Combination of il-1 receptor inhibitors, anti PD-1, and il-4 inhibitors in the treatment of cancer

Abstract

The present disclosure relates to methods of treating cancer in a subject undergoing PD-1 therapy comprising administering an effective amount of an interleukin-1 (IL-1) receptor inhibitor and / or an effective amount of an interleukin-4 (IL-4) inhibitor to the subject.

Description

Attorney Docket No.231106-PCT (765281: MTST-819PC) COMBINATION THERAPY METHODS FOR TREATMENT OF CANCER CROSS-REFERENCE TO RELATED APPLICATION

[0001] This Patent Application claims priority to U.S. Provisional Patent Application No.63 / 642,930, filed on May 6, 2024, and entitled “COMBINATION THERAPY METHODS FOR TREATMENT OF CANCER.” The disclosure of the prior Application is considered part of and is incorporated by reference into this Patent Application. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant no. 19-2781 awardedby the National Cancer Institute (NCI). The Government has certain rights in the invention. BACKGROUND

[0003] According to the National Cancer Institute, individuals over the age of 70 bear morethan half of the annual cancer burden. Aging is strongly associated with cancer, but how it impacts tumorigenesis has been unclear. The association between aging and tumorigenesis has often been ascribed to cumulative mutational burden, environmental factors (i.e., smoking), or T cell dysfunction over 5 time. However, the lack of an unbiased inquiry into the cellular basis for this association has left the study of cancer incomplete. Filling this gap in knowledge could help characterize the early stages of tumorigenesis and consequently aid the design of screening platforms and cancer prevention strategies. Non-small cell lung cancer (NSCLC) is one such neoplasia that is strongly associated with aging. As it is the most common cause of cancer- related mortality, this disclosure sought to elucidate the reasons underlying the effect of aging on NSCLC development and outcome. Current modes of immunotherapy for lung cancer are limited in their efficacy, not all patients are responsive to immune checkpoint blockade and depending on the age of the patient, relapses are common. BRIEF SUMMARY

[0004] The present disclosure provides methods for treating cancer in a subject undergoingPD-1 therapy comprising administering an effective amount of an interleukin-1 (IL-1) receptorAttorney Docket No.231106-PCT (765281: MTST-819PC) inhibitor to the subject. The present disclosure also provides methods for treating cancer using a combination therapy, wherein the combination therapy comprises administering an effective amount of an interleukin-1 (IL-1) receptor inhibitor and an effective amount of an interleukin- 4 (IL-4) inhibitor to a subject undergoing PD-1 therapy.

[0005] In an aspect, the IL-1 receptor inhibitor selectively inhibits an IL-1# receptor or an IL-+q ^RPR\`[^( >Z NZ N_\RP`& `UR >A'+ ^RPR\`[^ VZUVOV`[^ _RXRP`VbRXe VZUVOV`_ O[`U NZ >A'+# receptorNZQ NZ >A'+q ^RPR\`[^( >Z NZ N_\RP`& `UR >A'+ ^RPR\`[^ VZUVOV`[^ P[Y\^V_R_ NZ >A'+# neutralizingNZ`VO[Qe [^ NZ >A'+q ZRa`^NXVfVZT NZ`VO[Qe( >Z NZ N_\RP`& `UR >A'+ ^RPR\`[^ VZUVOV`[^ P[Y\^V_R_and IL-1 receptor antagonist. In an aspect, the IL-1 receptor inhibitor comprises anakinra, canakinumab, or rilonacept.

[0006] In an aspect, the IL-1 receptor inhibitor is administered via infusion, injection,subcutaneous, or any combination of thereof. In an aspect, the IL-1 receptor is administered concurrently with the PD-1 therapy.

[0007] In an aspect, the effective amount of the IL-1 receptor inhibitor administered is at leastabout 10 mg per dose, alternatively at least about 20 mg per dose, alternatively at least about 30 mg per dose, alternatively at least about 40 mg per dose, alternatively at least about 50 mg per dose, alternatively at least about 60 mg per dose, alternatively at least about 70 mg per dose, alternatively at least about 80 mg per dose, alternatively at least about 90 mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 110 mg per dose, alternatively at least about 120 mg per dose, alternatively at least about 130 mg per dose, alternatively at least about 140 mg per dose, or alternatively at least about 150 mg per dose.

[0008] In an aspect, the IL-1 receptor inhibitor is administered at least one a day, alternativelyat least twice a day, alternatively at least three times a day, or alternatively at least four times a day. In an aspect, the IL-1 receptor inhibitor is administered for at least 21 days, alternatively at least 22 days, alternatively at least 23 days, alternatively at least 24 days, alternatively at least 25 days, alternatively at least 26 days, alternatively at least 27 days, alternatively at least 28 days, alternatively at least 29 days, or alternatively at least 30 days.

[0009] In an aspect, the method further comprises administering an effective amount of aninterleukin-4 (IL-4) inhibitor. In an aspect, the IL-4 inhibitor comprises an IL-4R inhibitor or an IL-4R# inhibitor. In an aspect, the IL-4 inhibitor comprises dupilumab.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0010] In an aspect, the IL-4 inhibitor is administered via infusion, injection, subcutaneous, orany combination of thereof. In an aspect, the IL-4 inhibitor is administered concurrently with the PD-1 therapy.

[0011] In an aspect, the IL-4 inhibitor is administered at least once, alternatively at least twice,alternatively at least three times, alternatively at least four times, or alternatively at least five times. In an aspect, times between administration of the IL-4 inhibitor is at least about 30 minutes, alternatively at least about 1 hour, alternatively at least about 2 hours, alternatively at least about 4 hours, alternatively at least about 8 hours, alternatively at least about 16 hours, alternatively at least about 1 day, alternatively at least about 5 days, alternatively at least about 1 week, alternatively at least about 2 weeks, alternatively at least about 3 weeks, or alternatively at least about 4 weeks.

[0012] In an aspect, the effective amount of the IL-4 inhibitor administered is at least about 50mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 200 mg per dose, alternatively at least about 300 mg per dose, alternatively at least about 400 mg per dose, alternatively at least about 500 mg per dose, alternatively at least about 600 mg per dose.

[0013] In an aspect, the PD-1 therapy comprises administering an effective amount of a PD-1inhibitor or PD-L1 inhibitor. In an aspect, the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of pembrolizumab, durvalumab, nivolumab, ipilimumab, MEDI0680, and combinations thereof. In an aspect, the PD-1 inhibitor or PD-L1 inhibitor is administered via a standard of care dosing schedule.

[0014] In an aspect, the administration of the IL-1 receptor inhibitor enhances the response toPD-1 and PD-L1 blocking antibodies. In an aspect, the enhanced response results in anti-tumor immunity.

[0015] In an aspect, the effective amount is a pharmaceutically effective amount or atherapeutically effective amount.

[0016] In an aspect, the cancer is characterized by tumor-induced myelopoiesis associated withimmunosuppression. In an aspect, the cancer is selected from the group consisting of head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), hepatocellular carcinoma (HCC), mesothelioma, colorectal cancer, and breast cancer. In an aspect, the subject has relapsed / refractory non-small cell lung cancer (NSCLC).Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0017] In an aspect, said administration of the IL-1 inhibitor, and / or the IL-4 inhibitor (i)reduces the abundance of myeloid progenitors cells; (ii) reduces the abundance of the Natural Killer cell-suppressive monocyte-derived macrophages; (iii) reduces the production of IL-1# myeloid progenitor cells; (iv) reduces the production of IL-1#; (v) up-regulates differential expressed genes by hematopoietic stem cells in the bone marrow; (vi) reduces cancer growth; and / or (vii) decreases tumor burden.

[0018] These and other advantages, aspects, and novel features of the present disclosure, aswell as details of an illustrated embodiment thereof, will be more fully understood from the following description and drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Various aspects of the present disclosure will now be described, by way of exampleonly, with reference to the attached Figures, wherein:

[0020] FIGs. 1A-1I illustrate blocking IL-1(#) signaling deters pro-tumorigenic myelopoiesis,delays lung tumor growth, and improves survival. FIG. 1A depicts transcriptomic expression of Il1a and Il1b by tumoral myeloid and lymphoid cells. FIG. 1B depicts longitudinal quantification of myeloid progenitors (MPs) and monocyte-derived macrophages (mo-macs) in lung tumors. FIG.1C depicts major up-regulated genes by hematopoietic stem cells in bone marrow in response to IL-1# exposure. FIG. 1D depicts tumor burden in mice treated witheither control isotype, IL-1# ZRa`^NXVfVZT NZ`VO[Qe& >A'+q ZRa`^NXVfVZT NZ`VO[Qe& [^ >A'+F+antagonist anakinra at 16 days post-inoculation. Scale bar = 1mm. FIG.1E depicts survival of mice either treated with PBS control or anakinra. FIG.1F depicts the frequency of anti-tumoral activated NK cells in in the tumor-bearing lungs of control or anakinra-treated mice. FIG.1G and FIG. 1H depicts the abundance of lung MPs and their production of IL-1# in the tumor- bearing lungs of control or anakinra-treated mice. FIG.1I depicts the abundance of mo-macs in in the tumor-bearing lungs of control or anakinra-treated mice.

[0021] FIGs. 2A-2C illustrate blocking IL-1# / IL-4 signaling enhances response to PD-1blockade and promotes tumor clearance. An orthotopic model for primary lung adenocarcinoma involving the transplantation of KrasG12D / +Tp53- / -Rosa26A3BiRag1- / -(KPAR) cells was used to assess tumor growth in mice either given an isotype control; PD-1 blocking antibody at days 7, 10, and 14; anakinra at 24 hours post-inoculation and every two days since in combination with #-PD-1 and #-IL-4R# at days 7, 10, and 14. FIG. 2A Tumor burden inAttorney Docket No.231106-PCT (765281: MTST-819PC) the lungs of these mice at 16 days post-inoculation. Scale bar = 1mm. Frequency of FIG. 2B cytotoxic CD8 T cells and FIG.2C cytotoxic NK cells in lung tumors of mice.

[0022] FIGs. 3A-3I illustrate Bone marrow and lungs of old mice fail to communicate a needfor myeloid cell repopulation at steady-state. FIG. 3A depicts hematoxylin and eosin staining of lung sections derived from lungs of naïve young and old mice (left) and quantification of cell density (right). FIG.3B depicts vessel leakage assessed by retro-orbital administration ofeither Evans Blue (left) or fluorophore-conjugated Dextran (right). FIG. 3C depicts hematic offate-mapped GMP-derived cells produced during adult hematopoiesis using the Ms4a3CRE- tdTomato (TdT) mouse. FIG. 3D depicts absolute number of alveolar macrophages (AM) in the lungs of young and old Ms4a3CRE-TdT mice at steady-state. Quantification of FIG. 3E shows TdTNEGand self-renewing (Ki67POS) TdTNEGAM and of (FIG. 3F) TdTPOSAM and self-renewing TdTPOSAM in the lungs of young and old Ms4a3CRE-TdT mice at steady-state (n=4-5 mice per group). Quantification of (FIG.3G) GMP, GP, and cMoP in the bone marrow and of (FIG.3H) Ly6CHIand Ly6CLOmonocytes and neutrophils in the blood of naïve young (7-week-old, 7.wks) and old (72-week-old, 72.wks) mice. FIG. 3I shows frequency distribution of major myeloid cell types identified from scRNAseq of TdTNEGand TdTPOSmyeloid cells in naïve lungs of young and old Ms4a3CRE-TdTmice and of myeloid cells in naïve lungs of young and old Map17CreER-R26TdTmice. cDC1, conventional type I dendritic cells; cDC2, conventional type II dendritic cells; mregDC, mature DCs enriched in immunoregulatory molecules; moDC, monocyte-derived dendritic cells; Ly6CLO mono, Ly6CLOmonocytes; Ly6CHImono, Ly6CHI monocytes; IM, interstitial macrophages. Data shown in panels (FIG. 3A), (FIG. 3B), and (FIG. 3I) are representative of one independent experiment; panels (FIG. 3D)-(FIG. 3H) are representative of two independent experiments. Across all panels, data represent mean ± SEM. For all panels, unpaired student’s t-test was used.

[0023] FIGs. 4A-4C illustrate a poorer effector lymphoid and a stronger myelopoieticresponses underlie the enhanced tumor growth in old mice. FIG.4A depicted the frequency of seeded tumor cells in the lung parenchyma of young and old mice 24 hours post-inoculation.FIG. 4B QR\VP`RQ `UR ]aNZ`VSVPN`V[Z [S Pe`[`[dVP 892 H PRXX_ $89. / EDG 89-pEDG 892EDG>;C'sEDG HC;'#EDG% NZQ NP`VbN`RQ C@ PRXX_ $89. / EDG C@\.0EDG 89-pC:<KLRG1POS) in tumor-bearing lungs of young and old mice at 16 days post-tumor inoculation. FIG.4C depicted the Quantification of tissue-resident alveolar macrophages (AM; CD45POSAttorney Docket No.231106-PCT (765281: MTST-819PC) CD64POS Siglec-FPOS CD11cPOS), myeloid progenitors (MP; CD45POS LinNEG Sca-+C:< P'@V`EDG 89+- / C:< ;PsF>>)>>>EDG 89-.EDG%& NZQ Y[Z[Pe`R'QR^VbRQ YNP^[\UNTR_(mo-mac; CD45POS CD64POS CD2NEG Siglec-FNEG) in naïve and tumor-bearing lungs of young and old mice at 5-, 10- and 20-days post-tumor cell inoculation. Data in panels FIG.4A and FIG. 4B are representative of two independent experiments. Data of experimental endpoints in panel FIG. 4B are representative of three independent experiments; other timepoints are from one experiment. Across all panels, data represent mean ± SEM. For panels FIG.4A - FIG.4C, p-values computed by unpaired student’s t-test.

[0024] FIGs 5A-5E illustrate aging of the hematopoietic compartment promotes lung cancerprogression. An orthotopic model for primary lung adenocarcinoma involving the Intravenousinjection of KrasG12D / + Tp53- / - Rosa26A3Bi- Rag1- / - (KPAR) cells was used to assess tumor growth in young (7-week-old, 7.wks) and old (72-week-old, 72.wks) mice. FIG. 5A (Left) Longitudinal kinetic analysis of tumor burden in the lungs of young and old mice at 5-, 10- and 520-days post-tumor cell inoculation, and (Right) tumor burden in the lungs of young and old mice at 17 days post-inoculation (n=3-5 mice per group) with representative H&E cross- sections shown at left. Scale bar = 1mm. FIG.5B Survival curve of tumor-bearing young and old mice. (FIG. 5C) Experimental design of heterochronic bone marrow transplantation, involving the transfer of (1) donor bone marrow from young CD45.2 mice into youngCD45.1 recipient mice, (2) donor bone marrow from old CD45.2 mice into young CD45.1 recipientmice, and (3) donor bone marrow from young CD45.1 mice into old CD45.2 recipient mice.Chimeric mice were inoculated with tumor cells after an eight-week engraftment period. (FIG. 5D) Tumor burden in the lungs of chimeric mice at 10days post-tumor cell inoculation. Scale bar = 1mm. (FIG.5E) Tumor burden in the lungs of chimeric mice at 20 days post-inoculation. Scale bar = 1mm. Data shown in panels (FIG. 5A), (FIG. 5B), and (FIG. 5D) are from one independent experiment. Data shown in panel FIG. 5E are representative of two independent experiments. Across all panels, data represent15 mean ± SEM. In panel (FIG. 5A), p-values computed using unpaired student’s t-test. In panel (FIG.5B), p-value computed using the Log- rank Mantel-Cox test. For panels (FIG. 5D) and (FIG. 5E), p-values computed by one-wayANOVA (Tukey’s multiple comparisons test). Fig. S2. Lung myeloid progenitors aremonocytic cells born from adult hematopoiesis that expand in lung tumors. (A) Gating strategyS[^ XaZT BE_ $89. / EDG AVZC:< GPN'+C:< P'@V`EDG 89+- / C:< ;PsF>>)>>>EDGCD34POS) in the lungs of young and old mice. (B) Surface expression of Ly6C and CD115 on lung MPs, compared to expression profiles of GMP, GP, and cMoP in bone marrow. (C) InAttorney Docket No.231106-PCT (765281: MTST-819PC) vivo labeling of intra- and extravascular (parenchymal) immune cells via intravenous administration of APC-conjugated anti-CD45 antibody, separating lung MPs that are in the lung vasculature or are in the lung parenchyma. (D) tdTomato signal from lung MPs isolated from the tumor-bearing lungs of old Ms4a3CRE-TdTmice, indicating that lung MPs are of bone marrow.

[0025] FIGs 6A-6E illustrate lung myeloid progenitors are monocytic cells born from adulthematopoiesis that expand in lung tumors. FIG. 6A depicts the gating strategy for lung MPs$89. / EDG AVZC:< GPN'+C:< P'@V`EDG 89+- / C:< ;PsF>>)>>>EDG 89-.EDG% VZ `UR XaZT_of young and old mice. FIG. 6B shows the surface expression of Ly6C and CD115 on lung MPs, compared to expression profiles of GMP, GP, and cMoP in bone marrow. FIG. 6C depicts the in vivo labeling of intra- and extravascular (parenchymal) immune cells via intravenous administration of APC-conjugated anti-CD45 antibody, separating lung MPs that are in the lung vasculature or are in the lung parenchyma. FIG.6D depicts the tdTomato signal from lung MPs isolated from the tumor-bearing lungs of old Ms4a3CRE-TdTmice, indicating that lung MPs are of bone marrow origin. FIG. 6E depicts the intracellular staining for Ki-67 in lung MPs from tumor-bearing old mice.

[0026] FIGs. 7A-7H illustrate a single-cell atlas of lung cancer and aging. Immune cellsubtypes seen in the single-cell RNA sequencing of sorted immune cells from tumor-bearing lungs of young (7-week-old, 7.wks) and old (72-week-old, 72.wks) mice (n=3 mice per group). Frequency differences between young and old mice of cell subtypes in the (FIG. 7A) T cell compartment, (FIG. 7B) B cell compartment, (FIG. 7C) innate lymphoid cell compartment, and (FIG.7D) myeloid cell compartment. FIG.7E depicts a heatmap showing gene expression of highly variable markers (column) for each single cell (rows) classified as a monocyte- derived macrophage (mo-mac). FIG.7F shows frequency differences of mo-mac cell subtypes in young and in old tumor-bearing mice. FIG. 7G depicts Tumor burden in the lungs of old wild-type (WT) and Trem2 knockout (TREM2 KO) mice (n=4 mice per group). FIG.7H (left) shows the expression of Trem2 by non-immune cells in tumor-bearing lungs of mice, and (right) expression of TREM2 by non-immune cells in human NSCLC lesions. Data shown in (FIG.7A)-(FIG.7F) are one independent experiment. Raw data from panel (FIG.7H) (right) were taken from Grout et al., 2022. Data represent mean ± SEM. P-values were computed by unpaired student’s t-test.

[0027] FIGs. 8A-8J illustrate myeloid cells from old mice are less mature and reflect moreAttorney Docket No.231106-PCT (765281: MTST-819PC) severe emergency monopoiesis. CD45POScells were sorted from young (n=3) and old (n=3) tumor-bearing mice and sequenced at the single-cell level. FIG. 8A depicts sub-clustering of myeloid progenitors (MPs) using a K-nn graph partitioning approach and annotation of MP cell states (i.e., MonoP, GranuloP, NeuP) based on defining markers and shown through a heatmap plotting UMI counts per cell. FIG.8B shows cell type relatedness was determined by hierarchical clustering based on mRNA expression profile. Transcriptomes of bone marrow progenitors (BM-GMP, BM-GP, BM-cMoP) in the tumor-bearing setting were used. FIG.8C depicts frequency of total lung MPs in tumor-bearing lungs of young and old mice. FIG. 8D depicts differentially expressed genes (DEGs) between (top) NeuP, (middle) GranuloP, and (bottom) MonoP from lung tumors of old vs. young mice. FIG. 8E depicts DEGs between (left) Ly6CHI monocytes, (middle) Ly6CLO monocytes, and (right) TREM2 monocyte- derived macrophages (mo-macs) from lung tumors of old vs. young mice. FIG.8F depicts fold change in the frequency of NeuP, GranuloP, and MonoP, relative to the mean frequency of each respective cell state in lung tumors from young mice. FIG.8G depicts DEGs that define MonoP, based on Wilcoxon Rank Sum testing of MonoP vs. all other MPs. Hallmark genes plotted in red. Significant gene networks identified by gene ontology analysis. FIG.8H depicts Mean UMI of Il1a, Il1b, and Il1r1 across immune cells. FIG.8I depicts mRNA expression of Il1r1 by bone marrow hematopoietic stem and progenitor cells (HSPC, defined as LinNEG c- KitPOS Sca-1POS [LSK] and include hematopoietic stem cells [HSCs] and multipotent progenitors [MPP]) and other immune cell populations in bone marrow, and cell surface expression of IL-1R1. FIG. 8J depicts DEGs between HSPCs exposed to IL-1# and controls. Hallmark genes plotted in green. Data shown in FIGs. 8A – 8G are from one independent experiment. Raw data from FIGs.8B and 8J are taken from LaMarche et al., 2023 and Caiado et al., 2023, respectively. Data represent mean ± SEM. P-values for data in panels FIGs. 8C and 8F were computed by unpaired 5 student’s t-test.

[0028] FIGs. 9A-9F illustrates IL-1 does not impact tumor cell proliferation or viability. Flowcytometric staining for the IL-1 receptor 1 (IL-1R1) on (FIG. 9A) other immune and non- immune cells in the local TME and (FIG. 9B) on KPAR tumor cells. Tumor cell proliferation and viability of KPAR cells exposed to low (25 ng / mL) and high (100 ng / mL) doses of (FIG.9C) IL-1# and (FIG. 9D% >A'+q VZ bV`^[( FIG. 9E shows flow cytometric staining for IL-1R1on the cell surface of KPAR given non-targeting scramble sgRNA or Il1r1-targeting sgRNA (Il1r1 knockdown, KD). FIG.9F depicts tumor burden in mice challenged with either scramble KPAR cells or Il1r1 KD KPAR cells at 20 days post-inoculation. Scale bar = 1 mm. Data inAttorney Docket No.231106-PCT (765281: MTST-819PC) panels (FIG.9A)-(FIG.9F) are of one independent experiment. Data represent mean ± SEM. For panel (FIG.9F), p-value was computed by unpaired t-test.

[0029] FIGs. 10A-10Q illustrates IL-1 signaling fuels early tumor initiation in old mice.Brefeldin A was administered to young (n=5) and old (n=5) tumor-bearing mice to quantify invivo production of IL-1# NZQ >A'+q( FIG. 10A depicts IL-1# production levels in myeloidprogenitors (MPs), macrophages, monocytes, and neutrophils from lung tumors and in bulk granulocyte-monocyte progenitors (GMPs; LinNEG c-KitPOS Sca-1NEG CD135NEG CD16 / 32POS CD34POS), macrophages, monocytes, and neutrophils in bone marrow of tumor-bearing old mice. FIG. 10B depicts the quantification of IL-1# levels by cell typesshown in (FIG. 10A). FIG. 10C QR\VP`_ `UR >A'+q \^[QaP`V[Z XRbRX_ VZ YeRX[VQ \^[TRZV`[^_(MPs), macrophages, monocytes, and neutrophils from lung tumors and in bulk GMPs, macrophages, monocytes, and neutrophils in bone marrow of tumor-bearing old mice. FIG.10D QR\VP`_ `UR ]aNZ`VSVPN`V[Z [S >A'+q XRbRX_ Oe PRXX `e\R_ _U[cZ VZ $FIG. 10C). FIG. 10Edepicts the expression of IL-1# by lung MPs in young and old tumor-bearing mice. FIG.10FQR\VP`_ `UR Rd\^R__V[Z [S >A'+q Oe XaZT BE_ VZ e[aZT NZQ [XQ `aY[^'ORN^VZT YVPR( E^[`RVZconcentration of (FIG. 10G) IL-1# and (FIG. 10H% >A'+q VZ XaZT U[Y[TRZN`R [S QVTR_`RQ XaZTtumors from young and old naïve and tumor-bearing mice. FIG.10I depicts the tumor burden in the lungs of old mice that received either isotype control, anti-IL-1# neutralizing antibody,NZ`V'>A'+q ZRa`^NXVfVZT NZ`VO[Qe& [^ NZNWVZ^N NS`R^ +0 QNe_ \[_`'`aY[^ PRXX VZ[PaXN`V[Z( GPNXRbar = 1 mm. FIG.10J depicts the tumor burden in the lungs of young and old mice that received either control (PBS) or anakinra after 16 days post-tumor cell inoculation. Scale bar = 1 mm. FIG. 10K depicts the survival curve of control and anakinra-treated tumor-bearing old mice. Solid line: control; Dotted line: anakinra-treated. Statistical testing performed using the Log- rank Mantel-Cox test. Difference in median survival of 8 days. FIG.10L depicts the frequency of activated NK cells in lung tumors of control (PBS) old mice and old mice that received anakinra immediately after tumor cell inoculation. FIG. 10M depicts the abundance of phosphorylated p38 (phospho-p38) in bone marrow (BM) hematopoietic stem cells (HSC; LinNEG c-KitPOS Sca-1POS CD135NEG CD48NEG) of old mice that either received control (PBS) or anakinra. FIG.10N depicts the frequency of bulk GMPs in the bone marrow of young and old mice that either received control (PBS) or anakinra immediately after tumor cell inoculation. FIG.10O (Left) depicts the Quantification of lung MPs in lung tumors of control (PBS) old mice and old mice that received anakinra immediately after tumor cell inoculation, and (right) production of IL-1# by lung MPs in old tumor-bearing mice that either receivedAttorney Docket No.231106-PCT (765281: MTST-819PC) control (PBS) or anakinra via the same regimen used in (FIG. 10J). FIG. 10P depicts the quantification of monocyte-derived macrophages (mo-macs) in old tumor-bearing mice that either received control (PBS) or anakinra. FIG. 10Q depicts tumor burden in the lungs of control (PBS) old mice and old mice that received anakinra during late-stage tumor progression. Scale bar = 1mm. Data shown in panels (FIG. 10A)-(FIG. 10F), (FIG. 10J)- (FIG.10Q) are representative of at least two independent experiments; in panels (FIG.10G)- (FIG. 10I) are representative of one independent experiment. Data are represented as mean ± SEM. For panels (FIG. 10B), (FIG. 10D), (FIG. 10E), (FIG. 10F), (FIG. 10G)-(FIG. 10J), p-values computed by one-way ANOVA (Tukey’s multiple comparisons test). For all other panels, p-values computed by unpaired student’s t-test.

[0030] FIGs. 11A-11K illustrates cell-intrinsic aging of myeloid cells results in DNMT3Adeficiency and promotes expression of the IL-1# program. FIG. 11A depicts the IL-1# production by bone marrow monocytes from young and old mice in the presence of control media, LPS, or apoptotic cell debris. FIG.11B depicts the IL-1# production by bone marrow GMPs, GPs, cMoPs from young and old mice in the presence of control media, LPS, or apoptotic cell debris. FIG.11C depicts the differential gene expression between young and old hematopoietic stem cells (HSCs) sorted from bone marrow of young and old mice. FIG. 11D depicts the relative expression of Dnmt3a, Tet2, and Asxl1 mRNA by sorted bone marrow HSCs from 2-month-old and 2-year-old mice. FIG. 11R depicts the relative expression of Dnmt3a mRNA by sorted bone marrow HSCs from 2-month-old and 1-year-old mice. FIG. 11F depicts the relative expression of DNMT3A mRNA by HSCs from younger (n=3; ages 30, 31, 41) and older (n=3; ages 60, 60, 84) healthy donors. FIG.11G depicts the differential gene expression between Dnmt3a- / - and Dnmt3a+ / + (WT) murine HSCs. FIG. 11H depicts the differential gene expression between Dnmt3a- / - and WT murine GMPs. FIG. 11I depicts the differential gene expression between DNMT3A-proficient and –deficient (left) murine and (right) human bone marrow monocyte-derived macrophages and blood monocyte-derived macrophages, respectively. FIG. 11J depicts the IL-1# and FIG. 11K depicts the TNF-# production by LPS-stimulated young and old bone marrow monocytes that were either untreated or treated with the DNMT3A inhibitor. Data shown in (FIG. 11A), (FIG. 11B), (FIG. 11J), and (FIG. 11K) are representative of three independent experiments; each data point in these panels represents individual mice (biological replicates). Raw data for panels (FIG. 11C) and (FIG. 11D) were obtained from Itokawa et al., 2022 and Kovtonyuk et al., 2022, respectively; for panel (FIG.11E) were obtained from Young et al., 2021; for panel (F)Attorney Docket No.231106-PCT (765281: MTST-819PC) were obtained from Oetjen et al., 2018; for panels (FIG.11G) and (FIG.11H) were obtained from Zhang et al., 2022 and Guryanova et al., 2016, respectively; for panel (FIG. 11I) (left) and (right) were obtained from Rausch et al., 2023 and Cobo et al., 2022, respectively. Data are represented as mean± SEM. For panels (FIG. 11A) and (FIG. 11B), p-values were computed by one-way ANOVA (Tukey’s multiple comparisons test). For all other panels, p- values were computed by unpaired t-test.

[0031] FIGs. 12A-12G illustrates the IL-1# mRNA program is an age-dependent marker foroutcome in human non-small cell lung cancer. FIG. 12A depicts quantification of hematopoietic stem and progenitor cells (HSPCs) in the blood of younger (age<70) and older (age>70) NSCLC patients. FIG. 12B, Left shows mRNA expression of cell type-defining genes, IL1A, IL1B, and a composite score for the IL-1#-associated program, defined in FIG. 5A, according to scRNA-seq of immune cells in lung tissues from NSCLC patients, and (FIG. 12B, right) heatmap of UMI counts of individual genes per cell (each individual row is a single cell) belonging to the mo-mac cluster. FIG. 12C shows the frequency of monocyte-derived macrophages (mo-macs) expressing the IL1A program (IL1APOS) in paired tumor and adjacent, normal lung (nLung) tissue specimens from NSCLC patients. FIG. 12D shows the frequency of IL1APOS mo-macs in resected tumor lesions from (FIG. 12D, left) all patients and (FIG. 12D, right) just the top quartile of patients of each age group, based on frequency values after outlier exclusion. FIG.12E, left shows the distribution of patients that experienced a recurrence of cancer depending on age, and (FIG.12E, right) frequency of tumoral IL1APOS mo-macs per patient depending on status of recurrence. FIG. 12F shows the Kaplan-Meier curve showing overall survival difference between high and low scorers of the IL1A mRNA program among NSCLC patients in The Cancer Genome Atlas (TCGA). FIG.12G depicts the associations between risk of lung cancer incidence and cytokines and chemokines measured in the blood of lung cancer patients, collected prior to diagnosis, and age-matched and smoking controls without cancer. Statistical values shown as (p-value, odds ratio). Data shown in (FIG. 12A) are representative of at least two independent experiments. Raw data from panels (FIG. 12A)-(FIG. 12E) were obtained from Leader et al., 2021. Processed data for panel (G) were obtained from the Lung Cancer Cohort Consortium (LC3). Data are represented as mean ± SEM. For panel (FIG. 12A), p-value was computed by Mann-Whitney unpaired t-test. For panel (C), p-value was computed by paired two-tailed t-test. For panels (FIG.12D) and (FIG. 12E), p-values were computed by unpaired student’s t-test.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0032] FIGs. 13A-13F illustrates a dysregulated adaptive immune response underscores age-dependent lung cancer progression. FIG. 13A depicts quantification of regulatory T cells(Tregs; CD45POS CD3POS CD4POS FoxP3POS), cycling Tregs (Ki67POS Tregs), cytotoxic892 H PRXX_ $89. / EDG 89-EDG 892EDG >;C'sEDG HC;'#POS), and activated NK cells(CD45POS CD3NEG NKp46POS CD69POS) in lung tumors of heterochronic bone marrow transplant mice at 10 days post-inoculation. FIG. 13B depicts Quantification of the lymphoid cell populations shown in (FIG.13A) at 20 days post-inoculation. Frequencies of (FIG.13C) alveolar macrophages (AMs) and (FIG. 13D) monocyte-derived macrophages (mo-macs) in tumor-bearing lungs of chimeric mice at 10 days and 20 days post-inoculation. Frequency and absolute number of lung myeloid progenitors (lung MP) in tumor-bearing lungs of chimeric mice at (FIG. 13E) 10 days and (FIG. 13F) 20 days post-inoculation. Data shown in (FIG. 13A), (FIG. 13C,left), (FIG. 13D, left), and (FIG. 13E) are from one experiment; in (FIG. 13B), (FIG. 13C, right), (FIG. 13D, right), and (FIG. 13F) are representative of two independent experiments. Across all panels, data represent mean ± SEM. For panels (FIG. 13A)-(FIG.13F), p-values computed by one-way ANOVA (Kruskal-Wallis test).

[0033] FIGs. 14A-14C illustrates blocking IL-1# signaling synergizes with PD-1 blockade toenhance anti-tumor immunity and tumor clearance. An orthotopic model for primary lung adenocarcinoma involving the transplantation of KrasG12D / + Tp53- / - Rosa26A3Bi- Rag1- / - (KPAR) cells was used to assess tumor growth in wild-type mice that were either given an isotype control; #-PD-1 at days 7, 10, and 14; anakinra at 24 hours post-inoculation and every two days since in combination with #-PD-1 at days 7, 10, and 14; or anakinra at 24 hours post- inoculation and every two days since in combination with #-PD-1 and #-IL-4R# at days 7, 10, and 14. (FIG.14A) Tumor burden in the lungs of these mice at 16 days post-inoculation. Scale bar = 1mm. Frequency of (FIG. 14B) cytotoxic CD8 T cells and (FIG. 14C) cytotoxic NK cells in lung tumors of mice. Data shown in FIGs. 14A-14C are representative of one independent experiment. Across all panels, data represent mean ± SEM. For all panels, unpaired t-test was used. DETAILED DESCRIPTION I. Introduction

[0034] The present disclosure identified that IL-1 signaling from myeloid cells in lung tumorsdrive the age-associated progression of lung cancer, by augmenting pro-tumorigenicAttorney Docket No.231106-PCT (765281: MTST-819PC) myelopoiesis. Blocking IL-1 signaling with the IL-1R1 inhibitor significantly delays lung cancer progression. Combining it with PD-1 blockade yields major therapeutic benefit. The present disclosure relates to a novel improvement in the use of IL-1 receptor inhibitors and immune checkpoint inhibitors (e.g., agents that block the PD-1 / PD-L1 immune checkpoint axis) in the treatment of cancer (e.g., non-small cell lung cancer, NSCLC).

[0035] Immune checkpoints exist as an important component of the immune system. Ingeneral, the physiological role of immune checkpoints is to prevent the development of an immune response from being so strong that it destroys healthy cells in the body. Immune checkpoints engage when proteins on the surface of T cells recognize and bind to partner proteins on other cells, such as some tumor cells. These proteins are called immune checkpoint proteins. Examples of such proteins include programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), and programmed cell death ligand 2 (PD-L2). When the immune checkpoint and partner proteins bind together, they initiate signaling to inhibit the related immune response, thus acting as an “off” signal to the T cells. Due to the inhibitory activity of these proteins, they are also sometimes referred to as blockades or checkpoint blockades. Activation of these checkpoints can prevent and / or inhibit the immune reaction and hinder the immune system from destroying the cancer (e.g., cancer cells, tumors).

[0036] Immunotherapy drugs called immune checkpoint inhibitors work by blockingcheckpoint proteins from binding with their partner proteins. Thus, immune checkpoint inhibitors—which can also be referred to as checkpoint blockade therapies—are anti-cancer immunotherapies that block the inhibitory checkpoint molecules thereby reactivating the immune response against the tumor.

[0037] Targeted treatment of cancer has led to the clinical development of therapeuticmonoclonal antibodies blocking PD-1 or PD-L1. PD-L1 blocking agents are used in the treatment of nearly all patients with NSCLC who lack a targetable driver mutation who are being treated for metastatic disease, or as an adjuvant following concurrent chemoradiotherapy for patients with unresectable locally advanced disease. Incorporation of these agents into the treatment paradigm for NSCLC has significantly improved overall survival for patients with NSCLC, though the majority of patients eventually succumb to their disease. These agents inhibit the negative regulatory effects of PD-L1 on patient T cells via PD-1, resulting in the enhancement of a pre-existent antitumor immune activity. Although PD-1 / PD-L1 checkpointAttorney Docket No.231106-PCT (765281: MTST-819PC) blockade can result in dramatic therapeutic responses, this therapy is only effective in a subset of patients, and many patients are only partial responders to therapy.

[0038] As disclosed herein, combined complex bone marrow transplantation studies with anorthotopic model of primary lung adenocarcinoma and single-cell RNA sequencing (scRNAseq) to complete an unbiased and detailed dissection of the tumor microenvironment (TME) in young and old mice. Aging of the hematopoietic lineage was shown to be sufficient to drive lung cancer growth in mice. It was identified that locally-produced IL-1# as a driver of an enhanced myelopoietic response that promotes immunosuppression; blocking this axis with either an anti-IL-1# antibody or the IL-1R1 antagonist anakinra early during tumor initiation not only normalized myelopoiesis but also delayed lung cancer progression. Extending these findings to patients, it was demonstrated that the primary IL-1#-expressing cells in lung lesions are monocyte-derived macrophages that associate with aging, poorer survival, and recurrence of cancer. In sum, these findings describe a novel and important foundation for the aging-driven progression of lung cancer that can be therapeutically targeted to prevent the development of cancer or improve cancer outcomes.

[0039] Before continuing to describe the present disclosure in further detail, it will beunderstood that the materials, methods, and examples are illustrative only and not intended to be limiting. Methods and materials are described herein for use in the present invention and other, suitable methods and materials known in the art can also be used. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. II. Definitions

[0040] Unless otherwise defined, all technical and scientific terms used herein have the samemeaning as commonly understood by one of ordinary skill in the art to which the methods described herein belong.

[0041] The singular form "a", "an" and "the" include plural referents unless the context clearlydictates otherwise. These articles refer to one or to more than one (i.e., to at least one). The term "and / or" means any one or more of the items in the list joined by "and / or". As an example, "x and / or y" means any element of the three-element set {(x), (y), (x, y)}. In other words, "x and / or y" means "one or both of x and y". As another example, “x, y, and / or z” means anyAttorney Docket No.231106-PCT (765281: MTST-819PC) element of the seven-element set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. In other words, "x, y and / or z" means "one or more of x, y and z".

[0042] The term "about" as used in connection with a numerical value throughout thespecification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is + / -10%.

[0043] Where ranges are given, endpoints are included. Furthermore, unless otherwiseindicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0044] The term "exemplary" means serving as a non-limiting example, instance, orillustration. As utilized herein, the terms "e.g.," and "for example" set off lists of one or more non-limiting aspects, examples, instances, or illustrations.

[0045] As used herein, the terms "subject", "individual", and "patient" are interchangeable, andrelate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term "animal" as used herein includes humans. The term "subject" may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).

[0046] The term “antibody,” as may be used herein, refers to immunoglobulins (IG)comprising four peptides (e.g., polypeptides, proteins,). The peptides of antibodies are referred to and termed “chains,” which are connected via disulfide bonds. The chains of an antibody are sub-divided into two heavy (H) chains and two light (L) chains. Each H chain comprises a heavy chain variable region (VH) and a heavy chain constant region (CH). The CH is further comprised of three domains CH1-CH3. Similar to the H chain, each L chain comprises an L chain variable region (VL) and a L chain constant region (CL). However, dissimilarly from the CH, the CL comprises a single domain.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0047] The VH and VL regions of the H and L chains, respectively, are further sub-divided.These regions are known to be highly influential to the specificity of the antibody due to the fact they contain exceedingly high levels of variability (e.g., hypervariability). These elements of hypervariable regions, are referred to as “complementarity determining regions (CDRs).” These CDRs are supported by a scaffold portion of the variable region of the antibody (e.g., VH, VL), known as framework regions. These framework regions are known to be less variable than the CDRs (e.g., more conserved among and across antibodies).

[0048] In this specification “antibody” includes a fragment or derivative of an antibody, or asynthetic antibody or synthetic antibody fragment. Antibodies may be provided in isolated or purified form. Antibodies may be formulated as a pharmaceutical composition or medicament.

[0049] In view of today's techniques in relation to monoclonal antibody technology, antibodiescan be prepared to most antigens, e.g., an IL-1, IL-1 receptor, IL-4 or IL-4 receptor. The antigen-binding portion may be a part of an antibody (for example a Fab fragment) or a synthetic antibody fragment (for example a single chain Fv fragment [ScFv]). Suitable monoclonal antibodies to selected antigens may be prepared by known techniques, for example those disclosed in "Monoclonal Antibodies: A manual of techniques ", H Zola (CRC Press, 1988) and in "Monoclonal Hybridoma Antibodies: Techniques and Applications ", J G R Hurrell (CRC Press, 1982). Chimeric antibodies are discussed by Neuberger et al (1988, 8th International Biotechnology Symposium Part 2, 792-799).

[0050] Monoclonal antibodies (mAbs) are useful in the methods of the invention and are ahomogenous population of antibodies specifically targeting a single epitope on an antigen.

[0051] Polyclonal antibodies are useful in the methods of the invention. Monospecificpolyclonal antibodies are preferred. Suitable polyclonal antibodies can be prepared using methods well known in the art.

[0052] Antigen binding fragments of antibodies, such as Fab and Fab2 fragments may also beused / provided as can genetically engineered antibodies and antibody fragments. The variable heavy (VH) and variable light (VL) domains of the antibody are involved in antigen recognition, a fact first recognized by early protease digestion experiments. Further confirmation was found by "humanization" of rodent antibodies. Variable domains of rodent origin may be fused to constant domains of human origin such that the resultant antibodyAttorney Docket No.231106-PCT (765281: MTST-819PC) retains the antigenic specificity of the rodent parented antibody (Morrison et al (1984) Proc. Natl. Acad. Sd. USA 81, 6851-6855).

[0053] That antigenic specificity is conferred by variable domains and is independent of theconstant domains is known from experiments involving the bacterial expression of antibody fragments, all containing one or more variable domains. These molecules include Fab-like molecules (Better et al (1988) Science 240, 1041); Fv molecules (Skerra et al (1988) Science 240, 1038); single-chain Fv (ScFv) molecules where the VH and VL partner domains are linked via a flexible oligopeptide (Bird et al (1988) Science 242, 423; Huston et al (1988) Proc. Natl. Acad. Sd. USA 85, 5879) and single domain antibodies (dAbs) comprising isolated V domains (Ward et al (1989) Nature 341, 544). A general review of the techniques involved in the synthesis of antibody fragments which retain their specific binding sites is to be found in Winter & Milstein (1991) Nature 349, 293- 299.

[0054] The term "ScFv molecules" refers to molecules wherein the VH and VL partnerdomains are covalently linked, e.g. by a flexible oligopeptide.

[0055] Fab, Fv, ScFv and dAb antibody fragments can all be expressed in and secreted fromE. coli, thus allowing the facile production of large amounts of the said fragments.

[0056] Whole antibodies, and F(ab')2 fragments are "bivalent". The term “bivalent” means thatthe said antibodies and F(ab')2 fragments have two antigen combining sites. In contrast, Fab, Fv, ScFv and dAb fragments are monovalent, having only one antigen combining site. Synthetic antibodies may also be made using phage display technology as is well known in the art.

[0057] Antibodies may be produced by a process of affinity maturation in which a modifiedantibody is generated that has an improvement in the affinity of the antibody for antigen, compared to an unmodified parent antibody. Affinity-matured antibodies may be produced by procedures known in the art, e.g., Marks et al.,Rio / Technology 10:779-783 (1992); Barbas et al. Proc Nat. Acad. Sci. USA 91:3809-3813 (1994); Schier et al. Gene 169:147-155 (1995); Yelton et al. J. Immunol. 155:1994-2004 (1995); Jackson et al., J. Immunol. 154(7):3310-15 9 (1995); and Hawkins et al, J. Mol. Biol.226:889-896 (1992).

[0058] Antibodies may be detectably labelled or, at least, capable of detection. Such antibodiesbeing useful for both in vivo (e.g. imaging methods) and in vitro (e.g. assay methods)Attorney Docket No.231106-PCT (765281: MTST-819PC) applications For example, the antibody may be labelled with a radioactive atom or a colored molecule or a fluorescent molecule or a molecule which can be readily detected in any other way. Suitable detectable molecules include fluorescent proteins, luciferase, enzyme substrates, and radiolabels. The binding moiety may be directly labelled with a detectable label or it may be indirectly labelled. For example, the binding moiety may be an unlabeled antibody which can be detected by another antibody which is itself labelled. Alternatively, the second antibody may have bound to it biotin and binding of labelled streptavidin to the biotin is used to indirectly label the first antibody.

[0059] Aspects of the present invention include bi-specific antibodies, e.g. composed of twodifferent fragments of two different antibodies, such that the bi-specific antibody binds two types of antigen. The antibody may contain a different fragment having affinity for a second antigen, which may be any desired antigen. Techniques for the preparation of bi-specific antibodies are well known in the art, e.g. see Mueller, D et al., (2010 Biodrugs 24 (2): 89–98), Wozniak-Knopp G et al., (2010 Protein Eng Des 23 (4): 289–297. Baeuerle, PA et al., (2009 Cancer Res 69 (12): 4941–4944).

[0060] In some embodiments, the bispecific antibody is provided as a fusion protein of twosingle-chain variable fragments (scFV) format.

[0061] As used herein, the term "neutralizing" refers to an antigen binding molecule, scFv,antibody, or a fragment thereof, which binds to a ligand and prevents or reduces the biological effect of that ligand. In some embodiments, the antigen binding molecule, scFv, antibody, or a fragment thereof, directly blocking a binding site on the ligand or otherwise alters the ligand's ability to bind through indirect means (such as structural or energetic alterations in the ligand). In some embodiments, the antigen binding molecule, scFv, antibody, or a fragment thereof prevents the protein to which it is bound from performing a biological function. III. Interleukin-1 (IL-1) receptor inhibitor

[0062] >Z`R^XRaWVZ $>A% + RZP[Y\N__R_ `c[ QV_`VZP` Pe`[WVZR_& >A'+o NZQ >A'+q& cUVPU _VTZNXbVN `UR _NYR ^RPR\`[^& >A'+ ^RPR\`[^& `e\R + $>A'+F+%( :ZTNTRYRZ` [S >A'+F+ Oe >A'+o [^ >A'+q RZTNTR_ N YRYO^NZR'O[aZQ P[^RPR\`[^& >A'+ ^RPR\`[^ NPPR__[^e \^[`RVZ $>A'+F6PE%& NZQthe trimolecular IL-1 / IL-1R1 / IL-1RAcP complex initiates an intracellular kinase-dependent signaling process mediated by the adaptor protein MyD88 (also termed myeloid differentiation primary response 88), resulting in a wide range of cell-activation events, including new geneAttorney Docket No.231106-PCT (765281: MTST-819PC) transcription mediated through the nuclear factor kappa-light-chain-enhancer of activated B cells (NFkB) pathway.

[0063] Downstream effects depend upon the responding lineage and may include productionof cytokines such as IL-6 (and IL-1beta itself) and upregulation of adhesion molecules on leukocytes and endothelial cells to promote cell migration. IL-1 is the major endogenous pyrogen, triggering fever via the hypothalamus. Beyond these acute effects, IL-1 skews the differentiation of T cells toward proinflammatory T helper 17 (Th17) cells, while also aiding the function of CD4+ and CD8+ T cells and promoting effector T cell cytokine production.

[0064] >A'+q V_ \^[QaPRQ \^RQ[YVZNZ`Xe Oe YeRX[VQ PRXX_ _aPU N_ YNP^[\UNTR_& ZRa`^[\UVX_&NZQ YN_` PRXX_( >A'+q PNZ NX_[ OR PXRNbRQ `U^[aTU VZSXNYYN_[YR'VZQR\RZQRZ` \N`UcNe_( ;[^RdNY\XR& NP`VbN`RQ H PRXX_ VZQaPR YNP^[\UNTR_ `[ \^[PR__ \^['>A'+q `[ NP`VbR >A'+q `U^[aTUcaspase 8. Thus, IL-1beta can be produced by antigen-driven immune activation as well as antigen-independent processes such as autoinflammatory diseases.

[0065] >A'+o V_ Rd\^R__RQ P[Z_`V`a`VbRXe VZ WR^N`VZ[Pe`R_ VZ `UR _WVZ& VZ R\V`URXVaY [S XaZT NZQTa`& NZQ Oe \XN`RXR`_ NZQ YRTNWN^e[Pe`R_3 YeRX[VQ PRXX_ Rd\^R__ >A'+o cURZ NP`VbN`RQ( >A'+oalso can be expressed on the cell membrane, activating neighboring cells via contact as well as through microvesicles budded from the cell surface

[0066] In certain embodiments, the IL-1 receptor inhibitor is an IL-1 receptor antagonist (IL-1ra). IL-1ra is an inhibitor that competes with both cytokines for binding to the receptor. In certain embodiments, the IL-1 receptor inhibitor is IL-1R2, which serves as a nonsignalingQRP[e ^RPR\`[^ O[`U VZ YRYO^NZR'O[aZQ NZQ _[XaOXR S[^Y_& R_\RPVNXXe S[^ >A' +q( >Z PR^`NVZembodiments, the IL-1 receptor inhibitor selectively inhibits an IL-1# ^RPR\`[^ [^ NZ >A'+qreceptor. In certain embodiments, the IL-1 receptor inhibitor selectively inhibits both an IL-1#^RPR\`[^ NZQ NZ >A'+q ^RPR\`[^(

[0067] In certain embodiments, the IL-1 receptor inhibitor comprises an IL-1# neutralizingantibody. The term “IL-1# neutralizing antibody” or “IL-1# antibody” may refer to an antibody that specifically binds to IL-1#, thereby blocking or reducing the ability of IL-1 from bindingthe IL-1# ^RPR\`[^( >Z PR^`NVZ RYO[QVYRZ`_& `UR >A'+ ^RPR\`[^ VZUVOV`[^ P[Y\^V_R_ NZ >A'+qZRa`^NXVfVZT NZ`VO[Qe( HUR `R^Y k>A'+q ZRa`^NXVfVZT NZ`VO[Qel [^ k>A'+q NZ`VO[Qel YNe ^RSR^`[ NZ NZ`VO[Qe `UN` _\RPVSVPNXXe OVZQ_ `[ >A'+q& `UR^ROe OX[PWVZT [^ ^RQaPVZT `UR NOVXV`e [S >A'+ S^[Y OVZQVZT `UR >A'+q ^RPR\`[^( >Z PR^`NVZ RYO[QVYRZ`_& `UR >A'+ ^RPR\`[^ VZUVOV`[^Attorney Docket No.231106-PCT (765281: MTST-819PC) comprises and IL-1ra neutralizing antibody. The term “IL-1ra neutralizing antibody” or “IL-1ra antibody” may refer to an antibody that specifically binds to both IL-1# NZQ >A'+q& `UR^ROeblocking or reducing the ability of IL-1 from binding both the IL-1# NZQ `UR >A'+q ^RPR\`[^(

[0068] In an embodiment, the IL-1 receptor inhibitor comprises anakinra, which is marketedunder the name KINERET®. Anakinra is an IL-1ra. Through blockade of IL-1, anakinra modulates signaling of the IL-1 pathway.

[0069] Anakinra is a modified version of the human interleukin-1 (IL-1) receptor antagonistprotein and functions as an inhibitor for the human IL-1 receptor 1 (IL-1R1) to disrupt signalingfrom the alarmin IL-1# NZQ `UR \^['VZSXNYYN`[^e Pe`[WVZR >A'+q( 6ZNWVZ^N V_ ;96 N\\^[bRQfor the treatment of rheumatoid arthritis, the deficiency of IL-1 receptor antagonist, and cryopyrin-associated periodic syndromes. It was also authorized for emergency use to prevent or treat COVID-19.100mg daily dosing is a standard dose used across multiple indications.

[0070] In an embodiment, the IL-1 receptor inhibitor comprises canakinumab, which ismarketed under the name ILARIS®. Canakinumab is an immunoglobulin G1 (IgG1)Y[Z[PX[ZNX NZ`VO[Qe NTNVZ_` >A'+q `UN` OX[PW_ OVZQVZT `[ `UR >A'+ ^RPR\`[^ P[Y\XRd(Canakinumab is approved by the FDA and European Medicines Agency for patients with CAPS, tumor necrosis factor receptor-associated periodic syndrome (TRAPS), hyperimmunoglobulin D syndrome (HIDS) / mevalonate kinase deficiency (MKD), familial Mediterranean fever (FMF), sJIA, and adult onset Still’s disease, and gout.

[0071] In an embodiment, the IL-1 receptor inhibitor comprises rilonacept, which is marketedunder the name ARCALYST®. Rilonacept is a synthetic protein composed of the extracellular domains of IL-1R1 and IL-1RAcP (two molecules of each) fused to a human IgG1 Fc domainFVX[ZNPR\` V_ NOXR `[ OVZQ >A'+q cV`U P[Y\N^NOXR NSSVZV`e S[^ >A'+o( 6SSVZV`e S[^ >A'+^N V_ YaPUX[cR^ `UNZ >A'+q [^ >A'+o( FVX[ZNPR\` V_ N\\^[bRQ Oe `UR ;96 S[^ \N`VRZ`_ cV`U 86EG&recurrent pericarditis, and deficiency of the IL-1-receptor agonist (DIRA). IV. Interleukin-4 (IL-4) receptor inhibitor

[0072] Interleukin-4 (IL-4) is a multifunctional cytokine known to regulate inflammation. IL-4 is implicated in the development and upregulation of Th2 cells, is required for the biosynthesis of IgE, and stimulates the production of cysteinyl leukotrienes in a positive feedback loop that results in reactive mast cell hyperplasia. When deregulated, IL-4 activity isAttorney Docket No.231106-PCT (765281: MTST-819PC) associated with asthma, allergic inflammation, and multiple types of cancer. Studies have suggested that blocking IL-4 may provide an anti-cancer benefit. IL-4 can signal through two types of heterodimeric receptor complexes: type I receptor composed of IL-4 receptor alpha_aOaZV` $>A'.Fo% NZQ Pe`[WVZR ^RPR\`[^ P[YY[Z r'PUNVZ $rP% NZQ `e\R >> ^RPR\`[^ P[Y\[_RQ [S>A'.Fo NZQ >A'+- ^RPR\`[^ NX\UN + _aOaZV` $>A'+-Fo+%(

[0073] In certain embodiments, the IL-4 inhibitor comprises an IL-4 receptor (IL-4R) inhibitor.The term “IL-4R inhibitor” may refer to an inhibitor, such as an antibody or other suitable antagonist, which specifically binds to the IL-4 receptor or the IL-13 / IL-4 receptor, thereby blocking the ability for IL-4 to bind to said receptors.

[0074] In certain embodiments, the IL-4 inhibitor comprises an IL-4R# inhibitor. The term“IL-4R# inhibitor” may refer to an inhibitor, such as an antibody or other suitable antagonist, which specifically binds to the IL-4R# receptor, thereby blocking the ability for IL-4 to bind to said receptor. In some embodiments, the IL-4R# receptor may block both IL-4 and IL-13 signaling pathways.

[0075] In an embodiment, the IL-4 inhibitor may comprise dupilumab, which is marketedunder the name DUPIXENT®. Dupilumab binds to the alpha subunit of the interleukin-4^RPR\`[^ $>A'.Fo%& YNWVZT V` N ^RPR\`[^ NZ`NT[ZV_`( HU^[aTU OX[PWNQR [S >A'.Fo& Qa\VXaYNOmodulates signaling of the IL-4 pathway. Dupilumab is a fully human monoclonal antibody to the interleukin-4 (IL-4) receptor alpha subunit which disrupts signaling through receptors for both IL-4 and IL-13, two cytokines known to be classic Th-2 polarizing cytokines. Dupilumab is FDA approved for the treatment of moderate to severe asthma, atopic dermatitis and for patients with chronic rhinosinusitis with nasal polyps based on promising data in these diseases where few good alternatives exist 87-92. This treatment is very well tolerated in these atopic patients, with the most common side effect being injection site reactions occurring in less than 20% of people; these reactions are typically low grade. The use of dupilumab has yet to be explored specifically in patients, though strong rationale exists for the use of agents which target pro-tumorigenic Th2 polarization. V. PD-1 inhibitors and PD-L1 inhibitors

[0076] Pembrolizumab (KEYTRUDA®) and nivolumab (OPDIVO®) are two such agentstargeting PD-1, while atezolizumab (TECENTRIQ®), avelumab (BAVENCIO®), and durvalumab (IMFINZI®) block PD-L1 instead. Pembrolizumab is an anti-PD-1 antibody andAttorney Docket No.231106-PCT (765281: MTST-819PC) immune checkpoint inhibitor approved in the U.S. in 2014 as KEYTRUDA® for the treatment of a variety of cancers, including melanoma, NSCLC, and mesothelioma, among others. Administration of pembrolizumab acts to block PD-L1 checkpoint inhibitor signaling, thereby activating the immune system to better kill cancer cells. Specifically, PD-1 is a protein on the surface of activated T cells. If another molecule, called programmed cell death 1 ligand 1 or programmed cell death 1 ligand 2 (PD-L1 or PD-L2) binds to PD-1, the initially-activated T cell becomes inactive. This is one way that the body regulates the immune system, to avoid an overreaction. Many cancer cells make PD-L1, which inhibits T cells from attacking the tumor. Pembrolizumab blocks PD-L1 from binding to PD-1, allowing the T cell to work against the cancer cells.

[0077] For patients with metastatic disease the current treatment paradigm dictates the use ofimmunotherapy—most commonly pembrolizumab, though nivolumab in conjunction with ipilimumab has also been FDA approved—until progression of disease or intolerance of therapy for up to two years, while patients receiving adjuvant therapy following concurrent chemoradiation typically receive up to 12 months of the PD-L1 antibody durvalumab. PD-L1 expression, tumor type, and patient performance status typically dictate whether chemotherapy is incorporated into the induction and maintenance therapy for patients.

[0078] In some embodiments, the PD-1 therapy includes the administration of nivolumab,pembrolizumab, pidilizumab, MEDI0680, atezolizumab, BMS-936559, MEDI4736, MSB0010718C, or combinations thereof.

[0079] In some aspects, the disclosure comprises methods for administering an effectiveamount of a PD-1 inhibitor or PD-L1 inhibitor. In other aspects, the PD-1 inhibitor or PD-L1 inhibitor is administered via a standard of care dosing schedule. VI. Methods of Use

[0080] Certain aspects of the disclosure include methods of treating cancer in a subjectundergoing PD-1 therapy comprising administering an effective amount of an interleukin-1 (IL-1) receptor inhibitor to the subject. In some embodiments, the PD-1 therapy includes the administration of a therapeutic monoclonal antibody blocking PD-1 or PD-L1.

[0081] As used herein, the terms “subject”, “individual”, and “patient” are interchangeable,and relate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep,Attorney Docket No.231106-PCT (765281: MTST-819PC) cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term "animal" as used herein includes humans. The term "subject" may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).

[0082] The terms “treat”, “treating”, or “treatment” refer to administering to a subject acompound or pharmaceutical composition disclosed herein to partially or completely alleviate, inhibit, ameliorate, or relieve the disease or disorder from which the subject is suffering. This means any manner in which one or more of the symptoms of a disease or disorder are ameliorated or otherwise beneficially altered. As used herein, amelioration of the symptoms of a particular disease or disorder refers to any lessening, whether permanent or temporary, lasting or transient, that can be attributed to or associated with treatment by the compounds, compositions, and methods of the present disclosure. For example, treating a subject can mean eliminating or reducing the clinical signs of a disease or disorder in the subject; arrest, inhibit, or slow the progression of the disease or disorder in the subject; and / or decrease the number, frequency, or severity of clinical symptoms and / or recurrence of the disease or disorder in the subject who currently has or who previously had the disease or disorder. In particular, the terms “treatment of a disease” and “treating a disease” include curing, shortening in duration, ameliorating, slowing down, inhibiting progression or worsening, or delaying the onset of clinical symptoms in a subject who has the disease or disorder.

[0083] Cancers

[0084] The term "cancer" refers to a broad group of various diseases characterized by theuncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A "cancer" or "cancer tissue" can include a tumor. Examples of cancers that can be treated by the methods of the present disclosure include, but are not limited to, cancers of the immune system including lymphoma, leukemia, myeloma, and other leukocyte malignancies.

[0085] The methods of treatment are not limited to any particular cancer or tumor. Non-limiting examples of cancers include: bladder cancer, breast cancer, colon and rectal cancer, endometrial cancer, kidney or renal cell cancer, leukemia, lung cancer, melanoma, Non-Attorney Docket No.231106-PCT (765281: MTST-819PC) Hodgkin lymphoma, pancreatic cancer, prostate cancer, ovarian cancer, stomach cancer, wasting disease, and thyroid cancer. Additional non-limiting examples of cancer include Cardiac: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hanlartoma, inesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma, leiomyosarcoma), pancreas (ductal adenocarcinoma, insulinorna, glucagonoma, gastrinoma, carcinoid tumors, vipoma), small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma, tubular adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma, Wilm's tumor [nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's sarcoma, soft tissue Ewing's sarcoma, soft tissue sarcoma, synovial sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, desmoid-type fibromatosis, fibroblastic sarcoma, gastrointestinal stromal tumors, retroperitoneal sarcoma, osteochronfroma (osteocartilaginous exostoses), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors; Nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis defomians), meninges (meningioma, meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma); gynaecological sarcoma, Kaposi’s sarcoma, peripheral never sheath tumor, Gynecological: uterus (endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical dysplasia), ovaries (ovarian carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma], granulosa- thecal cell tumors, SertoliLeydig cell tumors, dysgerminoma, malignant teratoma), vulva (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma,Attorney Docket No.231106-PCT (765281: MTST-819PC) melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma (embryonal rhabdomyosarcoma], fallopian tubes (carcinoma); Hematologic: blood (myeloid leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's lymphoma [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi's sarcoma, moles, dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, psoriasis; and Adrenal glands: neuroblastoma.

[0086] In exemplary embodiments, the cancer is head and neck squamous cell carcinoma(HNSCC), non-small cell lung cancer (NSCLC), hepatocellular carcinoma (HCC), mesothelioma, colorectal cancer, or breast cancer. In another exemplary embodiment, the subject has relapsed / refractory non-small cell lung cancer (NSCLC). In some aspects, the cancer is characterized by tumor-induced myelopoiesis associated with immunosuppression

[0087] Combination Therapy

[0088] In some embodiments, the disclosure provides methods for administering an IL-1receptor inhibitor concurrently with PD-1 therapy to a subject in need thereof. In some embodiments, the disclosure provides methods for administering both an IL-1 receptor inhibitor and an IL-4 receptor inhibitor concurrently with PD-1 therapy to a subject in need thereof. This concurrent administration may be referred to as a combination therapy.

[0089] The terms “combination therapy” and “polytherapy,” as may be used interchangeablyherein, generally refer to the application (e.g., use) of multiple therapies (e.g., modes of treatment, such as drugs, therapeutics, or interventions) to treat a common (e.g., single) disease or disorder, or symptoms related thereto. Often, a disease or disorder is targeted directly by multiple therapies (e.g., at least two), but in instances, one therapy may treat a symptom (or more than one symptom), while another therapy may treat the underlying disease or disorder causing the symptoms.

[0090] In some embodiments, the two or more regimens may be administered simultaneously;in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered prior to administration of any doses of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, "administration" of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in theAttorney Docket No.231106-PCT (765281: MTST-819PC) combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some embodiments, two or more agents, or active moieties thereof, may be administered together in a combination composition, or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0091] The skilled artisan will readily appreciate that such term, combination therapy, shallalso include the use of adjuvants. The term “adjuvant,” as may be used herein, refers to any therapy or treatment (e.g., composition, drug, or method based) which is used as an adjunct to the primary or initial therapy or treatment. Adjuvants may be administered concurrently (e.g., at the same time, simultaneously) with the primary or initial treatment or shortly after the administration of the primary or initial treatment. In some, but not all, cases an adjuvant modulates (e.g., increases, decreases) the effect of the primary or initial treatment. In some, but not all, cases an adjuvant is used to modulate (e.g., increase, decrease) a side effect of the primary or initial treatment. In some, but not all, cases an adjuvant is used to prepare (e.g., condition) a subject in anticipation of the primary or initial treatment or aid in the primary or initial treatment’s effects or sustain or aid in the recovery of the subject after the primary or initial treatment. A “neoadjuvant,” as may be used herein, refers to an adjuvant which is administered prior to the primary treatment. Neoadjuvants are often given to improve the likelihood that the overall treatment or therapy will yield a favorable outcome. This may be accomplished in a variety of ways, for example, by improving the efficacy, tolerability (e.g., reducing the toxicity or side-effects), targeting (improving targeting, or reducing off-target effects) of the primary treatment.

[0092] As used herein, the term "administering" as used herein refers to the physicalintroduction of an agent to a subject, using any of the various methods and delivery systems known to those skilled in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase "parenteral administration" means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternalAttorney Docket No.231106-PCT (765281: MTST-819PC) injection and infusion, as well as in vivo electroporation. In some embodiments, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include a topical, epidermal or mucosal route of administration, for example, intranasally, vaginally, rectally, sublingually or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.

[0093] In some aspects, the IL-1 receptor inhibitor is administered via infusion, injection,subcutaneous, or any combination of thereof. In some aspects, the IL-4 receptor inhibitor is administered via infusion, injection, subcutaneous, or any combination of thereof.

[0094] In some aspects, the administration of the IL-1 receptor inhibitor enhances the responseto PD-1 and PD-L1 blocking antibodies. In some aspects, the IL-1 inhibitor, and / or the IL-4 inhibitor (i) reduces the abundance of myeloid progenitors cells; (ii) reduces the abundance of the Natural Killer cell-suppressive monocyte-derived macrophages; (iii) reduces the production of IL-1# myeloid progenitor cells; (iv) reduces the production of IL-1#; (v) up- regulates differential expressed genes by hematopoietic stem cells in the bone marrow; (vi) reduces cancer growth; and / or (vii) decreases tumor burden.

[0095] Dosing Regimens

[0096] As used herein, an "effective amount" of a therapeutic agent described herein (e.g.,inhibitor) refers to an amount sufficient to elicit the desired biological response. An effective amount of a therapeutic agent described herein may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of a therapeutic agent, the condition being treated, the mode of administration, and the age and health of the subject. In certain embodiments, an effective amount is a therapeutically effective amount. In certain embodiments, an effective amount is a prophylactic treatment. In certain embodiments, an effective amount is the amount of a compound described herein in a single dose. In certain embodiments, an effective amount is the combined amounts of a compound described herein in multiple doses.

[0097] In certain embodiments, the effective amount of the IL-1 receptor inhibitoradministered is at least about 10 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 20 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 30 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitorAttorney Docket No.231106-PCT (765281: MTST-819PC) administered is at least about 40 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 50 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 60 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 70 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 80 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 90 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 100 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 110 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 120 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 130 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 140 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is at least about 150 mg per dose.

[0098] In certain embodiments, the effective amount of the IL-1 receptor inhibitoradministered is about 10 mg per dose, alternatively about 20 mg per dose, alternatively about 30 mg per dose, alternatively about 40 mg per dose, alternatively about 50 mg per dose, alternatively about 60 mg per dose, alternatively about 70 mg per dose, alternatively about 80 mg per dose, alternatively about 90 mg per dose, alternatively about 100 mg per dose, alternatively about 110 mg per dose, alternatively about 120 mg per dose, alternatively about 130 mg per dose, alternatively about 140 mg per dose, or alternatively about 150 mg per dose.

[0099] In certain embodiments, the effective amount of the IL-1 receptor inhibitoradministered is about 10 mg – about 20 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 30 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 40 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 50 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 60 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 70 mg per dose. In certain embodiments, the effectiveAttorney Docket No.231106-PCT (765281: MTST-819PC) amount of the IL-1 receptor inhibitor administered is about 10 mg – about 80 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 90 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 100 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 110 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 120 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 130 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 140 mg per dose. In certain embodiments, the effective amount of the IL-1 receptor inhibitor administered is about 10 mg – about 150 mg per dose.

[0100] In certain embodiments, the IL-1 receptor inhibitor is administered at least one a day,alternatively at least twice a day, alternatively at least three times a day, or alternatively at least four times a day

[0101] In certain embodiments, the IL-1 receptor inhibitor is administered for at least 21 days,alternatively at least 22 days, alternatively at least 23 days, alternatively at least 24 days, alternatively at least 25 days, alternatively at least 26 days, alternatively at least 27 days, alternatively at least 28 days, alternatively at least 29 days, or alternatively at least 30 days.

[0102] In certain embodiments, the IL-1 receptor inhibitor is administered daily for 1 to 28days at a dose of 100 mg throughout the PD-1 therapy.

[0103] In certain embodiments, the effective amount of the IL-4 inhibitor administered is atleast about 50 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 100 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 200 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 300 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 400 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 500 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is at least about 600 mg per dose.

[0104] In certain embodiments, the effective amount of the IL-4 inhibitor administered is about50 mg per dose, alternatively about 100 mg per dose, alternatively about 200 mg per dose,Attorney Docket No.231106-PCT (765281: MTST-819PC) alternatively about 300 mg per dose, alternatively about 400 mg per dose, alternatively about 500 mg per dose, alternatively about 600 mg per dose.

[0105] In certain embodiments, the effective amount of the IL-4 inhibitor administered is about50 mg – 100 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is about 50 mg – 200 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is about 50 mg – 300 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is about 50 mg – 400 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is about 50 mg – 500 mg per dose. In certain embodiments, the effective amount of the IL-4 inhibitor administered is about 50 mg – 600 mg per dose.

[0106] In certain embodiments, the IL-4 inhibitor is administered at least once, alternatively atleast twice, alternatively at least three times, alternatively at least four times, or alternatively at least five times.

[0107] In certain aspects, there may be a period of time between the administration of the IL-4 inhibitor. In some embodiments, the time periods between administration of the IL-4 inhibitor is at least about 30 minutes, alternatively at least about 1 hour, alternatively at least about 2 hours, alternatively at least about 4 hours, alternatively at least about 8 hours, alternatively at least about 16 hours, alternatively at least about 1 day, alternatively at least about 5 days, alternatively at least about 1 week, alternatively at least about 2 weeks, alternatively at least about 3 weeks, or alternatively at least about 4 weeks.

[0108] In some embodiments, 600 mg of the IL-4 inhibitor is administered on day 1, 300 mgof the IL-4 inhibitor is administered on day 23 and 300 mg of the IL-4 inhibitor is administered on day 43 of the PD-1 therapy.

[0109] In some aspects, the effective amount is a pharmaceutically effective amount or atherapeutic effective amount. The term "pharmaceutically acceptable" or “therapeutically effective” refers to a molecule or composition that, when administered to a recipient, is not deleterious to the recipient thereof, or that any deleterious effect is outweighed by a benefit to the recipient thereof. With respect to a carrier, diluent, or excipient used to formulate a composition as disclosed herein, a pharmaceutically acceptable or therapeutically acceptable carrier, diluent, or excipient must be compatible with the other ingredients of the compositionAttorney Docket No.231106-PCT (765281: MTST-819PC) and not deleterious to the recipient thereof, or any deleterious effect must be outweighed by a benefit to the recipient.

[0110] The term "pharmaceutically acceptable carrier" or “therapeutically effective carrier”means a pharmaceutically or therapeutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one portion of the body to another (e.g., from one organ to another). Each carrier present in a must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient, or any deleterious effect must be outweighed by a benefit to the recipient. Some examples of materials which may serve as pharmaceutically acceptable carriers comprise: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical or therapeutic formulations.

[0111] In some aspects, the IL-1 receptor inhibitor, IL-4 receptor inhibitor, the PD-1 inhibitorand / or the PD-L1 inhibitor is formulated as a pharmaceutical composition. The term "pharmaceutical composition" refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant subject or population. In some embodiments, a pharmaceutical composition may be formulated for administration in solid or liquid form, comprising, without limitation, a form adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous,Attorney Docket No.231106-PCT (765281: MTST-819PC) intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0112] The presently described technology and its advantages will be better understood byreference to the following examples. These examples are provided to describe specific implementations of the present technology. By providing these specific examples, it is not intended limit the scope and spirit of the present technology. It will be understood by those skilled in the art that the full scope of the presently described technology encompasses the subject matter defined by the claims appending this specification, and any alterations, modifications, or equivalents of those claims.

[0113] EXAMPLES

[0114] Example 1: Complex bone marrow transplantation studies with an orthotopicmodel of primary lung adenocarcinoma and single-cell RNA sequencing (scRNAseq) to complete an unbiased and detailed dissection of the tumor microenvironment (TME) in young and old mice

[0115] Mice

[0116] For this study, the following murine strains were used: 7-week-old and 72-week-oldC57BL / 6J (JAX, #000664), B6.SJL-PtprcaPepcb / BoyJ (CD45.1) (JAX, #002014), and 72- week-old C57BL / 6J-Trem2em2Adiuj / J (Trem2- / -) (JAX, #027197). Ms4a3CREreporter mice were gifted from Dr. Florent Ginhoux. Map17CreER / + Rosa26TdTinducible reporter mice were gifted from Dr. Boris Reizis. To induce recombination, a single dose of 50 mg / kg tamoxifen (Sigma-Aldrich, Cat. #T5648-5G) in sunflower oil was intraperitoneally administered to 4- week-old mice. All mice were housed at the Icahn School of Medicine at Mount Sinai for a minimum of a week before experimental use. Mice were maintained at specific-pathogen-free health status in individually-ventilated cages at 21-22 deg C and 39-50% humidity. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the Icahn School of Medicine at Mount Sinai. Mice within experiments were age- and sex- matched. All studies performed on mice were done in accordance with the IACUC at the Icahn School of Medicine at Mount Sinai.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0117] Orthotopic lung tumor model

[0118] To model primary lung adenocarcinoma, mice were intravenously injected via the tailvein with either 1.5x105 tumor cells derived from KrasLSL-G12D / + Trp53- / - ;Rosa26A3Bi;Rag1- / - (KPAR) mice or 5.0x105 GFP-expressing tumor cells derived from KrasLSL-G12D / + Trp53- / - (KP) mice , which were generated, as previously described. KPAR and KP cells were grown in complete cell culture medium (DMEM, 10% fetal bovine serum, 1% penicillin / streptomycin) and detached for use at 80% confluence using 0.25% trypsin. Tumor-bearing lungs were analyzed at indicated timepoints; the left lung lobe was fixed in paraformaldehyde, embedded in paraffin, and examined as 4 µm cross-sections. Upon hematoxylin and eosin staining, lung tissue sections were scanned on slides using an Olympus digital scanner and analyzed using the Panoramic viewer and QuPath software.

[0119] Vascular permeability

[0120] To assess vascular integrity, mice were intravenously injected with either Dextran thatwas conjugated to an APC fluorophore or the Evans Blue dye. After 15 minutes, mice were pericardially perfused with 50 mL of PBS. Lung tissue was digested to then measure leaked contrast material into the parenchyma.

[0121] In vivo labeling of circulating immune cells

[0122] To partition immune cells in the intravascular circulation and in the extravascularparenchyma of peripheral tissues, an APC-conjugated antibody against the murine CD45 antigen was administered via the tail vein 12 min prior to euthanasia to label all cells in the intravascular space.

[0123] Antibody treatments

[0124] To assess the effect of blocking IL-1 signaling on the progression of lung cancer lesions,mice were either given control PBS or the appropriate isotype controls, 250 µg of IL-1#ZRa`^NXVfVZT NZ`VO[Qe $7V[KPRXX& 8X[ZR 6A;'+0+& 8N`( "7:*,.-% $V(b(%& / * jT [S >A'+qneutralizing antibody (BioXcell, Clone B122, Cat. #BE0246) (i.v.), or the anti-IL-1R antagonist anakinra (500 µg per mouse, i.p.) (Swedish Orphan Biovitrum) every other day. To assess the effect of blocking IL-4 signaling on the progression of lung cancer lesions, miceAttorney Docket No.231106-PCT (765281: MTST-819PC) were either given the appropriate isotype control or 500 µg of #-IL-4R# at days 7, 11, and 14 post-tumor cell inoculation.

[0125] Bone marrow transplantation

[0126] Recipient mice were irradiated with two doses of 5.5 Gy that were administered 6 hrsapart. Donor bone marrow cells (5x106) were retro-orbitally transferred into irradiated recipient mice. A period of 7-8 weeks was granted to ensure engraftment. The recipients were then supplemented with sulfamethoxazole / trimethoprim for three weeks. Reconstitution was assessed by flow cytometric analysis of inflammatory or Ly6CHI monocytes in the lungs.

[0127] In vitro culture

[0128] Stimulation of KPAR with IL-1: KPAR cells were cultured for at least three passages.These tumor cells were then counted and plated at 10,000 cells per well in 6-well plates either in the presence of control media (RPMI, supplemented with 10% FBS, 1% penicillin / streptomycin) or with either 25 ng / mL or 100 ng / mL of recombinant murine IL-1#$F#9 Ge_`RY_& 8N`( ".**'BA'** / )8;% [^ >A'+q $F#9 Ge_`RY_& 8N`( ".*+'BA%( 8RXX bVNOVXV`eand numbers were measured at 24, 48, and 72 hours post-plating.

[0129] Genetic knockdown of IL-1R1 in KPAR

[0130] Knockdown of IL-1R1 expression by KPAR cells were generated by CRISPR-Cas9-mediated genetic deletion. Briefly, a sgRNA targeting Il1r1 (ACAGCGGCTCCACATTGCCG) was cloned into the pSpCas9(BB)-2A-Puro (PX459) vector. KPAR cells were transfected with 5 µg of the PX459 vector using Lipofectamine 3000 followed by puromycin selection. CRISPR knockout was confirmed by flow cytometry. As a control, KPAR cells were transfected with a PX459 vector containing a non-targeting sgRNA (ACCTGATACGTCGTCGCGTA).

[0131] Ex vivo stimulation of bone marrow monocytes

[0132] For culture studies using bone marrow monocytes, bone marrow (femur and tibia ofboth hind legs) were flushed with 3 mL of PBS. Bone marrow monocytes were enriched from these suspensions by depleting magnetically labeled non-target cells (T cells, B cells, NK cells, dendritic cells, erythroid cells, and granulocytes), according to the manufacturer’s instructions (Miltenyi Biotec, Cat. #130-100-629). Bone marrow monocytes were then plated in 96-wellAttorney Docket No.231106-PCT (765281: MTST-819PC) plates, in the presence of either control media (RPMI, supplemented with 10% FBS, 1% penicillin / streptomycin), 25 µM of the DNMT3A inhibitor DNMT3A-IN-1 (MedChemExpress, Cat. #HY-144433), or 25 µM of each of the reverse transcriptase inhibitors (RTi) abacavir and lamivudine. Cells were treated for 48 hours, after which cells were centrifugated at 1,500 rpm for 5 min and stimulated in media with lipopolysaccharide (LPS) (InvivoGen, Cat. #tlrl-eblps) for 2 hours in the presence of Brefeldin A. Cells were then fixed and stained for cell surface expression and intracellular production of IL-1#.

[0133] Single-cell RNA sequencing

[0134] Sample preparation: Single-cell suspensions from lung tissues were obtained, asdescribed above. Samples were broadly enriched for CD45POS cells by fluorescence-activated cell sorting, and these cells were suspended in PBS supplemented with 0.5% BSA. Samples were loaded onto the 10x Genomics Next GEM 5’ assay, as per the manufacturer’s instructions, for a target cell recovery of 10,000 cells per lane. Libraries were constructed, according to manufacturer’s instructions. All libraries were quantified via Agilent 2100 hsDNA Bioanalyzer and KAPA library quantification kit (Roche, Cat. #0797014001). Libraries were sequenced at a targeted depth of 25,000 reads per cell; all libraries were sequenced using the Illumina NovaSeq S2100 cycle kit.

[0135] scRNAseq analysis

[0136] Gene expression reads were aligned to the mm10 reference transcriptome and countmatrices were generated using the default CellRanger 2.1 workflow, using the ‘raw’ matrix output. Following alignment, barcodes matching cells that contained > 500 unique molecular identifiers (UMIs) were extracted. From these cells, those with transcripts > 25% mitochondrial genes were filtered from downstream analyses. Matrix scaling, logarithmic normalization, and batch correction via data alignment through canonical correlation analysis, and unsupervised clustering using a K-nn graph partitioning approach were performed as previously described. Differentially expressed genes were identified using the FindMarkers function (Seurat). Mean UMI were imputed to determine logarithmic fold changes in expression between cell states to further the analysis of markers of interest. Gene set enrichment analysis was performed using the Enrichr database. Other R packages used include: scDissector v.1.0.0; shiny v.1.7.; ShinyTree v.0.2.7; heatmaply v.1.3.0; plotly v.4.10.0; ggvis v.0.4.7; ggplot2 v.3.3.5; dplyr v.1.0.7; Matrix v.0.9.8; seriation v.1.3.5.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0137] Survival analyses were performed using the survival, survminer, and gtsummary Rpackages.

[0138] Human study participants

[0139] Patients’ informed consent was obtained using the Universal Consent for Mount SinaiBiorepository (IRB Human Subjects Electronic Research Applications 20-01197) and the study-specific consent form for IRB Human Subjects Electronic Research Applications 10- 00472A, following the protocols reviewed and approved by the Institutional Review Board (IRB) at the Icahn School of Medicine at Mount Sinai. Patients provided written consent for the analysis of peripheral blood mononuclear cells (PBMCs). Samples were collected from patients undergoing surgical resection at the Mount Sinai Hospital (New York, NY) under the purview of a collaboration between the Department of Thoracic Surgery, the Mount Sinai Biorepository, and the Department of Pathology. PBMC analyses were completed under IRB Human Subjects Electronic Research Applications 10-00472A.

[0140] Flow cytometry. Single-cell suspensions from perfused murine lungs were obtainedupon digestion of naïve or tumor-bearing lung tissues using collagenase IV (0.25 mg / mL; Sigma, Cat. #C5138-1G) at 37 deg C for 30 min while spun at 80 r.p.m. Samples were passed through a 70 µm cell strainer and lysed for red blood cells. Cells were stained in flow cytometry buffer (PBS, 2% bovine serum albumin, 5 mM EDTA) with the following anti-mouse monoclonal antibodies: CD45.1 / .2 (BV510, Clone 30F-11; Cat. #103138), CD45.1 (APC, Clone A20; Cat. #17-0453-82), CD135 (PerCP-Cy5.5, Clone A2F10; Cat. #46-1351-82), CD117 (PE-Cy7, Clone 2B8; Cat. #25-1171-82), CD16 / 32 (Alexa Fluor 700, Clone 93; Cat. #56-0161-82), CD11b (APC-Cy7, Clone M1 / 70; Cat. #47-0112-82), Ly6G (APC-Cy7, Clone+623 8N`( "+,10,.%& 89-p $6E8'8e1& 8X[ZR +16,3 8N`( ".1'**-,'2,%& 7,,* $6E8'8e1&Clone RA3-6B2; Cat. #47-0452-82), Ter-119 (APC-Cy7, Clone TER-119; Cat. #47-5921-82), NK1.1 (APC-Cy7, Clone PK136; Cat. #108724), Sca-1 (APC-Cy7, Clone D7; Cat. #108125), CD34 (Pacific Blue, Clone RAM34; Cat. #48-0341-82), Ly6C (BV605, Clone HK1.4; Cat. #128035), CD115 (biotinylated, Clone AFS98; Cat. #13-1152-85), CD115 (PE, Clone AFS98; Cat. #12-1152-82), Anti-biotin streptavidin (Cat. #405232), IL-1# (PE, Clone ALF-161; Cat. #12-7011-82), phosphorylated STAT6 (APC, Clone CHI2S4N; Cat. #17-9013-42), Ki-67 (FITC, Clone SOLA15; Cat. #11-5698-82), CD11b (PerCP-Cy5.5, Clone M1 / 70; Cat. #101230), CD64 (PE, Clone X54-5 / 7.1; Cat. #139304), CD2 (PE-Cy7, Clone RM2-5; Cat. #100114), Siglec-F (APC-Cy7, Clone E50-2440; Cat. #565527), CX3CR1 (Pacific Blue, CloneAttorney Docket No.231106-PCT (765281: MTST-819PC) SA011F11; Cat. #149023), CD11c (BV785, Clone N418; Cat. #117336), CD8# (FITC, Clone 53-6.7; Cat. #11-0081-82), NKp46 (PerCP-Cy5.5, Clone 29A1.4; Cat. #137610), CD69 (PE, Clone H1.2F3; Cat. #12-0691-82), TNF-# (PE-Cy7, Clone TN3-19; Cat. #25-7423-82), IFN-s $6E8'8e1& 8X[ZR KB<+(,3 8N`( " / * / 2 / *%& 89. $6E8& 8X[ZR <@+( / 3 8N`( "+1'**.+'2,%&89-p $ENPVSVP 7XaR& 8X[ZR R7V[ / **6,38N`( ".2'**--'2,%& @AF<+ $7I0 / *& 8X[ZR ,;+3 8N`(#138405), FoxP3 (PE, Clone FJK-16s; Cat. #12-5773-82). Human peripheral blood mononuclear cells (PBMCs) were stained in flow cytometry buffer with the following anti- human monoclonal antibodies: CD34 (APC, Clone 8G12; Cat. #2242482), CD38 (PE-Cy7, Clone HIT2; Cat. #303515), CD3 (APC-Cy7, Clone HIT3a; Cat. #300317), CD19 (APC-Cy7, Clone HIB19; Cat. #302217), CD14 (APC-Cy7, Clone HCD14; Cat. #325619), CD10 (APC- Cy7, Clone HI10a; Cat. #312212), CD56 (APC-Cy7, Clone HCD56; Cat. #318331), CD8# (APC-Cy7, Clone RPA-T8; Cat. #301015), CD235# (APC-Cy7, Clone HI264; Cat. #349115), CD3 (APC-Cy7, Clone HIT3a; Cat. #300317), CD11b (APC-Cy7, Clone ICRF44; Cat. #301341), CD2 (APC-Cy7, Clone RPA-2.10; Cat. #300219), CD4 (APC-Cy7, Clone RPA-T4; Cat. #300517). For intracellular staining, cells were fixed with either BD Cytofix / Cytoperm kit or the eBiosciences Foxp3 transcription factor kit, both according to the manufacturer’s instructions. To assess the activation potential of T cells, cells were incubated with 10 µg / mL Brefeldin A, 0.2 µg / mL ionomycin, and 0.5 µg / mL phorbol myristate acetate for 3 hrs at 37 deg C. Upon staining, cells were analyzed using a BD LSR Fortessa. Flow cytometry data were acquired using the FACS Diva software v.7 (BD) and were analyzed using FlowJo.

[0141] Sequencing Datasets: The following external bulk and single-cell RNA sequencingdatasets were used for analyses shown in this study: GSE245236, PRJEB56666, GSE183219, GSE163503, GSE151333, GSE120221, GSE162607, GSE168807, GSE74166, GSE237599, GSE206030, and GSE154826. Data generated by this study will be made accessible upon publication.

[0142] The myeloid cell compartment in lung tumors revealed an IL-1 signaling module inmyeloid progenitor (MP) cells (FIG. 1A) that infiltrate lung tumors and accumulate early during lung cancer progression (FIG. 1B). The exposure of hematopoetic stem cells in bone marrow to IL-1 was shown to promote pro-tumorigenic myelopoiesis (FIG.1C). Blocking IL- 1 signaling during lung cancer development showed that early disruption of both IL-1# and IL-+q _VTZNXVZT bVN >A'+F+ VZUVOV`V[Z cV`U NZNWVZ^N _VTZVSVPNZ`Xe QRXNe_ XaZT PNZPR^ T^[c`U $FIG.1D) and improves overall survival (FIG.1E). This is associated with an enhanced anti-tumoralAttorney Docket No.231106-PCT (765281: MTST-819PC) NK cell response (FIG. 1F). Importantly, anakinra reduced the abundance of these MP cells, their production of IL-1#, and the abundance of NK cell-suppressive monocyte-derived macrophages (FIG.1G, FIG.1H, FIG.1I). These studies provided compelling evidence that IL-1 signaling contributes to tumor-induced myelopoiesis associated with immunosuppression.

[0143] There is strong clinical rationale for the combination of these therapies, particularlycancers that have the potential to respond, but most commonly are either refractory or develop resistance to PD-1 / PD-L1 blocking antibodies (e.g. head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), hepatocellular carcinoma (HCC), mesothelioma, colorectal cancer, or breast cancer). Lack of response, or loss-of-response to antibodies blocking the PD-1 / PD-L1 axis may represent lack of immunogenicity, however, based on pre-clinical data from our lab and others, this study proposed that highly immunosuppressive TH2 polarized tumor immune microenvironment promotes resistance to effective immune recognition.

[0144] This data demonstrated IL-4 produced by basophils in the bone marrow to be in partresponsible for the emergency myelopoiesis characteristic of cancer patients1. Subsequently, it was found IL-1 to similarly be integral to emergency myelopoiesis, likely in association with aging of the bone marrow, and that blockade of the IL-1 receptor, using anakinra, enhances response to PD-1 blockade to promote anti-tumor immunity – especially by enhancing anti- tumoral NK cell activity – and our data demonstrates potential synergy with IL-4R blockade (FIG.2).

[0145] Steady-state aging promotes myeloid bias in hematopoiesis but not activerecruitment into the lungs.

[0146] To understand the effect of steady-state aging on lung cancer development andprogression, the baseline differences that existed between the naïve lungs of young and old mice were examined using 7- and 72-week-old mice. The lungs of 72-week-old mice exhibited a major reduction in alveolar cell density (FIG. 3A) and increased vascular leakage into the lung parenchyma (FIG. 3B), compared to the lungs of 7-week-old mice. As these differences are well-known features of old lungs in humans, it was reasoned that 72-week-old mice were of sufficient age to model the biological changes associated with aging.

[0147] As the preservation of lung function is critically dependent on tissue-resident alveolarmacrophages (AMs)14, it was examined how they are impacted by age. Their function can beAttorney Docket No.231106-PCT (765281: MTST-819PC) dictated by their developmental origin (i.e., fetal-derived or bone marrow monocyte-derived), Ms4a3CREreporter (Ms4a3TdT) mice were used to distinguish tdTomato-expressing (TdTPOS) AMs – born from granulocyte-monocyte progenitors (GMPs) in bone marrow – from fetal- derived or TdTNEGAMs17(FIG. 3C). This comparison enabled assessment of how aging affects the ontogenic composition of AMs in young and old mice. By flow cytometry analysis, a significant decline in the absolute number of AMs in old lungs were shown (FIG.3D), largely due to a loss of fetal-derived AMs, with no major change in the number of adult monocyte- derived AMs (FIG. 3E and FIG. 3F). This was consistent with similar analyses of Kupffer cells in the aging liver18. Strikingly, the concomitant attrition of cycling (Ki-67POS) AMs in old mice, indicated a reduced capacity for self-renewal among these tissue-resident phagocytes (FIG.3E and FIG.3F). These findings could also be confirmed with scRNAseq of the TdTNEGand TdTPOSmyeloid cells from young and old Ms4a3TdTmice; cells expressing AM genes (i.e., Marco, Pparg, Il18, Axl, Mcemp1) were significantly reduced in frequency in old mice (p- value=0.0035) (FIG. 3I, top). Alternatively, fate-mapping AMs in old Pdzk1ip1CreER / + Rosa26TdTreporter mice – in which administering tamoxifen at 4 weeks of age traced all adult bone marrow monocyte-derived AMs (TdTPOS) – also confirmed this shift (FIG. 3I, bottom). These data suggested that myelopoiesis during steady-state aging may not compensate for the loss of AMs with age.

[0148] Thus, the myeloid progenitors in bone marrow and differentiated myeloid cells(monocytes and neutrophils) in the blood of young and old mice was quantified. It was found a major enrichment for GMPs, GPs (granulocyte progenitors), and cMoPs (common monocyte progenitors) in bone marrow of old mice (FIG. 3G). In the blood, however, the number of Ly6CHImonocytes did not significantly change, which aligned with recent studies of circulating classical monocytes in young and old healthy human donors. Instead, there were significantly more Ly6CLOmonocytes and neutrophils in the blood of old mice (FIG. 3G), consistent with other human studies. Altogether, these findings suggested that while steady- state aging generates a larger reservoir of myeloid progenitors in bone marrow that are poised to respond to recruitment cues, differentiated myeloid cells are poorly mobilized into old lungs, despite the loss of AMs. This highlighted the possibility that old mice may be equipped to mount a more magnified tumor-induced myelopoietic response, compared to young mice, which would then generate more immunosuppressive myeloid cells that are commonly associated with tumorigenesis.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0149] Lung cancer progression is enhanced in old mice

[0150] Based on these findings, this study next sought to determine how aging shapes the TMEand influences lung tumor growth. To do this, this study used a newly established NSCLC model based on transplantation and orthotopic growth of KrasG12D / + Trp53- / - Rosa26A3Bi Rag1- / - (KPAR) cells . This model enabled us to specifically assess the effect of age of host mice on tumor growth. No major differences were observed during the early stages of seeding and initiation, based on the presence of GFP-expressing tumor cells in the lung parenchyma of young (7.KPAR) and old (72.KPAR) mice at 1 day post-inoculation (FIG. 4A). During the later stages of progression, however, old mice exhibited significantly greater tumor burden, compared to young mice (FIG. 5A). This was accompanied by reduced frequencies of both cytotoxic CD8 T cells and activated NK cells in lung tumors of old mice (FIG. 4B). These differences also translated to a shorter survival time for old mice than for young mice (FIG. 5B).

[0151] This study also profiled the myeloid compartment of lung tumors in young and oldmice. This study first focused on the monocyte-macrophage sublineage, as these myeloid cells constitute a significant proportion of immune cells in lung tumors and are major determinantsof anti-tumor immunity . Consistent with prior studies, this study observed a steady decline inAMs in the lungs of both young and old mice during tumor growth (FIG.4C, left). In contrast, monocyte-derived macrophages (mo-macs), which this study had previously shown impair tumoricidal NK cells, significantly accumulated more drastically in old mice than in young mice (FIG. 4C, middle). Next, this study measured the number of immature myeloid progenitors (MPs) in lung tumors. Previous studies of the spleen, 30 blood, and lungs of both tumor-bearing mice and patients identified the extramedullary accumulation of these progenitors that can contribute locally to the pool of immunosuppressive mo-macs. This study identified these lung MPs (CD45POS LinNEG [CD11b, Ly6G, CD3, B220, Ter-119, NK1.1]GPN'+C:< P'@V`EDG 89+- / C:< ;PsF>> ) >>>EDG 89-.EDG% VZ XaZT `aY[^_ [S e[aZT NZQold mice (FIG.6A). These cells, like cMoPs in bone marrow, highly expressed both Ly6C and CD115, indicative of a predominantly monocytic phenotype (FIG. 6B). Intravenous labeling of circulating CD45POS cells enabled us to distinguish extravascular from intravascular immune cells in the lungs, and this showed that lung MPs largely reside in the lung parenchyma and are a true local population (FIG. 6C). In old, tumor-bearing Ms4a3TdT mice, this study confirmed that lung MPs are borne from adult myelopoiesis during tumor growth (FIG. 6D)Attorney Docket No.231106-PCT (765281: MTST-819PC) and are in cell cycle (FIG.6E). These cells exhibited the most dramatic expansion in old mice, compared to young mice, and as early as 10 days post-inoculation, 40 before a major difference in tumor load could be discerned between young and old mice (FIG. 4C, right). These data strongly supported our hypothesis that the myelopoietic response to lung cancer is enhanced with age.

[0152] Aging of the immune system is a major driver of lung cancer progression.

[0153] Whether these immunological differences were alone responsible for the age-dependentprogression of lung cancer remained uncertain. Prior studies had already reported on the pro- tumorigenic effects of an aged stromal compartment, this study designed a heterochronic bone marrow transplant (BMT) to parse out whether aging of the immune and / or non-immune ecosystems of the lung TME are responsible for the effect of aging on lung cancer growth (FIG.5C). Briefly donor bone marrow from young or old mice were transferred to either young or old recipient mice. After an eight-week engraftment period, mice were inoculated with KPAR cells and tumor burden was evaluated at 10 and 20 days post-inoculation (FIG. 5C). Strikingly, as early as 10 days, young recipients of old bone marrow exhibited the greatest tumor burden (FIG.5D), and this was statistically significant at day 20 (FIG.5E). Importantly, old recipients of young bone marrow bore a tumor load that was comparable to that of young mice reconstituted with young bone marrow (FIG. 5D and FIG. 5E). These data established that aging of the immune system is sufficient to promote lung cancer progression, independently of the age of the non-immune stroma.

[0154] Single-cell profiling of the TME in old mice describes a myeloid cell-enrichedmilieu.

[0155] These findings prompted us to further characterize the immune cells within the lungTME of young and old mice. To that end, scRNAseq was performed on 33,572 CD45POScells sorted from the tumor-bearing lungs of young and old mice. Unsupervised clustering segregated contaminating non-immune cells from the diversity of immune cells, and this yielded the first comparative single-cell atlas of the lung TME in young and old mice. This included T cells, NK cells, B cells, and myeloid cells (FIG. 7A). The tumor-bearing lungs of old mice harbored reduced frequencies of stem-like CD4 T cells, activated NK cells, cDC1, AMs, and cycling AMs, compared to young tumor-bearing mice (FIG.7A, FIG.7B, FIG.7C, FIG.7D). Instead, mo-macs were enriched in lung tumors of old mice (FIG.7E and FIG.7F).Attorney Docket No.231106-PCT (765281: MTST-819PC) To determine the relevance of their enrichment, Trem2 knockout mice were challenged with KPAR cells, since these mo-macs broadly expressed Trem2. Consistent with our prior study of TREM2, this data found a drastically reduced tumor load in these mice, compared to their wild- type counterparts (FIG. 7G). As TREM2 is not expressed by non-immune cells of the lung TME of either mice (FIG.7H, left) or humans (FIG.7H, right), these data supported the notion that myeloid cells contribute significantly to the enhanced growth of lung cancer in old mice.

[0156] Myelopoiesis in old mice results in the local enrichment of IL-1#POS progenitors.

[0157] By scRNAseq, this study also identified the local population of lung MPs, based ontheir co-expression of Csf1r, Csf2ra, Csf3r, Cebpe, and Klf4 and their lack of expression of markers defining differentiated myeloid cells. The 40 lung MPs included neutrophilic (NeuP; Ly6g), granulocytic (GranuloP; Mmp8, Ccl6, S100a8, S100a9), and monocytic progenitors (MonoP; Clec4n, Csf1r, Bhlhe40) (FIG.8A). To contextualize their relationship to their bone marrow counterparts, this study compared the transcriptome of the lung MPs with those of GMPs, GPs, and cMoPs from bone marrow of tumor-bearing mice. Hierarchical clustering showed that NeuP, GranuloP, and MonoP exhibit the greatest transcriptional similitude with their bone marrow progenitors, compared to the 45 differentiated myeloid cells of the lung TME (FIG. 8B). This confirmed that lung MPs are undifferentiated cells that are upstream of monocytes and mo-macs. Importantly, lung MPs defined by scRNAseq were significantly enriched in lung tumors of old mice (FIG.8C).

[0158] The study examined whether comparing lung MPs from lung tumors of young micewith those of old mice could elucidate molecular differences in myelopoiesis due to aging. Among DEGs, genes upregulated in old NeuP, GranuloP, and MonoP included Ier3, Wfdc21, Txnip, and Socs3, among others (FIG. 8D). Extending this analysis to differentiated myeloid cells, found that Ly6CHImonocytes in old mice, for instance, express higher levels of Prtn3, Lcn2, and Chil3, compared to those in young mice (FIG.8E, left;); as these markers are highly expressed in bone marrow MPs and monocytes, these DEGs also indicated that old Ly6CHImonocytes in lung tumors are transcriptionally less mature than their counterparts in young mice. In comparing the broad collection of TREM2 mo-macs in old mice with those in young mice, it was found that old mo-macs expressed higher levels of genes co-regulated with TREM2, suggesting that these cells are more committed to an immunosuppressive phenotype than the mo-macs in young, tumor-bearing mice (FIG.8E, right). In summary, the immaturity of progenitors and differentiated myeloid cells in old mice, compared to their correspondingAttorney Docket No.231106-PCT (765281: MTST-819PC) counterparts in young mice, supported our hypothesis that tumor-induced myelopoiesis becomes aggravated with age.

[0159] Among the lung MPs, MonoP were significantly enriched in lung tumors of old mice(FIG. 8F). As our phenotypic profiling had also indicated that the bulk of lung MPs are monocytic (FIG.6B), this narrowed the study’s focus to MonoP. Compared to the other lung MPs, MonoP expressed significantly higher levels of mRNA encoding Il1a and Il1rn and of those encoding pro-survival molecules like BCL-xL (Bcl2l1), a regulator 15 of myeloid cell life-span (Morrbid), the negative regulator of cell cycle p21 (Cdkn1a), and other BCL-2 family members (Bcl2a1b, Bcl2a1d) (FIG. 8G). The transcription of Il1a (encoding the alarmin IL- 1#) by MonoP was quite striking to us, as it was highly specific to these cells, whereas Il1b$RZP[QVZT `UR \^['S[^Y Pe`[WVZR >A'+q% cN_ aOV]aV`[a_Xe Rd\^R__RQ Oe NXX XaZT BE_ NZQ Y['macs, though to a lesser extent (FIG.8H). This motivated this study of the functional relevance of IL-1# in lung cancer progression in old mice.

[0160] The IL-1 receptor 1 (encoded by Il1r1), the cognate receptor for IL-1# $NZQ >A'+q%& cN_largely absent from all local MPs, differentiated myeloid cells, and lymphocytes (FIG.8H and FIG. 9A). Within stroma, fibroblasts and epithelial cells strongly expressed the IL-1R1 (FIG. 9A), and KPAR cells themselves expressed IL-1R1, as well (FIG.9B). However, exposure toneither IL-1# Z[^ >A'+q NSSRP`RQ @E6F T^[c`U in vitro (FIG. 9C and FIG. 9D). Also, IL-1R1-deficient KPAR cells were generated via CRISPR / Cas9 and found that their growth in vivo is comparable to that of control KPAR cells that were given non-targeting sgRNA (FIG.9E and FIG. 9F). This suggested that IL-1 signaling to the KPAR cells does not significantly determine outcome in the primary lung cancer setting. The responding cell types to the Il1a and Il1b expressed by the lung MPs are likely either the cancer-associated fibroblasts (CAFs) and lung epithelia or IL-1R1-expressing cells outside of the lungs. IL-1 signaling to CAFs has been shown to elicit a robust production of chemokines that recruit myeloid cells from the bone marrow, so IL-1# may indirectly promote myelopoiesis through the local activation of CAFs.

[0161] Among the potential peripheral responders, this study surveyed cell types directlyinvolved in hematopoiesis, since our heterochronic BMT study had stressed the rather unique relevance of an aged immune system in driving lung cancer progression. From our independent analysis of the ImmGen Consortium database, this study found that hematopoietic stem and progenitor cells (HSPCs) in bone marrow express high levels of Il1r1, and this was confirmedwith flow cytometry (FIG. 8I%( JUVXR >A'+q V_ WZ[cZ `[ NP` QV^RP`Xe [Z =G8_& `UR VY\NP` [SAttorney Docket No.231106-PCT (765281: MTST-819PC) IL-1# on HSCs has been less studied. So, this study completed our own analysis of a publicly available dataset, generated by bulk RNA sequencing of sorted HSCs that were either treated with PBS or IL-1#. A significant upregulation of major myeloid genes, including Ms4a3, Chil3, Ly6c2, Csf2rb, Itgam, and Ly6g (FIG. 8J), in the HSCs treated with IL-1#, which suggested that IL-1# promotes HSC commitment to the myeloid lineage. Given that its signaling to either the CAFs or the HSCs can both indirectly and directly skew hematopoiesis towards the myeloid lineage, it was hypothesized that the IL-1# produced by the local MPs found in tumor lesions fuels enhanced myelopoiesis in old mice.

[0162] Blocking IL-1 signaling during tumor initiation delays lung cancer progression.

[0163] To test this hypothesis, first validated the transcriptomic data by measuring theproduction of IL-1# NZQ >A'+q Oe XaZT BE_& ^RXN`VbR `[ QVSSR^RZ`VN`RQ YeRX[VQ PRXX_& N` `URprotein level. Lung MPs produced the highest level of IL-1# (FIG. 10A and FIG. 10B),cUR^RN_ >A'+q cN_ XN^TRXe \^[QaPRQ Oe X[PNX ZRa`^[\UVX_ VZ XaZT `aY[^_ $FIG. 10C and FIG.10D). Strikingly, still, both IL-1# NZQ >A'+q \^[QaP`V[Z Oe XaZT BE_ cN_ _VTZVSVPNZ`Xeincreased in tumor-bearing lungs of old mice than in young mice (FIG. 10E and FIG. 10F).Also, the study confirmed the increase in IL-1# NZQ >A'+q \^[`RVZ XRbRX_ VZ [XQ YVPR S^[Y XaZThomogenate; notably, this increase was specific to the tumor-bearing setting, as negligible levels were documented in the lungs of naïve young and old mice (FIG.10G and FIG.10H).

[0164] Next, this study performed antibody-based blockade of IL-1# NZQ >A'+q NZQ P[Y\N^RQthese therapies with the IL-1R1 antagonist anakinra, which would interfere with IL-1# and IL-+q _VTZNXVZT _VYaX`NZR[a_Xe( 6_ XaZT BE_ cR^R _U[cZ `[ NPPaYaXN`R VZ XaZT `aY[^_ RN^Xeduring tumor initiation, this study began treatment at 24 hours post-inoculation of tumor cells.Both IL-1# NZQ >A'+q OX[PWNQR _VTZVSVPNZ`Xe QRXNeRQ XaZT PNZPR^ \^[T^R__V[Z& `U[aTU N Y[^Rsignificant delay in tumor progression could be observed in mice treated with the anti-IL-1#antibody (FIG. 10I). More importantly, a synergistic effect of blocking both IL-1# NZQ >A'+qsignaling with anakinra was observed (FIG. 10J and FIG. 10K). This effect was associated with a significantly enhanced NK cell response (FIG. 10L). In bone marrow of anakinra- treated mice, phosphorylated (phospho-) p38 levels were measured in HSCs to assess whether anakinra reduced the impact of IL-1 signaling, or other tumorigenesis-associated MAPK- activating cues, in HSCs. Phospho-p38 levels were significantly reduced in the HSCs of anakinra-treated mice (FIG. 10M). Importantly, the abundance of bone marrow GMPs and lung MPs, their production of IL-1#, and the number of mo-macs were also significantlyAttorney Docket No.231106-PCT (765281: MTST-819PC) reduced in anakinra-treated mice (FIG. 10N, FIG. 10O, FIG. 10P), suggesting that blocking IL-1 signaling during tumor initiation does deter HSC commitment to the GMP lineage.

[0165] To further test the importance of this therapeutic window, this study next asked whetherdelaying treatment with anakinra would compromise its efficacy. To answer this question, this study compared tumor growth in old mice that received anakinra at day 14 (4 doses) with untreated controls and with mice that received anakinra according to the original regimen (starting at day 1; 9 doses). Strikingly, it was determined that postponing treatment with anakinra – which was timed to act during the exponential growth phase of lung tumors in vivo (i.e., on established tumors), according to our kinetics study – did not alleviate tumor burden in old mice (FIG. 10Q), indicating that the activity of IL-1 from lung MPs during tumor initiation represents a specific opportunity to derail lung cancer progression.

[0166] Steady-state aging of myeloid cells predisposes to IL-1# production.

[0167] Given that Il1a transcription by MPs was triggered in lung tissues, this studyendeavored to identify local cues that might elicit this response from the lung MPs within the TME. Among the potential candidates, this study postulated that exposure to cell debris could instigate the production of IL-1# by MPs in lung tumors, given the cellular turnover of tumor cells in the local microenvironment. To test this hypothesis, this study employed a reductionist in vitro system, in which this study exposed bone marrow monocytes that transcriptionally resemble lung MPs to apoptotic cell debris and measured IL-1# production. This study compared this to standard agonism of TLR4 with low-dose LPS (lipopolysaccharide). This study observed that old monocytes were more sensitive to TLR4 agonism, relative to young monocytes, and produced much higher levels of IL-1# (FIG.11A). Importantly, this study also observed that exposing these cells to apoptotic tumor cell debris elicited a much stronger IL- 1# response from old monocytes than from young monocytes (FIG. 11A). This was also true for bone marrow MPs (FIG.11B).

[0168] These data revealed that cell debris can induce the production of IL-1# and thathematopoietic aging alters the cell-intrinsic quality of both monocytic cells and their MPs towards states that predispose them to produce more IL-1#. To explore how steady-state aging of hematopoietic progenitors may be involved, this study leveraged bulk RNA-seq of sorted HSCs from bone marrow of young and old mice to identify transcriptional differences associated with aging. From this analysis, this study found that old HSCs significantlyAttorney Docket No.231106-PCT (765281: MTST-819PC) downregulated the DNA methyltransferase 3A (Dnmt3a) (FIG. 11C), and this decline in mRNA expression could be observed in our own independent analysis of another external dataset, as well (FIG. 11D)56. This was significant to us, as loss-of-function mutations in DNMT3A are leading drivers of the age-associated development of clonal hematopoiesis of indeterminate potential (CHIP) and are strongly associated with lung cancer risk. Other genes, such as Tet2 and Asxl1, where mutations result in CHIP, did not exhibit a similar reduction (FIG.11D). The unique downregulation of Dnmt3a could be observed as early as 1 year of age (FIG. 11E). This study also confirmed this steady-state downregulation of DNMT3A in an external dataset of human HSCs that were sequenced from otherwise healthy donors (FIG. 11F) and in other published works. Our own analysis of bulk RNA-seq of Dnmt3a- / -and Dnmt3a+ / + (wild-type, WT) HSCs revealed that, among many major transcriptional changes, DNMT3A deficiency results in the upregulation of Jag1, Prkca, S1pr1, and Vdr and downregulation of Runx3, Flt3, and Irf7 (FIG.11G), which are all associated with a potential bias towards the myeloid lineage and is consistent with the myeloid bias of aged HSCs.

[0169] To further characterize the impact of DNMT3A deficiency, this study analyzed bulkRNA-seq of murine Dnmt3a- / -and WT GMPs. Here, mutant GMPs significantly upregulated several genes associated with a monocytic phenotype (i.e., F13a1, Il4ra, Gpnmb, Ccr2, C1qa) and with immaturity (i.e., Cd38, Flt3, Chil3, Ly6a) and up-regulated Il1r1 (FIG. 11H), suggesting that DNMT3A loss-of-function in hematopoietic progenitors leads to a greater production of myeloid progenitors with enhanced susceptibility to IL-1 signaling. More strikingly, analyzing publicly available RNA-seq datasets of Dnmt3a- / -and WT monocytes / mo- macs, this study found that the absence of DNMT3A upregulates Il1a, Il1b, immunoregulatory molecules (i.e., Cd274, Pdcd1lg2), the lineage-defining markers of monocytes and myeloid progenitors (i.e., Vcan, Ms4a3, Mpo, Elane, Retnlg, S100a8, S100a9, Prtn3), and metabolic enzymes associated with immunosuppression (i.e., Arg1, Acod1, Hmox1) (FIG. 11I, left). Many of these markers were DEGs belonging to the IL-1# program and were also significant targets from an independent analysis of human DNMT3A-deficient and -proficient mo-macs (FIG.11I, right). In fact, in these cells, other upregulated markers included those indicative of (i) (im)maturity (i.e., CD38, CD48 NFE2L2, S100A8, CSF2RB), (ii) more responsive innate immune sensing (i.e., CGAS, NLRP3, MYD88), (iii) enhanced cell survival (i.e., BCL2L1, CDKN1A, TNF), and (iv) an immunosuppressive phenotype (i.e., CD274, TGFB1, IL18BP) with potential to recruit other monocytes or Tregs (i.e., CCL5, CCL7) (FIG.11I, right). TheseAttorney Docket No.231106-PCT (765281: MTST-819PC) changes suggested that DNMT3A regulates IL-1# and a broader myeloid phenotype in ways that are conserved in both mice and humans.

[0170] To experimentally validate these transcriptional data, this study used a highly specificand potent small molecule inhibitor of DNMT3A on bone marrow monocytes from young and old mice. This study observed a significant increase in IL-1# production by both young and old monocytes, treated with the DNMT3A inhibitor and stimulated with LPS (FIG. 11J), consistent with published work that reported increased IL-1# production by Dnmt3a- / -mo- macs. Importantly, young monocytes treated with the DNMT3A inhibitor produced IL-1# at levels comparable to that of untreated, old monocytes (FIG. 11J). This finding suggested that reducing DNMT3A activity can contribute to the age-associated increase in ability for monocytic cells to express IL-1#. In contrast, the production of TNF-# exhibited a different profile; while an age-associated increase in production, like that of IL-1#, could be seen, DNMT3A inhibition increased TNF-# production in young monocytes but not in old monocytes (FIG. 11K). This was significant to us, as TNF-# had been shown to also drive myeloid bias. These data suggested that the age-associated regulation of IL-1# by DNMT3A does not necessarily extend to other cytokines capable of hematopoietic skewing.

[0171] The IL-1#-associated mRNA program stratifies human NSCLC on the basis of ageand outcome.

[0172] Finally, this study sought to explore the relevance of our collective findings to humanNSCLC, First, this study collected peripheral blood of younger (age < 70, n=5) and older (agei 1*& Z52% RN^Xe'_`NTR CG8A8 \N`VRZ`_ NZQ ]aNZ`VSVRQ `UR NOaZQNZPR [S =GE8_( >Z XVZR cV`Uour results in mice, this study found a significantly greater frequency of circulating HSPCs in older than in younger patients (FIG.12A), indicative of an increasingly efficient mobilization of immature progenitor cells from bone marrow with age.

[0173] Next, this study mined scRNAseq of our previously published map of treatment-naïve,surgically-resected NSCLC lesions of patients, from whom this study characterized immune cells in adjacent normal and tumor tissues. In the single-cell dataset was not able to detect MPs, likely owing to their scarcity and that millions of cells per patient would need to have been sequenced to capture them in sufficient numbers. Nevertheless, across the major immune cell types identified by scRNAseq, this study found that IL1A and IL1B mRNA was detected most strongly in classical monocytes and mo-macs. However, the broader IL-1# mRNA programAttorney Docket No.231106-PCT (765281: MTST-819PC) (defined using the hallmark genes IL1A, MORRBID, BCL2L1, CDKN1A, IL1RN, CLEC6A, SPP1 specifically highlighted the mo-mac cluster as exhibiting the dominant signal (FIG.12B, left). This was consistent with the model that MP-derived cells, once acquiring this program, may continue to differentiate and promote IL-1 signaling. Examining the single-cell expression of some of these genes showed that a discrete subset of mo-macs expressed the IL-1# mRNA program (IL1APOS) (FIG. 12B, right). These IL1APOS mo-macs were significantly enriched in primary resected tumors, compared to normal tissues, of NSCLC patients (FIG.12C). These tumor-associated IL1APOS mo-macs were greater in frequency in the tumors of older patients$NTR i 1*& Z5+2% `UNZ VZ e[aZTR^ \N`VRZ`_ $NTR 4 1*& Z5+1% $FIG. 12D); this age-dependentdifference was not seen in adjacent, normal tissues (p=0.94). These data supported our study of the IL-1# mRNA program as a tumoral, molecular signature that is associated with age. Moreover, this study found that a greater proportion of older patients experienced a recurrence (n=8 of 18, 44.4%), compared to younger patients (n=4 of 17, 23.5%) (FIG. 12E, left). Strikingly, this study found a significant enrichment for tumoral IL1APOS mo-macs in the tumors of recurrent patients, compared to those who did not recur (FIG.12E, right), indicating a predictive association between the abundance of IL1APOS mo-macs in primary resected tumors and recurrence.

[0174] Finally, this study sought to assess the prognostic value of the IL-1# mRNA program.This study first leveraged The Cancer Genome Atlas (TCGA) to test the relevance of the IL- 1# mRNA program in a much larger population. Overall survival analysis using a Kaplan- Meier estimator and Cox regression indicated that high expressors of the IL-1# mRNA program were predicted to exhibit a worse prognosis, compared to low expressors (FIG.12F). This study then tested the probative value of the IL-1# mRNA program as a predictor of lung cancer risk. Here, this study harnessed the circulating proteome of individuals, whose blood was collected up to three years prior to lung cancer diagnosis and abundance levels of over 1,000 proteins were compared between lung cancer patients and smoking, age-matchedcontrols. This study found that both IL-1# NZQ >A'+q cR^R NY[ZT `UR `[\ Pe`[WVZR_ NZQchemokines with a positive association with lung cancer risk (FIG.12G).

[0175] A dysregulated adaptive immune response underscores age.

[0176] In accordance with the enhanced tumor growth seen in the lungs of young micereconstituted with old bone marrow, there were more proliferative regulatory T cells (Tregs), fewer cytotoxic CD8 T cells, and significantly fewer activated NK cells in these mice,Attorney Docket No.231106-PCT (765281: MTST-819PC) compared to young mice reconstituted with young bone marrow (FIG.13A, FIG.13A). Early during tumor formation, AMs were more abundant in the lungs of young recipients, compared to old recipients, likely reflecting the steady-state presence of AMs that had not yet been perturbed by nascent microlesions (FIG. 13C, left). However, the frequency of mo-macs was already significantly higher in the lungs of mice with old bone marrow, relative to either group of recipients of young bone marrow (FIG.13D, left). At the later timepoint, once tumors were more established, the frequency of AMs was significantly reduced in the lungs of mice with old marrow, as the tumor burden was the greatest (FIG.13C, right). By contrast, mo-macs had accumulated in the lungs of all mice, but this expansion was most pronounced in the young recipients of old bone marrow (FIG.13D, right), consistent with the inferior NK cell response in these mice. This study also observed that lung MPs were significantly enriched in mice reconstituted with old bone marrow as early as 10 days post-inoculation, before the age- dependent difference in tumor burden could be realized with sufficient statistical power (FIG. 13E and FIG.13F). These results supported our hypothesis that hematopoietic aging augments tumor-induced myelopoiesis.

[0177] Example 2: Phase 1b studies to determine safety and tolerability of exemplarycombination therapies.

[0178] Cohort A: For Phase 1b to determine the safety and tolerability of Dupilumab with PD-(L)1 blockade for patients with relapsed / refractory metastatic NSCLC. For Phase 2, to determine the effect of adding IL-4Ra blockade to PD-(L)1 blocking agents in patients with relapsed / refractory NSCLC, who have progressed on prior PD-(L)1 agents

[0179] Cohort B: For Phase 1b to determine the safety and tolerability of Dupilumab andAnakinra with PD-(L)1 blockade for patients with relapsed / refractory metastatic NSCLC. For Phase 2, to determine the effect of adding IL-4Ra and IL-1R blockade to PD-(L)1 blocking agents in patients with relapsed / refractory NSCLC, who have progressed on prior PD-(L)1 agents

[0180] Secondary Objectives (Cohort A and B, evaluated separately): Define 1) Safety andTolerability, 2) Best overall response (BORR), 3) Progression-free survival (PFS), 4) Overall survival (OS) and 5) Duration of response following addition of dupilumab ± anakinra to standard PD-(L)1 blocking agentsAttorney Docket No.231106-PCT (765281: MTST-819PC)

[0181] Exploratory Objectives: Define immunodynamic effects of incorporating dupilumab ±anakinra with SOC PD-(L)1 blockade in NSCLC.

[0182] Patients who have progressed on PD-(L)1 targeted therapies will be enrolled; optimallyPD-(L)1 targeting agents will be the immediate prior therapy, though up to one line of intervening anti-cancer therapy is permitted. Patients must be candidates for standard of care (SOC) PD-1 or PD-L1 therapy. Patients will receive 3 treatments with dupilumab as part of this clinical trial, the first to be given in conjunction with standard PD-(L)1 targeted therapy infusion. Dupilumab is administered as a subcutaneous injection. Patients enrolled in this trial upon documented (radiographic or clinical) progression of disease will undergo core needle biopsy and specified blood collection prior to starting therapy, and they will undergo repeat core needle biopsy of their cancer 4 weeks after receipt of their first dupilumab injection. Following their final dupilumab injection patients will undergo repeat imaging, which will define response to therapy. For Cohort B, in addition to the treatment described above patients will receive 28 days of daily Anakinra at the standard dosing regimen of 100mg per day. Cohort B will open to accrual once Cohort A has completed accrual.

[0183] While anecdotal experience of using dupilumab in cancer patients suggests there willbe no synergistic toxicity concerns, this combination has not formally been prospectively investigated in the setting of a clinical trial. As such there will be a Phase 1b run-in clinical trial, in which first 3 patients will be enrolled and the first cycle (21 days) constitutes the DLT window. If there are 2 or more patients experiencing a DLT, the trial will be halted and the treatment plan discussed with the DSMC. If 0 or 1 patient experience a DLT, 3 more patients (total of 6 patients) will be entered. If 2 or more patients experience a DLT the trial will be halted and the treatment plan discussed with the DSMC. If at most 1 patient out of 6 patients experiences a DLT, the Phase 2 portion of the trial will open. The six patients from the Phase 1b portion will be evaluable as part of the Phase 2 cohort of 21 patients. The 21 patient cohort will follow a two-stage minimax design, with a stopping rule for futility, as detailed in Section 15.4. Cohort B will be run in an identical fashion with initial lead-in, despite low concern for toxicity in this patient population.

[0184] The primary objective of the Phase 1b portion of the study, independently assessed ineach cohort, is to determine the safety and tolerability of combined treatment of Dupilumab ± anakinra and PD-(L)1 targeted therapy in patients with relapsed or refractory NSCLC.Attorney Docket No.231106-PCT (765281: MTST-819PC)

[0185] The primary objective of the Phase 2 trial, independently assessed in each cohort, is toassess efficacy of the addition of dupilumab ± anakinra to patients with relapsed or refractory NSCLC who have progressed on prior PD-(L)1 targeted therapy, by measuring overall response rate by imaging.

[0186] Dupilumab 600mg given on day 1, and 300mg on day 22 and 43, given in conjunctionwith PD-(L)1 standard of care agents (Cohort A and B). Anakinra 100mg daily, administeredsubcutaneously for days 1 to 28 (Cohort B only). Dupilumab will be administered for up to 3doses per patient, given every three weeks. Should patient achieve or re-achieve response / stabilization of disease, standard of care PD-(L)1 blocking agent will be continued at the discretion of the investigator (Cohorts A and B). Anakinra will be administered as a subcutaneous injection (patient will be instructed on how to do this and provided with pre- filled syringes to take home) on Days 1-28 (Cohort B).

[0187] REFERENCES1. Z. Yu, J. Wang, L. Feng, X. Yang, Q. Qi, W. Li, X. Zhang, M. Ge, H. Qin, Association of tumor mutational burden with age in solid tumors. J. Clin. Orthod. 38, e13590–e13590 (2020). 2. M. Klutstein, J. Moss, T. Kaplan, H. Cedar, Contribution of epigenetic mechanisms to variation in cancer risk among tissues. Proceedings of the National Academy of Sciences. 114, 2230–2234 (2017). 3. C. Tomasetti, L. Li, B. Vogelstein, Stem cell divisions, somatic mutations, cancer etiology, and cancer prevention. Science.355, 1330–1334 (2017). 4. S. Han, P. Georgiev, A. E. Ringel, A. H. Sharpe, M. C. Haigis, Age-associated remodeling of T cell immunity and metabolism. Cell Metab.35, 36–55 (2023). 5. C. López-Otín, F. Pietrocola, D. Roiz-Valle, L. Galluzzi, G. Kroemer, Meta-hallmarks of aging and cancer. Cell Metab.35, 12–35 (2023). 6. M. R. L. Lichtenstein, R. D. Nipp, A. Muzikansky, K. Goodwin, D. Anderson, R. A. Newcomb, J. F. Gainor, Impact of Age on Outcomes with Immunotherapy in Patients with Non-Small Cell Lung Cancer. J. Thorac. Oncol.14, 547–552 (2019). 7. Z. Ma, C. Zhu, H. Wang, M. Ji, Y. Huang, X. Wei, J. Zhang, Y. Wang, R. Yin, J. Dai, L. Xu, H. Ma, Z. Hu, G. Jin, M. Zhu, H. Shen, Association between biological aging and lung cancer risk: Cohort study and Mendelian randomization analysis. iScience.26, 106018 (2023). 8. J. Sceneay, G. J. Goreczny, K. Wilson, S. Morrow, M. J. DeCristo, J. M. Ubellacker, Y. Qin, T. Laszewski, D. G. Stover, V. Barrera, J. N. Hutchinson, R. A. Freedman, E. A. Mittendorf, S. S. McAllister, Interferon Signaling Is Diminished with Age and Is AssociatedAttorney Docket No.231106-PCT (765281: MTST-819PC) with Immune Checkpoint Blockade Efficacy in Triple-Negative Breast Cancer. Cancer Discov.9, 1208–1227 (2019). 9. M. R. Shurin, G. V. Shurin, G. S. Chatta, Aging and the dendritic cell system: implications for cancer. Crit. Rev. Oncol. Hematol.64, 90–105 (2007). A. Grolleau-Julius, E. K. Harning, L. M. Abernathy, R. L. Yung, Impaired dendritic cell function in aging leads to defective antitumor immunity. Cancer Res.68, 6341–6349 (2008). 11. Z. Guo, T. Tilburgs, B. Wong, J. L. Strominger, Dysfunction of dendritic cells in aged C57BL / 6 mice leads to failure of natural killer cell activation and of tumor eradication. Proc. Natl. Acad. Sci. U. S. A. 111, 14199–14204 (2014). 12. J. Boumelha, S. de Carné Trécesson, E. K. Law, P. Romero-Clavijo, M. A. Coelho, K. W. Ng, E. Mugarza, C. Moore, S. Rana, D. R. Caswell, M. Murillo, D. C. Hancock, P. P. Argyris, W. L. Brown, C. Durfee, L. K. Larson, R. I. Vogel, A. Suárez-Bonnet, S. L. Priestnall, P. East, S. J. Ross, G. Kassiotis, M. Molina-Arcas, C. Swanton, R. Harris, J. Downward, An Immunogenic Model of KRAS-Mutant Lung Cancer Enables Evaluation of Targeted Therapy and Immunotherapy Combinations. Cancer Res.82, 3435–3448 (2022). 13. J. L. Schneider, J. H. Rowe, C. Garcia-de-Alba, C. F. Kim, A. H. Sharpe, M. C. Haigis, The aging lung: Physiology, disease, and immunity. Cell.184, 1990–2019 (2021). 14. M. D. Park, A. Silvin, F. Ginhoux, M. Merad, Macrophages in health and disease. Cell. 185, 4259–4279 (2022). 15. H. Aegerter, J. Kulikauskaite, S. Crotta, H. Patel, G. Kelly, E. M. Hessel, M. Mack, S. Beinke, A. Wack, Influenza-induced monocyte-derived alveolar macrophages confer prolonged antibacterial protection. Nat. Immunol. 21, 145–157 (2020). 16. B. Machiels, M. Dourcy, X. Xiao, J. Javaux, C. Mesnil, C. Sabatel, D. Desmecht, F. Lallemand, P. Martinive, H. Hammad, M. Guilliams, B. Dewals, A. Vanderplasschen, B. N. Lambrecht, Bureau, Fabrice, L. Gillet, A gammaherpesvirus provides protection against allergic asthma by inducing the replacement of resident alveolar macrophages with regulatory monocytes. Nat. Immunol.18, 1310–1320 (2017). 17. Z. Liu, Y. Gu, S. Chakarov, C. Bleriot, I. Kwok, X. Chen, A. Shin, W. Huang, R. J. Dress, C.-A. Dutertre, A. Schlitzer, J. Chen, L. G. Ng, H. Wang, Z. Liu, B. Su, F. Ginhoux, Fate Mapping via Ms4a3-Expression History Traces Monocyte-Derived Cells. Cell. 178, 1509–1525.e19 (2019). 18. K. Adé, J. S. Coronilla, D. Obino, T. Weinberger, C. Kaiser, S. Mella, C. Chen, L. Katsimpardi, C. Werts, H. Li, P. Dardenne, Y. Lallemand, E. G. Perdiguero, Inflammation drives age-induced loss of tissue resident macrophages. bioRxiv (2022), p. 2022.10.02.510513. 19. I. Shchukina, J. Bagaitkar, O. Shpynov, E. Loginicheva, S. Porter, D. A. Mogilenko, E. Wolin, P. Collins, G. Demidov, M. Artomov, K. Zaitsev, S. Sidorov, C. Camell, M. Bambouskova, L. Arthur, A. Swain, A. Panteleeva, A. Dievskii, E. Kurbatsky, P. Tsurinov, R. Chernyatchik, V. D. Dixit, M. Jovanovic, S. A. Stewart, M. J. Daly, S. Dmitriev, E. M. Oltz, M. N. Artyomov, Enhanced epigenetic profiling of classical human monocytes reveals a specific signature of healthy aging in the DNA methylome. Nat Aging.1, 124–141 (2021).Attorney Docket No.231106-PCT (765281: MTST-819PC) 20. K. Hashimoto, T. Kouno, T. Ikawa, N. Hayatsu, Y. Miyajima, H. Yabukami, T. Terooatea, T. Sasaki, T. Suzuki, M. Valentine, G. Pascarella, Y. Okazaki, H. Suzuki, J. W. Shin, A. Minoda, I. Taniuchi, H. Okano, Y. Arai, N. Hirose, P. Carninci, Single-cell transcriptomics reveals expansion of cytotoxic CD4 T cells in supercentenarians. Proc. Natl. Acad. Sci. U. S. A.116, 24242–24251 (2019). 21. M. Terekhova, A. Swain, P. Bohacova, E. Aladyeva, L. Arthur, A. Laha, D.A. Mogilenko, S. Burdess, V.Sukhov, D. Kleverov, B. Echalar, P. Tsurinov, R. Chernyatchik, K. Husarcikova, M.N. Artyomov. Single-cell atlas of healthy human blood unveils age- related loss of NKG2C+GZMB-CD8+ memory T cells and accumulation of type 2 memory T cells. Immunity.56, 1-10 (2023). 22. Zheng, Y. et al. A human circulating immune cell landscape in aging and COVID-19. Protein Cell 11, 740–770 (2020). 23. Cao, Y. et al. Phenotypic and functional alterations of monocyte subsets with aging. Immun. Ageing 19, 63 (2022) 24. Sadeghi, H. M., Schnelle, J. F., Thomas, J. K., Nishanian, P. & Fahey, J. L. Phenotypic and functional characteristics of circulating monocytes of elderly persons". Exp. Gerontol. 34, 959–970 (1999) 25. N.M. LaMarche, S. Hegde, M.D. Park, B.B. Maier, L. Troncoso, J.L. Berichel, P. Hamon, M. Belabed, R. Mattiuz, C. Hennequin, T. Chin, A.M. Reid, I. Reyes-Torres, E. Nemeth, R. Zhang, O.C. Olson, D.B. Doroshow, N.C. Rohs, J.E. Gomez, R. Veluswamy, N. Hall, N. Venturini, F. Ginhoux, Z. Liu, M. Buckup, I. Figueiredo, V. Roudko, K. Miyake, H. Karasuyama, E. Gonzalez-Kozlova, S. Gnjatic, E. Passegué, S. Kim-Schulze, B.D. Brown, F.R. Hirsch, B.S. Kim, T.U. Marron, M. Merad. An IL-4 signaling axis in bone marrow drives pro-tumorigenic myelopoiesis. Nature. In Press. 26. A. M. Leader, J. A. Grout, B. B. Maier, B. Y. Nabet, M. D. Park, A. Tabachnikova, C. Chang, L. Walker, A. Lansky, J. Le Berichel, L. Troncoso, N. Malissen, M. Davila, J. C. Martin, G. Magri, K. Tuballes, Z. Zhao, F. Petralia, R. Samstein, N. R. D’Amore, G. Thurston, A. O. Kamphorst, A. Wolf, R. Flores, P. Wang, S. Müller, I. Mellman, M. B. Beasley, H. Salmon, A. H. Rahman, T. U. Marron, E. Kenigsberg, M. Merad, Single-cell analysis of human non-small cell lung cancer lesions refines tumor classification and patient stratification. Cancer Cell. 39, 1594– 1609.e12 (2021). 27. P.-L. Loyher, P. Hamon, M. Laviron, A. Meghraoui-Kheddar, E. Goncalves, Z. Deng, S. Torstensson, N. Bercovici, C. Baudesson de Chanville, B. Combadière, F. Geissmann, A. Savina, C. Combadière, A. Boissonnas, Macrophages of distinct origins contribute to tumor development in the lung. J. Exp. Med.215, 2536–2553 (2018). 28. M. Casanova-Acebes, E. Dalla, A. M. Leader, J. LeBerichel, J. Nikolic, B. M. Morales, M. Brown, C. Chang, L. Troncoso, S. T. Chen, A. Sastre-Perona, M. D. Park, A. Tabachnikova, M. Dhainaut, P. Hamon, B. Maier, C. M. Sawai, E. Agulló-Pascual, M. Schober, B. D. Brown, B. Reizis, T. Marron, E. Kenigsberg, C. Moussion, P. Benaroch, J. A.Attorney Docket No.231106-PCT (765281: MTST-819PC) Aguirre-Ghiso, M. Merad, Tissue-resident macrophages provide a pro-tumorigenic niche to early NSCLC cells. Nature.595, 578–584 (2021). 29. M. D. Park, I. Reyes-Torres, J. LeBerichel, P. Hamon, N. M. LaMarche, S. Hegde, M. Belabed, L. Troncoso, J. A. Grout, A. Magen, E. Humblin, A. Nair, M. Molgora, J. Hou, J. H. Newman, A. M. Farkas, A. M. Leader, T. Dawson, D. D’Souza, S. Hamel, A. R. Sanchez- Paulete, B. Maier, N. Bhardwaj, J. C. Martin, A. O. Kamphorst, E. Kenigsberg, M. Casanova- Acebes, A. Horowitz, B. D. Brown, L. F. De Andrade, M. Colonna, T. U. Marron, M. Merad, TREM2 macrophages drive NK cell paucity and dysfunction in lung cancer. Nat. Immunol. 24, 792–801 (2023). 30. V. Cortez-Retamozo, M. Etzrodt, A. Newton, P. J. Rauch, A. Chudnovskiy, C. Berger, R. J. H. Ryan, Y. Iwamoto, B. Marinelli, R. Gorbatov, R. Forghani, T. I. Novobrantseva, V. Koteliansky, J.-L. Figueiredo, J. W. Chen, D. G. Anderson, M. Nahrendorf, F. K. Swirski, R. Weissleder, M. J. Pittet, Origins of tumor-associated macrophages and neutrophils. Proc. Natl. Acad. Sci. U. S. A. 109, 2491–2496 (2012). 31. D. A. G. Barisas, A. U. Kabir, J. Wu, K. Krchma, M. Kim, M. Subramanian, B. H.MVZ_RXYReR^& 8( A( G`RcN^`& @( 8U[V& HaY[^'QR^VbRQ VZ`R^XRaWVZ'+o NZQ XRaWRYVN VZUVOV`[^efactor promote extramedullary hematopoiesis. PLoS Biol.21, e3001746 (2023). 32. L. Sikkema, C. Ramírez-Suástegui, D. C. Strobl, T. E. Gillett, L. Zappia, E. Madissoon, N. S. Markov, L.-E. Zaragosi, Y. Ji, M. Ansari, M.-J. Arguel, L. Apperloo, M. Banchero, C. Bécavin, M. Berg, E. Chichelnitskiy, M.-I. Chung, A. Collin, A. C. A. Gay, J. Gote- Schniering, B. Hooshiar Kashani, K. Inecik, M. Jain, T. S. Kapellos, T. M. Kole, S. Leroy, C. H. Mayr, A. J. Oliver, M. von Papen, L. Peter, C. J. Taylor, T. Walzthoeni, C. Xu, L. T. Bui, C. De Donno, L. Dony, A. Faiz, M. Guo, A. J. Gutierrez, L. Heumos, N. Huang, I. L. Ibarra, N. D. Jackson, P. Kadur Lakshminarasimha Murthy, M. Lotfollahi, T. Tabib, C. Talavera-López, K. J. Travaglini, A. Wilbrey-Clark, K. B. Worlock, M. Yoshida, Lung Biological Network Consortium, M. van den Berge, Y. Bossé, T. J. Desai, O. Eickelberg, N. Kaminski, M. A. Krasnow, R. Lafyatis, M. Z. Nikolic, J. E. Powell, J. Rajagopal, M. Rojas, O. Rozenblatt-Rosen, M. A. Seibold, D. Sheppard, D. P. Shepherd, D. D. Sin, W. Timens, A. M. Tsankov, J. Whitsett, Y. Xu, N. E. Banovich, P. Barbry, T. E. Duong, C. S. Falk, K. B. Meyer, J. A. Kropski, D. Pe’er, H. B. Schiller, P. R. Tata, J. L. Schultze, S. A. Teichmann, A. V. Misharin, M. C. Nawijn, M. D. Luecken, F. J. Theis, An integrated cell atlas of the lung in health and disease. Nat. Med.29, 1563–1577 (2023). 33. N. Mende, H. P. Bastos, A. Santoro, K. T. Mahbubani, V. Ciaurro, E. F. Calderbank, M. Quiroga Londoño, K. Sham, G. Mantica, T. Morishima, E. Mitchell, M. R. Lidonnici, F. Meier-Abt, D. Hayler, L.Jardine, A. Curd, M. Haniffa, G. Ferrari, H. Takizawa, N. K. Wilson, B. Göttgens, K. Saeb-Parsy, M. Frontini, E. Laurenti, Unique molecular and functional features of extramedullary hematopoietic stem and progenitor cell reservoirs in humans. Blood.139, 3387–3401 (2022). 34. E. Lefrançais, G. Ortiz-Muñoz, A. Caudrillier, B. Mallavia, F. Liu, D. M. Sayah, E. E. Thornton, M. B. Headley, T. David, S. R. Coughlin, M. F. Krummel, A. D. Leavitt, E. Passegué, M. R. Looney, The lung is a site of platelet biogenesis and a reservoir for haematopoietic progenitors. Nature.544, 105–109 (2017).Attorney Docket No.231106-PCT (765281: MTST-819PC) 35. K. G. Anderson, K. Mayer-Barber, H. Sung, L. Beura, B. R. James, J. J. Taylor, L. Qunaj, T. S. Griffith, V. Vezys, D. L. Barber, D. Masopust, Intravascular staining for discrimination of vascular and tissue leukocytes. Nat. Protoc.9, 209–222 (2014). 36. P. Hamon, P.-L. Loyher, C. Baudesson de Chanville, F. Licata, C. Combadière, A. Boissonnas, CX3CR1-dependent endothelial margination modulates Ly6Chigh monocyte systemic deployment upon inflammation in mice. Blood.129, 1296–1307 (2017). 37. A. Kaur, M. R. Webster, K. Marchbank, R. Behera, A. Ndoye, C. H. Kugel 3rd, V. M. Dang, J. Appleton, M. P. O’Connell, P. Cheng, A. A. Valiga, R. Morissette, N. B. McDonnell, L. Ferrucci, A. V. Kossenkov, K. Meeth, H.-Y. Tang, X. Yin, W. H. Wood 3rd, E. Lehrmann, K. G. Becker, K. T. Flaherty, D. T. Frederick, J. A. Wargo, Z. A. Cooper, M. T. Tetzlaff, C. Hudgens, K. M. Aird, R. Zhang, X. Xu, Q. Liu, E. Bartlett, G. Karakousis, Z. Eroglu, R. S. Lo, M. Chan, A. M. Menzies, G. V. Long, D. B. Johnson, J. Sosman, B. Schilling, D. Schadendorf, D. W. Speicher, M. Bosenberg, A. Ribas, A. T. Weeraratna, sFRP2 in the aged microenvironment drives melanoma metastasis and therapy resistance. Nature.532, 250–254 (2016). 38. M. E. Fane, Y. Chhabra, G. M. Alicea, D. A. Maranto, S. M. Douglass, M. R. Webster, V. W. Rebecca, G. E. Marino, F. Almeida, B. L. Ecker, D. J. Zabransky, L. Hüser, T. Beer, H.-Y. Tang, A. Kossenkov, M. Herlyn, D. W. Speicher, W. Xu, X. Xu, E. M. Jaffee, J. A. Aguirre-Ghiso, A. T. Weeraratna, Stromal changes in the aged lung induce an emergence from melanoma dormancy. Nature.606, 396–405 (2022). 39. Z. Gong, Q. Li, J. Shi, P. Li, L. Hua, L. D. Shultz, G. Ren, Immunosuppressive reprogramming of neutrophils by lung mesenchymal cells promotes breast cancer metastasis. Sci Immunol.8, eadd5204 (2023). 40. S. Meiners, O. Eickelberg, M. Königshoff, Hallmarks of the ageing lung. Eur. Respir. J.45, 807–827 (2015). 41. D. Chanda, M. Rehan, S. R. Smith, K. G. Dsouza, Y. Wang, K. Bernard, D. Kurundkar, V. Memula, K. Kojima, J. A. Mobley, G. A. Benavides, V. Darley-Usmar, Y.-I. Kim, J. W. Zmijewski, J. S. Deshane, S. De Langhe, V. J. Thannickal, Mesenchymal stromal cell aging impairs the self-organizing capacity of lung alveolar epithelial stem cells. Elife. 10 (2021), doi:10.7554 / eLife.68049. 42. I. Kwok, E. Becht, Y. Xia, M. Ng, Y. C. Teh, L. Tan, M. Evrard, J. L. Y. Li, H. T. N. Tran, Y. Tan, D. Liu, A. Mishra, K. H. Liong, K. Leong, Y. Zhang, A. Olsson, C. K. Mantri, P. Shyamsunder, Z. Liu, C. Piot, C.-A. Dutertre, H. Cheng, S. Bari, N. Ang, S. K. Biswas, H. P. Koeffler, H. L. Tey, A. Larbi, I.-H. Su, B. Lee, A. St John, J. K. Y. Chan, W. Y. K. Hwang, J. Chen, N. Salomonis, S. Z. Chong, H. L. Grimes, B. Liu, A. Hidalgo, E. W. Newell, T. Cheng, F. Ginhoux, L. G. Ng, Combinatorial Single-Cell Analyses of Granulocyte-Monocyte Progenitor Heterogeneity Reveals an Early Uni-potent Neutrophil Progenitor. Immunity.53, 303–318.e5 (2020). 43. P. R. Taylor, D. M. Reid, S. E. M. Heinsbroek, G. D. Brown, S. Gordon, S. Y. C. Wong, Dectin-2 is predominantly myeloid restricted and exhibits unique activation-dependent expression on maturing inflammatory monocytes elicited in vivo. Eur. J. Immunol.35, 2163– 2174 (2005).Attorney Docket No.231106-PCT (765281: MTST-819PC) 44. N. N. Jarjour, E. A. Schwarzkopf, T. R. Bradstreet, I. Shchukina, C.-C. Lin, S. C.-C. Huang, C.-W. Lai, M. E. Cook, R. Taneja, T. S. Stappenbeck, G. J. Randolph, M. N. Artyomov, J. F. Urban Jr, B. T. Edelson, Bhlhe40 mediates tissue-specific control of macrophage proliferation in homeostasis and type 2 immunity. Nat. Immunol. 20, 687–700 (2019). 45. M. E. Cook, N. N. Jarjour, C.-C. Lin, B. T. Edelson, Transcription Factor Bhlhe40 in Immunity and Autoimmunity. Trends Immunol.41, 1023–1036 (2020). 46. J. J. Kotzin, S. P. Spencer, S. J. McCright, D. B. U. Kumar, M. A. Collet, W. K. Mowel, E. N. Elliott, A. Uyar, M. A. Makiya, M. C. Dunagin, C. C. D. Harman, A. T. Virtue, S. Zhu, W. Bailis, J. Stein, C. Hughes, A. Raj, E. J. Wherry, L. A. Goff, A. D. Klion, J. L. Rinn, A. Williams, R. A. Flavell, J. Henao-Mejia, The long non-coding RNA Morrbid regulates Bim and short-lived myeloid cell lifespan. Nature.537, 239–243 (2016). 47. Z. Cai, F. Aguilera, B. Ramdas, S. V. Daulatabad, R. Srivastava, J. J. Kotzin, M. Carroll, G. Wertheim, A. Williams, S. C. Janga, C. Zhang, J. Henao-Mejia, R. Kapur, Targeting Bim via a lncRNA Morrbid Regulates the Survival of Preleukemic and Leukemic Cells. Cell Rep. 31, 107816 (2020). 48. E. Koncina, M. Nurmik, V. I. Pozdeev, C. Gilson, M. Tsenkova, R. Begaj, S. Stang, A. Gaigneaux, C. Weindorfer, F. Rodriguez, M. Schmoetten, E. Klein, J. Karta, V. S. Atanasova, K. Grzyb, P. Ullmann, R. Halder, M. Hengstschläger, J. Graas, V. Augendre, Y. E. Karapetyan, L. Kerger, N. Zuegel, A. Skupin, S. Haan, J. Meiser, H. Dolznig, E. Letellier, IL1R1+ cancer-associated fibroblasts drive tumor development and immunosuppression in colorectal cancer. Nat. Commun.14, 1–17 (2023). 49. D. F. Boyd, E. K. Allen, A. G. Randolph, X.-Z. J. Guo, Y. Weng, C. J. Sanders, R. Bajracharya, N. K. Lee, C. S. Guy, P. Vogel, W. Guan, Y. Li, X. Liu, T. Novak, M. M. Newhams, T. P. Fabrizio, N. Wohlgemuth, P. M. Mourani, PALISI Pediatric Intensive Care Influenza (PICFLU) Investigators, T. N. Wight, S. Schultz-Cherry, S. A. Cormier, K. Shaw- Saliba, A. Pekosz, R. E. Rothman, K.-F. Chen, Z. Yang, R. J. Webby, N. Zhong, J. C. Crawford, P. G. Thomas, Exuberant fibroblast activity compromises lung function via ADAMTS4. Nature.587, 466–471 (2020). 50. J. W. Griffith, L. D. Faustino, V. I. Cottrell, K. Nepal, L. P. Hariri, R. S.-Y. Chiu, M. C. Jones, A. Julé, C. Gabay, A. D. Luster, Regulatory T cell-derived IL-1Ra suppresses the innate response to respiratory viral infection. Nat. Immunol., 1–17 (2023). 51. P. R. Nagareddy, M. Kraakman, S. L. Masters, R. A. Stirzaker, D. J. Gorman, R. W. Grant, D. Dragoljevic, E. S. Hong, A. Abdel-Latif, S. S. Smyth, S. H. Choi, J. Korner, K. E. Bornfeldt, E. A. Fisher, V. D. Dixit, A. R. Tall, I. J. Goldberg, A. J. Murphy, Adipose tissue macrophages promote myelopoiesis and monocytosis in obesity. Cell Metab. 19, 821–835 (2014). 52. I. Mitroulis, K. Ruppova, B. Wang, L.-S. Chen, M. Grzybek, T. Grinenko, A. Eugster, M. Troullinaki, A. Palladini, I. Kourtzelis, A. Chatzigeorgiou, A. Schlitzer, M. Beyer, L. A. B. Joosten, B. Isermann, M. Lesche, A. Petzold, K. Simons, I. Henry, A. Dahl, J. L. Schultze, B. Wielockx, N. Zamboni, P. Mirtschink, Ü. Coskun, G. Hajishengallis, M. G. Netea, T.Attorney Docket No.231106-PCT (765281: MTST-819PC) Chavakis, Modulation of Myelopoiesis Progenitors Is an Integral Component of Trained Immunity. Cell.172, 147–161.e12 (2018). 53. A. Christ, P. Günther, M. A. R. Lauterbach, P. Duewell, D. Biswas, K. Pelka, C. J. Scholz, M. Oosting, K. Haendler, K. Baßler, K. Klee, J. Schulte-Schrepping, T. Ulas, S. J. C. F. M. Moorlag, V. Kumar, M. H. Park, L. A. B. Joosten, L. A. Groh, N. P. Riksen, T. Espevik, A. Schlitzer, Y. Li, M. L. Fitzgerald, M. G. Netea, J. L. Schultze, E. Latz, Western Diet Triggers NLRP3-Dependent Innate Immune Reprogramming. Cell. 172, 162–175.e14 (2018). 54. E. M. Pietras, C. Mirantes-Barbeito, S. Fong, D. Loeffler, L. V. Kovtonyuk, S. Zhang, R. Lakshminarasimhan, C. P. Chin, J.-M. Techner, B. Will, C. Nerlov, U. Steidl, M. G. Manz, T. Schroeder, E. Passegué, Chronic interleukin-1 exposure drives haematopoietic stem cells towards precocious myeloid differentiation at the expense of self-renewal. Nat. Cell Biol.18, 607–618 (2016). 55. K. C. Higa, A. Goodspeed, J. S. Chavez, M. De Dominici, E. Danis, V. Zaberezhnyy, J. L. Rabe, D. G. Tenen, E. M. Pietras, J. DeGregori, Chronic interleukin-1 exposure triggers selection for Cebpa-knockout multipotent hematopoietic progenitors. J. Exp. Med. 218 (2021), doi:10.1084 / jem.20200560. 56. L. V. Kovtonyuk, F. Caiado, S. Garcia-Martin, E.-M. Manz, P. Helbling, H. Takizawa, S. Boettcher, F. Al-Shahrour, C. Nombela-Arrieta, E. Slack, M. G. Manz, IL-1 mediates microbiome-induced inflammaging of hematopoietic stem cells in mice. Blood. 139, 44–58 (2022). 57. X. Li, H. Wang, X. Yu, G. Saha, L. Kalafati, C. Ioannidis, I. Mitroulis, M. G. Netea, T. Chavakis, G. Hajishengallis, Maladaptive innate immune training of myelopoiesis links inflammatory comorbidities. Cell.185, 1709–1727.e18 (2022). 58. F. Caiado, L. V. Kovtonyuk, N. G. Gonullu, J. Fullin, S. Boettcher, M. G. Manz, Aging drives Tet2+ / -clonal hematopoiesis via IL-1 signaling. Blood.141, 886–903 (2023). 59. N. Itokawa, M. Oshima, S. Koide, N. Takayama, W. Kuribayashi, Y. Nakajima-Takagi, K. Aoyama, S. Yamazaki, K. Yamaguchi, Y. Furukawa, K. Eto, A. Iwama, Epigenetic traits inscribed in chromatin accessibility in aged hematopoietic stem cells. Nat. Commun.13, 1– 15 (2022). 60. M. D. Kessler, A. Damask, S. O’Keeffe, N. Banerjee, D. Li, K. Watanabe, A. Marketta, M. Van Meter, S. Semrau, J. Horowitz, J. Tang, J. A. Kosmicki, V. M. Rajagopal, Y. Zou, Y. Houvras, A. Ghosh, C. Gillies, J. Mbatchou, R. R. White, N. Verweij, J. Bovijn, N. N. Parikshak, M. G. LeBlanc, M. Jones, Regeneron Genetics Center, GHS-RGC DiscovEHR Collaboration, D. J. Glass, L. A. Lotta, M. N. Cantor, G. S. Atwal, A. E. Locke, M. A. R. Ferreira, R. Deering, C. Paulding, A. R. Shuldiner, G. Thurston, A. A. Ferrando, W. Salerno, J. G. Reid, J. D. Overton, J. Marchini, H. M. Kang, A. Baras, G. R. Abecasis, E. Jorgenson, Common and rare variant associations with clonal haematopoiesis phenotypes. Nature. 612, 301–309 (2022). 61. O. Pich, I. Reyes-Salazar, A. Gonzalez-Perez, N. Lopez-Bigas, Discovering the drivers of clonal hematopoiesis. Nat. Commun.13, 4267 (2022).Attorney Docket No.231106-PCT (765281: MTST-819PC) 62. L. Fairchild, J. Whalen, K. D’Aco, J. Wu, C. B. Gustafson, N. Solovieff, F. Su, R. J. Leary, C. D. Campbell, O. A. Balbin, Clonal hematopoiesis detection in patients with cancer using cell-free DNA sequencing. Sci. Transl. Med.15, eabm8729 (2023). 63. C. C. Coombs, A. Zehir, S. M. Devlin, A. Kishtagari, A. Syed, P. Jonsson, D. M. Hyman, D. B. Solit, M. E. Robson, J. Baselga, M. E. Arcila, M. Ladanyi, M. S. Tallman, R. L. Levine, M. F. Berger, Therapy-Related Clonal Hematopoiesis in Patients with Non-hematologic Cancers Is Common and Associated with Adverse Clinical Outcomes. Cell Stem Cell.21, 374–382.e4 (2017). 64. K. Young, E. Eudy, R. Bell, M. A. Loberg, T. Stearns, D. Sharma, L. Velten, S. Haas, M.-D. Filippi, J. J. Trowbridge, Decline in IGF1 in the bone marrow microenvironment initiates hematopoietic stem cell aging. Cell Stem Cell.28, 1473–1482.e7 (2021). 65. K. A. Oetjen, K. E. Lindblad, M. Goswami, G. Gui, P. K. Dagur, C. Lai, L. W. Dillon, J. P. McCoy, C. S. Hourigan, Human bone marrow assessment by single-cell RNA sequencing, mass cytometry, and flow cytometry. JCI Insight. 3 (2018), doi:10.1172 / jci.insight.124928. 66. N. Hadad, D. R. Masser, S. Logan, B. Wronowski, C. A. Mangold, N. Clark, L. Otalora, A. Unnikrishnan, M. M. Ford, C. B. Giles, J. D. Wren, A. Richardson, W. E. Sonntag, D. R. Stanford, W. Freeman, Absence of genomic hypomethylation or regulation of cytosine- modifying enzymes with aging in male and female mice. Epigenetics Chromatin. 9, 30 (2016). 67. D. Midic, J. Rinke, F. Perner, V. Müller, A. Hinze, F. Pester, J. Landschulze, J. Ernst, B. Gruhn, G. Matziolis, F. H. Heidel, A. Hochhaus, T. Ernst, Prevalence and dynamics of clonal hematopoiesis caused by leukemia-associated mutations in elderly individuals without hematologic disorders. Leukemia.34, 2198–2205 (2020). 68. C. R. Zhang, E. L. Ostrander, O. Kukhar, C. Mallaney, J. Sun, E. Haussler, H. Celik, W. K. Koh, K. Y. King, P. Gontarz, G. A. Challen, Txnip Enhances Fitness of Dnmt3a- Mutant Hematopoietic Stem Cells via p21. Blood Cancer Discov.3, 220–239 (2022). 69. R. Zheng, A. D. Friedman, D. Small, Targeted inhibition of FLT3 overcomes the block to myeloid differentiation in 32Dcl3 cells caused by expression of FLT3 / ITD mutations. Blood.100, 4154–4161 (2002). 70. T. Schroeder, U. Just, Notch signalling via RBP-J promotes myeloid differentiation. EMBO J.19, 2558–2568 (2000). 71. Y. Meng, J. Carrelha, R. Drissen, X. Ren, B. Zhang, A. Gambardella, S. Valletta, S. Thongjuea, S. E. Jacobsen, C. Nerlov, Epigenetic programming defines haematopoietic stem cell fate restriction. Nat. Cell Biol.25, 812–822 (2023). 72. A. C. Menezes, R. Jones, A. Shrestha, R. Nicholson, A. Leckenby, A. Azevedo, S. Davies, S. Baker, A.Attorney Docket No.231106-PCT (765281: MTST-819PC) F. Gilkes, R. L. Darley, A. Tonks, Increased expression of RUNX3 inhibits normal human myeloid development. Leukemia.36, 1769–1780 (2022). 73. C. A. Saito-Reis, V. D. Balise, E. M. Pascetti, M. Jiminez, J. M. Gillette, Tetraspanin CD82 regulates S1PR1-mediated hematopoietic stem and progenitor cell mobilization. Stem Cell Reports.16, 2422–2431 (2021). 74. Z. Hmama, D. Nandan, L. Sly, K. L. Knutson, P. Herrera-Velit, N. E. Reiner, 1alpha,25- dihydroxyvitamin D(3)-induced myeloid cell differentiation is regulated by a vitamin D receptor-phosphatidylinositol 3-kinase signaling complex. J. Exp. Med. 190, 1583–1594 (1999). 75. K. Wakahashi, K. Minagawa, Y. Kawano, H. Kawano, T. Suzuki, S. Ishii, A. Sada, N. Asada, M. Sato, S. Kato, K. Shide, K. Shimoda, T. Matsui, Y. Katayama, Vitamin D receptor–mediated skewed differentiation of macrophages initiates myelofibrosis and subsequent osteosclerosis. Blood.133, 1619–1629 (2019). 76. Y.-Y. Chen, Y.-F. Liu, Y.-D. Liu, X.-H. Deng, J. Zhou, IRF7 suppresses hematopoietic regeneration under stress via CXCR4. Stem Cells.39, 183–195 (2021). 77. O. A. Guryanova, Y. K. Lieu, F. E. Garrett-Bakelman, B. Spitzer, J. L. Glass, K. Shank, A. B. V. Martinez, S. A. Rivera, B. H. Durham, F. Rapaport, M. D. Keller, S. Pandey, L. Bastian, D. Tovbin, A. R. Weinstein, J. Teruya-Feldstein, O. Abdel-Wahab, V. Santini, C. E. Mason, A. M. Melnick, S. Mukherjee, R. L. Levine, Dnmt3a regulates myeloproliferation and liver-specific expansion of hematopoietic stem and progenitor cells. Leukemia.30, 1133–1142 (2016). 78. P. J. Rauch, J. Gopakumar, A. J. Silver, D. Nachun, H. Ahmad, M. McConkey, T. Nakao, M. Bosse, T. Rentz, N. Vivanco Gonzalez, N. F. Greenwald, E. F. McCaffrey, Z. Khair, M. Gopakumar, K. B. Rodrigues, A. E. Lin, E. Sinha, M. Fefer, D. N. Cohen, A. Vromman, E. Shvartz, G. Sukhova, S. Bendall, M. Angelo, P. Libby, B. L. Ebert, S. Jaiswal, Loss-of-function mutations in Dnmt3a and Tet2 lead to accelerated atherosclerosis and concordant macrophage phenotypes. Nature Cardiovascular Research.2, 805–818 (2023). 79. E. Alaluf, B. Vokaer, A. Detavernier, A. Azouz, M. Splittgerber, A. Carrette, L. Boon, F. Libert, M. Soares, A. Le Moine, S. Goriely, Heme oxygenase-1 orchestrates the immunosuppressive program of tumor-associated macrophages. JCI Insight. 5 (2020), doi:10.1172 / jci.insight.133929. 80. Y.-J. Chen, G.-N. Li, X.-J. Li, L.-X. Wei, M.-J. Fu, Z.-L. Cheng, Z. Yang, G.-Q. Zhu, X.-D. Wang, C. Zhang, J.-Y. Zhang, Y.-P. Sun, H. Saiyin, J. Zhang, W.-R. Liu, W.-W. Zhu, K.-L. Guan, Y. Xiong, Y. Yang, D. Ye, L.-L. Chen, Targeting IRG1 reverses the immunosuppressive function of tumor-associated macrophages and enhances cancer immunotherapy. Science Advances.9, eadg0654 (2023). 81. E. L. Mills, D. G. Ryan, H. A. Prag, D. Dikovskaya, D. Menon, Z. Zaslona, M. P. Jedrychowski, A. S. H. Costa, M. Higgins, E. Hams, J. Szpyt, M. C. Runtsch, M. S. King, J. F. McGouran, R. Fischer, B. M. Kessler, A. F. McGettrick, M. M. Hughes, R. G. Carroll, L. M. Booty, E. V. Knatko, P. J. Meakin, M. L. J. Ashford, L. K. Modis, G. Brunori, D. C.Attorney Docket No.231106-PCT (765281: MTST-819PC) Sévin, P. G. Fallon, S. T. Caldwell, E. R. S. Kunji, E. T. Chouchani, C. Frezza, A. T. Dinkova-Kostova, R. C. Hartley, M. P. Murphy, L. A. O’Neill, Itaconate is an anti- inflammatory metabolite that activates Nrf2 via alkylation of KEAP1. Nature.556, 113–117 (2018). 82. I. Cobo, T. N. Tanaka, K. Chandra Mangalhara, A. Lana, C. Yeang, C. Han, J. Schlachetzki, J. Challcombe, B. R. Fixsen, M. Sakai, R. Z. Li, H. Fields, M. Mokry, R. G. Tsai, R. Bejar, K. Prange, M. de Winther, G. S. Shadel, C. K. Glass, DNA methyltransferase 3 alpha and TET methylcytosine dioxygenase 2 restrain mitochondrial DNA-mediated interferon signaling in macrophages. Immunity.55, 1386–1401.e10 (2022).2-( E( <( @VY& 6( CV^[aXN& I( GUW[XZVW& B( BP8[ZWRe& 6( :( AVZ& B( GnNOVPWV& ?( E( @RY\&A. Bick, C. J. Gibson, G. Griffin, A. Sekar, D. J. Brooks, W. J. Wong, D. N. Cohen, M. M. Uddin, W. J. Shin, J. Pirruccello, J. M. Tsai, M. Agrawal, D. P. Kiel, M. L. Bouxsein, J. B. Richards, D. M. Evans, M. N. Wein, J. F. Charles, S. Jaiswal, P. Natarajan, B. L. Ebert, Dnmt3a-mutated clonal hematopoiesis promotes osteoporosis. J. Exp. Med. 218 (2021), doi:10.1084 / jem.20211872. 84. J. M. SanMiguel, E. Eudy, M. A. Loberg, K. A. Young, J. J. Mistry, K. D. Mujica, L. S. Schwartz, T. M. Stearns, G. A. Challen, J. J. Trowbridge, Distinct Tumor Necrosis Factor Alpha Receptors Dictate Stem Cell Fitness versus Lineage Output in Dnmt3a-Mutant Clonal Hematopoiesis. Cancer Discov.12, 2763–2773 (2022).2 / ( B( LNYN_UV`N& :( EN__RTag& HC;'o 8[[^QVZN`R_ =RYN`[\[VR`VP G`RY 8RXX Ga^bVbNX NZQMyeloid Regeneration. Cell Stem Cell.25, 357–372.e7 (2019). 86. The Lung Cancer Cohort Consortium, The blood proteome of imminent lung cancer diagnosis. Nat. Commun.14, 1–12 (2023). 87. Beck LA, Thaci D, Hamilton JD, et al. Dupilumab treatment in adults with moderate- to-severe atopic dermatitis. The New England journal of medicine.2014;371(2):130-139. 88. Castro M, Corren J, Pavord ID, et al. Dupilumab Efficacy and Safety in Moderate-to- Severe Uncontrolled Asthma. The New England journal of medicine. 2018;378(26):2486- 2496. 89. Rabe KF, Nair P, Brusselle G, et al. Efficacy and Safety of Dupilumab in Glucocorticoid-Dependent Severe Asthma. The New England journal of medicine. 2018;378(26):2475-2485. 90. Simpson EL, Bieber T, Guttman-Yassky E, et al. Two Phase 3 Trials of Dupilumab versus Placebo in Atopic Dermatitis. The New England journal of medicine. 2016;375(24):2335-2348. 91. Wenzel S, Ford L, Pearlman D, et al. Dupilumab in persistent asthma with elevated eosinophil levels. The New England journal of medicine.2013;368(26):2455-2466. 92. Antonia SJ, Villegas A, Daniel D, et al. Durvalumab after Chemoradiotherapy in Stage III Non-Small-Cell Lung Cancer. The New England journal of medicine.2017. 93. Coussens LM, Zitvogel L, Palucka AK. Neutralizing tumor-promoting chronic inflammation: a magic bullet? Science.2013;339(6117):286-291.Attorney Docket No.231106-PCT (765281: MTST-819PC) 94. Mantovani A, Allavena P. The interaction of anticancer therapies with tumor-associated macrophages. J Exp Med.2015;212(4):435-445. 95. Maier B, Leader AM, Chen ST, et al. A conserved dendritic-cell regulatory program limits antitumour immunity. Nature.2020;580(7802):257-262. 96. Duan J, Cui L, Zhao X, et al. Use of immunotherapy with programmed cell death 1 vs programmed cell death ligand 1 inhibitors in patients with cancer: a systematic review and meta-analysis. JAMA oncology.2020;6(3):375-384. 97. Gadgeel S, Rodríguez-Abreu D, Speranza G, et al. Updated analysis from KEYNOTE- 189: pembrolizumab or placebo plus pemetrexed and platinum for previously untreated metastatic nonsquamous non-small-cell lung cancer.2020. 98. Hellmann MD, Paz-Ares L, Bernabe Caro R, et al. Nivolumab plus ipilimumab in advanced non–small-cell lung cancer. New England Journal of Medicine. 2019;381(21):2020-2031. 99. Paz-Ares L, Luft A, Vicente D, et al. Pembrolizumab plus chemotherapy for squamous non–small-cell lung cancer. New England Journal of Medicine.2018;379(21):2040-2051.

[0188] All features disclosed in the specification, including the claims, abstracts, and drawings,and all the steps in any method or process disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. Each feature disclosed in the specification, including the claims, abstract, and drawings, can be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

[0189] It will be understood that while the invention has been described in conjunction withthe detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.231106-PCT (765281: MTST-819PC) CLAIMS What is claimed is:

1. A method of treating cancer in a subject undergoing PD-1 therapy comprising administering an effective amount of an interleukin-1 (IL-1) receptor inhibitor to the subject.

2. The method of claim 1, wherein the IL-1 receptor inhibitor selectively inhibits an IL-1# ^RPR\`[^ [^ NZ >A'+q ^RPR\`[^(3. The method of claim 1, wherein the IL-1 receptor inhibitor selectively inhibits both anIL-1# ^RPR\`[^ NZQ NZ >A'+q ^RPR\`[^(4. The method of any one of claims 1 to 3, wherein the IL-1 receptor inhibitor comprisesan IL-1# ZRa`^NXVfVZT NZ`VO[Qe [^ NZ >A'+q ZRa`^NXVfVZT NZ`VO[Qe(5. The method of any one of claims 1 to 4, wherein the IL-1 receptor inhibitor comprises an IL-1 receptor antagonist.

6. The method of any one of claims 1 to 5, wherein the IL-1 receptor inhibitor comprises anakinra, canakinumab, or rilonacept.

7. The method of any one of claims 1 to 6, wherein the IL-1 receptor inhibitor is administered via infusion, injection, subcutaneous, or any combination of thereof.

8. The method of any one of claims 1 to 7, wherein the IL-1 receptor is administered concurrently with the PD-1 therapy.

9. The method of any one of claims 1 to 8, the effective amount of the IL-1 receptor inhibitor administered is at least about 10 mg per dose, alternatively at least about 20 mg per dose, alternatively at least about 30 mg per dose, alternatively at least about 40 mg per dose, alternatively at least about 50 mg per dose, alternatively at least about 60 mg per dose, alternatively at least about 70 mg per dose, alternatively at least about 80 mg per dose, alternatively at least about 90 mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 110 mg per dose, alternatively at least about 120 mg per dose, alternatively at least about 130 mg per dose, alternatively at least about 140 mg per dose, or alternatively at least about 150 mg per dose.Attorney Docket No.231106-PCT (765281: MTST-819PC) 10. The method of claim 9, wherein the IL-1 receptor inhibitor is administered at least one a day, alternatively at least twice a day, alternatively at least three times a day, or alternatively at least four times a day.

11. The method of claim 9 or claim 10, wherein the IL-1 receptor inhibitor is administered for at least 21 days, alternatively at least 22 days, alternatively at least 23 days, alternatively at least 24 days, alternatively at least 25 days, alternatively at least 26 days, alternatively at least 27 days, alternatively at least 28 days, alternatively at least 29 days, or alternatively at least 30 days.

12. The method of any one of claims 1 to 11, wherein the method further comprises administering an effective amount of an interleukin-4 (IL-4) inhibitor.

13. The method of claim 12, wherein the IL-4 inhibitor comprises an IL-4R inhibitor or an IL-4R# inhibitor.

14. The method of claim 12 or claim 13, wherein the IL-4 inhibitor comprises dupilumab.

15. The method of any one of claims 12 to 14, wherein the IL-4 inhibitor is administered via infusion, injection, subcutaneous, or any combination of thereof.

16. The method of any one of claims 12 to 15, wherein the IL-4 inhibitor is administered concurrently with the PD-1 therapy.

17. The method of claim 16, wherein the IL-4 inhibitor is administered at least once, alternatively at least twice, alternatively at least three times, alternatively at least four times, or alternatively at least five times.

18. The method of claim 17, wherein times between administration of the IL-4 inhibitor is at least about 30 minutes, alternatively at least about 1 hour, alternatively at least about 2 hours, alternatively at least about 4 hours, alternatively at least about 8 hours, alternatively at least about 16 hours, alternatively at least about 1 day, alternatively at least about 5 days, alternatively at least about 1 week, alternatively at least about 2 weeks, alternatively at least about 3 weeks, or alternatively at least about 4 weeks.

19. The method of any one of claims 12 to 18, wherein the effective amount of the IL-4 inhibitor administered is at least about 50 mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 200 mg per dose, alternatively at least about 300 mg perAttorney Docket No.231106-PCT (765281: MTST-819PC) dose, alternatively at least about 400 mg per dose, alternatively at least about 500 mg per dose, alternatively at least about 600 mg per dose.

20. The method of any one of claims 1 to 19, wherein the PD-1 therapy comprises administering an effective amount of a PD-1 inhibitor or PD-L1 inhibitor.

21. The method of claim 20, wherein the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of pembrolizumab, durvalumab, nivolumab, ipilimumab, MEDI0680, and combinations thereof.

22. The method of claim 20 or claim 21, wherein the PD-1 inhibitor or PD-L1 inhibitor is administered via a standard of care dosing schedule.

23. The method of any one of claims 1 to 22, wherein the administration of the IL-1 receptor inhibitor enhances the response to PD-1 and PD-L1 blocking antibodies.

24. The method of claim 23, wherein the enhanced response results in anti-tumor immunity.

25. The method of any one of claims 1 to 24, wherein the effective amount is a pharmaceutically effective amount or a therapeutically effective amount.

26. The method of any one of claims 1 to 24, wherein the cancer is characterized by tumor-induced myelopoiesis associated with immunosuppression.

27. The method of any one of claims 1 to 26, wherein the cancer is selected from the group consisting of head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), hepatocellular carcinoma (HCC), mesothelioma, colorectal cancer, and breast cancer.

28. The method of claim 27, wherein the subject has relapsed / refractory non-small cell lung cancer (NSCLC).

29. The method of any one of claims 1 to 28, wherein said administration of the IL-1 receptor inhibitor, and / or the IL-4 inhibitor (i) reduces the abundance of myeloid progenitors cells; (ii) reduces the abundance of the Natural Killer cell-suppressive monocyte-derived macrophages; (iii) reduces the production of IL-1# myeloid progenitor cells; (iv) reduces the production of IL-1#; (v) up-regulates differential expressed genes by hematopoietic stem cells in the bone marrow; (vi) reduces cancer growth; and / or (vii) decreases tumor burden.Attorney Docket No.231106-PCT (765281: MTST-819PC) 30. A method for treating cancer using a combination therapy, wherein the combination therapy comprises administering an effective amount of an interleukin-1 (IL-1) receptor inhibitor and an effective amount of an interleukin-4 (IL-4) inhibitor to a subject undergoing PD-1 therapy.

31. The method of claim 30, wherein the IL-1 receptor inhibitor selectively inhibits an IL-1# ^RPR\`[^ [^ NZ >A'+q ^RPR\`[^(32. The method of claim 30, wherein the IL-1 receptor inhibitor selectively inhibits bothan IL-1# ^RPR\`[^ NZQ NZ >A'+q ^RPR\`[^(33. The method of any one of claims 30 to 32, wherein the IL-1 receptor inhibitorcomprises an IL-1# ZRa`^NXVfVZT NZ`VO[Qe [^ NZ >A'+q ZRa`^NXVfVZT NZ`VO[Qe(34. The method of any one of claims 30 to 33, wherein the IL-1 receptor inhibitor comprises an IL-1 receptor antagonist.

35. The method of any one of claims 30 to 34, wherein the IL-1 receptor inhibitor comprises anakinra, canakinumab, or rilonacept.

36. The method of any one of claims 30 to 35, wherein the IL-1 receptor inhibitor is administered via infusion, injection, subcutaneous, or any combination of thereof.

37. The method of any one of claims 30 to 36, wherein the IL-1 receptor is administered concurrently with the PD-1 therapy.

38. The method of any one of claims 30 to 37, the effective amount of the IL-1 receptor inhibitor administered is at least about 10 mg per dose, alternatively at least about 20 mg per dose, alternatively at least about 30 mg per dose, alternatively at least about 40 mg per dose, alternatively at least about 50 mg per dose, alternatively at least about 60 mg per dose, alternatively at least about 70 mg per dose, alternatively at least about 80 mg per dose, alternatively at least about 90 mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 110 mg per dose, alternatively at least about 120 mg per dose, alternatively at least about 130 mg per dose, alternatively at least about 140 mg per dose, or alternatively at least about 150 mg per dose.

39. The method of claim 38, wherein the IL-1 receptor inhibitor is administered at least one a day, alternatively at least twice a day, alternatively at least three times a day, or alternatively at least four times a day.Attorney Docket No.231106-PCT (765281: MTST-819PC) 40. The method of claim 38 or claim 39, wherein the IL-1 receptor inhibitor is administered for at least 21 days, alternatively at least 22 days, alternatively at least 23 days, alternatively at least 24 days, alternatively at least 25 days, alternatively at least 26 days, alternatively at least 27 days, alternatively at least 28 days, alternatively at least 29 days, or alternatively at least 30 days.

41. The method of any one of claim 30 to 40, wherein the IL-4 inhibitor comprises an IL- 4R inhibitor or an IL-4R# inhibitor.

42. The method of any one of claims 30 to 41, wherein the IL-4 inhibitor comprises dupilumab.

43. The method of any one of claims 30 to 42, wherein the IL-4 inhibitor is administered via infusion, injection, subcutaneous, or any combination of thereof.

44. The method of any one of claims 30 to 43, wherein the IL-4 inhibitor is administered concurrently with the PD-1 therapy.

45. The method of claim 44, wherein the IL-4 inhibitor is administered at least once, alternatively at least twice, alternatively at least three times, alternatively at least four times, or alternatively at least five times.

46. The method of claim 45, wherein times between administration of the IL-4 inhibitor is at least about 30 minutes, alternatively at least about 1 hour, alternatively at least about 2 hours, alternatively at least about 4 hours, alternatively at least about 8 hours, alternatively at least about 16 hours, alternatively at least about 1 day, alternatively at least about 5 days, alternatively at least about 1 week, alternatively at least about 2 weeks, alternatively at least about 3 weeks, or alternatively at least about 4 weeks.

47. The method of any one of claims 45 to 46, wherein the effective amount of the IL-4 inhibitor administered is at least about 50 mg per dose, alternatively at least about 100 mg per dose, alternatively at least about 200 mg per dose, alternatively at least about 300 mg per dose, alternatively at least about 400 mg per dose, alternatively at least about 500 mg per dose, alternatively at least about 600 mg per dose.

48. The method of any one of claims 30 to 47, wherein the PD-1 therapy comprises administering an effective amount of a PD-1 inhibitor or PD-L1 inhibitor.Attorney Docket No.231106-PCT (765281: MTST-819PC) 49. The method of claim 48, wherein the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of pembrolizumab, durvalumab, nivolumab, ipilimumab, MEDI0680, and combinations thereof.

50. The method of claim 48 or claim 49, wherein the PD-1 inhibitor or PD-L1 inhibitor is administered via a standard of care dosing schedule.

51. The method of any one of claims 30 to 50, wherein the administration of the IL-1 receptor inhibitor enhances the response to PD-1 and PD-L1 blocking antibodies.

52. The method of claim 51, wherein the enhanced response results in anti-tumor immunity.

53. The method of any one of claims 30 to 52, wherein the effective amount is a pharmaceutically effective amount or a therapeutically effective amount.

54. The method of any one of claims 30 to 53, wherein the cancer is characterized by tumor-induced myelopoiesis associated with immunosuppression.

55. The method of any one of claims 30 to 54, wherein the cancer is selected from the group consisting of head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), hepatocellular carcinoma (HCC), mesothelioma, colorectal cancer, and breast cancer.

56. The method of claim 55, wherein the subject has relapsed / refractory non-small cell lung cancer (NSCLC).

57. The method of any one of claims 30 to 56, wherein said administration of the IL-1 inhibitor, and / or the IL-4 inhibitor (i) reduces the abundance of myeloid progenitors cells; (ii) reduces the abundance of the Natural Killer cell-suppressive monocyte-derived macrophages; (iii) reduces the production of IL-1# myeloid progenitor cells; (iv) reduces the production of IL-1#; (v) up-regulates differential expressed genes by hematopoietic stem cells in the bone marrow; (vi) reduces cancer growth; and / or (vii) decreases tumor burden.

Images