Tumor vaccine and use thereof

Abstract

A tumor vaccine for treating esophageal squamous cell carcinoma and other cancers, and a composition thereof. Specifically, provided is a polypeptide, which contains one or more antigen fragments selected from: ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10 and MAGEA11, wherein the one or more antigen fragments are linked via a linker peptide, and the antigen fragments contain one or more antigenic epitope peptides. Furthermore, provided are a linear epitope peptide, a nucleic acid encoding the polypeptide and the linear epitope peptide, and the use of the polypeptide or the linear epitope peptide in the preparation of a drug for preventing or treating cancers such as esophageal squamous cell carcinoma.

Description

A tumor vaccine and application thereof

[0001] Priority

[0002] This application claims the benefit of and priority to PCT International Application No. PCT / CN2024 / 090619, filed April 29, 2024, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present disclosure belongs to the field of biotechnology, and particularly relates to a tumor vaccine and application thereof. BACKGROUND

[0004] Tumor is an important disease affecting human health, and has become the second largest cause of death worldwide. Tumor treatment mainly includes traditional surgical treatment, radiotherapy, chemotherapy and new treatment methods such as targeted therapy and immunotherapy developed rapidly in recent years. Although existing immunotherapy has achieved remarkable results in the field of tumor treatment, tumor vaccines have their unique advantages, such as tumor vaccines can target intracellular antigens in addition to tumor-specific surface antigens, and can even induce new tumor-specific T cell responses. However, the number of clinical trials of cancer vaccines currently carried out is limited, and their therapeutic effects and detailed and explicit principles need to be further explored and confirmed by researchers.

[0005] Due to the heterogeneity of tumors, how to screen broad-spectrum universal antigens is a major scientific and technological problem faced in the design of mRNA vaccines. The key to the design of tumor vaccines is to select appropriate tumor antigens and epitopes, improve the safety and immunogenicity of the vaccine, and effectively stimulate the immune response of the body to produce an anti-tumor effect. Solid tumors have high heterogeneity, and theoretically, tumor vaccines designed based on a multi-antigen target strategy can induce more extensive specific T cell responses and overcome immune escape caused by antigen deficiency or loss, and their clinical efficacy potential is superior to that of single-target vaccines. mRNA vaccines can encode multiple antigens, and when multiple epitopes are linked in series, they can more fully demonstrate their technical advantages.

[0006] SUMMARY

[0007] The present disclosure provides a polypeptide comprising one or more targeting antigen fragments, the antigen fragments comprising one or more antigen epitope peptides, and the one or more antigen fragments being connected by a connecting peptide, wherein the antigen is selected from one or more of ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10, and MAGEA11.

[0008] In some embodiments, the antigen further comprises one or more of TP53.175R / H, TP53.220Y / C, PIK3CA.545E / K, and KRAS.12G / D.

[0009] In some embodiments, the antigen fragment comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-162.

[0010] In some embodiments, the polypeptide comprises 20 antigen fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-127.

[0011] In some embodiments, the polypeptide comprises 20 antigen fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 128-147.

[0012] In some embodiments, the polypeptide comprises 15 antigen fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 148-162.

[0013] In some embodiments, the antigen epitope peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-107 or SEQ ID NOs: 163-225.

[0014] In some embodiments, the polypeptide comprises:

[0015] (1) an antigen epitope peptide targeting ACTL8, the antigen epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 3 or 7;

[0016] (2) an antigen epitope peptide targeting SMC1B, the antigen epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 28;

[0017] (3) an antigen epitope peptide targeting FOXI3, the antigen epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 12;

[0018] (4) an antigen epitope peptide targeting GNGT1, the antigen epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 13;

[0019] (5) an antigen epitope peptide targeting PLAC1, the antigen epitope peptide comprising:

[0020] (i) an amino acid sequence set forth in SEQ ID NO: 23 or SEQ ID NO: 163;

[0021] (ii) the amino acid sequence represented by SEQ ID NO: 164; and

[0022] (iii) the amino acid sequence represented by SEQ ID NO: 165;

[0023] (6) an antigenic epitope peptide targeting BRDT, the antigenic epitope peptide comprising the amino acid sequence represented by SEQ ID NO: 9;

[0024] (7) an antigenic epitope peptide targeting MAGEA1, the antigenic epitope peptide comprising the amino acid sequence represented by SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, or SEQ ID NO: 169;

[0025] (8) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising:

[0026] (i) the amino acid sequence represented by SEQ ID NO: 19, SEQ ID NO: 70, SEQ ID NO: 170, SEQ ID NO: SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and

[0027] (ii) the amino acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, or SEQ ID NO: 176;

[0028] (9) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising:

[0029] (i) the amino acid sequence represented by SEQ ID NO: 177, SEQ ID NO: 178, or SEQ ID NO: 179; and

[0030] (ii) the amino acid sequence represented by SEQ ID NO: 180;

[0031] (10) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising:

[0032] (i) the amino acid sequence represented by SEQ ID NO: 181, SEQ ID NO: 182, or SEQ ID NO: 183; and

[0033] (ii) the amino acid sequence represented by SEQ ID NO: 184;

[0034] (11) an antigenic epitope peptide targeting MAGEA11, comprising:

[0035] (i) an amino acid sequence set forth in SEQ ID NO: 185, SEQ ID NO: 186, or SEQ ID NO: 187; and

[0036] (ii) an amino acid sequence set forth in SEQ ID NO: 15, SEQ ID NO: 188, or SEQ ID NO: 189;

[0037] (12) an antigenic epitope peptide targeting MAGEA10, comprising:

[0038] (i) an amino acid sequence set forth in SEQ ID NO: 14, SEQ ID NO: 190, SEQ ID NO: 191, or SEQ ID NO: 192; and

[0039] (ii) an amino acid sequence set forth in SEQ ID NO: 193, or SEQ ID NO: 194;

[0040] (13) an antigenic epitope peptide targeting TP53.175R / H, comprising an amino acid sequence set forth in SEQ ID NO: 195; and

[0041] (14) an antigenic epitope peptide targeting TP53.220Y / C, comprising an amino acid sequence set forth in SEQ ID NO: 196.

[0042] In some embodiments, the polypeptide comprises:

[0043] (1) an antigenic epitope peptide targeting SMC1B, comprising:

[0044] (i) an amino acid sequence set forth in SEQ ID NOs: 93, SEQ ID NOs: 101, or SEQ ID NOs: 106; and

[0045] (ii) an amino acid sequence set forth in SEQ ID NOs: 104;

[0046] (2) an antigenic epitope peptide targeting BRDT, comprising:

[0047] (i) an amino acid sequence set forth in SEQ ID NO: 42, or SEQ ID NO: 46; and

[0048] (ii) an amino acid sequence set forth in SEQ ID NO: 50;

[0049] (3) an antigenic epitope peptide targeting GNGT1, comprising an amino acid sequence set forth in SEQ ID NO: 54 and SEQ ID NO: 55;

[0050] (4) an antigenic epitope peptide targeting FOXI3, comprising an amino acid sequence set forth in SEQ ID NO: 53;

[0051] (5) an antigenic epitope peptide targeting ACTL8, comprising an amino acid sequence set forth in SEQ ID NO: 40 and SEQ ID NO: 31;

[0052] (6) an antigenic epitope peptide targeting MAGEA6, comprising:

[0053] (i) an amino acid sequence set forth in SEQ ID NO: 73 or SEQ ID NO: 78; and

[0054] (ii) an amino acid sequence set forth in SEQ ID NO: 74;

[0055] (7) an antigenic epitope peptide targeting MAGEA11, comprising an amino acid sequence set forth in SEQ ID NO: 59 and SEQ ID NO: 60;

[0056] (8) an antigenic epitope peptide targeting MAGEA3, comprising an amino acid sequence set forth in SEQ ID NO: 197 and SEQ ID NO: 65;

[0057] (9) an antigenic epitope peptide targeting MAGEA4, comprising an amino acid sequence set forth in SEQ ID NO: 71 and SEQ ID NO: 72;

[0058] (10) an antigenic epitope peptide targeting MAGEA10, comprising an amino acid sequence set forth in SEQ ID NO: 57;

[0059] (11) an antigenic epitope peptide targeting MAGEA1, comprising:

[0060] (i) an amino acid sequence set forth in SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO: 198; and

[0061] (ii) an amino acid sequence set forth in SEQ ID NO: 199, SEQ ID NO: 200, or SEQ ID NO: 201;

[0062] (12) an antigenic epitope peptide targeting PIK3CA.545E / K, comprising an amino acid sequence set forth in SEQ ID NO: 202; and

[0063] (13) an antigenic epitope peptide targeting KRAS.12G / D, comprising an amino acid sequence set forth in SEQ ID NO: 203.

[0064] In some embodiments, the polypeptide comprises:

[0065] (1) an antigenic epitope peptide targeting ACTL8, comprising:

[0066] (i) an amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; and

[0067] (ii) an amino acid sequence set forth in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 34, or SEQ ID NO: 40;

[0068] (2) an antigenic epitope peptide targeting GNGT1, comprising:

[0069] (i) an amino acid sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 54; and

[0070] (ii) an amino acid sequence set forth in SEQ ID NO: 55;

[0071] (3) an antigenic epitope peptide targeting MAGEA1, comprising:

[0072] (i) an amino acid sequence set forth in SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, or SEQ ID NO: 219; and

[0073] (ii) an amino acid sequence represented by any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 220, SEQ ID NO: 221, or SEQ ID NO: 222;

[0074] (4) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising:

[0075] (i) an amino acid sequence represented by SEQ ID NO: 208 or SEQ ID NO: 77;

[0076] (ii) an amino acid sequence represented by SEQ ID NO: 180 or SEQ ID NO: 223; and

[0077] (iii) an amino acid sequence represented by SEQ ID NO: 209;

[0078] (5) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising:

[0079] (i) an amino acid sequence represented by SEQ ID NO: 67;

[0080] (ii) an amino acid sequence represented by any one of SEQ ID NO: 210, SEQ ID NO: 211, or SEQ ID NO: 212;

[0081] (iii) an amino acid sequence represented by SEQ ID NO: 213; and

[0082] (iv) an amino acid sequence represented by SEQ ID NO: 184 or SEQ ID NO: 65;

[0083] (6) an antigenic epitope peptide targeting SMC1B, the antigenic epitope peptide comprising:

[0084] (i) an amino acid sequence represented by any one of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 185, SEQ ID NO: 94, SEQ ID NO: 105, SEQ ID NO: 95, or SEQ ID NO: 89;

[0085] (ii) an amino acid sequence represented by SEQ ID NO: 81 or SEQ ID NO: 99; and

[0086] (iii) the amino acid sequence represented by SEQ ID NO: 27 or SEQ ID NO: 80;

[0087] (7) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising:

[0088] (i) the amino acid sequence represented by SEQ ID NO: 70, SEQ ID NO: 19, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and

[0089] (ii) the amino acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, or SEQ ID NO: 214;

[0090] (8) an antigenic epitope peptide targeting MAGEA11, the antigenic epitope peptide comprising the amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 58, or SEQ ID NO: 60;

[0091] (9) an antigenic epitope peptide targeting BRDT, the antigenic epitope peptide comprising the amino acid sequence represented by SEQ ID NO: 11, SEQ ID NO: 43, or SEQ ID NO: 45.

[0092] In some embodiments, the polypeptide comprises an amino acid sequence as represented by SEQ ID NO: 226, SEQ ID NO: 227, or SEQ ID NO: 228.

[0093] In one specific embodiment, the polypeptide of the present disclosure comprises 20 antigenic fragments, the one or more antigenic fragments are connected by a connecting peptide, wherein the antigenic fragments are respectively selected from ACTL8, SMC1B, FOXI3, GNGT1, PLAC1, BRDT, MAGEA1, MAGEA4, MAGEA6, MAGEA3, MAGEA11, MAGEA10, TP53.175R / H, and TP53.220Y / C represented by SEQ ID NOs: 108-127, and the antigenic fragments comprise one or more antigenic epitope peptides, the antigenic epitope peptides are:

[0094] (1) an antigenic epitope peptide targeting ACTL8, the antigenic epitope peptide comprising the amino acid sequence represented by SEQ ID NO: 3 or 7;

[0095] (2) an antigenic epitope peptide targeting SMC1B, comprising an amino acid sequence set forth in SEQ ID NO: 28;

[0096] (3) an antigenic epitope peptide targeting FOXI3, comprising an amino acid sequence set forth in SEQ ID NO: 12;

[0097] (4) an antigenic epitope peptide targeting GNGT1, comprising an amino acid sequence set forth in SEQ ID NO: 13;

[0098] (5) an antigenic epitope peptide targeting PLAC1, comprising:

[0099] (i) an amino acid sequence set forth in SEQ ID NO: 23 or SEQ ID NO: 163;

[0100] (ii) an amino acid sequence set forth in SEQ ID NO: 164; and

[0101] (iii) an amino acid sequence set forth in SEQ ID NO: 165;

[0102] (6) an antigenic epitope peptide targeting BRDT, comprising an amino acid sequence set forth in SEQ ID NO: 9;

[0103] (7) an antigenic epitope peptide targeting MAGEA1, comprising an amino acid sequence set forth in SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, or SEQ ID NO: 169;

[0104] (8) an antigenic epitope peptide targeting MAGEA4, comprising:

[0105] (i) an amino acid sequence set forth in SEQ ID NO: 19, SEQ ID NO: 70, SEQ ID NO: 170, SEQ ID NO: SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and

[0106] (ii) an amino acid sequence set forth in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, or SEQ ID NO: 176;

[0107] (9) an antigenic epitope peptide targeting MAGEA6, comprising:

[0108] (i) the amino acid sequence set forth in SEQ ID NO: 177, SEQ ID NO: 178, or SEQ ID NO: 179; and

[0109] (ii) the amino acid sequence set forth in SEQ ID NO: 180;

[0110] (10) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising:

[0111] (i) the amino acid sequence set forth in SEQ ID NO: 181, SEQ ID NO: 182, or SEQ ID NO: 183; and

[0112] (ii) the amino acid sequence set forth in SEQ ID NO: 184;

[0113] (11) an antigenic epitope peptide targeting MAGEA11, the antigenic epitope peptide comprising:

[0114] (i) the amino acid sequence set forth in SEQ ID NO: 185, SEQ ID NO: 186, or SEQ ID NO: 187; and

[0115] (ii) the amino acid sequence set forth in SEQ ID NO: 15, SEQ ID NO: 188, or SEQ ID NO: 189;

[0116] (12) an antigenic epitope peptide targeting MAGEA10, the antigenic epitope peptide comprising:

[0117] (i) the amino acid sequence set forth in SEQ ID NO: 14, SEQ ID NO: 190, SEQ ID NO: 191, or SEQ ID NO: 192; and

[0118] (ii) the amino acid sequence set forth in SEQ ID NO: 193, or SEQ ID NO: 194;

[0119] (13) an antigenic epitope peptide targeting TP53.175R / H, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 195; and

[0120] (14) an antigenic epitope peptide targeting TP53.220Y / C, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 196.

[0121] In one specific embodiment, the antigen comprises the amino acid sequence set forth in SEQ ID NO: 226.

[0122] In one specific embodiment, the polypeptide described in the present disclosure comprises 20 antigen fragments, which are connected by a connecting peptide between the one or more antigen fragments, wherein the antigen fragments are respectively selected from SMC1B, BRDT, GNGT1, FOXI3, ACTL8, MAGEA6, MAGEA11, MAGEA3, MAGEA4, MAGEA10, MAGEA1, PIK3CA.545E / K and KRAS.12G / D shown in SEQ ID NOs: 128-147, and the antigen fragments comprise one or more antigen epitope peptides, which are:

[0123] (1) an antigen epitope peptide targeting SMC1B, which comprises:

[0124] (i) an amino acid sequence shown in SEQ ID NOs: 93, SEQ ID NOs: 101 or SEQ ID NOs: 106; and

[0125] (ii) an amino acid sequence shown in SEQ ID NO: 104;

[0126] (2) an antigen epitope peptide targeting BRDT, which comprises:

[0127] (i) an amino acid sequence shown in SEQ ID NO: 42 or SEQ ID NO: 46; and

[0128] (ii) an amino acid sequence shown in SEQ ID NO: 50;

[0129] (3) an antigen epitope peptide targeting GNGT1, which comprises an amino acid sequence shown in SEQ ID NO: 54 and SEQ ID NO: 55;

[0130] (4) an antigen epitope peptide targeting FOXI3, which comprises an amino acid sequence shown in SEQ ID NO: 53;

[0131] (5) an antigen epitope peptide targeting ACTL8, which comprises an amino acid sequence shown in SEQ ID NO: 40 and SEQ ID NO: 31;

[0132] (6) an antigen epitope peptide targeting MAGEA6, which comprises:

[0133] (i) an amino acid sequence shown in SEQ ID NO: 73 or SEQ ID NO: 78; and

[0134] (ii) an amino acid sequence shown in SEQ ID NO: 74;

[0135] (7) an antigenic epitope peptide targeting MAGEA11, comprising the amino acid sequences set forth in SEQ ID NO: 59 and SEQ ID NO: 60;

[0136] (8) an antigenic epitope peptide targeting MAGEA3, comprising the amino acid sequences set forth in SEQ ID NO: 197 and SEQ ID NO: 65;

[0137] (9) an antigenic epitope peptide targeting MAGEA4, comprising the amino acid sequences set forth in SEQ ID NO: 71 and SEQ ID NO: 72;

[0138] (10) an antigenic epitope peptide targeting MAGEA10, comprising the amino acid sequence set forth in SEQ ID NO: 57;

[0139] (11) an antigenic epitope peptide targeting MAGEA1, comprising:

[0140] (i) the amino acid sequence set forth in SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO: 198; and

[0141] (ii) the amino acid sequence set forth in SEQ ID NO: 199, SEQ ID NO: 200, or SEQ ID NO: 201;

[0142] (12) an antigenic epitope peptide targeting PIK3CA.545E / K, comprising the amino acid sequence set forth in SEQ ID NO: 202; and

[0143] (13) an antigenic epitope peptide targeting KRAS.12G / D, comprising the amino acid sequence set forth in SEQ ID NO: 203.

[0144] In one specific embodiment, the polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 227.

[0145] In one specific embodiment, the polypeptide of the present disclosure comprises 15 antigen fragments, which are connected by a connecting peptide between the one or more antigen fragments, wherein the antigen fragments are respectively ACTL8, GNGT1, MAGEA1, MAGEA6, MAGEA3, SMC1B, MAGEA4, MAGEA11, and BRDT selected from the group consisting of the amino acid sequences set forth in SEQ ID NOs: 148-162, and the antigen fragments comprise one or more antigenic epitope peptides, which are:

[0146] (1) an antigenic epitope peptide targeting ACTL8, the antigenic epitope peptide comprising:

[0147] (i) an amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; and

[0148] (ii) an amino acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 34, or SEQ ID NO: 40;

[0149] (2) an antigenic epitope peptide targeting GNGT1, the antigenic epitope peptide comprising:

[0150] (i) an amino acid sequence represented by SEQ ID NO: 13 or SEQ ID NO: 54; and

[0151] (ii) an amino acid sequence represented by SEQ ID NO: 55;

[0152] (3) an antigenic epitope peptide targeting MAGEA1, the antigenic epitope peptide comprising:

[0153] (i) an amino acid sequence represented by SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, or SEQ ID NO: 219; and

[0154] (ii) an amino acid sequence represented by SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 220, SEQ ID NO: 221, or SEQ ID NO: 222;

[0155] (4) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising:

[0156] (i) an amino acid sequence represented by SEQ ID NO: 208 or SEQ ID NO: 77;

[0157] (ii) the amino acid sequence represented by SEQ ID NO: 180 or SEQ ID NO: 223; and

[0158] (iii) the amino acid sequence represented by SEQ ID NO: 209;

[0159] (5) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising:

[0160] (i) the amino acid sequence represented by SEQ ID NO: 67;

[0161] (ii) the amino acid sequence represented by SEQ ID NO: 210, SEQ ID NO: 211, or SEQ ID NO: 212;

[0162] (iii) the amino acid sequence represented by SEQ ID NO: 213; and

[0163] (iv) the amino acid sequence represented by SEQ ID NO: 184 or SEQ ID NO: 65;

[0164] (6) an antigenic epitope peptide targeting SMC1B, the antigenic epitope peptide comprising:

[0165] (i) the amino acid sequence represented by SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 185, SEQ ID NO: 94, SEQ ID NO: 105, SEQ ID NO: 95, or SEQ ID NO: 89;

[0166] (ii) the amino acid sequence represented by SEQ ID NO: 81 or SEQ ID NO: 99; and

[0167] (iii) the amino acid sequence represented by SEQ ID NO: 27 or SEQ ID NO: 80;

[0168] (7) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising:

[0169] (i) the amino acid sequence represented by SEQ ID NO: 70, SEQ ID NO: 19, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and

[0170] (ii) an amino acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, or SEQ ID NO: 214;

[0171] (8) an antigenic epitope peptide targeting MAGEA11, comprising an amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 58, or SEQ ID NO: 60;

[0172] (9) an antigenic epitope peptide targeting BRDT, comprising an amino acid sequence represented by SEQ ID NO: 11, SEQ ID NO: 43, or SEQ ID NO: 45.

[0173] In one specific embodiment, the polypeptide comprises an amino acid sequence represented by SEQ ID NO: 228.

[0174] In some embodiments, the polypeptide C-terminus further comprises a Th cell epitope PADRE and a major histocompatibility complex (MHC) class I transmembrane and trafficking domain (MITD).

[0175] In some embodiments, the N-terminus of the polypeptide comprises a signal peptide.

[0176] In some embodiments, the linker peptide is a sequence represented by SEQ ID NOs: 235-236.

[0177] In some embodiments, the polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 229-231.

[0178] In some specific embodiments, the polypeptide is selected from the group consisting of an amino acid sequence represented by SEQ ID NOs: 229-231.

[0179] In another aspect, the present disclosure provides a linear epitope peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-107 and SEQ ID NOs: 163-225.

[0180] In some embodiments, the epitope peptide targets one or more antigens selected from the group consisting of ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10, and / or MAGEA11.

[0181] In some embodiments, the linear epitope peptide is selected from one or more of:

[0182] (1) a linear epitope peptide targeting ACTL8 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-7 and SEQ ID NOs: 29-41;

[0183] (2) a linear epitope peptide targeting BRDT comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-11 and SEQ ID NOs: 42-52;

[0184] (3) a linear epitope peptide targeting FOXI3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 53;

[0185] (4) a linear epitope peptide targeting GNGT1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13 and SEQ ID NOs: 54-56;

[0186] (5) a linear epitope peptide targeting SMC1B comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 24-28, SEQ ID NOs: 79-107, and SEQ ID NO: 185;

[0187] (6) a linear epitope peptide targeting PLAC1 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 23 and SEQ ID NOs: 163-165;

[0188] (7) a linear epitope peptide targeting MAGEA1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 16-17, SEQ ID NOs: 61-63, SEQ ID NOs: 166-169, SEQ ID NOs: 198-201, and SEQ ID NOs: 204-207;

[0189] (8) a linear epitope peptide targeting MAGEA3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NOs: 64-68, SEQ ID NOs: 181-184, SEQ ID NO: 197, and SEQ ID NOs: 210-213;

[0190] (9) a linear epitope peptide targeting MAGEA4 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-21, SEQ ID NOs: 69-72, SEQ ID NOs: 170-176, SEQ ID NO: 214, and SEQ ID NOs: 224-225;

[0191] (10) a linear epitope peptide targeting MAGEA6 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 22, SEQ ID NOs: 73-78, SEQ ID NOs: 177-180, SEQ ID NOs: 208-209, and SEQ ID NO: 223;

[0192] (11) a linear epitope peptide targeting MAGEA10 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 57, and SEQ ID NOs: 190-194; and

[0193] (12) a linear epitope peptide targeting MAGEA11 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NOs: 58-60, and SEQ ID NOs: 185-189.

[0194] In yet another aspect, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding the polypeptide as previously described or the linear epitope peptide as previously described.

[0195] In yet another aspect, the present disclosure provides an RNA nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide as previously described or an open reading frame thereof.

[0196] In yet another aspect, the present disclosure provides a tumor-associated antigen vaccine comprising the RNA nucleic acid molecule as previously described.

[0197] In some embodiments, the RNA nucleic acid molecule is an mRNA.

[0198] In yet another aspect, the present disclosure provides a pharmaceutical composition comprising the polypeptide as previously described, the linear epitope peptide as previously described, the nucleic acid as previously described, the RNA nucleic acid molecule as previously described, or the tumor-associated antigen vaccine as previously described.

[0199] Use of the polypeptide as previously described, the linear epitope peptide as previously described, the nucleic acid as previously described, the RNA nucleic acid molecule as previously described, the tumor-associated antigen vaccine as previously described, or the pharmaceutical composition as previously described in the manufacture of a medicament for the treatment and prevention of a disease.

[0200] In some embodiments, the disease is selected from the group consisting of esophageal squamous cell carcinoma, lung squamous cell carcinoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, gastric cancer, lung adenocarcinoma, colon cancer, and rectal cancer. Beneficial effects

[0201] The present disclosure is based on database-based de novo discovery and screening of tumor antigens, combined with immune mass spectrometry and AI algorithm screening of high-frequency HLA-I antigen sequences, through multi-antigen concatenation and addition of new functional elements, which can promote multi-antigen presentation and T cell response, and overcome immune escape caused by single antigen deficiency or loss. BRIEF DESCRIPTION OF DRAWINGS

[0202] The present disclosure can be more fully understood with reference to the following drawings.

[0203] Figure 1 shows the screening process of esophageal squamous cell carcinoma antigen target and epitope.

[0204] Figure 2 shows the bioinformatics analysis results of esophageal squamous cell carcinoma target, A shows gene expression difference analysis; B shows screening gene heat map; C shows screening gene TPM expression level.

[0205] Figure 3 shows the analysis of the expression ratio of antigens in various tumors.

[0206] Figure 4 shows the statistical chart of high expression ratio of ECVAC target RNA in esophageal cancer patient tumor tissue, N=132.

[0207] Figure 5 shows the HLA-A*02:01 antigen peptide affinity detection results (cElisa).

[0208] Figure 6 shows the HLA-A*02:01 antigen peptide affinity detection results (cell loading peptide).

[0209] Figure 7 shows the HLA-A*11:01 antigen peptide affinity detection results (cElisa).

[0210] Figure 8 shows the HLA-A*11:01 antigen peptide affinity detection results (cell loading peptide).

[0211] Figure 9 shows the ECVAC-A2 / 11 mRNA design schematic.

[0212] Figure 10 shows the results of non-denaturing gel electrophoresis detection of mRNA mobility, where Ml : marker, Lane 1-7: ECVAC-A2 / 11-V1.0, ECVAC-A2 / 11-V1.1, ECVAC-A2 / 11-V1.2, ECVAC-A2 / 11-V1.3, ECVAC-A2 / 11-V1.4, ECVAC-A2 / 11-V1.5, ECVAC-A2 / 11-V1.6, Lane 8-14: ECVAC-A2-V1.0, ECVAC-A2-V1.1, ECVAC-A2-V1.2, ECVAC-A2-V1.3, ECVAC-A2-V1.4, ECVAC-A2-V1.5, ECVAC-A2-V1.6, Lane 15-20: ECVAC-A11-V1.0, ECVAC-A11-V1.1, ECVAC-A11-V1.2, ECVAC-A11-V1.3, ECVAC-A11-V1.4, ECVAC-A11-V1.5; M2: marker.

[0213] Figure 11 shows the results of qPCR detection of mRNA intracellular expression levels, where (A) is ECVAC-A2 transfected mRNA qPCR detection of intracellular expression levels; (B) is ECVAC-A11 transfected mRNA qPCR detection of intracellular expression levels; (C) is ECVAC-A2 / 11 transfected mRNA qPCR detection of intracellular expression levels.

[0214] Figure 12 shows the results of cell free system detection of mRNA in vitro translation levels, where (A) is ECVAC-A2 in vitro translation levels; (B) is ECVAC-A11 in vitro translation levels; (C) is ECVAC-A2 / 11 in vitro translation levels.

[0215] Figure 13 shows the frequency of vaccine antigen specific T cells in HLA-A2.1 transgenic mice.

[0216] Figure 14 shows the frequency of vaccine antigen specific T cells in HLA-A11.1 transgenic mice.

[0217] Figure 15 shows the frequency of vaccine antigen specific T cells in HLA-A2.1 transgenic mice, where A. is the comparison result between each peptide pool group; B. is the overall comparison result between groups.

[0218] Figure 16 shows the frequency of vaccine antigen specific T cells in HLA-A11.1 transgenic mice, where A. is the comparison result between each peptide pool group of different optimized sequences; B. is the comparison result between groups of different optimized sequences.

[0219] Figure 17 shows the bioactivity detection of human PBMCs after in vitro expansion by ECVAC. Panel A shows the results of intracellular cytokine flow cytometry. The appropriate scanning peptide pool and brefeldin A were added to the T cells expanded in the control and test groups, and flow cytometry was performed after incubation at 37°C for about 16 hours. Panels B and C show the results of luciferase-based CTL cytotoxicity assays using KYSE-410 (B) or KYSE-410-A2.1 (C) transfected with fluorescent enzyme mRNA as target cells, and the T cells expanded in the two groups as effector cells.

[0220] Figure 18 shows the results of killing of tumor target cells by T cells from mice immunized with ECVAC. Panels A and B show the results of killing of (A) MC38-A2.1-HHD or (B) MC38-A2.1-HHD-EC by T cells isolated from the spleens of HLA-A2.1 mice immunized with PBS or ECVAC (labeled Vaccine in the figure) and incubated with the target cells at effector-to-target ratios of 5:1 and 40:1 for 24 hours. Panels C and D show the results of killing of (C) MC38-A11.1-HHD or (D) MC38-A11.1-HHD-EC by T cells isolated from the spleens of HLA-A11.1 mice immunized with PBS or ECVAC (labeled Vaccine in the figure) and incubated with the target cells at effector-to-target ratios of 10:1 and 40:1 for 24 hours.

[0221] Figure 19 shows the therapeutic effects of ECVAC in two transgenic mouse tumor models. Panel A shows a schematic diagram of the experimental design. Panel B shows the results of the HLA-A2.1 transgenic mouse tumor model. Panel C shows the results of the HLA-A11.1 transgenic mouse tumor model.

[0222] Figure 20 shows the tumor growth curves of experimental animals after the start of treatment, *P<0.05, **P<0.01. DETAILED DESCRIPTION

[0223] The following description of the disclosure is merely intended to illustrate various different embodiments of the disclosure. Therefore, the specific modifications discussed should not be interpreted as limiting the scope of the disclosure. It is obvious to those skilled in the art that various different equivalents, changes and modifications can be made without departing from the scope of the disclosure, and it should be understood that these equivalent embodiments will be included herein. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0224] As used herein, the term "antigen" refers to a molecule that elicits an immune response, which can involve antibody production, or activation of specifically immune-competent cells. It is understood by those skilled in the art that any macromolecule, including all proteins or peptides, can be used as an antigen. An antigen can be derived from recombinant or genomic DNA. It is understood by those skilled in the art that any DNA, including a nucleotide sequence or a portion of a nucleotide sequence that encodes a protein that elicits an immune response, encodes an "antigen" as the term is used herein. Furthermore, it is understood by those skilled in the art that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present disclosure includes, but is not limited to, the use of portions of nucleotide sequences of more than one gene, and these nucleotide sequences are arranged in different combinations to elicit a desired immune response. A "polypeptide" in the present application comprises one or more antigenic fragments consisting of 10-50, such as 20-50, or 25-30 amino acids, selected from the group consisting of ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10, MAGEA11, TP53.175R / H, TP53.220Y / C, PIK3CA.545E / K, and KRAS.12G / D, connected by a connecting peptide between the one or more antigenic fragments, and comprising one or more antigenic epitope peptides on the antigenic fragments. In some embodiments, the antigenic fragments comprise an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-162; in some embodiments, the polypeptide comprises 20 antigenic fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-127; in some embodiments, the polypeptide comprises 20 antigenic fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 128-147; in some embodiments, the polypeptide comprises 15 antigenic fragments, each of which is an amino acid sequence selected from the group consisting of SEQ ID NOs: 148-162. Furthermore, it is understood by those skilled in the art that an antigen need not be encoded by a "gene" at all, but can be produced, synthesized, or derived from a biological sample. Such a biological sample can include, but is not limited to, a tissue sample, a tumor sample, a cell, or a biological fluid.

[0225] As used herein, the term "antigenic epitope peptide" refers to a polypeptide molecule in an antigen molecule that determines the specificity of the antigen. The antigen binds to the antigen receptor on the surface of the corresponding lymphocyte through the antigenic epitope, thereby activating the lymphocyte and causing an immune response; the antigen also exerts an immune effect by specifically binding to the corresponding antibody or sensitized lymphocyte through the epitope. The size of the antigenic epitope is suitable for the antigen-binding site of the corresponding antibody. The specificity of an antigenic epitope is determined by all residues that make it up, but some residues play a greater role than others in binding to the antibody. The "antigenic epitope peptide" of the present application refers to a polypeptide molecule containing 6-13 amino acid residues, such as 8-13, or 8-9, targeting the ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10 and MAGEA11 antigens. In some embodiments, the antigenic epitope peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-107 or SEQ ID NOs: 163-225.

[0226] Unless otherwise specified, as used herein, a nucleic acid molecule "encoding" a certain protein or a nucleotide sequence of the amino acid sequence of a certain protein includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The nucleotide sequence can also include one or more introns.

[0227] As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, e.g., non-human primates, sheep, dogs, cats, horses, cows, chickens, rats, mice, amphibians, reptiles, etc. The terms "patient" or "subject" are used interchangeably unless otherwise specified. In the present disclosure, the preferred subject is a human.

[0228] As used herein, the term "treatment" refers to the administration of an effective amount of a polypeptide or vaccine according to the present disclosure to a subject such that the subject has a reduction of at least one symptom of the disease or an improvement of the disease, e.g., a beneficial or desired clinical outcome. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treatment can refer to prolonging survival as compared to expected survival in the absence of treatment. Thus, one skilled in the art recognizes that treatment can improve a disease state, but can not be a complete cure of the disease. As used herein, the term "treatment" includes prophylaxis. Alternatively, treatment is "effective" if it results in a reduction in the progression of the disease or cessation of the progression of the disease. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Patients in need of treatment include those who have been diagnosed with a disorder associated with expression of a polynucleotide sequence, as well as those who can develop such a disorder due to genetic predisposition or other factors.

[0229] The term "disease" includes breast cancer, colon cancer, rectal cancer, esophageal cancer, lung cancer, liver cancer, gastric cancer, non-small cell lung cancer, squamous cell carcinoma, adrenal cancer, melanoma cancer, ovarian cancer, preferably the disease is selected from the group consisting of esophageal squamous carcinoma, lung squamous carcinoma, head and neck squamous carcinoma, hepatocellular carcinoma, gastric carcinoma, lung adenocarcinoma, colon cancer and rectal cancer, oral squamous cell carcinoma.

[0230] Embodiment

[0231] In order to better understand the present disclosure scheme for those skilled in the art, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present disclosure, not all the embodiments.

[0232] Embodiment 1: Antigen target screening

[0233] The screening process of esophageal squamous carcinoma antigen target and epitope is shown in Figure 1. In order to screen the tumor antigen target meeting the expression characteristics of esophageal squamous carcinoma (ESCC) population, the present disclosure analyzes 80 cases of esophageal squamous carcinoma patient tumor tissue RNAseq data (from TCGA) and 555 cases of esophageal mucosa tissue RNAseq data (from GTEx), and sets the following antigen screening rules:

[0234] (1) The selected genes are significantly up-regulated in esophageal squamous carcinoma compared with normal esophageal mucosa tissue. DESeq2 (R package v1.38.3) was used to analyze the differential gene expression of the tumor group and the normal group. The Benjamini-Hochberg method was used to adjust the p-value and reduce the false discovery rate. The differential gene screening criteria: the corrected P-value is less than 0.01, and |log2(fold-change)|>1);

[0235] (2) The average TPM of 50 human normal tissues except testis and uterus is less than 0.25;

[0236] (3) The number of samples with TPM greater than 1 in the TCGA esophageal squamous carcinoma cohort is more than 20%.

[0237] The bioinformatics analysis results are shown in FIG. 2. Through differential gene expression screening, 4478 genes up-regulated in esophageal squamous carcinoma were found in the present disclosure. After excluding normal tissue expression and ensuring a certain coverage in tumor patients, 27 genes were screened. After investigating the functions of the proteins translated by the 27 genes, 12 candidate antigens with the best treatment potential were selected, namely ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10 and MAGEA11, into the experimental verification stage.

[0238] Example 2: Expression analysis of candidate antigens in other tumors

[0239] According to the RNAseq sequencing data of patients in the TCGA database, the expression of the 12 candidate antigens selected in Example 1 in hepatocellular carcinoma, gastric cancer, lung adenocarcinoma, lung squamous carcinoma, colon cancer and rectal cancer was analyzed by bioinformatics. The median value of the gene TPM (transcripts per million) in the GTEx database normal tissue was used as the cutoff value. If the gene TPM in the tumor sample is greater than the cutoff value, it is considered that the patient expresses the gene. The ratio of the number of patients expressing the gene to the total number of patients with the cancer was calculated, and the results are shown in FIG. 3. The results show that the 12 selected candidate antigens are expressed in different proportions in the above different tumors.

[0240] Example 3: Coverage verification of candidate antigens in clinical samples

[0241] To validate the coverage of the selected antigens in patients, we collected and sequenced 132 tumor tissues and 96 para-cancer tissues provided by Peking University Cancer Hospital. After the samples passed the detection, 1-3 ug of total RNA was taken from each sample as the starting material to construct the transcriptome sequencing library. According to the VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina®(NEB), the library was constructed and sequenced on the Illumina®(Illumina) platform. The sequencing data was analyzed by the bioinformatics pipeline to obtain the gene expression level of each sample. The results are shown in Table 1. The operation instructions of (NR604-01 / 02) select different index labels to build the library respectively. For the qualified total RNA sample, the mRNA with polyA tail is enriched by Oligo(dT) magnetic beads, then the mRNA is broken into short fragments by adding fragmentation buffer, the first strand of cDNA is synthesized using mRNA as template and random hexamers, then the RNA template strand is degraded by RNaseH, and the second strand of cDNA is synthesized using dNTPs as raw material under the system of DNA polymerase I, then the double-stranded cDNA is purified by AMPure P beads or QiaQuick PCR kit. The purified double-stranded cDNA is subjected to end repair, A tailing and ligation of sequencing adapter, then fragment size selection is performed, and finally PCR amplification is performed to obtain the final cDNA library. After library detection, sample pooling is performed according to the effective concentration of the library and the target data volume, Illumina platform is used for sequencing, PE150 sequencing strategy is used, and 150bp double-end sequencing reads are obtained. The basic principle of sequencing is sequencing by synthesis. Four kinds of fluorescently labeled dNTPs, DNA polymerase and adapter primers are added to the sequencing flow cell for amplification, and when the complementary strand is extended in each sequencing cluster, each fluorescently labeled dNTP added can release the corresponding fluorescence. The sequencer captures the fluorescence signal, and the computer software bcl2fastq converts the light signal into sequencing peaks, thereby obtaining the sequence information of the test fragment and storing it in the FASTQ file format. Next, the fast-0.22.0 software (https: / / github.com / OpenGene / fastp) is used to filter the raw data (Raw Data), and after removing the adapter sequences, removing the reads with high N (N represents the base information that cannot be determined) proportion and removing the low-quality sequences, the clean data (Clean Data) is obtained. STAR-2.7.10b (https: / / github.com / alexdobin / STAR / ) is used to align the clean data after removing rRNA to the reference genome (GRCh38). Next, the featureCounts v2.0.3 software is used to quantify the gene-level expression of each sample. The antigen high expression determination standard is that the TPM of the gene in the tumor sample is greater than the average value of the TPM of the 96 cancer-adjacent samples plus the standard deviation.The tumor tissue of each patient carried RNA high expression of at least 2 antigen target points, nearly 90% of patients carried high expression of at least 5 antigen target points, and the proportion of patients carrying 8 or more than 8 antigen target points was as high as 53.79%, and the results are shown in Figure 4.

[0242] Example 4: Epitope screening of candidate antigens

[0243] HLA-A*02:01 and HLA-A*11:01 are the two HLA subtypes with the highest population coverage frequency in the world. The HLA-A*02:01 subtype is dominant in the European and American population, and the HLA-A*11:01 subtype is dominant in the Chinese population. Considering the influence of HLA double alleles, these two HLAs can cover more than half of the total population. Therefore, the present disclosure targets these two HLA subtypes, using K562 cell lines that only express single HLA-A2.1 or HLA-A11.1 as genetically engineered antigen presenting cells, respectively, and electrically transforming plasmids expressing the above-mentioned 12 TAAs, and then isolating the HLA-presented polypeptides by immunoprecipitation after cell lysis, and performing mass spectrometry detection, and the test procedure is as follows:

[0244] 1. Cell preparation

[0245] According to the instructions, K562 cells (purchased from Zhejiang Meisen) were recovered and cultured, and K562-HLA-A2.1 and K562-HLA-A11.1 cells were prepared by transfecting HLA-A2.1 and HLA-A11.1 genes (method referred to Eichmann, M et al. Tissue antigens vol. 84, 4 (2014): 378-88).

[0246] 2. Overexpression plasmid electroporation

[0247] According to the information of 12 antigens (Uniprot ID: Q9H568, Q58F21, A8MTJ6, P63211, P43363, P43364, P43355, P43357, P43358, P43360, Q9HBJ0, Q8NDV3), pcDNA3.1(+) was used as the backbone to construct overexpression vectors (synthesized by Nanjing Kingsun). At the same time, 2x106 7 Cells were divided into 1.5 mL centrifuge tubes, and after centrifugation to collect cell pellets, they were washed twice with PBS. After washing, the supernatant was removed and the electroporation system was prepared; the electroporation operation steps refer to the "Neon TM 100 μL electroporation kit operation manual". The cells after electroporation were quickly transferred to a T175 bottle and cultured in a 37°C, 5% CO2 incubator for 24 hours, and then the cells were collected for mass spectrometry sample preparation.

[0248] 3. Mass spectrometry sample preparation

[0249] Mass spectrometry sample preparation was performed according to the experimental protocol (Purcell, Anthony W et al. Nature protocols vol.14,6(2019):1687-1707.). First, K562-HLA cells from each group were transferred to 50mL centrifuge tubes, centrifuged at 1500rpm at room temperature for 10 minutes, resuspended in 5mL PBS, and counted. Based on the counting results, the cells were aliquoted into 1.5mL centrifuge tubes, with each tube containing 2×10⁶ cells. 7 Collect cells by centrifugation; discard the supernatant, add 1 mL of pre-chilled PBS to each tube, centrifuge at 1500 rpm for 5 minutes at room temperature, discard the supernatant, and repeat the washing once. Then, prepare cell lysis buffer in advance, add 1 mL of cell lysis buffer to each tube of cell pellet, fully resuspend the cell pellet, place the EP tube on a rotary shaker, and lyse at 4°C for 30 minutes; after lysis, centrifuge at 4°C for 12000 rpm for 20 minutes, and collect the supernatant. Next, add 40 μL of affinity gel to the cell lysis supernatant collected in the previous step, mix thoroughly, place the tube on a rotary shaker, and incubate at 4°C for 3 hours; after incubation, set the centrifuge program to 4°C for 14000 rpm for 1 minute, and collect the supernatant. Finally, add 1 mL of pre-chilled washing buffer to the pellet, mix thoroughly, centrifuge at 4°C for 1 minute, and repeat the washing 4 times. After the final wash, remove the supernatant thoroughly, add 40 μL of acetic acid eluent to the precipitate tube and mix thoroughly. Incubate at 65°C for 15 minutes and then allow to return to room temperature. Balance the sample and place it in a centrifuge. Set the centrifugation program to 4°C and 14,000 rpm for 1 minute. Carefully collect all sample supernatant and transfer it to a new 1.5 ml EP tube for storage.

[0250] 4. Mass spectrometry detection

[0251] The prepared samples were sent to Baizhen Biotechnology Co., Ltd. for mass spectrometry detection. The mass spectrometry detection results obtained in this experiment were statistically analyzed to compare the differences in the number of immune peptides that matched the target protein.

[0252] Based on mass spectrometry detection, combined with NetMHCPan 4.1BA prediction, IEDB database and literature search, the epitope library of the above 12 candidate antigens was obtained. Among them, the newly discovered HLA-A2.1 and HLA-A11.1 epitopes are shown in Table 1 and Table 2.

[0253] Table 1. Epitopes of antigen HLA-A2.1

[0254] Table 2. Epitopes of antigen HLA-A11.1

[0255] Example 5: Antigen epitope affinity verification

[0256] To compare the relative affinity of each antigen peptide in the epitope peptide library, the affinity of each antigen peptide was identified using two methods of cELISA and cell loading peptide. The cELISA test procedure is as follows:

[0257] Preparation before experiment: 1) peptide Flex-T TM monomer UVX cannot be repeatedly frozen and thawed, so the first use should be divided and labeled with name and date of sub-packaging at -20°C, and the subsequent use should be taken directly from the sub-packaging tube; 2) take out LEGEND MAX TM Flex-T TM Human Class IPeptide Exchange ELISA Kit in advance to recover to room temperature.

[0258] Antigen polypeptide replacement: take out the reagents required for the experiment and ice bath; dilute the polypeptide to 400 mM with PBS (if DMSO is required, the concentration of DMSO cannot exceed 10% (v / v)), ice bath for standby; take a piece of V-shaped hole 96-well plate, add 20 μL of diluted antigen peptide and 20 μL of peptide Flex-T TM monomer UVX (200 μg / mL) to the hole with a pipette, and the blank control (UV only) group is 20 μL of PBS and 20 μL of peptide Flex-T TM monomer UVX (200 μg / mL), and mix well by pipetting; cover, centrifuge at 2500g for 2 minutes in a 4°C environment to make the liquid sink to the bottom of the hole; uncover, and place the 96-well plate in an ice bath state under a ultraviolet lamp (366 nm): irradiate for 30 minutes, and the sample-lamp distance is 2-5 cm. Biolegend recommends using an 8W, 366nm ultraviolet; cover, and incubate the hole plate at 37°C in the dark for 30 minutes to allow the antigen peptide to fully bind; centrifuge, and collect the liquid in the hole for standby. (The liquid contains prepared pMHC monomer complex, and the concentration of pMHC monomer complex in each hole is 100 μg / mL).

[0259] Polypeptide displacement activity detection: dilute 20x Wash Buffer to 1x Wash Buffer with ddH2O; dilute the prepared pMHC complex sample to 5 ng / mL with Assay Buffer A, which is the monomer complex sample working solution; take out the required reagents and restore to room temperature, take out the required ELISA strip and place it in the ELISA plate; first add 50 μL of Assay Buffer A in the wells of the ELISA plate, then continue to add 50 μL of sample solution (after this step, the sample concentration is 2.5 ng / mL, and each sample is set with 2 duplicate wells) or control solution (Assay Buffer A) in the corresponding wells. Seal the ELISA plate with sealing film, shake on a shaker at room temperature for 30 minutes (optional at 220 rpm); discard the liquid in the wells, and wash the plate 4 times with 200 μL of 1x Wash Buffer per well, and try to dry the liquid as much as possible. You can invert the plate onto the absorbent paper on the table to allow the liquid to be absorbed.

[0260] After drying the liquid, add 100 μL of avidin-HRP reagent to each well, seal with sealing film, and incubate at room temperature on a shaker for 30 minutes (optional at 220 rpm); discard the liquid in the wells, and wash as described above for 5 times. The last time, add Wash Buffer to the wells and soak for 30 seconds to 1 minute to minimize background interference.

[0261] After the last step of drying the liquid, add 100 μL of substrate solution F to each well and incubate at room temperature in the dark for 10 minutes; (after adding the substrate, the liquid color of the experimental wells should change to blue, and the blue color will gradually deepen with increasing sample concentration; this step can be optionally sealed for incubation); after incubation, add 100 μL of stop solution to each well, (after adding the stop solution, the liquid color changes from blue to yellow); after color development, use a microplate reader to detect the absorbance values at OD450 and OD570 within 30 minutes.

[0262] Data processing, the calculation formula is as follows:

[0263] The method for loading peptides into cells is as follows (refer to the patent with application number 202410069100.3):

[0264] Cell plating: take an appropriate amount of K562-HLA-A*11:01-TAP_KO / K562-HLA-A*02:01-TAP_KO cells, resuspend the cells in 1 ml of serum-free RPMI 1640 medium and count them. Adjust the cell concentration to 1x10 6 / ml, 100 μl / well in a 48-well plate, i.e. 1x10 5Add β2M protein (final concentration 5 μg / ml) and antigen peptide (final concentration 60 μM), and incubate overnight in a carbon dioxide incubator.

[0265] Flow detection: collect cells into flow tubes the next day, centrifuge at 350 x g for 5 minutes, discard the supernatant. Wash the cells with 2 ml PBS twice, centrifuge at 350 x g for 5 minutes at room temperature, discard the supernatant, and resuspend the cells in 100 μl PBS. Add 2 μl BV510 anti-human HLA-ABC to each tube, incubate at room temperature for 20 minutes in the dark, wash the cells with 2 ml PBS once, centrifuge at 350 x g for 5 minutes at room temperature, discard the supernatant, and resuspend the cells in 200 μl PBS. Use a flow cytometer to detect the expression level of HLA-ABC molecules on the surface of K562 cells.

[0266] Data processing: MFI Ratio = (MFI of the test group - MFI of the control group) / (MFI of the positive peptide group - MFI of the control group)

[0267] For the epitopes with relatively high mass spectrometry detection intensity in Example 4, corresponding polypeptides were synthesized (synthesized by Nanjing Kingsray) and affinity detection was performed. The cELISA test results of the antigen HLA-A2.1 epitope polypeptide are shown in Figure 5, and the cell peptide loading results are shown in Figure 6. The cELISA test results of the antigen HLA-A11.1 epitope polypeptide are shown in Figure 7, and the cell peptide loading results are shown in Figure 8. Based on the cElisa and cell peptide loading test, the affinity results are determined as follows: strong positive: the ratio of the test to the positive (cElisa) or MFI ratio (cell peptide loading) is greater than 1. Intermediate positive: the ratio of the test to the positive (cElisa) or MFI ratio (cell peptide loading) is greater than the intermediate value of the positive and negative control peptides, and is less than 1. Weak positive: the ratio of the test to the positive (cElisa) or MFI ratio (cell peptide loading) is less than the intermediate value of the positive and negative control peptides, and is greater than the negative control peptide. The negative control peptide is determined to be negative. The detailed results are shown in Tables 3, 4, 5 and 6.

[0268] Table 3. cElisa detection results of HLA-A2.1 epitope polypeptide

[0269] Table 4. Cell peptide loading detection results of HLA-A2.1 epitope polypeptide

[0270] Table 5. cElisa detection results of HLA-A11.1 epitope polypeptide

[0271] Table 6. Cell peptide loading detection results of HLA-A11.1 epitope polypeptide

[0272] Example 6: ECVAC vaccine design

[0273] Three vaccines were designed according to the epitope information of 12 antigens for different HLA populations. ECVAC-A2 was designed for HLA-A*02:01 population, 18 fragments of 25 amino acids were selected from the above 12 antigens and two tumor patient common neoantigen fragments TP53.175R / H and TP53.220Y / C (Table 7) to form a tandem sequence of 20 antigen fragments. Each fragment contains at least one HLA-A*02:01 epitope, and some fragments may contain multiple antigen epitopes. A total of 50 HLA-A*02:01 epitopes have been identified, details see Table 8. ECVAC-A11 was designed for HLA-A*11:01 population, 18 fragments of 25 amino acids were selected from the above 11 antigens (excluding PLAC1) and two tumor patient common neoantigen fragments PIK3CA.545E / K and KRAS.12G / D to form a tandem sequence of 20 antigen fragments. Each fragment contains at least one HLA-A*11:01 epitope, and a total of 30 HLA-A*11:01 epitopes have been identified, details see Table 9. ECVAC-A2 / 11 takes into account the design for HLA-A*02:01 and HLA-A*11:01 populations, a total of 15 fragments of 30 amino acids were selected from 9 antigens (excluding PLAC1, FOXI3 and MAGEA10), each fragment contains at least one HLA-A*02:01 and HLA-A*11:01 epitope. The 15 antigen fragments contain a total of 46 HLA-A*02:01 epitopes and 37 HLA-A*11:01 epitopes that have been identified, details see Table 10 and Table 11.

[0274] In order to avoid the generation of new epitopes by connecting different antigen fragments, GS linker without immunogenicity was used to connect different fragments, and universal Th cell epitope PADRE was introduced after it to ensure high population response rate and sufficient immunogenicity, while HLA-I signal peptide (SP) and transmembrane / cytoplasmic segment MITD (MHC class I trafficking signal domain) were added at the N- and C-termini respectively to enhance the efficiency of overall antigen presentation. Finally, the amino acid sequences of each vaccine were obtained, see the sequence listing. Take ECVAC-A2 / 11 as an example, the structure is shown in Figure 9.

[0275] Table 7. Antigen fragments corresponding to ECVAC-A2, ECVAC-A11 and ECVAC-A2 / 11

[0276] Table 8. HLA-A*02:01 epitopes of ECVAC-A2

[0277] Table 9. HLA-A*11:01 epitopes of ECVAC-A11

[0278] Table 10. HLA-A*02:01 epitopes of ECVAC-A2 / 11

[0279] Table 11. HLA-A*11:01 epitopes of ECVAC-A2 / 11

[0280] Table 12. Antigen polypeptide sequences

[0281] Table 13. Amino acid sequences

[0282] Example 7: mRNA sequence optimization

[0283] Sequence optimization of the CDS region of vaccine mRNA can improve its translation efficiency, and structure optimization can improve its half-life. The general principle of CDS sequence optimization is to find a stable and high-yield mRNA sequence by using the degeneracy of codons to improve the expression amount of functional protein. Codon adaptation index (CAI) refers to the degree of consistency between the frequency of codon use in heterologous mRNA sequence and the optimal codon use in host cells. Replacing the codons in the foreign mRNA sequence with synonymous codons with high frequency of use in host cells ensures that the codon use bias in the foreign mRNA sequence and the host cells is more consistent, which can significantly improve the translation efficiency of mRNA. In addition, GC-rich mRNA can be more efficiently transcribed or processed, thereby producing more stable mRNA. Therefore, when selecting codons, it is also necessary to increase the GC content as much as possible to further improve the stability and translation efficiency of mRNA. In addition to this, CDS optimization also needs to consider the stability of mRNA secondary structure, reduce its minimum folding free energy (MFE), and improve the half-life of mRNA in vivo, so as to express more functional proteins. Of course, the standards for different functional regions are also different, for example, the fewer secondary structures formed by the first ten codons in the mRNA CDS region, the higher the expression amount of the encoded protein, and the more secondary structures formed by the remaining CDS region, the higher the expression amount of the encoded protein.

[0284] Therefore, the sequences of ECVAC-A2, ECVAC-A11 and ECVAC-A2 / 11 were optimized according to the above principles, and 6-7 sequences of each vaccine were selected for experimental verification considering the influence of various factors, and the sequences are shown in Table 14.

[0285] Table 14. Optimized nucleic acid sequences

[0286] Example 8: In vitro screening of mRNA optimized sequences

[0287] In order to find three ECVAC mRNA sequences for different HLA versions with better function, 6-7 mRNA sequences of ECVAC-A2, ECVAC-A11 and ECVAC-A2 / 11 were designed by optimizing GC content, CAI and MFE. In this embodiment, the optimal sequences were screened by multiple dimensions such as mRNA electrophoretic mobility, mRNA integrity, mRNA intracellular degradation capacity and mRNA in vitro protein translation level. It is intended to select 3 optimal sequences for each version, and a total of 9 mRNA are used for subsequent HLA transgene (Tg) mouse immunogenicity verification.

[0288] The mRNA nucleic acid sequences of ECVAC-A2, ECVAC-A11 and ECVAC-A2 / 11 are shown in Table 14, and the mRNA production is operated according to the T7 High Yield RNA Transcription Kit (Novagen, TR101-02) instruction.

[0289] 1. Non-denaturing gel electrophoresis for detecting mRNA mobility

[0290] The prepared mRNA was subjected to electrophoretic mobility test using 1% non-denaturing agarose gel. In theory, mRNA molecules with lower MFE (MFE: minimum free energy) values contain tighter shapes and smaller kinetic sizes. The more stable the mRNA secondary structure, the faster the electrophoretic migration. Therefore, different mRNA sequences designed according to the theoretical MFE can be screened and verified by the test. The results are shown in Figure 10: the migration rates of the mRNA versions are different, and they are all correlated with their theoretical MFE values. After statistical analysis of the electrophoretic migration results, it was found that among the 7 mRNA of ECVAC-A2 / 11 group, ECVAC-A2 / 11-V1.2 migrated the fastest, among the 7 mRNA of ECVAC-A2 group, ECVAC-A2-V1.1 migrated faster, and among the 6 mRNA of ECVAC-A11 group, ECVAC-A2-V1.2 migrated faster, which is consistent with the theoretical value. In summary, the non-denaturing gel electrophoresis results can preliminarily determine the mRNA version with more stable structure.

[0291] 2. qPCR detection of intracellular mRNA degradation

[0292] The expression level of mRNA in cells (mRNA half-life) was selected as another indicator for screening mRNA stability. K562 cells (purchased from Zhejiang Meisen) were selected as test cells, and 6-7 mRNA of each of A2, A11 and A2 / 11 were transfected, and the K562 cell samples after electroporation were collected at different time points of 0, 3, 6, 12, 24 and 48 hours. The amplification primers were set as UTR-F3 (GTTCCAGACACCTCCCAAGC) and UTR-R3 (TGTGGCTGGCACGAAATTGA), and RNA extraction and qPCR detection were performed. The qPCR results were analyzed with 2 -ΔCT as the vertical coordinate and the transfection time as the horizontal coordinate, the intracellular degradation of different versions of mRNA within 48 hours was compared. As shown in Figure 11: within a certain time range, each version of mRNA showed different degradation in cells. By comparing the Half-life values of ECVAC-A2 / 11, ECVAC-A2 and ECVAC-A11 mRNA groups, it was found that the three mRNA versions with longer half-life were: ECVAC-A2 / 11 (V1.2, V1.3, V1.4); ECVAC-A2 (V1.2, V1.3, V1.6); and ECVAC-A11 (V1.2, V1.3, V1.5), which can be used as a reference indicator for determining the optimal sequence in the future.

[0293] 3. Cell free system detection of mRNA translation level

[0294] ECVAC mRNA is a series of tandem antigen epitopes, which lacks related detection antibodies and cannot be detected by traditional cell transfection methods using Western-blot. The application of a cell-free reaction system (Rabbit Reticulocyte Lysate System, Promega, L4960) can realize the process of mRNA translation and protein synthesis in an in vitro cell-free system. In this experiment, rabbit reticulocyte lysate was used to synthesize proteins by optimizing biotinylated tRNA (Transcend TM Non-Radioactive Translation Detection System, Promega, L5061), which labels lysine and directly detects the synthesized protein in vitro, avoiding the limitation of lacking antibodies. Therefore, the subsequent experiments were completed using this system. However, this system has certain limitations: the system is a rabbit-derived translation system, and ECVAC mRNA is a humanized codon-optimized sequence, which may have a low risk of translation efficiency; the detection intensity of this system is theoretically related to the proportion of lysine contained in the sequence, but since the lysine content in the ECVAC mRNA sequence is basically the same, the method was selected for detecting mRNA translation efficiency. Therefore, to compare the in vitro translation levels of different versions of mRNA, a cell-free system was prepared to translate mRNA in vitro, and Western Blot was used to detect protein expression levels. The results are shown in Figure 12: ECVAC-A2 (V1.0, V1.3, V1.5, V1.6), ECVAC-A11 (V1.0, V1.3, V1.5), and ECVAC-A2 / 11 (V1.1, V1.2, V1.4, V1.5, V1.6) were all detected to have in vitro expression; after quantifying the obtained bands, it was found that the three mRNA versions with higher expression levels were: ECVAC-A2 (V1.0, V1.3, V1.5), ECVAC-A11 (V1.0, V1.3, V1.5), and ECVAC-A2 / 11 (V1.2, V1.4, V1.5).

[0295] 4. Determination of ECVAC optimized sequence

[0296] By GC content, CAI and MFE, etc. Optimization, ECVAC each version of mRNA function exists certain difference, the statistical results are shown in Table 15, the present application focuses on the mRNA intracellular degradation level, in vitro expression level and migration rate three aspects of mRNA stability screening, from the mRNA of each group, select the optimal version of stability. That is, from ECVAC-A2, ECVAC-A2 / 11, ECVAC-A11 three groups of mRNA to determine the following mRNA optimal sequence (ECVAC-A2-1.0, ECVAC-A2-1.3, ECVAC-A2-1.5, ECVAC-A2 / 11-1.2, ECVAC-A2 / 11-1.4, ECVAC-A2 / 11-1.5, ECVAC-A11-1.0, ECVAC-A11-1.3, ECVAC-A11-1.5) as the subsequent Tg mice in vivo immunogenicity verification object.

[0297] Table 15. mRNA intracellular half-life, in vitro expression level and migration rate statistics

[0298] Example 9: mRNA optimized sequence in vivo screening

[0299] In vivo test in animals can better simulate the actual effect of drugs in clinical practice, therefore, the present application further compares the immunogenicity of three optimized sequences selected from ECVAC-A2, ECVAC-A11, ECVAC-A2 / 11 three groups in HLA transgenic mice in vivo, to determine the strongest immunogenicity as the final drug candidate molecule.

[0300] The present application uses two kinds of HLA transgenic mice (purchased from Biosearch Technologies, item number 110110 and 112803), 5 mice in each group, and immunizes the mRNA-LNP vaccine to be screened by intramuscular injection, once every 7 days, a total of 3 times. Three days after the third immunization, the mouse spleen is taken and the ELISPOT method is used to screen the best immunogenicity of the drug candidate molecule.

[0301] mRNA LNP preparation: the preparation equipment used is microfluidic nanoparticle preparation instrument (Ignite, PNI), the preparation parameters refer to the equipment instruction manual, and the lipids (LNP) used are the same as those used in the Pfizer / BioNtech produced new coronary pneumonia vaccine BNT162b2, that is, ALC-0315, ALC-0159, DSPC and cholesterol.

[0302] Dosing regimen

[0303] The principles of group design are consistent in two different HLA transgenic animals. G1 is the solvent control, G2, G3, G4 are HLA-A2.1 or HLA-A11.1 single HLA epitope tumor vaccines, and G5, G6, G7 are HLA-A2.1 and HLA-A11.1 double HLA epitope tumor vaccines. The specific administration scheme is shown in Table 16 and Table 17.

[0304] Table 16. HLA-A2.1 animal administration scheme table

[0305] Note: i.m. Intramuscular injection, injection site is bilateral thigh muscle; test preparation is prepared at a concentration of 40 μg / mL for administration.

[0306] Table 17. HLA-A11.1 animal administration scheme table

[0307] Note: i.m. Intramuscular injection, injection site is bilateral thigh muscle; test preparation is prepared at a concentration of 40 μg / mL for administration.

[0308] In the implementation of ELISPOT, two different long and short peptide libraries are used to stimulate T cells, which are epitope (short) peptide library and scanning (long) peptide library. The epitope peptides selected are the most likely epitope peptides presented by HLA in each antigen fragment of ECVAC-A2, ECVAC-A11 and ECVAC-A2 / 11. Each 5 epitope peptides form a peptide library (P1-P4). The long peptide library is composed of 15 amino acid scanning peptides, which cover the entire sequence of an antigen fragment, and there is a 10 amino acid sequence overlap between adjacent two scanning peptides. Each 5 antigen scanning peptides form a peptide library (LP1-LP4), and the scanning peptide library can avoid missing immune responses other than selected epitopes in detection.

[0309] 1. In vivo screening of ECVAC-A2 optimized sequence

[0310] The summary of HLA-A2.1 mouse single HLA epitope vaccine antigen-specific T cell frequency is shown in Table 18. The data were analyzed by IBM SPSS Statistics 25.0 statistical software, and the average values of different peptide libraries were compared by One-Way ANOVA test. The overall comparison between groups was performed by Two-Way ANOVA test using Graphpad Prism 8 software, p<0.05 was considered to have significant difference, and the statistical analysis results are shown in Table 19. The data are shown in Figure 13.

[0311] Table 18. Summary of HLA-A2.1 mouse single HLA epitope vaccine antigen-specific T cell frequency (Mean ± SD)

[0312] Unit: SFU / 2*10^5 cells

[0313] Table 19. Summary of p values of statistical analysis of HLA-A2.1 mouse single HLA epitope vaccine antigen-specific T cell frequency

[0314] Note: p values of p a <0.05 for comparison with G2 group b <0.05 for comparison with G3 group * , p < 0.05 ** , p < 0.01 *** , p < 0.001.

[0315] The experimental results showed that the antigen epitopes in the No. 4 peptide library (including short peptides and / or long peptides) contained the most dominant antigen epitopes that stimulated the production of HLA-A2.1 transgenic mice after vaccination, and positive reactions were also detected in the No. 1, No. 2, and No. 3 peptide libraries (including short peptides and / or long peptides). After stimulation by the No. 1 peptide library, the antigen-specific T cell frequency of the spleen cells of the G2 group was higher than that of the G3 and G4 groups, and the G2 group was significantly higher than the G4 group after stimulation by P1 and LP1 (p < 0.05), and the G2 group was significantly higher than the G3 group after stimulation by P1. After stimulation by the No. 4 peptide library, the antigen-specific T cell frequency of the spleen cells of the G3 group was significantly higher than that of the G2 and G4 groups after stimulation by P4 and LP4. There was no significant difference between the three groups in the stimulation of the No. 2 and No. 3 peptide libraries. When different peptide libraries were used as analysis factors, the overall comparison between the three groups showed that the G3 (ECVAC-A2-1.3) group was significantly better than the G2 and G4 groups, and there was no significant difference between the G2 and G4 groups.

[0316] 2. In vivo screening of ECVAC-A11 optimized sequences

[0317] The summary of HLA-A11.1 mouse single HLA epitope vaccine antigen-specific T cell frequency is shown in Table 20. The data were analyzed by IBM SPSS Statistics 25.0 statistical software, and the mean values of different peptide libraries were compared by One-Way ANOVA test; the overall comparison between groups was performed by Two-Way ANOVA test using Graphpad Prism 8 software, and p < 0.05 was considered to be significantly different. The statistical analysis results are shown in Table 21. The data are shown in Figure 14.

[0318] Table 20. Summary of HLA-A11.1 mouse single HLA epitope vaccine antigen-specific T cell frequency (Mean ± SD)

[0319] Unit: SFU / 2*10^5 cells

[0320] Table 21. Summary of p values of statistical analysis of HLA-A11.1 mouse single HLA epitope vaccine antigen-specific T cell frequency

[0321] Note: p values of p a p<0.05 compared with G2 group b p<0.05 compared with G3 group * p<0.05 ** p<0.01 *** p<0.001.

[0322] The experimental results showed that the antigen epitopes in the No. 2 long peptide library contained the most dominant antigen epitopes that stimulated HLA-A11.1 transgenic mice after vaccination, and positive reactions were also detected in the No. 1 and No. 3 long peptide libraries. The T cell frequencies of the four short peptide libraries and the No. 4 long peptide library were relatively low. After stimulation by the LP1 peptide library, the antigen-specific T cell frequency of the spleen cells of the G3 group mice was significantly higher than that of the G2 and G4 groups (p<0.05). After stimulation by the P4 and LP4 peptide libraries, the antigen-specific T cell frequency of the spleen cells of the G2 group mice was significantly higher than that of the G3 and G4 groups. Taking different peptide libraries as the analysis factor, the overall comparison between the three groups showed that the G3 (ECVAC-A11-1.3) group had the highest mean value, but there was no statistical difference between the groups.

[0323] 3. In vivo screening of ECVAC-A2 / 11 optimized sequences

[0324] The results of statistical analysis of HLA-A2.1 vaccine antigen-specific T cell frequency are shown in Table 22, and the data are shown in Figure 15. The data were analyzed using IBM SPSS Statistics 25.0 statistical software, and the mean values of different peptide libraries were compared between groups by One-Way ANOVA test. The Graphpad Prism 8 software was used for overall comparison between groups by Two-Way ANOVA test, and p<0.05 was considered to be significantly different.

[0325] The results showed that the antigen epitopes in the first peptide library (including short peptide P1 and / or long peptide LP1) contained the most dominant antigen epitopes that stimulated the production of HLA-A2.1 transgenic mice after vaccination, and positive reactions were also detected in the second and third peptide libraries (including short peptides and / or long peptides), among which the A2 / 11-P2 positive reaction was the weakest. After stimulation by the first peptide library (including P1 and LP1), the antigen-specific T cell frequency of the ECVAC-A2 / 11-1.2 group of mice was significantly higher than that of the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups (p<0.05). After stimulation by the A2 / 11-P2 peptide library, the antigen-specific T cell frequency of the ECVAC-A2 / 11-1.5 group of mice was significantly higher than that of the ECVAC-A2 / 11-1.4 group. When different peptide libraries were used as analysis factors, the overall comparison between the three groups showed that the ECVAC-A2 / 11-1.2 group was significantly better than the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups, and there was no significant difference between the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups.

[0326] Table 22. Summary of p values for statistical analysis of HLA-A2.1 mouse vaccine antigen-specific T cell frequency

[0327] Note: * p<0.05; ** p<0.01; *** p<0.001.

[0328] The results of statistical analysis of HLA-A11.1 vaccine antigen-specific T cell frequency are shown in Table 23, and the data are shown in Figure 16. The data were analyzed using IBM SPSS Statistics 25.0 statistical software, and the average values of different peptide libraries were compared by One-Way ANOVA test. The Graphpad Prism 8 software was used for overall comparison between groups by Two-Way ANOVA test, and p<0.05 was considered to be significantly different.

[0329] The results showed that positive reactions were detected in the No. 4, No. 5 and No. 6 peptide libraries (including short peptides and / or long peptides), and the A2 / 11-P5 positive reaction was the weakest. Due to the large individual differences within the group, the peptide library where the dominant epitope is located is not obvious. After stimulation by the A2 / 11-LP5 peptide library, the antigen-specific T cell frequency of the ECVAC-A2 / 11-1.4 group was significantly higher than that of the ECVAC-A2 / 11-1.5 group (p<0.05). Taking different peptide libraries as the analysis factor, the overall group comparison of the three groups showed that the mean of the ECVAC-A2 / 11-1.2 group was the highest, but there was no statistical difference with the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups.

[0330] Table 23. Summary of statistical analysis of HLA-A11.1 mouse vaccine antigen-specific T cell frequency p value table

[0331] Note: * p<0.05; ** p<0.01; *** p<0.001.

[0332] According to the above animal test results, among the three groups of ECVAC-A2 / 11 vaccine optimization sequences, the ECVAC-A2 / 11-1.2 group tested vaccine has the strongest immunogenicity in HLA-A2.1 mice, which is significantly better than the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups, and is slightly stronger than the ECVAC-A2 / 11-1.4 and ECVAC-A2 / 11-1.5 groups in HLA-A11.1 mice, but there is no statistical difference.

[0333] In summary, the ECVAC-A2 / 11-1.2 version performs the best in in vitro and in vivo screening tests, so the ECVAC-A2 / 11-1.2 is determined as the final candidate drug molecule, which is hereinafter referred to as ECVAC.

[0334] Example 10: In vitro pharmacodynamics study of ECVAC

[0335] Due to the mechanism of action of ECVAC, it requires specific human HLA and immune system to play a role, and the existing animal models have certain limitations in evaluating the pharmacodynamics of ECVAC. In order to simulate the biological activity of ECVAC in the human body, this study verified the expansion effect and killing activity of antigen-specific T cells of human PBMC under the action of ECVAC in vitro. In this study, 3 subjects (purchased from Shunshun Biological) were selected, whose HLA subtypes were HLA-A*02:01 or HLA-A*11:01, and CD14+ mononuclear cells were obtained by magnetic bead sorting of PBMC (EasySep CD14+ Human Monocyte Isolation Kit, StemCell)TM Human CD14 Positive Selection Kit II,Stemcell,17858) and T cells (EasySep TM Human TCell Iso Kit,Stemcell,17951), after inducing CD14+ monocytes into DC cells according to the conventional procedure (Ali, Muhammad et al. Nature protocols vol. 14, 6 (2019): 1926-1943.), the DC cells can express and present ECVAC antigens after co-incubation with ECVAC-mRNA-LNP. Then, the antigen-specific T cells can be induced and expanded in vitro by co-culturing the DC cells with the homologous T cells at a certain ratio (between 1:1 and 1:10). KYSE-410 is a human esophageal squamous cell carcinoma cell line with HLA-A*24:02. In order to evaluate the HLA-dependent tumor killing effect, HLA-A*02:01 and HLA-A*11:01 were overexpressed in the KYSE-410 cell line, which are referred to as KYSE-410-A2.1 and KYSE-410-A11.1, respectively. The expanded antigen-specific T cells were co-incubated with KYSE-410 cells with different HLA at different effector-to-target ratios to detect the killing effect of the antigen-specific T cells expanded by ECVAC on tumor cells.

[0336] The experimental results are shown in Figure 17. Among the 3 subjects, 1 subject with HLA-A*02:01 homozygous PBMCs showed strong T cell activation signals after in vitro expansion by ECVAC. DCs without antigen treatment were used as a control group (DC+T), and DCs co-incubated with ECVAC were used as a test group (DC+ECVAC-mRNA-LNP). Compared with the control group, the CD8+ T cells showed significant up-regulation of intracellular IFN-γ, TNF-α, CD107a, and Granzyme-B after overnight stimulation with the ECVAC antigen scanning peptide library added at the end of the test (Figure 3A). The IFN-γ positive cell population increased from 0.59% to 4.92%, the TNF-α positive cell population increased from 0.19% to 3.12%, the CD107a positive cell population increased from 54.44% to 81.30%, and the Granzyme-B positive cell population increased from 28.46% to 61.04%.

[0337] The results of cell killing showed (Fig. 17B and C) that the antigen-specific T cells expanded by ECVAC had significant killing effect on KYSE-410-A2.1, and increased with the increase of effector-target ratio, and the killing rate of tumor cells could reach 61.76% at a high effector-target ratio of 100:1. The control group without ECVAC had no killing effect, and both groups of cells had no killing effect on KYSE-410, indicating that this killing effect was a specific HLA-restricted and antigen-specific T cell-mediated killing reaction.

[0338] In summary, ECVAC can effectively expand antigen-specific T cells in human PBMC in vitro and exert strong anti-tumor effect, and in the absence of ideal animal models, the biological activity of ECVAC in humans is explored at the in vitro level.

[0339] Example 11: Ex vivo pharmacodynamic study of ECVAC

[0340] HLA-A2.1 transgenic mice express intergeneric hybrid class I MHC genes HHD, which contain the alpha-1 and alpha-2 domains of the human HLA-A2.1 gene and the alpha-3 transmembrane structure and cytoplasmic domain alleles of the mouse H-2Db gene. This transgenic mouse can simulate the immune response of T cells to HLA-A2.1-presented antigens and can be used to study the immune effect of HLA-restricted vaccines. HLA-A11.1 transgenic mice are the same as HLA-A2.1 transgenic mice except for the difference in HLA type. MC38 is a mouse colorectal cancer cell line commonly used for immune function studies of anti-tumor drugs. In this study, the endogenous MHC of MC38 cells was knocked out and the HLA-A*02:01 / H-2Db or HLA-A*11:01 / H-2Db chimeric gene was overexpressed to form MC38-A2.1-HHD and MC38-A11.1-HHD cell lines. On the basis of these two cell lines, the antigen fragments in ECVAC were further overexpressed to form MC38-A2.1-HHD-EC and MC38-A11.1-HHD-EC cell lines for in vitro killing activity studies.

[0341] HLA-A2.1 and HLA-A11.1 transgenic mice (purchased from Biosearch, item number 110110 and 112803) were injected intramuscularly with ECVAC LNP, with an interval of 7 days, for a total of 3 injections. At the same time, a control group was set up with the same immunization program, but injected with PBS. On the 3rd day after the last immunization, the mice were sacrificed, and the spleen was taken to prepare a single cell suspension, and T cells were sorted by magnetic beads. The above modified MC38 cell line was transfected with luciferase mRNA to indicate the target cells, and the sorted T cells were co-incubated with different target cells at different effector-to-target ratios for 24 hours, and the killing of target cells by effector cells after immunization was detected by luciferase activity.

[0342] The experimental results are shown in Figure 18. After the HLA-A2.1 transgenic mice were immunized with ECVAC, the T cells in the spleen could effectively kill MC38-A2.1-HHD-EC, and the killing efficiency could reach 79.65% at an effector-to-target ratio of 40:1, but had no killing effect on MC38-A2.1-HHD. Similarly, after the HLA-A11.1 transgenic mice were immunized with ECVAC, the T cells in the spleen could effectively kill MC38-A11.1-HHD-EC, and the killing efficiency could reach 73.28% at an effector-to-target ratio of 10:1, and 93.24% at an effector-to-target ratio of 40:1, but also had no killing effect on MC38-A11.1-HHD. The T cells of the PBS group of both HLA-A2.1 and HLA-A11.1 mice had no killing effect on the four target cells, indicating that this killing effect was an HLA-dependent killing reaction mediated by antigen-specific T cells.

[0343] In summary, both HLA-A2.1 and HLA-A11.1 transgenic mice immunized with ECVAC can produce specific T cells against ECVAC antigens and have in vitro anti-tumor activity.

[0344] Example 12: In vivo pharmacodynamic study of ECVAC

[0345] In order to evaluate the in vivo efficacy of ECVAC, this study used HLA-A2.1 and HLA-A11.1 transgenic mice (purchased from Biosearch, item number 110110 and 112803) to subcutaneously inject MC38-A2.1-HHD-EC or MC38-A11.1-HHD-EC tumor cells as an in vivo efficacy model to verify the in vivo tumor inhibition effect of ECVAC.

[0346] The mice were randomly divided into two groups on the 4th day after tumor-bearing, one group as the treatment group (Vaccine) was injected with ECVAC LNP by intramuscular injection, with an interval of 7 days, a total of 3 times. The other group was injected with PBS as the control group under the same immunization procedure. After grouping, the tumor volume was measured every 3 days, and the tumor growth inhibition rate TGITV(%) was calculated at the end of the experiment, TGITV(%) = 1-(T / C) x 100%, where T / C = treatment group evaluation TV / control group average TV (Tumor Volume).

[0347] The results are shown in Figure 19. On the 20th day after tumor-bearing, the average tumor volume of the ECVAC vaccine group was much smaller than that of the PBS control group in both HLA-A2.1 and HLA-A11.1 transgenic mice. The TGITV of the ECVAC vaccine group in HLA-A2.1 mice was 79.56% (P = 0.0012), and the TGITV of the ECVAC vaccine group in HLA-A11.1 mice was 83.61% (P = 0.0018).

[0348] In summary, in both HLA-A2.1 and HLA-A11.1 tumor-bearing mouse models, the in vivo tumor inhibition effect of ECVAC was demonstrated, indicating that ECVAC can be used for tumor treatment in HLA subtypes HLA-A*02:01 or HLA-A*11:01.

[0349] Example 13: In vivo pharmacodynamic study of ECVAC combined with anti-PD-1 antibody

[0350] MC38-A2.1-HHD-EC cells were inoculated subcutaneously on the flank of HLA-A2.1 Tg mice (purchased from Baoaishitu, item number 110110, a total of 69) (the inoculation day was recorded as D0). Starting from D4, 34 animals were randomly immunized with ECVAC LNP, referred to as ECVAC, and the remaining 35 animals were immunized with empty LNP, referred to as LNP, each animal was immunized with 2 μg, and the second and third immunization times were D11 and D18. When the average tumor volume reached 60 mm 3At the left time (D11), the immunized ECVAC and LNP animals were randomly divided into 6 groups according to the tumor volume for drug treatment (the grouping day was recorded as PG-D0), which were LNP+Isotype Ab 1.6 mg / kg (G1), ECVAC+Isotype Ab 1.6 mg / kg (G2), LNP+anti-mPD-1 0.4 mg / kg (G3), LNP+anti-mPD-1 1.6 mg / kg (G4), ECVAC+anti-mPD-1 0.4 mg / kg (G5), and ECVAC+anti-mPD-1 1.6 mg / kg (G6) groups, with 6 animals in each group. The animals in G1 to G6 groups were administered with Isotype Ab or anti-mPD-1 via the tail vein, once every 4 days, for a total of 4 times. The tumor volume and body weight of the mice were measured 3 times per week after grouping and drug administration. The tumor growth inhibition rate (TGI) of the treatment groups was calculated and statistically analyzed.

[0351] After grouping and drug administration, the mice in each group had normal food and water intake, no significant downward trend in body weight, no abnormal performance, and good general condition. By the end of the experiment (PG-D19), compared with LNP+Isotype Ab 1.6 mg / kg (G1), the TGI (%) of ECVAC+Isotype Ab 1.6 mg / kg (G2), LNP+anti-mPD-1 0.4 mg / kg (G3), LNP+anti-mPD-1 1.6 mg / kg (G4), ECVAC+anti-mPD-1 0.4 mg / kg (G5), and ECVAC+anti-mPD-1 1.6 mg / kg (G6) groups were 55%, 55%, 60%, 68%, and 75%, respectively. Statistical analysis results showed that, at PG-D19, the tumor volume of each treatment group was significantly lower than that of the control group (P<0.05) except for LNP+anti-mPD-1 0.4 mg / kg (G3). The tumor inhibition effect of the combination group was better than that of the single-drug group, which suggested that the combination of ECVAC and anti-mPD-1 had better tumor inhibition effect than ECVAC or anti-mPD-1 single drug. The tumor growth curve is shown in FIG. 20, and the tumor growth inhibition effect is summarized in Table 24. TV TV (%) respectively. Statistical analysis results showed that, at PG-D19, the tumor volume of each treatment group was significantly lower than that of the control group (P<0.05) except for LNP+anti-mPD-1 0.4 mg / kg (G3). The tumor inhibition effect of the combination group was better than that of the single-drug group, which suggested that the combination of ECVAC and anti-mPD-1 had better tumor inhibition effect than ECVAC or anti-mPD-1 single drug. The tumor growth curve is shown in FIG. 20, and the tumor growth inhibition effect is summarized in Table 24.

[0352] Table 24. Tumor inhibition effect of test substances

[0353] Note: a. Mean ± standard error; b. Compared with G1 group; c. G5 compared with G3 group, G6 compared with G4 group; d. G6, G5 compared with G2 group.

[0354] In summary, in the MC38-A2.1-HHD-ECVAC tumor-bearing model, both the single-drug group and the combination group had significant tumor inhibition effect; ECVAC and anti-mPD-1 combination had better tumor inhibition effect than single use of ECVAC or anti-mPD-1. In addition, tumor-bearing animals had good tolerance to all test drugs.

[0355] incorporated by reference

[0356] The entire contents of each patent and scientific document referred to herein is incorporated by reference for all purposes.

[0357] equivalents

[0358] The present disclosure can be embodied in other specific ways without departing from the spirit or essential characteristics thereof. Therefore, the above embodiments should be regarded as illustrative in all respects, rather than restrictive. Accordingly, the scope of the present disclosure is indicated by the appended claims rather than by the description preceding them and all changes that come within the meaning and range of equivalents are intended to be embraced therein.

Claims

1. A polypeptide comprising one or more antigen targeting fragments, the antigen targeting fragments comprising one or more antigenic epitope peptides, and the one or more antigen targeting fragments are connected by a connecting peptide, wherein the antigen is selected from one or more of ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10 and MAGEA11; preferably, the antigen further comprises one or more of TP53.175R / H, TP53.220Y / C, PIK3CA.545E / K and KRAS.12G / D.

2. The polypeptide of claim 1, wherein the antigen targeting fragments comprise an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-162.

3. The polypeptide of claim 1, wherein the polypeptide comprises: 1) 20 antigen targeting fragments each comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 108-127; 2) 20 antigen targeting fragments each comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 128-147; or 3) 15 antigen targeting fragments each comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 148-162.

4. The polypeptide of claim 1, wherein the antigenic epitope peptides comprise an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-107 or SEQ ID NOs: 163-225.

5. The polypeptide of claim 1, comprising: (1) an antigenic epitope peptide targeting ACTL8, the antigenic epitope peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 or 7; (2) an antigenic epitope peptide targeting SMC1B, the antigenic epitope peptide comprising an amino acid sequence of SEQ ID NO: 28; (3) an antigenic epitope peptide targeting FOXI3, the antigenic epitope peptide comprising an amino acid sequence of SEQ ID NO: 12; (4) an antigenic epitope peptide targeting GNGT1, the antigenic epitope peptide comprising an amino acid sequence of SEQ ID NO: 13; (5) an antigenic epitope peptide targeting PLAC1, the antigenic epitope peptide comprising: (i) an amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 163; (ii) an amino acid sequence of SEQ ID NO: 164; and (iii) an amino acid sequence of SEQ ID NO: 165; (6) an antigenic epitope peptide targeting BRDT, the antigenic epitope peptide comprising an amino acid sequence of SEQ ID NO: 9; (7) an antigenic epitope peptide targeting MAGEA1, the antigenic epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, or SEQ ID NO: 169; (8) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising: (i) an amino acid sequence set forth in SEQ ID NO: 19, SEQ ID NO: 70, SEQ ID NO: 170, SEQ ID NO: SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and (ii) an amino acid sequence set forth in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, or SEQ ID NO: 176; (9) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising: (i) an amino acid sequence set forth in SEQ ID NO: 177, SEQ ID NO: 178, or SEQ ID NO: 179; and (ii) an amino acid sequence set forth in SEQ ID NO: 180; (10) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising: (i) an amino acid sequence set forth in SEQ ID NO: 181, SEQ ID NO: 182, or SEQ ID NO: 183; and (ii) an amino acid sequence set forth in SEQ ID NO: 184; (11) an antigenic epitope peptide targeting MAGEA11, the antigenic epitope peptide comprising: (i) an amino acid sequence set forth in SEQ ID NO: 185, SEQ ID NO: 186, or SEQ ID NO: 187; and (ii) an amino acid sequence set forth in SEQ ID NO: 15, SEQ ID NO: 188, or SEQ ID NO: 189; (12) an antigenic epitope peptide targeting MAGEA10, the antigenic epitope peptide comprising: (i) an amino acid sequence set forth in SEQ ID NO: 14, SEQ ID NO: 190, SEQ ID NO: 191, or SEQ ID NO: 192; and (ii) an amino acid sequence set forth in SEQ ID NO: 193, or SEQ ID NO: 194; (13) an antigenic epitope peptide targeting TP53.175R / H, the antigenic epitope peptide comprising an amino acid sequence set forth in SEQ ID NO: 195; and (14) an antigenic epitope peptide targeting TP53.220Y / C, the antigenic epitope peptide comprising an amino acid sequence set forth in SEQ ID NO:

196.

6. The polypeptide of claim 1, comprising: (1) an antigenic epitope peptide targeting SMC1B, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 93, SEQ ID NO: 101, or SEQ ID NO: 106; and (ii) the amino acid sequence set forth in SEQ ID NO: 104; (2) an antigenic epitope peptide targeting BRDT, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 42 or SEQ ID NO: 46; and (ii) the amino acid sequence set forth in SEQ ID NO: 50; (3) an antigenic epitope peptide targeting GNGT1, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 54 and SEQ ID NO: 55; (4) an antigenic epitope peptide targeting FOXI3, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 53; (5) an antigenic epitope peptide targeting ACTL8, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 40 and SEQ ID NO: 31; (6) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 73 or SEQ ID NO: 78; and (ii) the amino acid sequence set forth in SEQ ID NO: 74; (7) an antigenic epitope peptide targeting MAGEA11, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 59 and SEQ ID NO: 60; (8) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 197 and SEQ ID NO: 65; (9) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 71 and SEQ ID NO: 72; (10) an antigenic epitope peptide targeting MAGEA10, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 57; (11) an antigenic epitope peptide targeting MAGEA1, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO: 198; and (ii) the amino acid sequence set forth in SEQ ID NO: 199, SEQ ID NO: 200, or SEQ ID NO: 201; (12) an antigenic epitope peptide targeting PIK3CA.545E / K, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO: 202; and (13) an antigenic epitope peptide targeting KRAS.12G / D, the antigenic epitope peptide comprising the amino acid sequence set forth in SEQ ID NO:

203.

7. The polypeptide of claim 1, comprising: (1) an antigenic epitope peptide targeting ACTL8, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; and (ii) the amino acid sequence set forth in SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 34, or SEQ ID NO: 40; (2) an antigenic epitope peptide targeting GNGT1, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 54; and (ii) the amino acid sequence set forth in SEQ ID NO: 55; (3) an antigenic epitope peptide targeting MAGEA1, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, or SEQ ID NO: 219; and (ii) the amino acid sequence set forth in SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 63, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 220, SEQ ID NO: 221, or SEQ ID NO: 222; (4) an antigenic epitope peptide targeting MAGEA6, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 208 or SEQ ID NO: 77; (ii) the amino acid sequence set forth in SEQ ID NO: 180 or SEQ ID NO: 223; and (iii) the amino acid sequence set forth in SEQ ID NO: 209; (5) an antigenic epitope peptide targeting MAGEA3, the antigenic epitope peptide comprising: (i) the amino acid sequence set forth in SEQ ID NO: 67; (ii) the amino acid sequence set forth in SEQ ID NO: 210, SEQ ID NO: 211, or SEQ ID NO: 212; (iii) the amino acid sequence set forth in SEQ ID NO: 213; and (iv) the amino acid sequence set forth in SEQ ID NO: 184 or SEQ ID NO: 65; (6) an antigenic epitope peptide targeting SMC1B, the antigenic epitope peptide comprising: (i) an amino acid sequence represented by SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 185, SEQ ID NO: 94, SEQ ID NO: 105, SEQ ID NO: 95, or SEQ ID NO: 89; (ii) an amino acid sequence represented by SEQ ID NO: 81 or SEQ ID NO: 99; and (iii) an amino acid sequence represented by SEQ ID NO: 27 or SEQ ID NO: 80; (7) an antigenic epitope peptide targeting MAGEA4, the antigenic epitope peptide comprising: (i) an amino acid sequence represented by SEQ ID NO: 70, SEQ ID NO: 19, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, or SEQ ID NO: 173; and (ii) an amino acid sequence represented by SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, or SEQ ID NO: 214; (8) an antigenic epitope peptide targeting MAGEA11, the antigenic epitope peptide comprising an amino acid sequence represented by SEQ ID NO: 15, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 58, or SEQ ID NO: 60; (9) an antigenic epitope peptide targeting BRDT, the antigenic epitope peptide comprising an amino acid sequence represented by SEQ ID NO: 11, SEQ ID NO: 43, or SEQ ID NO:

45.

8. The polypeptide of any one of claims 1 to 7, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 226-228.

9. The polypeptide of claim 1, further comprising a Th cell epitope PADRE and a major histocompatibility complex (MHC) class I transmembrane and trafficking domain (MITD) at the C-terminus of the polypeptide.

10. The polypeptide of claim 1, comprising a signal peptide at the N-terminus of the polypeptide.

11. The polypeptide of claim 1, wherein the linker peptide is a sequence represented by SEQ ID NOs: 235-236.

12. The polypeptide of any one of claims 1 to 11, wherein the polypeptide is selected from the group consisting of an amino acid sequence represented by SEQ ID NOs: 229-231.

13. A linear epitope peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NOs: 1-107 and SEQ ID NOs: 163-225; preferably, the epitope peptide targets one or more antigens selected from the group consisting of ACTL8, BRDT, FOXI3, GNGT1, SMC1B, PLAC1, MAGEA1, MAGEA3, MAGEA4, MAGEA6, MAGEA10, and / or MAGEA11.

14. The linear epitope peptide of claim 13, selected from one or more of: (1) a linear epitope peptide targeting ACTL8 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-7 and SEQ ID NOs: 29-41; (2) a linear epitope peptide targeting BRDT comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-11 and SEQ ID NOs: 42-52; (3) a linear epitope peptide targeting FOXI3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 12 and SEQ ID NO: 53; (4) a linear epitope peptide targeting GNGT1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13 and SEQ ID NOs: 54-56; (5) a linear epitope peptide targeting SMC1B comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 24-28, SEQ ID NOs: 79- 107, and SEQ ID NO: 185; (6) a linear epitope peptide targeting PLAC1 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 23 and SEQ ID NOs: 163-165; (7) a linear epitope peptide targeting MAGEA1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 16-17, SEQ ID NOs: 61-63, SEQ ID NOs: 166-169, SEQ ID NOs: 198-201, and SEQ ID NOs: 204-207; (8) a linear epitope peptide targeting MAGEA3 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NOs: 64-68, SEQ ID NOs: 181-184, SEQ ID NO: 197, and SEQ ID NOs: 210-213; (9) a linear epitope peptide targeting MAGEA4 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-21, SEQ ID NOs: 69-72, SEQ ID NOs: 170-176, SEQ ID NO: 214, and SEQ ID NOs: 224-225; (10) a linear epitope peptide targeting MAGEA6 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 22, SEQ ID NOs: 73-78, SEQ ID NOs: 177-180, SEQ ID NOs: 208-209, and SEQ ID NO: 223; (11) a linear epitope peptide targeting MAGEA10 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 14, SEQ ID NO: 57, and SEQ ID NOs: 190-194; and (12) a linear epitope peptide targeting MAGEA12 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO:

58. ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ (12) a linear epitope peptide targeting MAGEA11 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 15, SEQ ID NOs: 58-60, and SEQ ID NOs: 185-189.

15. A nucleic acid comprising a nucleotide sequence encoding the polypeptide of any one of claims 1-12 or the linear epitope peptide of any one of claims 13-14.

16. An RNA nucleic acid molecule comprising an open reading frame encoding the polypeptide of any one of claims 1-12; preferably, the RNA nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 237-256.

17. A tumor-associated antigen vaccine comprising the RNA nucleic acid molecule of claim 16; preferably, the RNA nucleic acid molecule is an mRNA; preferably, the vaccine is prepared using a lipid nanoparticle (LNP).

18. A pharmaceutical composition comprising the polypeptide of any one of claims 1-12, the linear epitope peptide of any one of claims 13-14, the nucleic acid of claim 15, the RNA nucleic acid molecule of claim 16, or the tumor-associated antigen vaccine of claim 17.

19. Use of the polypeptide of any one of claims 1-12, the linear epitope peptide of any one of claims 13-14, the nucleic acid of claim 15, the RNA nucleic acid molecule of claim 16, the tumor-associated antigen vaccine of claim 17, or the pharmaceutical composition of claim 18 in the manufacture of a medicament for treating and preventing a disease in a subject; preferably, the disease is selected from the group consisting of esophageal squamous carcinoma, lung squamous carcinoma, hepatocellular carcinoma, gastric carcinoma, lung adenocarcinoma, colon carcinoma, and rectal carcinoma; preferably, the subject is preferably a human.

Images