South american white shrimp hif-1α gene snp molecular marker and application thereof
By using SNP molecular marker screening technology of the HIF-1α gene in Litopenaeus vannamei, the problem of nitrite pollution in water bodies inhibiting shrimp growth has been solved, achieving an efficient and accurate breeding process, improving the nitrite tolerance trait of Litopenaeus vannamei, and promoting variety improvement.
Patent Information
- Application Number
- CN202411541702.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2044-10-31
AI Technical Summary
In high-density farming, nitrite pollution in the water leads to growth inhibition and decreased immunity in whiteleg shrimp. Existing technologies make it difficult to effectively screen out individuals tolerant to nitrite, affecting the breeding process and yield.
By screening and applying 11 SNP molecular markers of the HIF-1α gene in Litopenaeus vannamei, especially 10 significantly related SNP sites, combined with PCR amplification and sequencing technology, the genotype of individuals was determined, and individuals with nitrite tolerance were selected as reserve parents for breeding.
It significantly improved the tolerance of Litopenaeus vannamei to nitrite, enhanced breeding efficiency and accuracy, ensured the genotype stability of selected individuals and prevented genetic differentiation, thus avoiding the need for large-scale nitrite stress experiments.
Smart Images

Figure CN119193856B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of breeding technology for Litopenaeus vannamei, specifically relating to a molecular marker for the HIF-1α gene of Litopenaeus vannamei and its application. Background Technology
[0002] The Pacific white shrimp (Litopenaeus vannamei), with its delicious meat, rapid growth, and rich nutrition, is one of the world's most important economically important shrimp species, with China ranking among the world's leading producers. In recent years, high-density farming of Pacific white shrimp, coupled with extended farming periods, has led to the accumulation of large amounts of uneaten feed, excrement, and metabolites at the bottom of the ponds, exacerbating aquatic environmental degradation and impacting shrimp health and yield. Nitrite is a common environmental pollutant in aquaculture systems. As an intermediate product of the nitrogen cycle in water, nitrite originates from the nitrosation of ammonia and the denitrification of nitrates. Therefore, the presence of nitrogen in the water will inevitably lead to nitrite formation. During shrimp farming, due to the large amount of residual organic nitrogen in the water, nitrite levels are relatively low in the early stages of farming but rise sharply in the middle and late stages, becoming a limiting factor, especially in the later stages. Certain concentrations of nitrite inhibit shrimp growth and metamorphosis; in particular, its impairment of the oxygen-carrying and releasing capacity of hemocyanin is considered one of the main mechanisms by which it is toxic to shrimp.
[0003] Hypoxia-inducible factor-1 (HIF-1) is a key transcription factor found in various animals and humans, regulating the responses of multiple molecules to hypoxia. It has a wide range of target genes, with over 100 identified. HIF-1 is a heterodimer composed of α and β subunits. The α and β subunits of the HIF-1 gene are primarily constitutively transcribed and translated independently of oxygen tension, but only HIF is regulated at the post-translational level. HIF-1α is the active subunit of HIF-1. Under normoxic conditions, HIF-1α is continuously synthesized and hydrolyzed via the ubiquitin-proteasome pathway. Under hypoxic conditions, HIF-1α degradation is inhibited, leading to increased accumulation in the cytoplasm and translocation into the nucleus, where it binds to HIF-1β to form the HIF-1 molecule. HIF-1α regulates the organism by activating erythropoietin, glucose transporters, and glycolytic enzymes, thereby increasing oxygen exchange or promoting metabolism to adapt to hypoxic environments.
[0004] Nitrites bind to hemocyanin, disrupting its oxygen-carrying and releasing capabilities, causing oxygen deficiency in shrimp. This further inhibits shrimp growth and metamorphosis, leading to decreased immunity and even death. This invention studies the SNP marker sites of the HIF-1α gene associated with nitrite tolerance in Litopenaeus vannamei, providing fundamental data and references for molecularly assisted breeding of new nitrite-tolerant Litopenaeus vannamei varieties. Summary of the Invention
[0005] The purpose of this invention is to provide a molecular marker for the HIF-1α gene SNP in Litopenaeus vannamei, which can be used as a functional marker for the nitrite tolerance trait in Litopenaeus vannamei, thereby laying the foundation for the molecular-assisted breeding of nitrite tolerance strains in Litopenaeus vannamei.
[0006] This invention is achieved using the following technical solution:
[0007] A molecular marker for the HIF-1α gene SNP in Litopenaeus vannamei includes molecular markers D.12311 (C>T), D.12363 (G>T), D.12377 (T>A), D.12416 (C>T), D.12584 (A>G), D.12653 (T>C), D.12681 (G>A), and D.1... 2718 (T>G), molecular marker D.12821 (T>A), molecular marker D.12891 (G>T), molecular marker D.12993 (C>T), and are located at positions 67, 119, 133, 172, 340, 409, 437, 474, 577, 647, and 749 of the nucleotide sequence shown in Sequence 1 of the sequence listing, respectively.
[0008] The polymorphic forms of the molecular markers D.12311, D.12363, D.12377, D.12416, D.12584, D.12653, D.12681, D.12718, D.12821, D.12891, and D.12993 are C / T, G / T, A / T, T / C, A / G, C / T, A / G, G / T, A / T, T / G, and C / T, respectively.
[0009] The genotypes of the molecular marker D.12311 include the CC genotype and the CT genotype;
[0010] The molecular marker D.12363 includes the GG and GT genotypes;
[0011] The genotypes of the molecular marker D.12377 include the AT genotype and the TT genotype;
[0012] The genotypes of the molecular marker D.12416 include the CT genotype and the CC genotype;
[0013] The genotypes of the molecular marker D.12584 include AA, GG, and AG genotypes;
[0014] The genotypes of the molecular marker D.12653 include the CT genotype and the TT genotype;
[0015] The genotypes of the molecular marker D.12681 include the AG genotype and the GG genotype;
[0016] The molecular marker D.12718 includes GT and TT genotypes;
[0017] The genotypes of the molecular marker D.12821 include AA, AT, and TT genotypes;
[0018] The genotypes of the molecular marker D.12891 include the GT genotype and the GG genotype;
[0019] The molecular marker D.12993 has two genotypes: CT and CC.
[0020] The application of the HIF-1α gene SNP molecular markers in Litopenaeus vannamei was carried out for the breeding of nitrite-tolerant varieties of Litopenaeus vannamei. Specifically, genomic DNA was first extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then the obtained genomic DNA was used as a template for PCR amplification and purification of the PCR amplification products. The obtained PCR amplification products were then sequenced to determine the genotypes of the molecular markers D.12311, D.12363, D.12377, D.12416, D.12584, D.12653, D.12681, D.12718, D.12821, D.12891, and D.12993.
[0021] When the genotype of the molecular marker D.12311 is the dominant CC genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0022] When the genotype of the molecular marker D.12363 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0023] When the genotype of the molecular marker D.12377 is the dominant TT genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0024] When the genotype of the molecular marker D.12416 is the dominant CC genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0025] When the genotype of the molecular marker D.12584 is the dominant genotype GG or AG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0026] When the genotype of the molecular marker D.12653 is the dominant TT genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0027] When the genotype of the molecular marker D.12681 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0028] When the genotype of the molecular marker D.12718 is the dominant TT genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0029] When the genotype of the molecular marker D.12821 is the dominant genotype AA or AT, the individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0030] When the genotype of the molecular marker D.12891 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties.
[0031] When the genotype of the molecular marker D.12993 is the dominant CC genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0032] Furthermore, during the PCR amplification process, the primers used to detect the SNP molecular marker of the HIF-1α gene in Litopenaeus vannamei include primer F1, primer R1, and primer F2.
[0033] The nucleotide sequence of primer F1 is: TGTCCTTATGTGTCGGTGGTT (as shown in sequence 2 in the sequence listing);
[0034] The nucleotide sequence of primer R1 is: CCTCCTTAGCATCATCACTTGG (as shown in sequence 3 in the sequence listing).
[0035] The nucleotide sequence of primer F2 is: GTTGGTGTTGAGTTCGGATGAT (as shown in sequence listing 4).
[0036] Furthermore, the PCR amplification process involves two PCR amplifications. The first PCR amplification system includes 5 μL of 2×Es Taq MasterMix, 0.2 μL of template at a concentration of 100 ng / μL, 0.4 μL of primer F1 at a concentration of 10 μmol / L, 0.4 μL of primer R1 at a concentration of 10 μmol / L, and 4 μL of ddH2O. The second PCR amplification system includes 25 μL of 2×Es Taq MasterMix, 1 μL of the product from the first PCR amplification diluted 100-fold, 2 μL of primer F2 at a concentration of 10 μmol / L, 2 μL of primer R1 at a concentration of 10 μmol / L, and 20 μL of ddH2O.
[0037] Furthermore, the amplification procedure for the first PCR amplification is as follows:
[0038] S101: Pre-denaturation at 94℃ for 5 min;
[0039] S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles;
[0040] S103: Extend at 72℃ for 7 minutes;
[0041] The amplification procedure for the second PCR was as follows:
[0042] S201: Pre-denaturation at 94℃ for 3 min;
[0043] S202: 94℃ denaturation for 30s, 66℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles;
[0044] S203: Extend for 7 minutes after reaching 72℃.
[0045] Compared with existing technologies, this technical solution has the following advantages:
[0046] 1. This invention provides a HIF-1α gene SNP locus associated with the nitrite tolerance trait of Litopenaeus vannamei. Of the 11 SNP loci, 10 SNP loci are highly significantly associated with the nitrite tolerance trait of Litopenaeus vannamei, and 1 SNP locus is significantly associated with the nitrite tolerance trait of Litopenaeus vannamei. Six of these SNP loci can be selected as TaggerSNPs.
[0047] 2. Applying the molecular markers provided by this invention to the breeding of nitrite-tolerant Litopenaeus vannamei can effectively improve the nitrite tolerance of Litopenaeus vannamei by retaining individuals with favorable genotypes and eliminating those with unfavorable genotypes. Furthermore, the selected individuals exhibit stable genotypes and do not undergo genetic differentiation, allowing for accurate screening without large-scale nitrite stress experiments. Therefore, utilizing this invention for molecularly assisted breeding of nitrite tolerance traits in Litopenaeus vannamei can significantly improve breeding efficiency and accuracy, accelerate the breeding process, and provide a solid foundation for research on the improvement of nitrite-tolerant Litopenaeus vannamei varieties. Attached Figure Description
[0048] Figure 1 These are partial sequences of the product obtained from amplifying the HIF-1α gene in the examples. 'a' represents positions 62-72, showing the CC and CT peaks at the D.12311 (C>T) site; 'b' represents positions 114-124, showing the GG and GT peaks at the D.12363 (G>T) site; 'c' represents positions 128-138, showing the AT and TT peaks at the D.12377 (T>A) site; and 'd' represents positions 167-177, showing the CT and CC peaks at the D.12416 (C>T) site.
[0049] Figure 2 These are partial sequences of the product obtained from amplifying the HIF-1α gene in the examples. e represents positions 335 to 345, showing the AA and AG peaks at the D.12584 (A>G) site; f represents positions 404 to 414, showing the CT and TT peaks at the D.12653 (T>C) site; g represents positions 432 to 442, showing the AG and GG peaks at the D.12681 (G>A) site; and h represents positions 469 to 479, showing the GT and TT peaks at the D.12718 (T>G) site.
[0050] Figure 3 The above are partial sequences of the product obtained from amplifying the HIF-1α gene in the examples. i represents positions 572 to 582, showing the peak values of AA, AT, and TT at the D.12821 (T>A) site; j represents positions 642 to 652, showing the peak values of GT and GG at the D.12891 (G>T) site; and k represents positions 744 to 754, showing the peak values of CT and CC at the D.12993 (C>T) site.
[0051] Figure 4 This is a linkage analysis diagram of 11 SNP sites of the HIF-1α gene in Litopenaeus vannamei described in the examples. Detailed Implementation
[0052] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.
[0053] Example: The screening process for the HIF-1α gene SNP molecular marker of Litopenaeus vannamei described in this invention is as follows:
[0054] (1) Take several 1000L plastic barrels, fill them with 500L of aquaculture water, and add analytical grade sodium nitrite so that the concentration of sodium nitrite in the aquaculture water in the plastic barrels is 757.18mg / L; select 240 whiteleg shrimp weighing about 10g each and temporarily raise them for 3 days. Then put 30 whiteleg shrimp into each plastic barrel to conduct a nitrite stress experiment. During the entire experiment, the water was kept aerated, the pH value was kept at 8.2±0.3, the temperature was kept at 27±0.5℃, and the salinity was kept at 30.0‰. Dissolved oxygen was maintained at 7–8 mg / L. No feed was given during the experiment to maintain the nitrite concentration. The water was changed every 24 hours, and the sodium nitrite concentration was readjusted to 757.18 mg / L. When the whiteleg shrimp rolled over and did not swim away quickly or show any obvious reaction when touched with a stick, and remained in a rolled-over position, it was considered dead. The number of dead individuals was recorded starting 3 hours after the stress. 51 whiteleg shrimp that died 3–12 hours later and 56 whiteleg shrimp that were still alive after 96 hours were selected as the nitrite-sensitive group and the nitrite-tolerant group, respectively.
[0055] (2) All samples selected in step (1) were subjected to total DNA extraction from muscle tissue of Litopenaeus vannamei using the ammonium acetate / isopropanol method. The quality and integrity of the extracted DNA were detected by ultra-micro UV spectrophotometer and agarose gel electrophoresis. The total DNA obtained was stored at -20 °C for later use.
[0056] (3) Specific primers were designed by screening partial DNA fragments of the HIF-1α gene in Litopenaeus vannamei, and the following primers were obtained:
[0057] Primer F1 has the following sequence: TGTCCTTATGTGTCGGTGGTT;
[0058] Primer R1 has the following sequence: CTCTCCTTAGCATCATCACTTGG;
[0059] Primer F2 has the following sequence: GTTGGTGTTGAGTTCGGATGAT;
[0060] (4) Take the total DNA obtained in step (2) as a template and use the primers designed in step (3) to perform nested PCR amplification of the target fragment. In the specific PCR amplification process, two PCR amplifications are performed. The amplification system of the first PCR includes 5 μL of 2×Es Taq MasteMix, 0.2 μL of template with a concentration of 100 ng / μL, 0.4 μL of primer F1 with a concentration of 10 μmol / L, 0.4 μL of primer R1 with a concentration of 10 μmol / L and 4 μL of ddH2O. The amplification system of the second PCR includes 25 μL of 2×Es Taq MasteMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of primer F2 with a concentration of 10 μmol / L, 2 μL of primer R1 with a concentration of 10 μmol / L and 20 μL of ddH2O.
[0061] The amplification procedure for the first PCR amplification is as follows:
[0062] S101: Pre-denaturation at 94℃ for 5 min;
[0063] S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles;
[0064] S103: Extend at 72℃ for 7 minutes;
[0065] The amplification procedure for the second PCR was as follows:
[0066] S201: Pre-denaturation at 94℃ for 3 min;
[0067] S202: 94℃ denaturation for 30s, 66℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles;
[0068] S203: Extend at 72℃ for 7 minutes;
[0069] (5) The PCR amplification product obtained in step (4) was purified and sequenced after detection by 1% agarose gel electrophoresis. Then, DNAstar software was used to compare and analyze the sequencing results, including nucleotide sequence alignment and peak diagram analysis, to screen out relevant SNP sites.
[0070] See Figures 1-3The nucleotide sequence of the PCR amplification product of one of the samples is shown in Sequence 1 of the sequence listing, where position 67 is D.12311 (C>T), position 119 is D.12363 (G>T), position 133 is D.12377 (T>A), position 172 is D.12416 (C>T), position 340 is D.12584 (A>G), position 409 is D.12653 (T>C), position 437 is D.12681 (G>A), position 474 is D.12718 (T>G), position 577 is D.12821 (T>A), position 647 is D.12891 (G>T), and position 749 is D.12993 (C>T).
[0071] (6) Based on the selected SNPs, the Litopenaeus vannamei in the sensitive group and the tolerant group were detected and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The specific results are shown in Table 1.
[0072] Table 1. Chi-square analysis results of SNP marker sites
[0073]
[0074] Analysis based on Table 1 shows that the dominant genotypes for molecular markers D.12311 (C>T) are CC, D.12363 (G>T) is GG, D.12377 (T>A) is TT, D.12416 (C>T) is CC, D.12584 (A>G) is AG or GG, D.12653 (T>C) is TT, D.12681 (G>A) is GG, D.12718 (T>G) is TT, D.12821 (T>A) is AA or AT, D.12891 (G>T) is GG, and D.12993 (C>T) is CC.
[0075] Simultaneously, linkage disequilibrium analysis was performed on 11 SNP sites, from Figure 4It was found that D.12311 (C>T) is completely linked to D.12653 (T>C), D.12584 (A>G) is linked to D.12821 (T>A), and D.12363 (G>T), D.12377 (T>A), D.12681 (G>A) is linked to D.12718 (T>G). Therefore, the sites D.12681 (G>A), D.12584 (A>G), D.12311 (C>T), D.12416 (C>T), D.12993 (C>T), and D.12891 (G>T) can be selected as Tagger SNPs.
[0076] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. The application of a SNP molecular marker for the HIF-1α gene in Litopenaeus vannamei, characterized in that: The molecular markers of the HIF-1a gene SNPs in Litopenaeus vannamei include molecular markers D.12311, D.12363, D.12377, D.12416, D.12584, D.12653, D.12681, D.12718, D.12821, D.12891, and D.12993, and are located sequentially at positions 67, 119, 133, 172, 340, 409, 437, 474, 577, 647, and 749 of the nucleotide sequence shown in Sequence 1 of the sequence listing. The polymorphic forms of the molecular markers D.12311, D.12363, D.12377, D.12416, D.12584, D.12653, D.12681, D.12718, D.12821, D.12891, and D.12993 are C / T, G / T, A / T, T / C, A / G, C / T, A / G, G / T, A / T, T / G, and C / T, respectively. The genotypes of the molecular marker D.12311 include the CC genotype and the CT genotype; The molecular marker D.12363 includes the GG and GT genotypes; The genotypes of the molecular marker D.12377 include the AT genotype and the TT genotype; The genotypes of the molecular marker D.12416 include the CT genotype and the CC genotype; The genotypes of the molecular marker D.12584 include AA, GG, and AG genotypes; The genotypes of the molecular marker D.12653 include the CT genotype and the TT genotype; The genotypes of the molecular marker D.12681 include the AG genotype and the GG genotype; The molecular marker D.12718 includes GT and TT genotypes; The genotypes of the molecular marker D.12821 include AA, AT, and TT genotypes; The genotypes of the molecular marker D.12891 include the GT genotype and the GG genotype; The genotypes of the molecular marker D.12993 include the CT genotype and the CC genotype; The HIF-1α gene SNP molecular markers of Litopenaeus vannamei were used for the breeding of nitrite-tolerant varieties of Litopenaeus vannamei. Specifically, genomic DNA was first extracted from the muscle tissue of the Litopenaeus vannamei to be tested. Then, the obtained genomic DNA was used as a template for PCR amplification and purification of the PCR amplification products. The obtained PCR amplification products were then sequenced to determine the genotypes of the molecular markers D.12311, D.12363, D.12377, D.12416, D.12584, D.12653, D.12681, D.12718, D.12821, D.12891, and D.12993. When the genotype of the molecular marker D.12311 is the dominant CC genotype, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12363 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12377 is the dominant TT genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12416 is the dominant CC genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12584 is the dominant genotype GG or AG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12653 is the dominant TT genotype, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12681 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12718 is the dominant TT genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12821 is the dominant genotype AA or AT, the individual is selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of the molecular marker D.12891 is the dominant genotype GG, this individual is selected as a backup parent for breeding of Litopenaeus vannamei varieties. When the genotype of the molecular marker D.12993 is the dominant CC genotype, this individual is selected as a backup parent for breeding Litopenaeus vannamei. The breeding of Litopenaeus vannamei varieties involves screening and cultivating Litopenaeus vannamei varieties with tolerance to nitrite nitrogen.
2. The application of the SNP molecular marker of the HIF-1α gene in Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primers used to detect the SNP molecular marker of the HIF-1α gene in Litopenaeus vannamei include primer F1, primer R1, and primer F2. The nucleotide sequence of primer F1 is: TGTCCTTATGTGTCGGTGGTT; The nucleotide sequence of primer R1 is: CCTCCTTAGCATCATCACTTGG; The nucleotide sequence of primer F2 is: GTTGGTGTTGAGTTCGGATGAT.
3. The application of the SNP molecular marker of the HIF-1α gene in Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification process involves two PCR amplifications. The first PCR amplification system includes 5 μL of 2×Es TaqMasteMix, 0.2 μL of template at a concentration of 100 ng / μL, 0.4 μL of primer F1 at a concentration of 10 μmol / L, 0.4 μL of primer R1 at a concentration of 10 μmol / L, and 4 μL of ddH2O. The second PCR amplification system includes 25 μL of 2×Es TaqMasteMix, 1 μL of the product from the first PCR amplification diluted 100-fold, 2 μL of primer F2 at a concentration of 10 μmol / L, 2 μL of primer R1 at a concentration of 10 μmol / L, and 20 μL of ddH2O.
4. The application of the HIF-1α gene SNP molecular marker in Litopenaeus vannamei according to claim 3, characterized in that: The amplification procedure for the first PCR amplification is as follows: S101: Pre-denaturation at 94℃ for 5 min; S102: Denaturation at 94℃ for 30s, annealing at 62℃ for 30s, extension at 72℃ for 30s, for a total of 35 amplification cycles; S103: Extend at 72℃ for 7 minutes; The amplification procedure for the second PCR was as follows: S201: Pre-denaturation at 94℃ for 3 min; S202: 94℃ denaturation for 30s, 66℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles; S203: Extend for 7 minutes after reaching 72℃.
Citation Information
Patent Citations
South America white shrimp anti-ammonia nitrogen and nitrite stress resistance character related gene SNP (Single Nucleotide Polymorphism) marker, amplification primer and application thereof
CN117587147A
Method for improving and evaluating antioxidant and anti-inflammatory activity of tortoise shells
CN117899118A