Porcine circovirus type 3 cap protein and related product thereof
Patent Information
- Application Number
- PCT/CN2025/092883
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-07
- Filing Date
- 2025-05-06
- Publication Date
- 2025-11-13
Smart Images

Figure CN2025092883_13112025_PF_FP_ABST
Abstract
Description
Cap protein of porcine circovirus type 3 and related products Cross-reference to related applications This application, filed with the Chinese Patent Office on May 7, 2024, application number [Application Number Missing] Priority is given to Chinese patent application 202410556985X, entitled "Cap protein of porcine circovirus type 3 and related products thereof," the entire contents of which are incorporated herein by reference. Technical Field
[0001] This application relates to the field of veterinary biological products technology, specifically providing a porcine circovirus type 3 Cap protein and related products. Background Technology
[0002] Porcine circovirus (PCV) belongs to the Circoviridae family and is the smallest DNA virus. Before 2015, PCV1 and PCV2 were considered the only known porcine circoviruses. PCV1 is a cell culture-derived virus and is non-pathogenic to pigs. PCV2 is the main pathogen of porcine circovirus-associated disease (PCVAD), causing significant losses to the global swine industry. PCV3 was first reported in the United States in 2015 and has since been detected in several other countries. Similar to PCV2, PCV3 can cause PCVAD and can lead to secondary infections with other viruses and bacteria, causing severe illness and significant harm to the swine industry. Currently, vaccination is the main strategy for controlling PCV3. However, PCV3 and PCV2 have poor homology, and PCV2 vaccines do not provide cross-protection against PCV3. Furthermore, PCV3 is difficult to isolate and culture in vitro, making it difficult to obtain live virus suitable for inactivated vaccine preparation; therefore, there are currently no commercially available vaccines for PCV3.
[0003] Porcine circoviruses (PCV3) are small, self-replicating DNA viruses, primarily consisting of two reading frames, ORF1 and ORF2, encoding a replicase (Rep) and an outer membrane protein (Cap), respectively. Like PCV1 and PCV2, the Cap protein is the only capsid protein encoded by PCV3's ORF2. The 1-32 amino acids of the Cap protein form the main nuclear localization signal region, mediating Cap protein entry into the nucleus and its participation in DNA replication. As the only structural protein and a protective antigen, the Cap protein can self-assemble into virus-like particles; therefore, expressing the Cap protein is an important direction for PCV3 vaccine research. Currently, most researchers use prokaryotic expression systems to express Cap. However, achieving soluble expression of the full-length Cap protein in *E. coli* is difficult; most methods involve removing the NLS region. While this achieves protein expression, the assembly effect is poor, and due to the lack of necessary modifications, immunogenicity is poor, failing to meet the requirements for immune protection. Some researchers have also used yeast expression systems to express Cap, achieving soluble protein expression, but at a low level. Baculoviruses are widely used for the expression of exogenous proteins due to their ease of manipulation, ability to modify proteins, and low cost. Some researchers have attempted to express full-length Cap and NLS-deficient regions on baculoviruses, but the expression levels were low in both cases. Summary of the Invention
[0004] This application obtains a highly expressed and highly assembled recombinant baculovirus strain by locally truncating the NLS region.
[0005] One of the purposes of this application is to provide a Cap protein of porcine circovirus type 3 (PCV3).
[0006] One of the purposes of this application is to provide a PCV3 virus-like particle antigen.
[0007] One of the purposes of this application is to provide a PCV3 virus-like particle vaccine.
[0008] One of the purposes of this application is to provide the use of PCV3 virus-like particle antigen in the preparation of drugs for the prevention of porcine circovirus-related diseases.
[0009] To achieve the above objectives, this application adopts the following technical solution:
[0010] This application relates to a Cap protein of porcine circovirus type 3 (PCV3), wherein the Cap protein is a truncated Cap protein with NLS region 8-16aa. Preferably, the amino acid sequence of the Cap protein is shown in SEQ ID NO.2.
[0011] This application relates to a PCV3 virus-like particle antigen, which is the Cap protein as described above.
[0012] Biomaterials related to the Cap protein described above, wherein the biomaterials include any of the following:
[0013] (1) The nucleic acid fragment encoding the Cap protein;
[0014] (2) An expression cassette containing the nucleic acid fragments in (1);
[0015] (3) A vector containing the nucleic acid fragment in (1) or the expression cassette in (2);
[0016] (4) Recombinant cells containing the nucleic acid in (1), the expression cassette in (2), or the vector in (3);
[0017] Preferably, the nucleic acid fragment encoding the Cap protein has the nucleotide sequence shown in SEQ ID NO.1.
[0018] This application relates to a PCV3 virus-like particle vaccine, wherein the virus-like particle vaccine comprises an immunizing dose of the PCV3 virus-like particle antigen and a pharmaceutically acceptable carrier.
[0019] As one embodiment of this application, in the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen is ≥30μg / ml.
[0020] As one embodiment of this application, in the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen is 30 μg / ml to 100 μg / ml.
[0021] In the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen may also be selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.
[0022] Furthermore, the pharmaceutically acceptable carrier includes at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives;
[0023] Preferably, the adjuvant comprises one or more of the following: aluminum gel adjuvant, saponin, avrididine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, and muramyl dipeptide.
[0024] Preferably, the concentration range of the adjuvant is from 5% V / V to 60% V / V, more preferably from 30% V / V to 60% V / V, and even more preferably 50% V / V;
[0025] Preferably, the freeze-drying protectant is selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids;
[0026] Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.
[0027] Compared with the prior art, the technical effects of this application are as follows:
[0028] This application utilizes an insect baculovirus expression system to express the PCV3 Cap protein to prepare virus-like particles. Initial attempts included truncating the entire NLS region sequence, but this resulted in poor virus-like particle assembly. Further attempts involved truncating NLS region segments 1-22aa, which improved assembly but resulted in low expression levels, insufficient for vaccine preparation. A first attempt at truncating Cap protein NLS region segments 8-16aa unexpectedly yielded results: it did not affect Cap protein virus-like particle assembly and formation, and the protein was expressed at a high level, providing a possibility for the preparation of a virus-like particle vaccine against PCV3. Attached Figure Description
[0029] Figure 1 shows the electron microscopy results of PCV3-ΔNLS1 protein. Detailed Implementation
[0030] The following explanations are provided for the relevant terms used in this application:
[0031] An antigen is a substance that can induce an immune response in the body. It is a substance that can be specifically recognized and bound by antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activate T / B cells, cause them to proliferate and differentiate, produce immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products in vivo and in vitro.
[0032] "Virus-like particles (VLPs)" are particles assembled from one or more viral structural proteins. They have an external structure and antigenicity similar to virus particles, but do not contain viral genes.
[0033] The terms “vaccine” and “vaccine composition” refer to a pharmaceutical composition containing PCV3 virus-like particle antigen, which can induce, stimulate or enhance an immune response against PCV3 in pigs.
[0034] The term "immunogenic dose" should be understood as "immunely effective dose," also known as immune protective dose or effective dose to elicit an immune response. It refers to the amount of antigen that can effectively induce an immune response in a recipient, sufficient to prevent or improve the signs or symptoms of disease, including adverse health effects or complications thereof. This immune response may be sufficient for diagnostic purposes or other tests, or may be suitable for preventing signs or symptoms of disease, including adverse health outcomes or complications of infection caused by a pathogen. Humoral immunity or cell-mediated immunity, or both, may be induced. An animal's immune response to an immunogenic composition can be indirectly assessed, for example, by measuring antibody titers, lymphocyte proliferation analysis, or directly assessed by monitoring signs or symptoms after challenge with a wild-type strain. The protective immunity provided by the immunogenic composition can be assessed by measuring, for example, clinical signs in the test animal such as a decrease in healthy litters, an increase in stillbirths, the overall physiological condition and overall health and performance of the test animal. The immune response may include, but is not limited to, the induction of cellular and / or humoral immunity.
[0035] The term "pharmaceutically acceptable carrier" refers to any carrier or diluent in the vaccine composition of this application, other than the porcine circovirus antigen, that does not irritate the body or impede the biological activity and properties of the compound, preferably an adjuvant. The term "adjuvant" may include aluminum gel adjuvants; saponins, such as Quil A, QS-21 (Cambridge Biotech Incorporation, Cambridge MA), and GPI-0100 (Galenica Pharmaceuticals Incorporation, Birmingham AL); water-in-oil emulsions; oil-in-water emulsions; water-in-oil-in-water emulsions; polymers of acrylic acid or methacrylic acid; and compounds selected from copolymers of maleic anhydride and alkenyl derivatives. The term "emulsion" may be particularly based on light liquid paraffin oils (European Pharmacopea type); isoprenoid oils resulting from olefin oligomerization, such as squalane or squalene oils, especially isobutylene or decanene; esters of acids or alcohols containing linear alkyl groups, more particularly vegetable oils, ethyl oleate, propylene glycol di-(octanoate / decanoate), glyceryl tri-(octanoate / decanoate), or propylene glycol dioleate; esters of branched fatty acids or alcohols, especially isostearates. Oils are used in combination with emulsifiers to form emulsions. Emulsifiers are preferably nonionic surfactants, especially esters of sorbitan, esters of mannitol (such as anhydrous mannitol oleate), esters of aliphatic glycols, esters of polyglycerol, esters of propylene glycol, and esters of oleic acid, isostearic acid, castor oil, or hydroxystearic acid. These may be ethoxylated, as well as polyoxypropylene-polyoxyethylene block copolymers, especially Pluronic products, particularly L121. See Hunter et al., *The Theory and Practical Application of Adjuvants* (Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94) and Todd et al., *Vaccine* (1997, 15: 564-570). For example, the SPT emulsion described on page 147 and the MF59 emulsion described on page 183 of Vaccine design, the Subunit and adiuvant approach, in Powell M and Newman M (Plenum Press, 1995) can be used.The term "polymer of acrylic acid or methacrylic acid" preferably refers to crosslinked acrylic acid or methacrylic acid polymers, especially those crosslinked with polyolefin ethers or polyols of sugar, compounds known as Carbomer (trade name Carbopol) (Phameuropa, 1996, 8(2)). Those skilled in the art may also refer to U.S. Patent US2909462, which describes such acrylic polymers crosslinked with polyhydroxylated compounds having at least three hydroxyl groups, preferably no more than eight, wherein the hydrogen atoms of at least three hydroxyl groups are replaced by unsaturated aliphatic radicals having at least two carbon atoms. Preferred groups are those containing 2-4 carbon atoms, such as vinyl, allyl, and other ethylenically unsaturated groups. These unsaturated groups may themselves contain other substituents, such as methyl groups. These products are sold under the name Carbopol (BF Goodrich, Ohio, USA), which is particularly suitable. They are crosslinked with allyl sucrose or with allyl pentaerythritol. This may include Carbopol 974P, 934P, and 971P, with Carbopol 971P being the most preferred. The term "copolymer of maleic anhydride and alkenyl derivatives" may also refer to EMA (Monsanto), a copolymer of maleic anhydride and ethylene. These polymers dissolve in water to produce an acidic solution, which is neutralized, preferably to physiological pH, to produce an adjuvant solution into which immunogenic, immunizing, or vaccine-like compositions can be incorporated. The term "adjuvant" also includes, but is not limited to, the RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli (recombinant or other), cholera toxin, IMS1314, muramyl dipeptide, gel adjuvant, etc. Preferably, the adjuvant comprises one or more of the following: mineral oil, aluminum gel adjuvant, saponin, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, muramyl dipeptide, Montanide ISA 206, Montanide ISA 201, or gel adjuvant.
[0036] The term "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, it is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, and cosmids.
[0037] The term "assembly" refers to the process by which structural proteins of a virus (such as capsid proteins) interact with each other or with nucleic acids to form regular granular structures. This includes the assembly of natural viral particles and the assembly of virus-like particles.
[0038] As one embodiment of this application, in the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen is ≥30μg / ml.
[0039] As one embodiment of this application, in the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen is 30 μg / ml to 100 μg / ml.
[0040] As one embodiment of this application, in the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen is 50 μg / ml.
[0041] In the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen may also be selected from 30 μg / ml to 50 μg / ml, or 50 μg / ml to 100 μg / ml.
[0042] In the virus-like particle vaccine of this application, the content of PCV3 virus-like particle antigen may be, but is not limited to, 30 μg / ml, 40 μg / ml, 50 μg / ml, 60 μg / ml, 70 μg / ml, 80 μg / ml, 90 μg / ml or 100 μg / ml.
[0043] In some embodiments, pharmaceutically acceptable carriers include at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives.
[0044] Preferably, the adjuvant comprises one or more of the following: aluminum gel adjuvant, saponin, avrididine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS1314, and muramyl dipeptide.
[0045] In some embodiments, the concentration range of the adjuvant is from 5% V / V to 60% V / V, preferably from 30% V / V to 60% V / V, and more preferably 50% V / V.
[0046] In some embodiments, the freeze-drying protectant is selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids.
[0047] Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.
[0048] To prepare such a vaccine, methods known in the art can be used.
[0049] The vaccine described in this application can be prepared into oral or non-oral formulations.
[0050] Preferred are non-oral formulations that can be administered via intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, or epidural routes.
[0051] This application also relates to the use of the virus-like particle antigen in the preparation of a drug for preventing porcine circovirus-related diseases, wherein the porcine circovirus-related diseases are diseases caused by infection with porcine circovirus type 3.
[0052] As one embodiment of this application, the application of the preparation of drugs for preventing porcine circovirus-related diseases is as follows: the application of drugs for preventing multisystemic wasting syndrome in weaned piglets, porcine dermatitis-nephropathy syndrome, proliferative necrotizing pneumonia, reproductive disorders, and inflammatory responses in the heart and multiple systems.
[0053] The term "porcine circovirus-associated disease" as used in this application refers to diseases caused by infection with porcine circovirus type 3. This includes, but is not limited to, porcine dermatitis-nephropathy syndrome, reproductive disorders, and inflammatory responses in the heart and multiple systems.
[0054] The term "prevention" in relation to porcine circovirus type 3 infection-related diseases refers to inhibiting the replication of porcine circovirus type 3, inhibiting the spread of porcine circovirus type 3, or preventing porcine circovirus type 3 from settling in its host, as well as alleviating the symptoms of porcine circovirus type 3 infection or disease.
[0055] The present application will be further described below with reference to specific embodiments, and the advantages and features of the present application will become clearer with the description. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present application without departing from the spirit and scope of the present application, but such modifications and substitutions all fall within the protection scope of the present application.
[0056] All chemical reagents used in the embodiments of this application are of analytical grade and were purchased from Sinopharm Group. Unless otherwise specified, the experimental methods described in this application are conventional methods; and the biological materials described are commercially available unless otherwise specified.
[0057] Example 1: Construction of donor plasmid
[0058] The codons of the PCV3-Cap sequence (Genome Accession Number: KX898030.1) were optimized and synthesized by Genewiz Biotechnology Co., Ltd. The NLS region from line 8 to 16 aa was truncated to form a variant sequence of Cap, named △NLS1.
[0059] 1. Experimental Materials
[0060] Restriction endonucleases were purchased from Thermo Fisher Scientific; gel extraction kits were purchased from Omega Biotech; DNA polymerase was purchased from TaKaRa Biotech; plasmid miniprep kits were purchased from Tiangen Biotech; T4 DNA Ligase was purchased from Thermo Fisher Scientific; and Trans1-T1 competent cells were purchased from Beijing TransGen Biotech Co., Ltd.
[0061] 2. Experimental Methods
[0062] 2.1 Obtaining the target gene
[0063] The sequence codons of PCV3-Cap were optimized. Using the optimized PCV3-Cap as a template, the gene sequence of △NLS1 (SEQ ID NO.1) was amplified using primers △NLS1-F: CGCGGATCCATGAGACACAGAGCTATATTCCGACGCCACAGAAGGCGCTATGC; △NLS1-R: CCCAAGCTTTTAGAGAACGGACTTGTAACGAATCCAAAC.
[0064] 2.2 Construction and Identification of Recombinant Donor Plasmids
[0065] 2.2.1 Construction of recombinant donor plasmid
[0066] The amplified variant sequence △NLS1 and pFastBacI vector were double-digested with BamHI and HindIII, the target fragment and vector were recovered, and ligated at 22℃ for 1 h. The ligation product was then transformed into Trans1-T1 competent cells.
[0067] 2.2.2 Identification of recombinant donor plasmids
[0068] The transformed bacterial culture was spread on a plate containing ampicillin resistance and incubated at 37°C for 12 h. Single colonies were picked and inoculated into 3 mL of LB liquid medium containing 100 μg / mL ampicillin. The culture was incubated at 37°C with shaking at 200 rpm for 12 h. The plasmid was extracted and identified by double digestion with BamHI and HindIII. A specific band of about 620 bp was observed in pFastBacI-△NLS1, while no target band was observed in the empty vector. Therefore, the recombinant donor plasmid containing the △NLS1 gene was successfully constructed, and the correctly identified plasmid was named pFBI-△NLS1.
[0069] Example 2: Obtaining PCV3-ΔNLS1 recombinant Bacmid
[0070] 1. Experimental Materials
[0071] PureLink TM HiPure plasmid extraction kit; DH10Bac competent cells were purchased from Thermo Fisher Scientific.
[0072] 2. Experimental Methods
[0073] The pFBI-△NLS1 recombinant donor plasmid constructed in Example 1 was transformed into DH10Bac competent cells and cultured at 37℃ with shaking at 220r / min for 4h. 100μL of the bacterial culture was then spread onto LB solid medium containing three types of antibiotics: kanamycin, tetracycline, and gentamicin, as well as IPTG and X-gal.
[0074] Incubate at 37℃ for 48 hours. When the blue and white spots are obvious, pick a single white colony and streak it in sections. Incubate at 37℃ for 24 hours.
[0075] White single colonies were selected for colony PCR identification using Bac-M13 primers. Blue colonies (untransposonized) served as a control. The correctly identified bacterial solutions were transferred at a ratio of 1:100 to LB liquid medium containing kanamycin, tetracycline, and gentamicin. The medium was incubated at 37°C with shaking at 220 rpm for 16 h, and recombinant Bacmid was extracted.
[0076] 3. Experimental Results
[0077] PCR using Bac-M13 primers revealed a target band of approximately 3000 bp in lane △NLS1, while the negative control showed a band of approximately 300 bp. This indicates that the recombinant Bacmid of PCV3-△NLS1 was successfully obtained and named Bac-△NLS1.
[0078] Example 3: Rescue of PCV3-△NLS1 Recombinant Baculovirus
[0079] 1. Experimental Materials
[0080] Cellfectin II Reagent transfection reagent was purchased from Invitrogen, DNA extraction kit was purchased from Qiagen, and 2×Taq premixed enzyme was purchased from Tiangen.
[0081] 2 Experimental Methods
[0082] Seed cells, 3 × 10⁶ cells per T25 cell flask 6 Each cell.
[0083] The PCV3-△NLS1 recombinant Bacmid obtained in Example 2 and the wild-type baculovirus Bacmid (control) were transfected into cells according to the transfection reagent instructions. At the same time, normal cells were set up as a control. The lesions were observed every day. When the lesions were obvious, the supernatant was collected, which was the P1 generation.
[0084] The harvested P1 generation virus was inoculated at an MOI of 1 until it contained 3 × 10⁻⁶ cells / mL. 6 In a flask containing T25 cells, when the disease reaches about 80%, the supernatant is collected as P2 generation.
[0085] Nucleic acid was extracted from the P2 generation recombinant baculovirus and identified by PCR using Bac-M13 primers.
[0086] 3. Results
[0087] The extracted P2 generation nucleic acid was identified by PCR using Bac-M13 primers. A target band of about 3000 bp was found in the △NLS1 lane, while a band of about 300 bp was found in the wild-type control group. This indicates that the recombinant △NLS1 baculovirus was successfully rescued and named rAC-PCV3-△NLS1.
[0088] Example 4: Expression and identification of PCV3-ΔNLS1 protein
[0089] 1. Identification of recombinant proteins
[0090] After harvesting the P2 generation recombinant baculovirus, the extracellular supernatant, cell lysis supernatant, and cell lysis precipitate were identified by SDS-PAGE.
[0091] 2 Expression of recombinant proteins
[0092] The harvested P2 generation recombinant baculovirus was used to infect sf9 cells at an MOI of 1. When the cell viability reached approximately 80%, the cell supernatant was harvested as the P3 generation virus. The P3 generation virus was then inoculated into 100 mL of 2.3 x 10⁻⁶ cells at an MOI of 1. 6 Cells were cultured until day 4, and the cell culture supernatant was harvested for SDS-PAGE and Western blotting. Protein assembly was determined by electron microscopy. The purified target protein had a purity of approximately 90%. After BCA quantification, the protein concentration was adjusted to 0.35 mg / ml.
[0093] 3 Results
[0094] Identification of P2 generation revealed rAC-PCV3-ΔNLS1, a band of approximately 25 kDa that could be detected in the cell culture supernatant, and virus-like particles of approximately 20 nm in size could be observed under an electron microscope, as shown in Figure 1.
[0095] Example 5: Preparation of PCV3 virus-like particle vaccine
[0096] PCV3 virus-like particles were slowly added to the adjuvant while continuously stirring with an emulsifier at 800 rpm for 12 minutes until homogeneous. The adjuvant suitable for this application can be any adjuvant known to those skilled in the art. In this application, a biphasic adjuvant (water-in-oil-in-water emulsion) is selected, such as SEIWEI 201 adjuvant. Specific formulations are shown in Table 1.
[0097] Table 1 PCV3 virus-like particle vaccine formulation
[0098] Example 6: Immunogenicity test of PCV3 virus-like particle vaccine
[0099] Twenty healthy piglets aged 28–30 days, all negative for PCV2 and PCV3 antigens and antibodies by ELISA, were randomly divided into four groups of five. All piglets were immunized with PCV3 virus-like particle vaccine. Groups 1–3 were immunized with vaccines 1–3 respectively, while group 4 served as a challenge control group. Each immunized group received 2 ml of vaccine per piglet, while the challenge control group received 2 ml of saline per piglet. Twenty-eight days post-immunization, each group underwent challenge with porcine circovirus type 3 (strain SG, deposited at the China Center for Type Culture Collection, accession number CCTCC NO. V201712, deposited on March 23, 2017, at Wuhan University, Wuhan, China). 5.0 TCID50 / head. After challenge, piglets in each group were continuously observed. All experimental pigs were euthanized after 25 days. The results were determined based on the clinical symptoms, pathological changes and virus detection results of each group of piglets. The specific results are shown in Table 2.
[0100] Table 2. Results of immunogenicity studies for PCV3 virus-like particle vaccine.
[0101] The results showed that the PCV3 virus-like particle vaccine provided 100% (5 / 5) protection to piglets, while all piglets in the challenge control group developed the disease after challenge. This indicates that the PCV3 virus-like particle vaccine provided in this application has excellent protective efficacy.
[0102] The above description is merely a preferred embodiment of this application and is not intended to limit this application in any way. Although this application has disclosed the preferred embodiment as above, it is not intended to limit this application. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the technical solution of this application. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of this application without departing from the content of the technical solution of this application shall still fall within the scope of the technical solution of this application.
Claims
1. A Cap protein of porcine circovirus type 3 (PCV3), wherein the Cap protein is a truncated Cap protein of NLS region 8-16aa.
2. The Cap protein according to claim 1, wherein, The amino acid sequence of the Cap protein is shown in SEQ ID NO.
2.
3. A PCV3 virus-like particle antigen, wherein the PCV3 virus-like particle antigen is the Cap protein as described in claim 1 or 2.
4. [Amended according to Rule 26, 19.05.2025] Biomaterials related to the Cap protein of claim 2, said biomaterials comprising any of the following: (1) The nucleic acid fragment encoding the Cap protein; (2) An expression cassette containing the nucleic acid fragments in (1); (3) A vector containing the nucleic acid fragment in (1) or the expression cassette in (2); (4) Recombinant cells containing the nucleic acid in (1), the expression cassette in (2), or the vector in (3).
5. The biomaterial according to claim 4, wherein, The nucleotide sequence of the nucleic acid fragment encoding the Cap protein is shown in SEQ ID NO.
1.
6. The use of the PCV3 virus-like particle antigen according to claim 3 in the preparation of a medicament for the prevention of porcine circovirus-related diseases.
7. A PCV3 virus-like particle vaccine, wherein, The virus-like particle vaccine comprises an immunizing dose of the PCV3 virus-like particle antigen and a pharmaceutically acceptable carrier.
8. The PCV3 virus-like particle vaccine according to claim 7, wherein, The content of the PCV3 virus-like particle antigen is ≥30 μg / ml; Preferably, the content of the PCV3 virus-like particle antigen is 30 μg / ml to 100 μg / ml.
9. [Amended according to Rule 26, 19.05.2025] The PCV3 virus-like particle vaccine according to claim 7, wherein, The pharmaceutically acceptable carriers include at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants, and preservatives.
10. The PCV3 virus-like particle vaccine according to claim 9, wherein, The adjuvants include one or more of the following: aluminum gel adjuvant, saponins, avrididine, DDA, water-in-oil emulsions, oil-in-water emulsions, water-in-oil-in-water emulsions, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophospholipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin of Escherichia coli, cholera toxin, IMS 1314, and muramyl dipeptide. Preferably, the concentration range of the adjuvant is from 5% V / V to 60% V / V, more preferably from 30% V / V to 60% V / V, and even more preferably 50% V / V; Preferably, the freeze-drying protectant is selected from sugars, polyols, polymers, surfactants, salts, amines, or amino acids; Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor, or interleukin-2.
Citation Information
Patent Citations
Recombinant baculovirus expressing porcine circovirus type 3 truncated Cap protein and construction method and primers thereof
CN109207522A
Porcine circovirus type 3 virus-like particle as well as preparation method and application thereof
CN113416236A