGCTAATATTACACTTTACGAAAAAGCATTAAATTTATGCCCGAAATAT CCTAATTTTAACGGATTACGATTGCTTGAAGTTGGATGCGGTCAAGGTGGTGGTATCGAA TGGATTTTGAAGGCGCACTCGTTCGCAGTCGTAAATGGTATTGATCCGATCGTAGTCAAT TCATGTTCTGGTAATATTATCAGGGGAAGTGCGGAAAAATTGCCATTTGCTAACAATTCA TTTGATATTATAATAAATATCGAAAGCAGTCATTTATACGGAAATTGCGGGCACTTTTTC TTGGAATGTTCCAGAGTTTTATGTGAAAATGGATTCTTGTGCTGGGCTGATCTTCGCTAT ACTCACCAGTTAGAGGCAACCATGATTGAAGCACAAAAATCCAGCTTAAACTTAATCAC GATGGAAGATATCACAGAACAAGTATTGCGAGGTATTGAATCAACAACAGTAAGATAC GATGCAATGCTTCAAAATGCACCTTATTTTATTCGTCTTTTTCAAAACTCCATTCGGACA ACATATTGCGCACCAGGAACAAAAAGTTATGAAAGACTTCTTAAACATGAAAAAACATA CGTTTGTGCATGCTGGCAAAATCACAAGAGAATCAAAGAGCTTGATTAA (SEQ ID NO: 1), wherein the start codon is ATG and the stop codon is TAA.

6. The method of claim 1, wherein the inhibitor specifically inhibits a catechol O-methyl transferase expressed by the gene in parasitic microfilariae.500.157W01UIUC2022-115-02(PCT)7. The method of claim 6, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal accumulation of catecholamines.

8. The method of claim 6, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal accumulation of dopamine, octopamine, tyramine, serotonin, or a combination thereof.

9. The method of claim 6, wherein inhibition of catechol O-methyl transferase by the inhibitor causes a lethal inhibition of parasitic microfdariae locomotion, pharyngeal pumping, fecundity, or a combination thereof.

10. The method of claim 6, wherein the inhibitor has an ICso value of about 10 pM to about 200 pM at an inhibition site of the catechol O-methyl transferase.

11. The method of claim 6, wherein the inhibitor has an antiparasitic ECso value of about 10 pM to about 40 pM.

12. The method of claim 1, wherein the parasitic microfilariae causes dirofilariasis in canines.

13. The method of claim 1, wherein the parasitic microfilariae comprise Dirofilaria immitis.

14. The method of claim 1, wherein the inhibitor is more effective at killing parasitic microfilariae than ivermectin.

15. The method of claim 1, wherein the inhibitor is:36500.157W01UIUC2022-115-02(PCT)or a derivative or pharmaceutically acceptable salt thereof.

16. A method for treating a dog infected with Dirofilaria immitis microfilariae (heartworm), comprising administering a therapeutically effective amount of an inhibitor to a dog infected with heartworm, wherein the inhibitor specifically inhibits catechol O-methyl transferase expressed by a heartworm gene and causes a lethal accumulation of catecholamines in the heartworm, thereby treating the dog infected with the heartworm.

17. The method of claim 16, wherein the compound is [(9E,22Z)-2,15,17-trihydroxy-28-(6- hy droxy-2-methyloxan-3 -yl)imino- 11 -methoxy-3 ,7, 12,14,16,23 -hexamethyl-6,21 ,24,30-tetraoxo- 8,31-dioxa-25-azapentacyclo[24.3.1.14,7.05,29.018,20]hentriaconta-l(29),2,4,9,22,26-hexaen-13-yl] acetate (NSC177383).

18. The method of claim 16, wherein the compound is [26-[(dimethylamino)methyl]-2,15,17,27,29-pentahy droxy- 11 -methoxy-3 ,7, 12,14,16,18,22-heptamethyl-6,23 -dioxo-8,30-dioxa-24- azatetracyclo[23.3.1.14,7.05,28]triaconta-l(29),2,4,9,19,21,25,27-octaen-13-yl] acetate (NSC145612).

19. The method of claim 16, wherein the compound is (1 l-amino-7-methoxy-5,12-dimethyl- 10,13-dioxo-2,5-diazatetracyclo[7.4.0.02, 7.04, 6]trideca-l (9), l l-dien-8-yl)methyl carbamate (NSC56410).

20. The method of claim 16, wherein the gene comprises the coding sequence according to SEQ ID NO: 1.37500.157W01UIUC2022-115-02(PCT)

Images