Anti-tumor use of phosphorus compound

Compositions or formulations prepared using phosphorus compounds can be used to treat tumors with high expression of creatine kinase B, thus solving the problem of precision in tumor treatment, improving treatment efficacy, and reducing side effects.

WO2025237351A1PCT designated stage Publication Date: 2025-11-20SHANGHAI SHIJIANG BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/094989
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-16
Filing Date
2025-05-15
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

Current technologies are insufficient for precise treatment of tumors, leading to problems such as inappropriate treatment and drug side effects.

Method used

A phosphorus compound is provided for preparing compositions or formulations for the treatment of tumors with high creatine kinase B expression, wherein the suitability of a patient for treatment with this compound is determined by detecting the creatine kinase B expression level.

Benefits of technology

This approach enables precise treatment of tumors with high creatine kinase B expression, improving treatment efficacy and reducing drug dosage and side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025094989_20112025_PF_FP_ABST
    Figure CN2025094989_20112025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to an anti-tumor use of a phosphorus compound. Specifically, the present invention provides a use of a compound of formula (I), an optical isomer thereof, a racemate thereof, a solvate thereof, a pharmaceutically acceptable salt thereof or a deuterated compound thereof in preparation of a composition or a preparation, wherein the composition or the preparation is used for preventing and / or treating tumors. The compound of the present invention exhibits excellent precise therapeutic efficacy against tumors characterized by high expression of kinase B.
Need to check novelty before this filing date? Find Prior Art

Description

Use of a phosphorus compound in the field of anti-tumor TECHNICAL FIELD

[0001] The present application relates to the field of medicine, in particular to the use of a phosphorus compound in the field of anti-tumor. BACKGROUND

[0002] Tumor is a common disease that seriously endangers human health, and the mortality rate of malignant tumor has been on the rise. Due to the heterogeneity of tumor, if the same treatment method or the same drug is simply used according to its source or pathological characteristics, etc., it is easy to cause improper treatment, and miss the valuable treatment time and opportunity of the patient, so it is necessary to use precise treatment for different conditions of tumor. With the development of biological technology, tumor is continuously typed at the molecular level of gene, protein, etc., and more and more changes in tumor-related gene expression and activity have been discovered. The changes in tumor-related gene expression and activity play an important role in the development of malignant tumor, so the discovery and application of biomarkers will provide precise guidance for the application of related drugs, making precise treatment of tumor possible, so as to realize targeted drug delivery, significantly improve tumor treatment effect, and reduce drug dosage and side effects.

[0003] Therefore, there is an urgent need in the art to develop a drug that can precisely treat tumor. SUMMARY

[0004] The purpose of the present application is to provide a compound that has significantly excellent precise treatment for tumor with high expression of creatine kinase B.

[0005] In a first aspect of the present application, the use of a compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for preparing a composition or a preparation for preventing and / or treating tumor is provided.

[0006] wherein,

[0007] R1, R2, R3, and R4 are each independently substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C1-C16 haloalkyl, substituted or unsubstituted C2-C8 alkenyl- substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted C3-C16 cycloalkyl, substituted or unsubstituted 3-16 membered heterocycloalkyl, substituted or unsubstituted C6-C16 aryl, substituted or unsubstituted 3-16 membered heteroaryl, substituted or unsubstituted C6-C16 aryl- substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted 3-16 membered heteroaryl- substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted C2-C10 ester- substituted or unsubstituted C1-C10 alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C10 alkyl-.

[0008] In another preferred embodiment, R1, R2, R3, and R4 are each independently substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C1-C12 haloalkyl, substituted or unsubstituted C2-C6 alkenyl- substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C12 aryl- substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted 3-12 membered heteroaryl- substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted C2-C8 ester- substituted or unsubstituted C1-C8 alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C8 alkyl-.

[0009] In another preferred embodiment, R1, R2, R3, and R4 are each independently substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 haloalkyl, substituted or unsubstituted C2-C4 alkenyl- substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C12 aryl- substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted 3-12 membered heteroaryl- substituted or unsubstituted C1-C4 alkyl-, substituted or unsubstituted C2-C6 ester- substituted or unsubstituted C1-C6 alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C6 alkyl-.

[0010] In another preferred embodiment, R1, R2, R3, and R4are each independently substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C1-C8haloalkyl, substituted or unsubstituted C2-C4alkenyl-, substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C6-C12aryl, substituted or unsubstituted 3-12 membered heteroaryl, substituted or unsubstituted C6-C12aryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted 3-12 membered heteroaryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C2-C5ester- substituted or unsubstituted C1-C6alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C6alkyl-.

[0011] In another preferred embodiment, R1, R2, R3, and R4are each independently substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C1-C6haloalkyl, substituted or unsubstituted C2-C4alkenyl-, substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C4-C6cycloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C6-C10aryl, substituted or unsubstituted 5-10 membered heteroaryl, substituted or unsubstituted C6-C10aryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted 5-10 membered heteroaryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C2-C5ester- substituted or unsubstituted C1-C5alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C6alkyl-.

[0012] In another preferred embodiment, R1, R2, R3, and R4are each independently substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C1-C4haloalkyl, substituted or unsubstituted C2-C4alkenyl-, substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C4-C6cycloalkyl, substituted or unsubstituted 5-7 membered heterocycloalkyl, substituted or unsubstituted C6-C10aryl, substituted or unsubstituted 5-10 membered heteroaryl, substituted or unsubstituted C6-C10aryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted 5-10 membered heteroaryl- substituted or unsubstituted C1-C2alkyl-, substituted or unsubstituted C2-C4ester- substituted or unsubstituted C2-C4alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C2-C5alkyl-.

[0013] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms of a group are each independently replaced with a substituent.

[0014] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C8alkyl, C3-C8cycloalkyl, C2-C8alkenyl, C1-C8haloalkyl, C3-C8halocycloalkyl, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C3-C8halocycloalkoxy, C3-C8halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C8ester, C2-C8amide, C1-C8alkoxy, C1-C8alkylthio, C1-C8haloalkoxy, C1-C8haloalkylthio, C6-C12aryl, 5-12 membered heteroaryl.

[0015] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C6alkyl, C3-C8cycloalkyl, C2-C6alkenyl, C1-C6haloalkyl, C3-C8halocycloalkyl, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C3-C8halocycloalkoxy, C3-C8halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C6ester, C2-C6amide, C1-C6alkoxy, C1-C6alkylthio, C1-C6haloalkoxy, C1-C6haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0016] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C4alkyl, C3-C8cycloalkyl, C2-C4alkenyl, C1-C4haloalkyl, C3-C8halocycloalkyl, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C3-C8halocycloalkoxy, C3-C8halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C6ester, C2-C6amide, C1-C4alkoxy, C1-C4alkylthio, C1-C4haloalkoxy, C1-C4haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0017] In another preferred embodiment, the heterocycloalkyl and heteroaryl have 1-4 (preferably 1, 2, 3, or 4) heteroatoms each independently selected from N, O, and S on the heterocyclic ring.

[0018] In another preferred embodiment, the heterocycloalkyl has 1-4 (preferably 1, 2, 3, or 4) heteroatoms each independently selected from N, O, and S on the heterocyclic ring.

[0019] In another preferred embodiment, the heteroaryl group has 1 to 4 (preferably 1, 2, 3, or 4) heteroatoms each independently selected from N, O, and S on the heterocyclic ring.

[0020] In another preferred embodiment, the heterocycloalkyl group has 0, 1, or 2 C=C ring double bonds.

[0021] In another preferred embodiment, R1, R2, and R3 are each independently phenyl.

[0022] In another preferred embodiment, R1, R2, R3, and R4 are each independently methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, cyclopentyl, halomethyl, halopropyl, halobutyl, ethenyl-methyl-, propenyl-methyl-, butenyl-methyl-, propionyl-propyl-, indolyl, thienyl, furanyl, pyridyl-methyl-, naphthyl, naphthyl-methyl-,

[0023] R5, R6, R7, R8, R9, R 10 , R 11 , and R 12 are each independently hydrogen, C1-C8 alkyl, C1-C8 alkoxy, C1-C8 alkylthio, halogen;

[0024] Z1 is C1-C10 alkylene.

[0025] In another preferred embodiment, R5, R6, R7, R8, R9, R 10 , R 11 , and R 12 are each independently hydrogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, halogen.

[0026] In another preferred embodiment, R5, R6, R7, R8, R9, R 10 , R 11 , and R 12 are each independently hydrogen, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 alkylthio, halogen.

[0027] In another preferred embodiment, R5, R6, R7, R8, R9, R 10 , R 11 , and R 12 are each independently hydrogen, C1-C2 alkyl, C1-C2 alkoxy, C1-C2 alkylthio, halogen.

[0028] In another preferred embodiment, R5, R6, R7, R8, R9, R 10 , R 11 , and R 12each independently hydrogen, methyl, methoxy, methylthio, ethoxy, ethylthio, halogen (such as F or CI).

[0029] In another preferred embodiment, Z1is C1-C8alkylene.

[0030] In another preferred embodiment, Z1is C1-C6alkylene.

[0031] In another preferred embodiment, Z1is C1-C4alkylene.

[0032] In another preferred embodiment, Z1is C2-C4alkylene.

[0033] In another preferred embodiment, Z1is propylene.

[0034] In another preferred embodiment, propyl is n-propyl, isopropyl.

[0035] In another preferred embodiment, butyl is

[0036] In another preferred embodiment, pentyl is

[0037] In another preferred embodiment, octyl is

[0038] In another preferred embodiment, propylene is

[0039] In another preferred embodiment, cyclopentyl is

[0040] In another preferred embodiment, halomethyl is monohalomethyl.

[0041] In another preferred embodiment, halomethyl is monoiodomethyl.

[0042] In another preferred embodiment, halomethyl is

[0043] In another preferred embodiment, halopropyl is monohalopropyl.

[0044] In another preferred embodiment, halopropyl is monobromopropyl.

[0045] In another preferred embodiment, halopropyl is

[0046] In another preferred embodiment, halobutyl is monohalobutyl.

[0047] In another preferred embodiment, halobutyl is monobromobutyl.

[0048] In another preferred embodiment, halobutyl is

[0049] In another preferred embodiment, ethenyl-methyl- is

[0050] In another preferred embodiment, ethenyl-methyl- is

[0051] In another preferred embodiment, butenyl-methyl- is

[0052] In another preferred embodiment, propyl-ethyl- is

[0053] In another preferred embodiment, indolyl is

[0054] In another preferred embodiment, thienyl is

[0055] In another preferred embodiment, furanyl is

[0056] In another preferred embodiment, pyridyl-methyl- is

[0057] In another preferred embodiment, naphthyl-methyl- is

[0058] In another preferred embodiment, halo is fluoro, chloro, bromo, or iodo.

[0059] In another preferred embodiment, aryl is phenyl.

[0060] In another preferred embodiment, halo is mono-, di-, tri-, or per-halo.

[0061] In another preferred embodiment, halo is fluoro, chloro, bromo, or iodo.

[0062] In another preferred embodiment, fluoro is mono-, di-, tri-, or per-fluoro.

[0063] In another preferred embodiment, chloro is mono-, di-, tri-, or per-chloro.

[0064] In another preferred embodiment, bromo is mono-, di-, tri-, or per-bromo.

[0065] In another preferred embodiment, iodo is mono-, di-, tri-, or per-iodo.

[0066] In another preferred embodiment, deuterio is mono-, di-, tri-, or per-deuterio.

[0067] In another preferred embodiment, halogenated means that one or more (preferably 1, 2, or 3) hydrogen atoms on a group are each independently replaced with a halogen.

[0068] In another preferred embodiment, the structure of the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof is shown as Formula I-1:

[0069] wherein R1, R2, R3, and R4 are each independently as defined above;

[0070] X - is an anionic salt counterion.

[0071] In another preferred embodiment, X - is an anionic acid counterion.

[0072] In another preferred embodiment, X - loses a H + to form a salt counterion.

[0073] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of Formula I includes a salt of the compound of Formula I with an acid.

[0074] In another preferred embodiment, the acid includes one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid, and glutamic acid.

[0075] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of Formula I includes a salt of the compound of Formula I with hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid, and glutamic acid.

[0076] In another preferred embodiment, the salt counterion of the pharmaceutically acceptable salt of the compound of Formula I includes F - , Cl - , Br - , I - , HCOO - , CH3COO - , SO4 2- , NO3 - or

[0077] In another preferred embodiment, the compound is:

[0078] In another preferred embodiment, the tumor is a human tumor.

[0079] In another preferred embodiment, the tumor is a human tumor.

[0080] In another preferred embodiment, the tumor is an animal tumor.

[0081] In another preferred embodiment, the tumor is a mammalian tumor.

[0082] In another preferred embodiment, the tumor is a non-human mammalian tumor.

[0083] In another preferred embodiment, the tumor is a tumor with high expression of creatine kinase B.

[0084] In another preferred embodiment, the tumor with high expression of creatine kinase B means that creatine kinase B can be detected by creatine kinase B antibody detection from 20 μg protein extracted from the tumor, more preferably from 5 μg protein extracted from the tumor, more preferably from 1 μg protein extracted from the tumor, more preferably from 0.2 μg protein extracted from the tumor, more preferably from 0.05 μg protein extracted from the tumor, more preferably from 0.01 μg protein extracted from the tumor.

[0085] In another preferred embodiment, the tumor with high expression of creatine kinase B means that the expression level of creatine kinase B of tumor cells is higher than that of cells of the same type or normal cells.

[0086] In another preferred embodiment, the tumor with high expression of creatine kinase B means that the ratio of the expression level E1 of creatine kinase B of tumor cells to the expression level E0 of creatine kinase B of cells of the same type or normal cells (E1 / E0) is >1.0, more preferably ≥1.2, more preferably ≥1.5, more preferably ≥2, more preferably ≥3, more preferably ≥5, more preferably ≥8, more preferably ≥10, more preferably ≥15, more preferably ≥20, more preferably ≥30, more preferably ≥50, for example 2-50.

[0087] In another preferred embodiment, the same class of cells comprises cells of the same type.

[0088] In another preferred embodiment, the same class of cells comprises tumor cells of the same type.

[0089] In another preferred embodiment, the same class of cells comprises tumor cells of the same type.

[0090] In another preferred embodiment, the same class of cells comprises cells that express, do not express, or express low levels of creatine kinase B.

[0091] In another preferred embodiment, the same class of cells comprises cells that express, do not express, or express low levels of creatine kinase B (such as tumor cells of the same type or tumor cells of the same type).

[0092] In another preferred embodiment, the same class of cells comprises tumor cells of the same type that express, do not express, or express low levels of creatine kinase B.

[0093] In another preferred embodiment, the same class of cells comprises cells of the same type that express, do not express, or express low levels of creatine kinase B.

[0094] In another preferred embodiment, the normal cells comprise normal tissue cells (such as tumor origin cells, tumor adjacent cells, or peritumoral tissue cells).

[0095] In another preferred embodiment, the normal cells comprise normal tissue cells (such as tumor origin cells, tumor adjacent cells, or peritumoral tissue cells) that express normal levels of creatine kinase B.

[0096] In another preferred embodiment, E0 is the expression level of creatine kinase B of a cell that expresses, does not express, or expresses low levels of creatine kinase B.

[0097] In another preferred embodiment, the cell that expresses, does not express, or expresses low levels of creatine kinase B is not sensitive to the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0098] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0099] In another preferred embodiment, the lung cancer is selected from the group consisting of non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0100] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0101] In another preferred embodiment, the breast cancer cells comprise MDA-MB-453 cells.

[0102] In another preferred embodiment, the breast cancer comprises triple negative breast cancer.

[0103] In another preferred embodiment, the brain tumor is selected from the group consisting of brain glioblastoma, brain glioma, brain medulloblastoma, brain neuroblastoma, or a combination thereof.

[0104] In another preferred embodiment, the brain glioblastoma comprises glioblastoma multiforme.

[0105] In another preferred embodiment, the kidney cancer is selected from the group consisting of renal clear cell adenocarcinoma, kidney cancer Wilms, or a combination thereof.

[0106] In another preferred embodiment, the kidney cancer cells comprise G-401 cells.

[0107] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal carcinoma.

[0108] In another preferred embodiment, the expression comprises protein expression and / or mRNA expression.

[0109] In another preferred embodiment, the level comprises protein level and / or mRNA level.

[0110] In another preferred embodiment, the composition is a pharmaceutical composition.

[0111] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0112] In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, a liquid preparation, or a semi-solid preparation.

[0113] In another preferred embodiment, the dosage form of the composition or preparation is an oral preparation, a topical preparation, or an injection preparation.

[0114] In a second aspect of the present application, a marker for determining whether a tumor patient is suitable for the prevention and / or treatment of tumor by using a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as described in the first aspect of the present application is provided, wherein the marker comprises creatine kinase B expression level.

[0115] In another preferred embodiment, the creatine kinase B expression level comprises creatine kinase B expression level in tumor cells.

[0116] In another preferred embodiment, the instructions or labels indicate that the composition is used for the prevention and / or treatment of tumor.

[0117] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application.

[0118] In another preferred embodiment, the instructions or labels further indicate that the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application is used for the treatment of a tumor patient having tumor cells with low expression or no expression of creatine kinase B.

[0119] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application.

[0120] In another preferred embodiment, the low expression or no expression of creatine kinase B means that the ratio of the expression level E1 of creatine kinase B in the tumor cells to the expression level E0 of creatine kinase B in the same type of cells or normal cells (E1 / E0) is <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0121] In a third aspect, the present application provides a detection kit, wherein the detection kit comprises:

[0122] (i) a detection reagent for detecting the expression level of creatine kinase B.

[0123] In another preferred embodiment, the detection sample of the detection kit comprises tumor cells.

[0124] In another preferred embodiment, the level comprises a protein level and / or an mRNA level.

[0125] In another preferred embodiment, the expression comprises mRNA and / or protein expression.

[0126] In a fourth aspect, the present application provides use of the detection kit according to the third aspect of the present application in the preparation of a companion diagnostic kit for determining whether a tumor patient is suitable for prevention and / or treatment with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application.

[0127] In another preferred embodiment, the companion diagnostic kit further comprises instructions or labels.

[0128] In another preferred embodiment, the instructions or the label further state:

[0129] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0130] In another preferred embodiment, the instructions or the label further state:

[0131] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0132] In another preferred embodiment, the tumor patient suitable for the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, comprises that the tumor of the tumor patient is sensitive to the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0133] In another preferred embodiment, the tumor patient not suitable for the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, comprises that the tumor of the tumor patient is not sensitive to the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0134] In a fifth aspect of the present application, there is provided a kit, said kit comprising:

[0135] (i) a detection reagent for detecting the expression level of creatine kinase B; and

[0136] (ii) a compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0137] In another preferred embodiment, the sample to be detected comprises a tumor.

[0138] In another preferred embodiment, the kit further comprises instructions or a label.

[0139] In another preferred embodiment, the instructions or the label further state:

[0140] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0141] In another preferred embodiment, the instructions or the label further state:

[0142] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0143] In a sixth aspect of the present application, there is provided a use of the kit according to the fifth aspect of the present application for the manufacture of a pharmaceutical kit for prevention and / or treatment of a tumor.

[0144] In another preferred embodiment, the pharmaceutical kit further comprises instructions or a label.

[0145] In another preferred embodiment, the instructions or the label further state:

[0146] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0147] In another preferred embodiment, the instructions or the label further state:

[0148] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0149] In a seventh aspect of the present application, there is provided a method for prevention and / or treatment of a tumor, the method comprising: administering to a subject in need thereof the compound of Formula I according to the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, thereby preventing and / or treating the tumor.

[0150] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0151] In another preferred embodiment, the subject is a human and a non-human mammal (rodents, rabbits, monkeys, livestock, dogs, cats, etc.).

[0152] In another preferred embodiment, the method comprises the step of:

[0153] The subject is first administered a creatine kinase B promoter to increase the expression of creatine kinase B in the tumor of the subject, and then the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is administered to prevent and / or treat the tumor.

[0154] In another preferred embodiment, the method comprises the step of:

[0155] The subject is first administered a creatine kinase B promoter to increase the expression of creatine kinase B in the tumor of the subject, and then the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is administered to prevent and / or treat the tumor.

[0156] In another preferred embodiment, the promoter comprises a specific promoter.

[0157] In another preferred embodiment, the creatine kinase B promoter comprises a promoter capable of increasing the expression of creatine kinase B in the tumor.

[0158] In an eighth aspect of the present application, there is provided an apparatus or system, the apparatus or system comprising:

[0159] (i) a detection module for detecting the expression level of creatine kinase B;

[0160] (ii) an output module comprising outputting the following information:

[0161] When the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application; and / or

[0162] When the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application.

[0163] In another preferred embodiment, the sample detected comprises tumor cells.

[0164] In another preferred embodiment, the apparatus comprises a gene detector or a protein detector.

[0165] In another preferred embodiment, the device or system further comprises a sample injection module.

[0166] In another preferred embodiment, the sample injection module is used for injecting tumor cell extract.

[0167] In another preferred embodiment, the device or system further comprises a data processing module.

[0168] In another preferred embodiment, the data processing module processes the expression level of creatine kinase B.

[0169] In a ninth aspect of the present application, there is provided a use of a creatine kinase B promoter for the preparation of a composition or preparation for enhancing the anti-tumor effect of an anti-tumor drug.

[0170] In another preferred embodiment, the anti-tumor drug is a compound of Formula I as described in the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0171] In another preferred embodiment, the creatine kinase B promoter comprises a promoter capable of promoting high expression of creatine kinase B in a tumor.

[0172] In another preferred embodiment, the promoter comprises a specific promoter.

[0173] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0174] In another preferred embodiment, the composition or preparation is a pharmaceutical composition or a pharmaceutical preparation.

[0175] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0176] In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, a liquid preparation, or a semi-solid preparation.

[0177] In another preferred embodiment, the dosage form of the composition or preparation is an oral preparation, a topical preparation, or an injection preparation.

[0178] In a tenth aspect of the present application, there is provided an active ingredient combination comprising the following components:

[0179] (1) a first active ingredient, wherein the first active ingredient comprises an anti-tumor drug; and

[0180] (2) a second active ingredient, wherein the second active ingredient comprises a creatine kinase B promoter.

[0181] In another preferred embodiment, the antitumor drug is a compound of Formula I as described in the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0182] In another preferred embodiment, the creatine kinase B promoter includes a promoter capable of promoting high expression of creatine kinase B in a tumor.

[0183] In another preferred embodiment, the promoter includes a specific promoter.

[0184] In another preferred embodiment, the molar ratio of the first active ingredient to the second active ingredient is 0.01-600:1, preferably 0.05-500:1, more preferably 0.1-400:1, more preferably 0.2-200:1, more preferably 0.5-100:1, more preferably 0.5-80:1, most preferably 1-50:1.

[0185] In another preferred embodiment, at least one of the active ingredients in the active ingredient combination is independent.

[0186] In another preferred embodiment, the first active ingredient and the second active ingredient in the active ingredient combination are independent of each other.

[0187] In an eleventh aspect of the present application, a composition is provided, the composition comprising:

[0188] (1) a first active ingredient, the first active ingredient comprising an antitumor drug; and

[0189] (2) a second active ingredient, the second active ingredient comprising a creatine kinase B promoter.

[0190] In another preferred embodiment, the antitumor drug is a compound of Formula I as described in the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0191] In another preferred embodiment, the creatine kinase B promoter includes a promoter capable of promoting high expression of creatine kinase B in a tumor.

[0192] In another preferred embodiment, the promoter includes a specific promoter.

[0193] In another preferred embodiment, the composition is a pharmaceutical composition.

[0194] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0195] In another preferred embodiment, the dosage form of the composition is a solid preparation, a liquid preparation, or a semi-solid preparation.

[0196] In another preferred embodiment, the dosage form of the composition is an oral preparation, a topical preparation, or an injectable preparation.

[0197] In another preferred embodiment, the content of the first active ingredient is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, more preferably 1-99 wt%, more preferably 10-99 wt%, most preferably 20-99 wt%, based on the total weight of the active ingredients in the composition.

[0198] In another preferred embodiment, the content of the second active ingredient is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, more preferably 1-99 wt%, more preferably 10-99 wt%, most preferably 20-99 wt%, based on the total weight of the active ingredients in the composition.

[0199] In a twelfth aspect of the present application, there is provided a kit, which comprises:

[0200] (A) a first preparation containing a first active ingredient, wherein the first active ingredient comprises an antitumor drug; and

[0201] (B) a second preparation containing a second active ingredient, wherein the second active ingredient comprises a creatine kinase B promoter.

[0202] In another preferred embodiment, the antitumor drug is a compound of Formula I as described in the first aspect of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0203] In another preferred embodiment, the creatine kinase B promoter comprises a promoter capable of promoting high expression of creatine kinase B in a tumor.

[0204] In another preferred embodiment, the promoter comprises a specific promoter.

[0205] In another preferred embodiment, the kit further comprises an instruction for use.

[0206] In another preferred embodiment, the first preparation and the second preparation are independent preparations.

[0207] In another preferred embodiment, the first preparation and the second preparation are combined preparations.

[0208] In another preferred embodiment, the instruction for use indicates that the first preparation and the second preparation are used in combination to enhance the antitumor activity of the antitumor drug.

[0209] In another preferred embodiment, the method of combination is to administer the second preparation containing the creatine kinase B promoter first, and then administer the antitumor drug.

[0210] In a thirteenth aspect, there is provided a method of inhibiting a tumor cell, the method comprising the step of contacting a tumor cell with a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, as described in the first aspect of the present application, thereby inhibiting the tumor cell.

[0211] In another preferred embodiment, the method is an in vitro method or an in vitro method.

[0212] In another preferred embodiment, the method of inhibiting a tumor cell comprises an in vitro non-therapeutic and non-diagnostic method of inhibiting a tumor cell.

[0213] In another preferred embodiment, the contacting is an in vitro culturing.

[0214] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0215] Within the scope of the present application, each of the technical features described above and each of the technical features described in detail hereinafter can be combined with each other to form a new or preferred technical solution. BRIEF DESCRIPTION OF DRAWINGS

[0216] Figure 1 is the creatine kinase B expression level of NCI-H82 cells, G-401 cells, MDA-MB-453 cells, 786-O cells, CFPAC-1 cells and SF126 cells.

[0217] Figure 2 is the Western Blot experiment to detect the creatine kinase B (CKB) expression level in NCI-H82-shCON cells and NCI-H82-shCKB cells, wherein shCON is the creatine kinase B expression level in NCI-H82 cells transfected with empty viral vector without specific shRNA to knock down creatine kinase B, as a control; shCKB is the creatine kinase B expression level in NCI-H82 cells transfected with viral vector carrying specific shRNA to knock down creatine kinase B.

[0218] Figure 3 is the relative cell viability of NCI-H82-shCON cells and NCI-H82-shCKB cells, wherein shCON is the cell viability of NCI-H82 cells transfected with empty viral vector without specific shRNA to knock down creatine kinase B, as a control; shCKB is the cell viability of NCI-H82 cells transfected with viral vector carrying specific shRNA to knock down creatine kinase B. DETAILED DESCRIPTION

[0219] The inventors have made a long-term and in-depth study, and for the first time, unexpectedly found that tumors with high expression of creatine kinase B are highly sensitive to the compounds of the present application, that is, the compounds of the present application have more excellent therapeutic effects on tumors with high expression of creatine kinase B, and therefore, the compounds of the present application have excellent precision treatment effects on tumors with high expression of creatine kinase B, and creatine kinase B can be used as a marker for judging whether a tumor patient is suitable for precision prevention and / or treatment with the compounds of the present application. On this basis, the inventors completed the present application.

[0220] Terms

[0221] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0222] As used herein, the terms "comprise", "comprising", "contain", "containing", "include", "including" and "includes" are interchangeable with and mean "consisting of".

[0223] As used herein, the terms "anti-cancer drug" and "anti-tumor drug" are interchangeable.

[0224] As used herein, the terms "cancer", "cancerous", "tumor" and "neoplasm" are interchangeable.

[0225] As used herein, the term "a cell" refers to a certain cell (such as a single cancer cell) or a group of cells containing a plurality of similar cells (such as a tumor tissue).

[0226] As used herein, the terms "SF126 cell" and "SF-126 cell" are interchangeable.

[0227] As used herein, "a tumor patient is suitable for using the compounds of the present application" includes that the tumor of the tumor patient is sensitive to the compounds of the present application.

[0228] As used herein, "a tumor patient is not suitable for using the compounds of the present application" includes that the tumor of the tumor patient is not sensitive to the compounds of the present application.

[0229] As used herein, the terms "IC50" and "IC 50 " are interchangeable, and refer to the half-inhibiting concentration (50% inhibiting concentration), that is, the concentration of the inhibitor when 50% inhibition effect is achieved.

[0230] As used herein, the term "P / S" refers to the addition of Penicillin (penicillin) and Streptomycin (streptomycin) in the relevant culture medium.

[0231] As used herein, the term "creatine kinase B" is abbreviated as CKB.

[0232] As used herein, the term "solvate" refers to a compound coordinated with solvent molecules in a specific ratio to form a complex.

[0233] As used herein, the term "deuterated" refers to a compound or group in which one or more hydrogens are replaced by deuterium. Deuterated can be mono-substituted, di-substituted, poly-substituted, or per-substituted.

[0234] As used herein, the term "MS-ESI" refers to electrospray ion source mass spectrometry.

[0235] As used herein, the term "H NMR" refers to proton nuclear magnetic resonance. 1 H NMR" is meant to refer to proton nuclear magnetic resonance.

[0236] It is understood that one of ordinary skill in the art can select substituents and substitution patterns on the compounds of the present application to produce compounds that are chemically stable, which can be synthesized by techniques known in the art and methods set forth below. If substituted by more than one substituent group, it is understood that the multiple groups can be on the same carbon or on different carbons, as long as a stable structure results.

[0237] As used herein, the term "substituted" or "substitution" is the replacement of a hydrogen atom on a group with a non-hydrogen atom group, provided that the valency requirements are met and that a chemically stable compound results, i.e., a compound that does not spontaneously undergo transformation such as cyclization, elimination, etc.

[0238] As used herein, represents the point of attachment of the group.

[0239] As used herein, the term "alkyl" refers to a straight chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a combination thereof. When preceded by a number indicating the number of carbon atoms (e.g., C1-C6alkyl), it is intended to indicate the number of carbon atoms in the alkyl group (e.g., 1 to 6). For example, C1-C4alkyl refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, or the like.

[0240] As used herein, the term "alkylene" refers to an alkyl group as defined above minus one hydrogen atom. When a carbon number limitation precedes the alkylene group (e.g., C1-C6 alkylene), the number of carbon atoms contained in the alkylene group is meant (e.g., 1 to 6). Representative examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, isopropylene, butylene, isobutylene, sec-butylene, t-butylene, or the like.

[0241] As used herein, the term "alkenyl" refers to a straight or branched chain alkenyl group having one or more double bonds, formed by removing one hydrogen atom from an alkenyl molecule. When a carbon number limitation precedes the alkenyl group (e.g., C2-C6 alkenyl), the number of carbon atoms contained in the alkenyl group is meant (e.g., 2 to 6). For example, C2-C4 alkenyl refers to an alkenyl group containing 2 to 4 carbon atoms. Representative examples include, but are not limited to, ethenyl (CH2=CH-), butenyl (e.g., C(CH3)2=CH-), or the like.

[0242] As used herein, the term "halogen" refers to F, Cl, Br, or I.

[0243] As used herein, the term "halo" refers to one or more (preferably 1, 2, or 3) hydrogen atoms on a group that are replaced with a halogen.

[0244] As used herein, the term "haloalkyl" refers to an alkyl group as defined above in which one or more (preferably 1, 2, 3, or 4) hydrogen atoms have been replaced with a halogen. When a carbon number limitation precedes the haloalkyl group (e.g., C1-C8 haloalkyl), the number of carbon atoms contained in the haloalkyl group is meant (e.g., 1 to 8). For example, C1-C6 haloalkyl refers to a haloalkyl group containing 1 to 6 carbon atoms. Representative examples of haloalkyl groups include, but are not limited to, -CF3, -CHF2, monofluoroisopropyl, difluorobutyl, or the like.

[0245] As used herein, the term "cycloalkyl" refers to a saturated or partially saturated monocyclic, bicyclic or polycyclic (fused, bridged or spirocyclic) ring carbocyclic hydrocarbon radical. When a cycloalkyl radical is preceded by a number limitation on the number of carbon atoms (e.g., C3-C12), it is intended that the cycloalkyl radical have the indicated number of ring carbon atoms (e.g., 3 to 12). For example, the term "C3-C8 cycloalkyl" refers to a saturated or partially saturated monocyclic or bicyclic alkyl radical having from 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or the like. "Spiro cycloalkyl" refers to a bicyclic or polycyclic radical in which the single rings share a single carbon atom (termed a spiro atom), which can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. "Fused cycloalkyl" refers to a fully carbon bicyclic or polycyclic radical in which each ring in the system shares an adjacent pair of carbon atoms with another ring in the system, in which one or more rings can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. "Bridged cycloalkyl" refers to a fully carbon polycyclic radical in which any two rings share two non-adjacent carbon atoms, which rings can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. Representative examples of cycloalkyl groups include, but are not limited to:

[0246] As used herein, the term "halocycloalkyl" refers to a cycloalkyl radical in which one or more (preferably 1, 2, 3 or 4) hydrogens of the cycloalkyl radical and the halogen are as defined above, and when a halocycloalkyl radical is preceded by a number limitation on the number of carbon atoms (e.g., C3-C8 halocycloalkyl) it is intended that the halocycloalkyl radical contain the indicated number of ring carbon atoms (e.g., 3 to 8 ring carbon atoms), for example, C3-C8 halocycloalkyl refers to a halocycloalkyl radical containing 3 to 8 ring carbon atoms. Representative examples of halocycloalkyl groups include, but are not limited to, monofluorocyclopropyl, monochlorocyclobutyl, monofluorocyclopentyl, difluorocycloheptyl, or the like.

[0247] As used herein, the term "alkoxy" refers to a R-O- radical in which R is alkyl, alkyl being as defined herein above, and when an alkoxy radical is preceded by a number limitation on the number of carbon atoms, e.g., C1-C8 alkoxy, it is intended that the alkyl group in the alkoxy radical have 1 to 8 carbon atoms. Representative examples of alkoxy groups include, but are not limited to: methoxy, ethoxy, n-propoxy, i-propoxy, t-butoxy, or the like.

[0248] As used herein, the term "alkylthio" refers to a R-S- radical in which R is alkyl, alkyl being as defined herein above, and when an alkylthio radical is preceded by a number limitation on the number of carbon atoms, e.g., C1-C8 alkylthio, it is intended that the alkyl group in the alkylthio radical have 1 to 8 carbon atoms. Representative examples of alkylthio groups include, but are not limited to: methylthio, ethylthio, n-propylthio, i-propylthio, t-butylthio, or the like.

[0249] As used herein, the term "haloalkoxy" refers to haloalkyl-O-, said haloalkyl being as defined above, with the number of carbon atoms being defined when haloalkoxy is preceded by such a number, e.g., C1-C6haloalkoxy means C1-C6haloalkyl-O-, i.e., a haloalkoxy group containing from 1 to 6 carbon atoms. Representative examples of haloalkoxy include, but are not limited to: monofluoromethoxy, monofluoroethoxy, difluorobutoxy, or the like.

[0250] As used herein, the term "haloalkylthio" refers to haloalkyl-S-, said haloalkyl being as defined above, with the number of carbon atoms being defined when haloalkylthio is preceded by such a number, e.g., C1-C6haloalkylthio means C1-C6haloalkyl-S-, i.e., a haloalkylthio group containing from 1 to 6 carbon atoms. Representative examples of haloalkylthio include, but are not limited to: monofluoromethylthio, monofluoroethylthio, difluorobutylthio, or the like.

[0251] As used herein, the term "cycloalkoxy" refers to a R-O- group, wherein R is a cycloalkyl group, cycloalkyl being as defined herein above, with the number of carbon atoms being defined when cycloalkoxy is preceded by such a number, e.g., C3-C8cycloalkoxy means that the cycloalkyl group in said cycloalkoxy has from 3 to 8 ring carbon atoms. Representative examples of cycloalkoxy include, but are not limited to: cyclopropyloxy, cyclobutyloxy, or the like.

[0252] As used herein, the term "cycloalkylthio" refers to a R-S- group, wherein R is a cycloalkyl group, cycloalkyl being as defined herein above, with the number of carbon atoms being defined when cycloalkylthio is preceded by such a number, e.g., C3-C8cycloalkylthio means that the cycloalkyl group in said cycloalkylthio has from 3 to 8 ring carbon atoms. Representative examples of cycloalkylthio include, but are not limited to: cyclopropylthio, cyclobutylthio, or the like.

[0253] As used herein, the term "halocycloalkoxy" refers to a cycloalkoxy group in which one or more, preferably 1, 2, 3, or 4, of the hydrogens have been replaced by a halogen, said cycloalkoxy and halogen being as defined above, with the number of carbon atoms being defined when halocycloalkoxy is preceded by such a number (e.g., C3-C8halocycloalkoxy) means that the number of ring carbon atoms (e.g., 3 to 8) in said halocycloalkoxy is contained, e.g., C3-C8halocycloalkoxy means a halocycloalkoxy group containing from 3 to 8 ring carbon atoms. Representative examples of halocycloalkoxy include, but are not limited to: monofluorocyclopropyl-O-, monochlorocyclobutyl-O-, monofluorocyclopentyl-O-, difluorocycloheptyl-O-, or the like.

[0254] As used herein, the term "haloalkyl" refers to an alkyl group, as defined above, having one or more (preferably 1, 2, 3, or 4) hydrogens replaced by a halogen. When a haloalkyl group is preceded by a carbon number limitation (e.g., C1-C4 haloalkyl), this refers to the number of carbon atoms that the haloalkyl group contains (e.g., 1 to 4). Representative examples of haloalkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, pentafluoroethyl, monochloromethyl, dichloromethyl, trichloromethyl, pentachloroethyl, monobromomethyl, dibromomethyl, and tribromomethyl.

[0255] As used herein, the term "heterocycloalkyl" refers to a fully saturated or partially unsaturated cyclic (including but not limited to, e.g., 3-7 membered monocyclic, 7-11 membered bicyclic, or 8-16 membered tricyclic ring systems) group having at least one heteroatom present in at least one carbon atom-containing ring, with the point of attachment of the group being at a ring containing a heteroatom. When a heterocycloalkyl group is preceded by a member number limitation (e.g., 3-16 membered heterocycloalkyl), this refers to the number of ring atoms of the heterocycloalkyl group. Each heteroatom-containing ring can have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, wherein the nitrogen atom or the sulfur atom can be oxidized, and the nitrogen atom can be quaternized. Typical monocyclic heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl. Polycyclic heterocycloalkyl groups include spiro, fused, and bridged ring heterocycloalkyl groups; wherein the spiro, fused, and bridged ring heterocycloalkyl groups are optionally connected to other groups by a single bond, or further annulated to other cycloalkyl, heterocycloalkyl rings through any two or more atoms of the ring.

[0256] As used herein, the term "aryl" refers to a fully carbon monocyclic or fused polycyclic (i.e., sharing pairs of adjacent carbon atoms of the rings) ring group having a conjugated pi electron system, an aromatic cyclic hydrocarbon compound group, and when aryl is preceded by a carbon number limitation, this refers to the number of ring carbon atoms of the aryl group (e.g., C6-C12 aryl refers to an aryl group having 6 to 12 ring carbon atoms, such as phenyl and naphthyl).

[0257] As used herein, the term "heteroaryl" refers to an aromatic heterocyclic ring system group having one to multiple (preferably 1, 2, 3, or 4) ring heteroatoms, wherein at least one heteroatom is present in a ring of at least one carbon atom, which can be a single ring (monocyclic) or a multiple ring (bicyclic, tricyclic, or polycyclic) group fused together or linked covalently, each heteroatom-containing heterocyclic ring can have one to multiple (e.g., 1, 2, 3, 4) heteroatoms each independently selected from the group consisting of oxygen, sulfur, and nitrogen. When the number of members is specified before the heteroaryl group, it refers to the number of ring atoms of the heteroaryl group, for example, 5-12 membered heteroaryl refers to a heteroaryl group having 5-12 ring atoms. Representative examples of heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, furanyl, pyridyl, pyrimidinyl, and the like.

[0258] As used herein, the term "ester" refers to a group having the formula R-C(O)-O- or -C(O)-O-R, wherein R is an alkyl group, which is as defined herein above, for example, "C2-C4 ester" refers to a group having the formula of C1-C3 alkyl-C(O)-O- or -C(O)-O-C1-C3 alkyl. Representative examples of ester groups include, but are not limited to, CH3C(O)O-, C2H5C(O)O-, (CH3)2CHC(O)O-, -C(O)OCH3, -C(O)OC2H5, or the like.

[0259] As used herein, the term "amide" refers to a group having the formula R-C(O)-NH- or -C(O)-NH-R, wherein R is an alkyl group, which is as defined herein above, for example, "C2-C4 amide" refers to a group having the formula of C1-C3 alkyl-C(O)-NH- or -C(O)-NH-C1-C3 alkyl. Representative examples of amide groups include, but are not limited to, CH3C(O)-NH-, C2H5C(O)-NH-, (CH3)2CHC(O)-NH-, -C(O)-NH-CH3, -C(O)-NH-C2H5, or the like.

[0260] As used herein, "-C(O)-" and are used interchangeably.

[0261] As used herein, the term "amino" alone or as part of another substituent group, is -NH2.

[0262] As used herein, the term "hydroxy" alone or as part of another substituent group, is -OH.

[0263] As used herein, the term "mercapto" alone or as part of another substituent group, is -SH.

[0264] In the present application, it is to be understood that all substituents are unsubstituted unless otherwise described herein as "substituted". The term "substituted" means that one or more hydrogen atoms on a group are each independently replaced with a substituent group. The substituent group can be a substituent group described in the foregoing, or a substituent group as it appears in each embodiment. Unless otherwise specified, an arbitrary substituted group can be substituted at any substitutable position of the group, and the substituent group can be the same or different at each position.

[0265] In the present application, the term "prevention" means a method of preventing the onset of a disease and / or its attendant symptoms or protecting a subject from acquiring a disease. As used herein, "prevention" also includes delaying the onset of a disease and / or its attendant symptoms and reducing the risk of a subject acquiring the disease.

[0266] In the present application, the term "treatment" includes delaying and arresting the progress of a disease, or eliminating a disease, and does not require 100% inhibition, eradication, and reversal. In some embodiments, the compounds of the present application reduce, inhibit, and / or reverse a relevant disease (e.g., a tumor) and its complications, for example, by at least about 30%, at least about 50%, or at least about 80%, at least about 90%, or 100%, as compared to the level observed in the absence of the compounds of the present application.

[0267] Compounds

[0268] As used herein, "a compound of the present application", "a compound of the present application", "a compound of Formula I of the present application", or "a compound of Formula I" are used interchangeably to refer to a compound having the structure of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof. It is to be understood that the term also includes mixtures of the above components.

[0269] The structure of the compounds of Formula I of the present application is as follows:

[0270] In particular, the compounds of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof are as described above in the first aspect of the present application.

[0271] Representatively, the compounds of Formula I of the present application, or an optical isomer thereof, or a racemate thereof, or a pharmaceutically acceptable salt thereof are as the specific compounds of the embodiments of the present application (including the salted forms or free forms without salted groups).

[0272] The compounds of Formula I of the present application can be converted into their pharmaceutically acceptable salts by conventional methods, for example, a solution of the corresponding acid can be added to a solution of the above-mentioned compound, and the salted form is removed after the completion of the reaction, and the solvent is removed to obtain the corresponding salt of the compound of the present application.

[0273] creatine kinase B

[0274] In the present application, the English name of creatine kinase B is creatine kinase B, which is abbreviated as CKB.

[0275] The tumor with high expression of creatine kinase B is sensitive to the compound of the present application, and therefore the compound of the present application has excellent precision treatment effect on the tumor with high expression of creatine kinase B.

[0276] Preferably, the tumor with high expression of creatine kinase B is as described above in the first aspect of the present application.

[0277] In a preferred embodiment of the present application, the low expression or non-expression of creatine kinase B means that the ratio of the expression level E1 of creatine kinase B of tumor cells to the expression level E0 of creatine kinase B of the same type of cells or normal cells (E1 / E0) is <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0278] tumor

[0279] In the present application, the terms "tumor", "cancer", "carcinoma" and "neoplasm" can be used interchangeably.

[0280] In a preferred embodiment of the present application, the tumor of the present application includes the tumor with high expression of creatine kinase B.

[0281] Preferably, the tumor with high expression of creatine kinase B of the present application is as described above in the first aspect of the present application.

[0282] Specifically, the tumor of the present application is as described above in the first aspect of the present application.

[0283] In the present application, the tumor types corresponding to the representative tumor cell lines are shown in the following Table 1:

[0284] Table 1

[0285] anti-tumor drug

[0286] In the present application, the anti-tumor drug can be the compound of formula I of the present application, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0287] use

[0288] The present application provides a use of the compound of the present application in preventing and / or treating tumors. In particular, the tumor with high expression of creatine kinase B is highly sensitive to the drug of the compound of the present application, i.e. the compound of the present application has more excellent therapeutic effect on the tumor with high expression of creatine kinase B, and therefore, the compound of the present application has excellent precision treatment effect on the tumor with high expression of creatine kinase B.

[0289] The present application also provides a method for preventing and / or treating tumors, which comprises administering the compound of the present application to a subject in need thereof.

[0290] The compound of the present application has more significantly excellent preventive and therapeutic effect on the tumor with high expression of creatine kinase B, and can be administered to the subject to promote creatine kinase B first, so that the tumor of the subject has high expression of creatine kinase B, and then the compound of the present application is administered to prevent and / or treat the tumor, thereby more significantly preventing and / or treating the tumor.

[0291] In a preferred embodiment of the present application, the subject is a human and a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0292] Marker

[0293] The present application also provides a marker for determining whether a tumor patient is suitable for prevention and / or treatment with the compound of the present application, and the marker comprises the expression level of creatine kinase B.

[0294] In an embodiment of the present application, the expression level of creatine kinase B is used as a marker for determining whether a tumor patient is suitable for prevention and / or treatment with the compound of the present application, and the method comprises but is not limited to:

[0295] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application; and / or

[0296] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the compound of formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof according to the first aspect of the present application.

[0297] Specifically, the tumor with high expression of creatine kinase B according to the present application is as described above in the first aspect of the present application.

[0298] Composition or preparation, combination of active ingredients, and kit and method of administration

[0299] The composition according to the present application is preferably a pharmaceutical composition, and the composition according to the present application can include a pharmaceutically acceptable carrier.

[0300] As used herein, "pharmaceutically acceptable carrier" means one or more compatible solid, semi-solid, liquid or gelled fillers, excipients, or diluents suitable for use in human or animal subjects and must be of sufficiently high purity and sufficiently low toxicity to be suitable for use in the compositions. "Compatible" means that the components of the composition and the active ingredient are physically and chemically compatible, i.e., they do not significantly react with each other or with the vehicle.

[0301] It is understood that the pharmaceutically acceptable carrier according to the present application is not particularly limited, and can be selected from materials commonly used in the art, or can be prepared by conventional methods, or can be purchased from the market. Examples of the pharmaceutically acceptable carrier include cellulose and its derivatives, gelatin, talc, solid lubricants, calcium sulfate, vegetable oils, polyhydric alcohols, emulsifiers, wetting agents, buffers, chelating agents, thickening agents, pH adjusting agents, coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, bacteriostatic agents, pyrogen-free water, and the like.

[0302] In a preferred embodiment of the present application, the composition or formulation is in the form of a solid formulation, a liquid formulation, or a semi-solid formulation.

[0303] In a preferred embodiment of the present application, the composition or formulation is in the form of an oral formulation, a topical formulation, or an injection formulation.

[0304] Typically, the composition or formulation is in the form of a tablet, an injection, an infusion, a paste, a gel, a solution, a microsphere, or a film.

[0305] The pharmaceutical formulation should be matched with the administration method. The pharmaceutical formulation according to the present application can also be used with other synergistic therapeutic agents (including before, during, or after use). When the pharmaceutical composition or formulation is used, a safe and effective amount of the drug is administered to the subject (e.g., a human or a non-human mammal), and the safe and effective amount is usually at least about 10 μg / kg of body weight, and in most cases, not more than about 8 mg / kg of body weight, and preferably, the dose is about 10 μg / kg of body weight to about 1 mg / kg of body weight. Of course, the specific dose should also take into account the administration route, the patient's health condition, and the like, which are within the skill of a skilled physician.

[0306] The main technical effects of the present application include:

[0307] The present application first unexpectedly discovers that tumors with high expression of creatine kinase B are highly sensitive to the compounds of the present application, i.e., the compounds of the present application have more excellent therapeutic effects on tumors with high expression of creatine kinase B, and thus the compounds of the present application have excellent precision treatment effects on tumors with high expression of creatine kinase B, and creatine kinase B can be used as a marker for judging whether a tumor patient is suitable for precision prevention and / or treatment with the compounds of the present application. The precision treatment of the compounds of the present application on tumors with high expression of creatine kinase B can improve the therapeutic effect on tumors and avoid administering the compounds of the present application to tumor patients who are not sensitive to them. Therefore, the precision treatment of the compounds of the present application on tumors with high expression of creatine kinase B has more excellent therapeutic effects on tumors, lower drug dosage, and less side effects, etc., and can reduce side effects and improve patient compliance while improving the precision treatment effect of the compounds of the present application on tumors.

[0308] The present application will be further described below in conjunction with specific examples. It should be understood that the following specific examples are given on the premise of the technical solution of the present application, and detailed implementation modes and specific operation processes are given, but the protection scope of the present application is not limited to the present examples.

[0309] Example 1 compound AB3020-28-8

[0310] Obtained by commercial purchase, the structure is as follows:

[0311] Example 2 compound AB2065-66-9

[0312] Obtained by commercial purchase, the structure is as follows:

[0313] Example 3 compound AB1530-32-1

[0314] Obtained by commercial purchase, the structure is as follows:

[0315] Example 4 compound AB6228-47-3

[0316] Obtained by commercial purchase, the structure is as follows:

[0317] Example 5 compound AB1560-54-9

[0318] Obtained by commercial purchase, the structure is as follows:

[0319] Example 6 compound AB3607-17-8

[0320] Obtained by commercial purchase, the structure is as follows:

[0321] Example 7 Compound AB21406-61-1

[0322] Obtained by commercial purchase, structure as follows:

[0323] Example 8 Compound AB7333-52-0

[0324] Obtained by commercial purchase, structure as follows:

[0325] Example 9 Compound AB1449-46-3

[0326] Obtained by commercial purchase, structure as follows:

[0327] Example 10 Compound AB3462-95-1

[0328] Obtained by commercial purchase, structure as follows:

[0329] Example 11 Compound AB63368-37-6

[0330] Obtained by commercial purchase, structure as follows:

[0331] Example 12 Compound AB70219-09-9

[0332] Obtained by commercial purchase, structure as follows:

[0333] Example 13 Compound AB50479-11-3

[0334] Obtained by commercial purchase, structure as follows:

[0335] Example 14 Compound AB36544

[0336] Synthesis method as follows:

[0337] Compound 1 (300 mg, 1.0 mmol, 1.0 eq) and triphenylphosphine (262 mg, 1.0 mmol, 1.0 eq) were dissolved in dimethyl sulfoxide (5 mL), tris(dibenzylideneacetone)dipalladium (46 mg, 0.05 mmol, 0.05 eq) was added, after 16 h of reaction at 120 °C, the reaction was diluted with water and extracted with dichloromethane, the organic phase was collected, dried over anhydrous sodium sulfate and filtered, the filtrate was evaporated, the crude was purified using reverse phase preparative (acetonitrile / water + 0.1% formic acid) to obtain compound AB36544.

[0338] MS-ESI: [M+1]+calcd for C34H21N7O7 673.15; found: 673.15. + :378.14; found: 378.10.

[0339] 1 H NMR (400 MHz, DMSO-d6) δ 8.48 (s, 1H), 7.92-7.89 (m, 3H), 7.77-7.69 (m, 14H), 7.30-7.28 (m, 1H), 7.07-7.05 (m, 1H), 6.83 (d, J = 8.0 Hz, 1H).

[0340] Example 15 Compound AB36540

[0341] The synthesis method is as follows:

[0342] Compound 1 (200 mg, 0.76 mmol, 1.0 eq) and compound 2 (160 mg, 0.76 mmol, 1.0 eq) were dissolved in dimethyl sulfoxide (5 mL), tris(dibenzylideneacetone)dipalladium (35 mg, 0.038 mmol, 0.05 eq) was added, after 16 h of reaction at 120 °C, the reaction was diluted with water and extracted with dichloromethane, the organic phase was collected, dried over anhydrous sodium sulfate and filtered, the filtrate was evaporated, the crude was purified using reverse phase preparative (acetonitrile / water + 0.1% formic acid) to obtain compound AB36540.

[0343] MS-ESI: [M+1]+calcd for C34H21N7O7 673.15; found: 673.15. + :345.09; found: 344.95.

[0344] 1 H NMR (400 MHz, DMSO-d6) δ 8.61-8.59 (m, 1H), 8.14-8.11 (m, 1H), 8.00-7.96 (m, 3H), 7.85-7.79 (m, 9H), 7.77-7.74 (m, 4H), 7.66-7.64 (m, 1H).

[0345] Example 16 Compound AB36541

[0346] The synthesis method is as follows:

[0347] Compound 1 (200 mg, 0.76 mmol, 1.0 eq) and compound 2 (160 mg, 0.76 mmol, 1.0 eq) were dissolved in dimethyl sulfoxide (5 mL), tris(dibenzylideneacetone)dipalladium (35 mg, 0.038 mmol, 0.05 eq) was added, and the reaction was carried out at 120 °C for 16 h. The reaction solution was diluted with water and extracted with dichloromethane. The organic phase was collected, dried over anhydrous sodium sulfate, and filtered. The filtrate was rotary evaporated, and the crude product was subjected to reverse phase preparation (acetonitrile / water + 0.1% formic acid) to obtain compound AB36541.

[0348] MS-ESI: [M+H]+calcd: 344.95; found: 344.95. + :345.09; found: 344.95.

[0349] 1 H NMR (400 MHz, DMSO-d6) δ 8.41-8.39 (m, 1H), 8.19-8.17 (m, 1H), 7.97-7.94 (m, 3H), 7.83-7.78 (m, 7H), 7.75 (s, 2H), 7.73 (s, 1H), 7.72 (s, 2H), 7.70 (s, 1H), 7.65-7.63 (m, 1H).

[0350] Example 17 Compound AB36543

[0351] The synthesis method is as follows:

[0352] Compound 1 (200 mg, 0.76 mmol, 1.0 eq) and compound 2 (112 mg, 0.76 mmol, 1.0 eq) were dissolved in dimethyl sulfoxide (5 mL), tris(dibenzylideneacetone)dipalladium (35 mg, 0.038 mmol, 0.05 eq) was added, and the reaction was carried out at 120 °C for 16 h. The reaction solution was diluted with water and extracted with dichloromethane. The organic phase was collected, dried over anhydrous sodium sulfate, and filtered. The filtrate was rotary evaporated, and the crude product was subjected to reverse phase preparation (acetonitrile / water + 0.1% formic acid) to obtain compound AB36543.

[0353] MS-ESI: [M+H]+calcd: 344.95; found: 344.95. + :329.11; found: 328.95.

[0354] 1H NMR (400 MHz, DMSO-d6) δ 8.58 (s, 1H), 8.01 - 7.97 (m, 3H), 7.84 - 7.72 (m, 13H), 7.62 - 7.58 (m, 1H), 7.05 - 7.04 (m, 1H).

[0355] Example 18 Compound AB 24470-78-8

[0356] Obtained by commercial purchase, structure as follows:

[0357] Example 19 Compound AB 13371-17-0

[0358] Obtained by commercial purchase, structure as follows:

[0359] Example 20 Compound AB 7333-63-3

[0360] Obtained by commercial purchase, structure as follows:

[0361] Example 21 Compound AB 22884-29-3

[0362] Obtained by commercial purchase, structure as follows:

[0363] Example 22 Compound AB 28322-40-9

[0364] Obtained by commercial purchase, structure as follows:

[0365] Example 23 Compound AB 1530-34-3

[0366] Obtained by commercial purchase, structure as follows:

[0367] Example 24 Compound AB 2751-90-8

[0368] Obtained by commercial purchase, structure as follows:

[0369] Example 25 Compound AB 99662-46-1

[0370] Obtained by commercial purchase, structure as follows:

[0371] Example 26 Compound AB 2492-23-1

[0372] Obtained by commercial purchase, structure as follows:

[0373] Example 27 Compound AB18880-05-2

[0374] Obtained by commercial purchase, structure as follows:

[0375] Example 28 Compound AB42036-78-2

[0376] Obtained by commercial purchase, structure as follows:

[0377] Example 29 Compound AB36547

[0378] Obtained by commercial purchase, structure as follows:

[0379] Example 30 Compound AB18583-55-6

[0380] Obtained by commercial purchase, structure as follows:

[0381] Example 31 Compound SJ00-1

[0382] Obtained by commercial purchase, structure as follows:

[0383] Example 32 Compound AB13138-25-5

[0384] Obtained by commercial purchase, structure as follows:

[0385] Example 33 Compound AB82105-88-2

[0386] Obtained by commercial purchase, structure as follows:

[0387] Example 34

[0388] This example investigates the sensitivity of cells with different expression levels of creatine kinase B (CKB) to the compounds of the embodiments of the present application.

[0389] Experimental Methods

[0390] 1. The difference in creatine kinase B expression level of NCI-H82 cells (human small cell lung cancer cells), G-401 cells (human kidney cancer Wilms cells), MDA-MB-453 cells (breast cancer cells), 786-O cells (kidney clear cell adenocarcinoma cells), CFPAC-1 cells (human pancreatic cancer cells) and SF126 cells (human glioblastoma cells) was detected by Western Blot experiment, and the results are shown in Figure 1.

[0391] As can be seen from Figure 1, creatine kinase B is highly expressed in NCI-H82, G-401 and MDA-MB-453 cells compared with 786-O, CFPAC-1 and SF126 cells.

[0392] 2. Inhibition effect of the compound of the embodiment of the present application on tumor cells with different expression levels of creatine kinase B

[0393] Experimental background: The Promega CellTiter-Glo cell activity detection kit was used, which detects cell viability by directly detecting the content of ATP in cells, and the IC 50 value of the inhibition of the cell viability of tumor cells with different expression levels of creatine kinase B by each compound of the embodiment of the present application was detected.

[0394] Experimental method and results: Each tumor cell was cultured in the relevant culture medium, after cell passage, gradient-diluted different compounds of the embodiment of the present application were added, and after 3 days of culture, the half-inhibitory concentration IC 50 was detected, and the names, sources and culture conditions of each tumor cell line are as follows:

[0395] The cell line NCI-H82 (ATCC, number HTB-175) was cultured in RPMI1640 culture medium containing 10% fetal bovine serum (+P / S);

[0396] The cell line G-401 (ATCC, number CRL-1441) was cultured in McCoy's 5a culture medium containing 10% fetal bovine serum (+P / S);

[0397] The cell line MDA-MB-453 (ATCC, number HTB-131) was cultured in Leibovitz's L-15 culture medium containing 10% fetal bovine serum (+P / S);

[0398] The cell line 786-O (ATCC, number CRL-1932) was cultured in RPMI1640 culture medium containing 10% fetal bovine serum (+P / S);

[0399] The cell line CFPAC-1 (ATCC, number CRL-1918) was cultured in IMDM culture medium containing 10% fetal bovine serum (+P / S);

[0400] Cell line SF126 (JCRB, No. IFO50286) was cultured in EMEM medium containing 10% fetal bovine serum (+P / S)

[0401] The experimental results are shown in Table 2:

[0402] Table 2 Inhibitory effect (IC50) of each compound of the embodiments of the present application on different cell lines 50 , μM)

[0403] Note: IC 50 is the half inhibiting concentration (50% inhibiting concentration), i.e. the concentration of the inhibiting compound required to achieve 50% inhibition effect.

[0404] As can be seen from Table 2, compared with the cells with low expression of creatine kinase B (such as 786-O, CFPAC-1 and SF126 cells), the cells with high expression of creatine kinase B (such as NCI-H82, G-401 and MDA-MB-453 cells) are more sensitive to each compound of the embodiments of the present application, thereby indicating that the inhibiting effect of the compounds of the embodiments of the present application on the tumor cells with high expression of creatine kinase B is more significant, and the expression level of creatine kinase B in the tumor cells is significantly positively correlated with the sensitivity to the compounds described in the present application, thus the compounds of the embodiments of the present application have excellent precision treatment effect on the tumor cells with high expression of creatine kinase B.

[0405] Example 35

[0406] 1. Construction of NCI-H82 cells with low expression of creatine kinase B

[0407] NCI-H82 cells with low expression of creatine kinase B (NCI-H82-shCKB cells) were obtained by transfecting NCI-H82 cells with a virus vector carrying shRNA specific for knocking down creatine kinase B (the nucleotide sequence of the shRNA is CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 1)) by a method of transfecting shRNA specific for knocking down creatine kinase B by a virus vector, and NCI-H82 cells transfected with an empty virus vector without carrying shRNA specific for knocking down creatine kinase B (NCI-H82-shCON cells) were used as a control. The expression level of creatine kinase B in NCI-H82-shCKB cells and NCI-H82-shCON cells was detected by Western Blot experiment, and the results are shown in Figure 2. As can be seen from Figure 2, the expression of creatine kinase B in NCI-H82-shCKB cells was knocked down (i.e. low expression) compared with NCI-H82-shCON cells, thereby constructing NCI-H82 cells with low expression of creatine kinase B (i.e. NCI-H82-shCKB cells).

[0408] The viability of NCI-H82-shCON cells and NCI-H82-shCKB cells was detected using Promega CellTiter-Glo cell viability assay kit (which detects cell viability by detecting intracellular ATP content), and the results are shown in Figure 3. As can be seen from Figure 3, the viability of NCI-H82-shCON cells and NCI-H82-shCKB cells was almost the same, and the difference in cell viability was not statistically significant.

[0409] 2. Investigation of the correlation between the anti-tumor effect of the compound of the embodiment and the expression level of creatine kinase B

[0410] 2.1 Experimental background: Promega CellTiter-Glo cell viability assay kit was used to detect the IC 50 value of the compound of the embodiment of the application for inhibiting the viability of NCI-H82-shCON cells and NCI-H82 cells with low expression of creatine kinase B (i.e. NCI-H82-shCKB cells) constructed in the above steps, which detects cell viability by directly detecting intracellular ATP content.

[0411] 2.2 Experimental method and results: NCI-H82-shCON cells and NCI-H82 cells with low expression of creatine kinase B (NCI-H82-shCKB cells) constructed in the above steps were cultured in RPMI1640 medium containing 10% fetal bovine serum (+P / S), and the half-inhibitor concentration IC 50 of each compound of the embodiment of the application on the two kinds of cells was determined, and the experimental results are shown in Table 3:

[0412] Table 3 Half-inhibiting concentration IC of each compound of the embodiment of the present application to NCI-H82-shCON cells and NCI-H82-shCKB cells 50 Values (μM)

[0413] Note: IC 50 is the half-inhibiting concentration (50% inhibiting concentration), i.e. the concentration of the inhibiting compound required to achieve 50% inhibiting effect; NCI-H82-shCON cells are NCI-H82 cells transfected with empty virus vector without specific shRNA for knocking down creatine kinase B, as a control; NCI-H82-shCKB cells are NCI-H82 cells transfected with virus vector carrying specific shRNA for knocking down creatine kinase B, in which creatine kinase B is lowly expressed.

[0414] As can be seen from Table 3, NCI-H82 cells with low expression of creatine kinase B (NCI-H82-shCKB cells) are less sensitive to each compound of the embodiment of the present application, and NCI-H82-shCON cells with high expression of creatine kinase B are more sensitive to each compound of the embodiment of the present application than NCI-H82-shCKB cells, thus indicating that the compounds of the embodiment of the present application have more significant inhibiting effect on tumor cells with high expression of creatine kinase B, and the expression level of creatine kinase B in tumor cells is significantly positively correlated with the sensitivity to the compounds of the present application, therefore, the compounds of the embodiment of the present application have excellent precision treatment effect on tumor cells with high expression of creatine kinase B.

[0415] The above is an embodiment of the present application designed for a case, it should be pointed out that for ordinary skilled in the art, without departing from the principles of the present application can also be made several improvements, these improvements should also be considered as the protection scope of the present application.

Claims

1. Use of a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for preparing a composition or a preparation for preventing and / or treating a tumor; wherein, Formula I R1, R2, R3and R4are each independently substituted or unsubstituted C1-C16alkyl, substituted or unsubstituted C1-C16haloalkyl, substituted or unsubstituted C2-C8alkenyl- substituted or unsubstituted C1-C10alkyl-, substituted or unsubstituted C3-C16cycloalkyl, substituted or unsubstituted 3-16 membered heterocycloalkyl, substituted or unsubstituted C6-C16aryl, substituted or unsubstituted 3-16 membered heteroaryl, substituted or unsubstituted C6-C16aryl- substituted or unsubstituted C1-C8alkyl-, substituted or unsubstituted 3-16 membered heteroaryl- substituted or unsubstituted C1-C8alkyl-, substituted or unsubstituted C2-C10ester- substituted or unsubstituted C1-C10alkyl-, substituted or unsubstituted benzoquinone- substituted or unsubstituted C1-C10alkyl-; any "substituted" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms of a group are each independently replaced by a substituent selected from the group consisting of C1-C8alkyl, C3-C8cycloalkyl, C2-C8alkenyl, C1-C8haloalkyl, C3-C8halocycloalkyl, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C3-C8halocycloalkoxy, C3-C8halocycloalkylthio, halogen, hydroxyl, thiol, amino, C2-C8ester, C2-C8amide, C1-C8alkoxy, C1-C8alkylthio, C1-C8haloalkoxy, C1-C8haloalkylthio, C6-C12aryl, 5-12 membered heteroaryl; the heterocycloalkyl and heteroaryl have 1-4 (preferably 1, 2, 3 or 4) heteroatoms each independently selected from N, O and S in the heterocyclic ring. The tumor includes a tumor with high expression of creatine kinase B. The tumor with high expression of creatine kinase B means that the ratio of the expression level E1 of creatine kinase B of tumor cells to the expression level E0 of creatine kinase B in the same type of cells or normal cells (E1 / E0) is greater than 1.0, preferably greater than or equal to 1.2, more preferably greater than or equal to 1.5, more preferably greater than or equal to 2, more preferably greater than or equal to 3, more preferably greater than or equal to 5, more preferably greater than or equal to 8, more preferably greater than or equal to 10, more preferably greater than or equal to 15, more preferably greater than or equal to 20, more preferably greater than or equal to 30, more preferably greater than or equal to 50, for example 2-50. The same type of cells include the same type of tumor cells with normal expression, no expression or low expression of creatine kinase B. The tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof. The marker includes the expression level of creatine kinase B.

2. Use according to claim 1, characterized in that, The compounds are:

3. Use according to claim 1, characterized in that, ​ 4. Use according to claim 3, characterized in that, ​ 5. The use according to claim 1, characterized in that, ​ 6. A marker for judging whether a tumor patient is suitable for prevention and / or treatment of a tumor with the compound of formula I according to claim 1, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, characterized in that, ​ 7. Use of a test kit characterized in that, A companion diagnostic kit for determining whether a tumor patient is suitable for prevention and / or treatment with a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1; The said test kit comprises: (i) a test agent for detecting the expression level of creatine kinase B; and The said companion diagnostic kit further comprises an instruction or a label, which states that: when the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1; and / or when the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1.

8. A kit characterized in that, The said kit comprises: (i) a test agent for detecting the expression level of creatine kinase B; and (ii) a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1.

9. The use of a creatine kinase B promoter, characterized in that, A composition or a preparation for enhancing the anti-tumor effect of an anti-tumor drug; The said anti-tumor drug is a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1.

10. A composition characterized in that, The said composition comprises: (1) a first active ingredient, which comprises an anti-tumor drug, the anti-tumor drug being a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as claimed in claim 1; and (2) a second active ingredient, which comprises a creatine kinase B promoter.

Citation Information

Patent Citations

  • GPX4 and DHODH dual-inhibition small-molecule prodrug compound based on mitochondrial targeting as well as preparation method and application of GPX4 and DHODH dual-inhibition small-molecule prodrug compound

    CN117050110A

  • TRAP1 inhibitors and uses thereof

    CN117769559A

  • Biomarker for ovarian cancer

    US20070172902A1

  • Phosphorus compound and use thereof

    WO2023232143A1