Method for site-specific replacement of West China cattle gene promoter with creatine kinase promoter
By using CRISPR/Cas12i-mediated homologous recombination technology to replace the FTO gene promoter in Huaxi cattle with the MCK promoter, the problems of long breeding cycles and low selection efficiency in traditional breeding methods have been solved. This has enabled the efficient expression of the FTO gene in muscle cells, improving the precision and efficiency of Huaxi cattle breeding.
Patent Information
- Application Number
- CN202511756169.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-26
- Publication Date
- 2026-01-16
- Estimated Expiration
- 2045-11-26
AI Technical Summary
Existing technologies make it difficult to efficiently and precisely regulate the promoter activity of fat development-related genes in Huaxi cattle using traditional breeding methods, resulting in long breeding cycles, low selection efficiency, and difficulty in achieving targeted regulation of target traits.
Using CRISPR/Cas12i-mediated homologous recombination technology, the FTO gene promoter in the muscle tissue of West China cattle was replaced with the creatine kinase (MCK) promoter to achieve specific expression enhancement of the FTO gene. Site-specific replacement was achieved by designing upstream and downstream crRNA, Cas12i nuclease expression vectors and FTO homologous replacement vectors.
It significantly improved the expression efficiency of the FTO gene in muscle cells, providing a new approach for the genetic improvement of Huaxi cattle, and enhancing breeding efficiency and the precision of target trait regulation.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This application belongs to the field of animal gene editing and genetic breeding technology, specifically relating to a method for site-specific replacement of the creatine kinase promoter with the gene promoter of the Huaxi bovine gene. Background Technology
[0002] Huaxi cattle are a superior beef cattle breed independently developed in my country, possessing outstanding advantages such as excellent growth performance and strong environmental adaptability. Continuous selective breeding based on Huaxi cattle, focusing on growth and development, environmental adaptability, and specific selection in terms of meat quality, flavor, and taste, will help enhance the market competitiveness of Huaxi cattle. Currently, the improvement of genetic traits in beef cattle still largely relies on traditional breeding methods. These methods have long breeding cycles, low selection efficiency, and difficulty in achieving precise and targeted regulation of target traits. In recent years, with the rapid development of genome editing technology, especially the widespread application of the CRISPR / Cas12i system in the animal and plant fields, it has become possible to precisely edit and replace the promoter regions of specific genes.
[0003] However, the current problem in Huaxi cattle is that the promoter activity of genes related to fat development in muscle tissue is insufficient and the expression efficiency is low. There are no reports on replacing the natural promoters of specific endogenous genes (such as genes related to fat metabolism, muscle development or meat quality formation) using promoters. Summary of the Invention
[0004] The purpose of this invention is to provide a method and reagents for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, using CRISPR / Cas12i-mediated homologous recombination technology to replace the MCK promoter in muscle tissue. FTO Gene promoters enable specific enhancement of muscle tissue. FTO The purpose of gene expression.
[0005] This invention provides a way to improve bovine muscle cells FTO Gene expression reagents include crRNA for upstream site knockout, crRNA for downstream site knockout, a Cas12i nuclease expression vector, and an FTO homologous substitution vector; the FTO homologous substitution vector includes... FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of gene promoter; The nucleotide sequence of the crRNA used for upstream site knockout is shown in SEQ ID NO:23; The nucleotide sequence of the crRNA used for downstream site knockout is shown in SEQ ID NO:24.
[0006] Preferably, the upstream site knockout crRNA or the downstream site knockout crRNA exists in the form of a recombinant vector; The backbone vector of the recombinant vector is pUC19-U6-Cas12i-crRNA plasmid.
[0007] Preferably, the FTO The nucleotide sequence of the homologous arm upstream of the gene promoter is shown as SEQ ID NO: 25.
[0008] Preferably, the FTO The nucleotide sequence of the homologous arm downstream of the gene promoter is shown as SEQ ID NO: 26.
[0009] Preferably, the Cas12i nuclease expression vector further comprises a fluorescent reporter gene.
[0010] The application provides application of the reagent in a cell of a West China cattle FTO in gene promoter replacement.
[0011] Preferably, the West China cattle cell comprises muscle cells and / or fibroblasts.
[0012] The application provides a method for site-specific replacement of a West China cattle gene promoter by a creatine kinase promoter, comprising the following steps: The recombinant vector containing crRNA for upstream site knockout, the recombinant vector containing crRNA for downstream site knockout, the Cas12i nuclease expression vector and FTO The homologous replacement vector are co-transformed into the West China cattle cell.
[0013] Preferably, the mass ratio of the recombinant vector containing crRNA for upstream site knockout, the recombinant vector containing crRNA for downstream site knockout, the Cas12i nuclease expression vector and the FTO homologous replacement vector is 1-1.5:1-1.5:2-2.5:1-1.5.
[0014] The application provides application of the reagent in a West China cattle breed for breeding muscle FTO genes to up-regulate expression.
[0015] The application provides a reagent for improving expression of a gene in a muscle cell of a West China cattle FTO The reagent comprises crRNA for upstream site knockout, crRNA for downstream site knockout, a Cas12i nuclease expression vector and an FTO homologous replacement vector; the FTO homologous replacement vector comprises FTO a homologous arm upstream of a gene promoter, a MCK gene promoter and FTOThe nucleotide sequence of the upstream site knockout crRNA is shown as SEQ ID NO: 23, and the nucleotide sequence of the downstream site knockout crRNA is shown as SEQ ID NO: 24. The reagent described in the present application is based on the CRISPR / Cas12i-mediated homologous recombination technology, and the upstream site knockout crRNA and the downstream site knockout crRNA are used to knockout the promoter of the target gene in the bovine muscle cells FTO The FTO homologous replacement vector is used to mediate the precise insertion of the MCK gene promoter into the position of the FTO gene promoter FTO The FTO homologous replacement vector is used to mediate the precise insertion of the MCK gene promoter into the position of the FTO gene promoter FTO The FTO homologous replacement vector is used to mediate the precise insertion of the MCK gene promoter into the position of the FTO gene promoter BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 It is a pCAG-Cas12i-x12-2AeGFP v4 plasmid spectrum diagram; Figure 2 It is a pUC19-U6-Cas12i-crRNA plasmid spectrum diagram; Figure 3 It is an experimental flowchart of the present application; Figure 4 It is a crRNA knockout efficiency determination result of the target FTO gene promoter; Figure 5 It is FTO a PCR amplification product electrophoresis result of the upstream homologous arm of the gene promoter; Figure 6 It is FTO a PCR amplification product electrophoresis result of the downstream homologous arm of the gene promoter; Figure 7 It is MCK a PCR amplification product electrophoresis result of the promoter; Figure 8 It is a product electrophoresis result of the upstream homologous arm and the MCK promoter; Figure 9 and Figure 10 It is FTO a Sanger sequencing result of the product of the upstream homologous arm of the gene promoter; MCK FTO a Sanger sequencing result of the product of the promoter; Figure 11 It is a white light observation result of the fibroblasts after electroporation; Figure 12 It is a fluorescence observation result of the fibroblasts after electroporation; Figure 13 For electroporated fibroblasts (FB) and muscle cells (MuSC) FTO Results of gene mRNA expression level analysis. Detailed Implementation
[0017] This invention provides a way to improve bovine muscle cells FTO Gene expression reagents include upstream site knockout crRNA, downstream site knockout crRNA, Cas12i nuclease expression vector, and FTO homology substitution vector. The nucleotide sequence of the upstream site knockout crRNA is shown in SEQ ID NO:23 (CAUUGGCAGGUGGGUUCUUU); the nucleotide sequence of the downstream site knockout crRNA is shown in SEQ ID NO:24 (CCGCGGUGCACCCUGGGAGU).
[0018] In this invention, the FTO homologous substitution vector includes FTO upstream homologous arm of gene promoter, MCK gene promoter and FTO Downstream homologous arm of the gene promoter. In this invention, the... FTO The preferred nucleotide sequence of the upstream homologous arm of the gene promoter is shown in SEQ ID NO:25. FTO The preferred nucleotide sequence of the downstream homologous arm of the gene promoter is shown in SEQ ID NO:26. The nucleotide sequence of the MCK gene promoter is shown in SEQ ID NO:27. The MCK gene promoter is a tissue-specific promoter, capable of specifically initiating the expression of the target gene in muscle cells, thereby increasing the expression level of the target gene.
[0019] In the present application, the Cas12i nuclease expression vector comprises a Cas12i coding sequence for expressing a Cas12i enzyme to knockout the FTO gene under the guidance of a crRNA for upstream site knockout and a crRNA for downstream site knockout. The Cas12i nuclease expression vector preferably further comprises a fluorescent reporter gene. The fluorescent reporter gene comprises a gene encoding green fluorescent protein, a gene encoding red fluorescent protein, or a gene encoding orange fluorescent protein. In an embodiment of the present application, the backbone vector of the FTO homologous replacement vector preferably is a pCAG-Cas12i-x12-2AeGFPv4 plasmid comprising a coding gene of green fluorescent protein. The Cas12i nuclease expression vector of the present application is described with reference to the prior art (Chen, Y., Y. Hu, X. Wang, S. Luo, N. Yang, Y. Chen, Z. Li, Q. Zhou, and W. Li. 2022. 'Synergistic engineering of CRISPR-Cas nucleases enables robust mammalian genome editing', Innovation (Camb), 3: 100264.), wherein the Cas12i nuclease expression vector is named Cas12iMax in the above prior art, and the spectrum is shown in Figure 1 .
[0020] In the present application, the crRNA for upstream site knockout or the crRNA for downstream site knockout preferably exists in the form of a recombinant vector; the backbone vector of the recombinant vector preferably is a pUC19-U6-Cas12i-crRNA plasmid. The pUC19-U6-Cas12i-crRNA plasmid is purchased from Beijing Huayueyang Company, with the product number VECT90023, and the spectrum is shown in Figure 2 . The cloning site of the recombinant vector comprises Bsa I enzyme cleavage site. The present application does not have special restrictions on the construction method of the recombinant vector, and the construction method of the recombinant vector well known in the art can be used, for example, homologous recombination method connection, and then screening culture and sequencing identification are performed using ampicillin-containing medium to obtain a recombinant vector containing a target fragment.
[0021] In an embodiment of the present application, in order to screen the crRNA with high knockout FTO gene promoter efficiency, the FTO gene promoter of the Huaxi cattle FTOEight crRNAs were designed targeting the gene promoter region (NCBI reference sequence: NC_037346.1, -100 bp to 0 bp and -1400 bp to -1300 bp upstream of the transcription start site). The results showed that crRNA-F2 and crRNA-F7 were the crRNAs with the highest gene knockout efficiency upstream and downstream, respectively.
[0022] This invention provides the reagent in West China bovine cells. FTO Applications in gene promoter replacement.
[0023] In this invention, the West China bovine cells preferably include muscle cells and / or fibroblasts.
[0024] This invention provides a method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene, the flowchart of which is shown below. Figure 3 This includes the following steps: Recombinant vectors containing crRNA for upstream site knockout, recombinant vectors containing crRNA for downstream site knockout, Cas12i nuclease expression vectors, and FTO The homologous substitution vector was co-transformed into West China bovine cells.
[0025] In this invention, the mass ratio of the recombinant vector containing upstream site knockout crRNA, the recombinant vector containing downstream site knockout crRNA, the Cas12i nuclease expression vector, and the FTO homologous substitution vector is preferably 1~1.5:1~1.5:2~2.5:1~1.5, or can be 1:1:1:1.
[0026] This invention does not impose any particular limitation on the conversion method; conversion methods well known in the art, such as electroconversion, can be used. This invention also does not impose any particular limitation on the parameters of the single conversion; electroconversion conditions well known in the art can be used.
[0027] The present invention does not have any particular limitation on the type of Huaxi bovine cells, and any Huaxi bovine system well known in the art can be used, such as fibroblasts.
[0028] In this invention, the transformation process preferably includes positive screening, somatic cell nuclear transfer, genotyping, and expression analysis to verify the transformed Huaxi bovine cells. The positive screening method is preferably fluorescent protein flow cytometry screening of positive cells and PCR identification to obtain cell clones with successfully replaced promoters. Positive screening involves culturing transfected Huaxi bovine cells in 10% FBS DMEM medium for 48 hours. Somatic cell nuclear transfer involves isolating cells from the successfully replaced promoter cell clones and transferring them into oocytes to activate recombinant embryos, preparing gene-edited Huaxi bovine embryos, and then transferring them into the uterus of a synchronized estrus recipient cow to produce offspring. The offspring are preferably verified using genotyping and expression analysis to verify the expression level of the target gene driven by the MCK promoter.
[0029] This invention provides the reagent for cultivating muscle. FTO Application in the Huaxi cattle breed with upregulated gene expression.
[0030] In this invention, the reagent can effectively improve the muscle tissue of West China cattle. FTO Upregulation of genes has laid the foundation for improving the genetic traits of beef quality in West China.
[0031] The following detailed description, in conjunction with embodiments, illustrates a method for site-specific replacement of the creatine kinase promoter with the promoter of the Huaxi bovine gene provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0032] Reagent source description in the examples: Gel Extraction Kit (purchased from Omega Bio-tek), Fast Digest Bsa I (purchased from Fermentas), T4 Ligase (purchased from Fermentas), competent Escherichia coli (purchased from TransGen), plasmid extraction kit (purchased from OMEGA).
[0033] Example 1 Replace Huaxi Niu with MCK promoter FTO Gene promoter (1) Regarding Huaxi cattle FTO Four crRNAs were designed for each of the gene promoter regions (NCBI reference sequence: NC_037346.1, -100 bp to 0 bp and -1400 bp to -1300 bp upstream of the transcription start site). The DNA sequences of the crRNAs are shown in Table 1.
[0034] Table 1. crRNA at the FTO upstream promoter substitution site
[0035] Note: The underlined parts are the added enzyme cleavage sites.
[0036] (2) Use Bsa I. Endonuclease pUC19-U6-Cas12i-cr RNA plasmid (see...) Figure 2 The enzyme digestion system is shown in Table 2.
[0037] Table 2 Enzyme digestion system
[0038] (3) After reacting at 37°C for 5 hours, the DNA was purified using a DNA purification kit. The purification process was based on the Omega Biotek Gel Extraction Kit.
[0039] (4) Ligation of recovered products: Each crRNA in Table 1 was ligated to the purified linear pUC19-U6-Cas12i-crRNA vector using sticky ends. Ligation system: 1 μL pUC19-U6-Cas12i-crRNA vector, 5 μL 2×solution Ⅰ, 4 μL crRNA. The mixture was incubated at 16℃ for 3 h.
[0040] (5) Transform the above-mentioned or ligation products into competent Escherichia coli cells: Take out competent Escherichia coli cells from the -80℃ freezer, thaw them on ice, add the ligation product to 33 μL of competent cells with a sterile pipette tip, incubate on ice for 30 min, heat shock at 42℃ for 30 s, incubate on ice again for 2 min, then spread the competent bacterial culture on a solid culture medium containing 100 μg / ml ampicillin, and incubate upside down for 12~16 h.
[0041] (6) Screening and sequencing identification of positive clones: Using a sterilized pipette tip, a single clone was picked up from the plate and inoculated into 400 μl of liquid culture medium containing 100 μg / ml ampicillin. The culture was then placed in a shaker at 220 rpm and 37°C for 6 h to expand the culture. The bacterial culture was sent to Beijing Liuhe Huada Genomics Co., Ltd. for sequencing and comparison. The plasmid was extracted from the correctly sequenced positive clones using a plasmid extraction kit. The plasmid was named FTO-pUC19-U6-Cas12i-crRNA.
[0042] (7) Validation of crRNA efficiency: The FTO-pUC19-U6-Cas12i-crRNA plasmid and the pCAG-Cas12i-x12-2AeGFP v4 plasmid (see...) were used to verify the efficiency of crRNA. Figure 1Cells were electroporated into fibroblasts at a 1:1 mass ratio and cultured in DMEM medium containing 10% FBS for 48 h. Green fluorescent cells were sorted by flow cytometry, and the sorted cells were lysed using Lysis cell lysis buffer to extract genomic DNA. Primers targeting the region around the target site were designed for PCR amplification. The purified products were sent to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing and comparison. Efficiency was predicted using the online tool https: / / decodr.org / , and the screening efficiency is shown in [link to efficiency chart]. Figure 4 .
[0043] Depend on Figure 4 It can be seen that the upstream crRNA with higher knockout rate is the F-2-U group (FTO-crRNA-F2 / FTO-crRNA-R2), and the downstream crRNA with higher knockout rate is the F-7-D group (FTO-crRNA-F7 / FTO-crRNA-R7).
[0044] (8) Construction of homologous arm cloning vector: Primers were designed based on the target sites of F-2-U and F-7-D selected above (800 bp upstream and downstream) and the MCK promoter (1354 bp). Primers are shown in Table 3. PCR amplification. FTO upstream homologous arm of gene, FTO The downstream homologous arm of the gene and the MCK promoter fragment were purified by gel extraction and PCR amplification. The amplified fragment is shown below. Figure 5~Figure 10 .
[0045] Table 3 FTO Gene recombination fragment primers
[0046] Note: The underlined part is pUC57 Hind III enzyme digestion.
[0047] The three amplified sequences were ligated using 2× MultiF Seamless Assembly Mix, and the resulting ligation product (SEQ ID NO:28) was cloned into pUC 57 plasmid. For detailed instructions, refer to the manual. After ligation, the product was named FTO homologous substitution vector.
[0048] (9) Replace FTO homology vector, FTO-pUC19-U6-Cas12i-crRNA F-2-U Plasmid, FTO-pUC19-U6-Cas12i-crRNA F-7-D The plasmid and pCAG-Cas12i-x12-2AeGFP v4 plasmid were co-electroporated into fibroblasts at a mass ratio of 1:1:1:1 and cultured in DMEM medium containing 10% FBS for 48 h. Green fluorescent cells were sorted by flow cytometry.Figure 11~Figure 12 Cells were cultured in 96-well plates. They were passaged every 48 hours and transferred to 24-well plates for sequencing to screen for successfully replaced promoter fibroblast cell lines. These lines were then used as donor cells for nuclear transfer. The transplanted oocytes were then activated into recombinant embryos and transferred to the uterus of a surrogate mother in estrus at the same time for implantation and development, ultimately resulting in the birth of cloned offspring.
[0049] (10) Detect the fibroblast cell lines and muscle cells of the cloned offspring, respectively. FTO Gene expression levels. The specific methods are as follows: Total RNA was extracted from the target cell line using the Nanjing Novizan FreeZol Reagent (cat: R711-02) RNA extraction kit. The RNA was then reverse transcribed according to the following procedure: Table 4 Reaction System
[0050] Table 5 Reaction Procedure:
[0051] The product obtained from the reaction can be stored at -20°C and used within six months.
[0052] The cDNA was detected by RT-qPCR. The primers and reaction system are as follows: Table 6 Primers for detection
[0053] Table 7 Reaction System
[0054] Table 8 Reaction Procedure
[0055] The relative gene expression levels among different cell lines were obtained by calculating the Ct values obtained from the reaction.
[0056] See results Figure 13 .Depend on Figure 13 It can be seen that in wild-type fibroblasts and fibroblast lines with successfully replaced promoters... FTO Gene expression levels were consistent. However, compared to wild-type muscle cells, muscle cells that successfully replaced the promoter... FTO Gene expression levels were significantly increased. This indicates that after the MCK promoter replaced the FTO gene promoter in muscle cells, the MCK promoter specifically activated the gene. FTO The upregulation of gene expression lays the foundation for subsequent genetic engineering modifications of West China cattle.
[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An agent for increasing expression of a gene in bovine muscle cells, characterized in that, FTO comprising a crRNA for upstream site knockout, a crRNA for downstream site knockout, a Cas12i nuclease expression vector, and an FTO homologous replacement vector; the FTO homologous replacement vector comprises FTO a homologous arm upstream of a gene promoter, a MCK gene promoter, and FTO a homologous arm downstream of a gene promoter; The nucleotide sequence of the crRNA for upstream site knockout is shown as SEQ ID NO:
23. The nucleotide sequence of the crRNA for downstream site knockout is shown as SEQ ID NO:
24.
2. The agent of claim 1, wherein The upstream site knockout crRNA or the downstream site knockout crRNA exists in the form of a recombinant vector. The backbone vector of the recombinant vector is a pUC19-U6-Cas12i-crRNA plasmid.
3. The agent of claim 1, wherein The FTO The nucleotide sequence of the homology arm upstream of the gene promoter is shown in SEQ ID NO:
25.
4. The agent of claim 1, wherein The FTO The nucleotide sequence of the homology arm downstream of the gene promoter is shown in SEQ ID NO:
26.
5. The agent according to any one of claims 1 to 4, characterized in that, The Cas12i nuclease expression vector further comprises a fluorescent reporter gene.
6. The agent of any one of claims 1 to 5 for use in a cell of a Chinese West cattle. FTO application in the replacement of a gene promoter.
7. Use according to claim 6, characterized in that, The Huaxi cattle cells comprise muscle cells and / or fibroblasts.
8. A method for site-directed replacement of the Xishan cattle gene promoter with a creatine kinase promoter, characterized in that, The method comprises the following steps: The recombinant vector containing the upstream site knockout crRNA, the recombinant vector containing the downstream site knockout crRNA, the Cas12i nuclease expression vector, and FTO The homologous replacement vector is co-transformed into the Huaxi cattle cells.
9. The method of claim 7, wherein, The mass ratio of the recombinant vector containing the upstream site knockout crRNA, the recombinant vector containing the downstream site knockout crRNA, the Cas12i nuclease expression vector and the FTO homologous replacement vector is 1-1.5:1-1.5:2-2.5:1-1.
5.
10. Use of the agent of any one of claims 1 to 5 in a breed of cattle in which the expression of the muscle gene is upregulated. FTO West China cattle breed in which the expression of the muscle gene is upregulated.
Citation Information
Patent Citations
Cattle FTO gene promoter mutation site and application thereof
CN119842717A
Engineered muscle targeting compositions
US20220243226A1
Muscle-specific expression cassettes
WO2024216118A1