Antisense oligonucleotides and their use for the treatment of pulmonary fibrosis

Antisense oligonucleotides targeting HSPB5 provide a novel approach to treat pulmonary fibrosis by inhibiting HSPB5 expression, effectively reducing fibrosis markers and collagen accumulation, addressing the limitations of current treatments.

WO2025237990A1PCT designated stage Publication Date: 2025-11-20INST NAT DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM) +6
View PDF 109 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/063054
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-14
Filing Date
2025-05-13
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

Current treatments for pulmonary fibrosis, such as idiopathic pulmonary fibrosis (IPF), are limited in effectiveness, with existing drugs only slowing down the disease progression without reversing or halting it, and there is a need for novel therapeutic approaches targeting the key profibrotic pathways involved in fibrosis development.

Method used

Development of antisense oligonucleotides (ASOs) specifically designed to target and inhibit the expression of HSPB5, a protein involved in TGF-β1 signaling, to reduce fibrosis progression by decreasing HSPB5 expression and activity in lung cells.

Benefits of technology

The ASOs effectively limit pulmonary fibrosis development by reducing HSPB5 expression, leading to decreased fibrosis markers and collagen accumulation, offering a potential therapeutic strategy for treating fibrotic interstitial lung diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000011_0001
    Figure IMGF000011_0001
  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure 00000057_0000
    Figure 00000057_0000
Patent Text Reader

Abstract

The present invention concerns the treatment of Fibrotic interstitial lung diseases (Fibrotic ILDs) and particularly Progressive pulmonary fibrosis (PPF) such as idiopathic lung fibrosis (IPF). In particular inventors develop antisense oligonucleotides targeting HSPB5 and study their effects on the development of experimental pulmonary fibrosis. Specific antisense oligonucleotides (ASO) were designed and screened in vitro, based on their ability to inhibit both human and murine HSPB5 expression. One of them, ASO22, was selected by its capacity to inhibit TGF-β1-induced expression of HSPB5 and additional key markers of fibrosis such as PAI-1, collagen, fibronectin and α-SMA in fibroblastic human CCD-19Lu cells as well as PAI- 1 and α-SMA in pulmonary epithelial A549 cells. Intra-tracheal or intravenous administration of ASO22 in bleomycin-induced pulmonary fibrotic mice decreased HSPB5 expression and reduced fibrosis as measured by the decrease in pulmonary remodeling, collagen accumulation and Acta2 and Col1a1 expression. Altogether, these results suggest a real interest of using an antisense oligonucleotide strategy targeting HSPB5 for the treatment of pulmonary fibrosis.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ANTISENSE OLIGONUCLEOTIDES AND THEIR USE FOR THE

[0002] TREATMENT OF PULMONARY FIBROSIS

[0003] FIELD OF THE INVENTION

[0004] The present invention relates to antisense oligonucleotides efficiency in reducing the expression of HSPB5 (heat shock protein aB-crystallin) in Fibrotic interstitial lung diseases (Fibrotic ILDs) in particular Progressive pulmonary fibrosis (PPF) such as idiopathic pulmonary fibrosis (IPF) of a subject.

[0005] BACKGROUND OF THE INVENTION:

[0006] Fibroproliferative diseases are a major clinical issue and are responsible for 45 % of deaths around the world (1). Diffuse interstitial lung diseases (ILDs) include a large number of different diseases and causes with variable outcomes often associated with progressive fibrosis. Although each of the individual fibrotic ILDs are rare, collectively they affect a considerable number of patients, representing a significant burden of disease (2). Idiopathic pulmonary Fibrosis (IPF) is the typical chronic fibrosing ILD of unknown origin associated with progressive decline in lung function and a median survival time of less than five years after diagnosis (3). Others fibrosing ILDs are often associated with connective tissues diseases including rheumatoid arthritis-ILD (RA-ILD) and systemic sclerosis associated ILD (SSc-ILD). Bases on survey data from multiple countries, these progressive pulmonary fibrosis (PPF) may develop in -18-32 % of patients with ILDs others than IPF, representing up to 20 patients per 100,000 people in Europe and up to 28 patients per 100,000 in the United States. (M Nasser et al, Eur Respie J 57 (2) (2021)); Treatment options for pulmonary fibrosis are limited with only two drugs pirfenidone and nintedanib, which slow down IPF (4) but are unable to reverse or even halt the disease. Recently, Nintedanib has been approved for patients with chronic fibrosing ILDs with a progressive phenotype including SSc-ILD (KR Flaherty et al, NEJM 381(18)1718 (2019) ; M Kuwana and A Azuma, Modern Rheumatology 30(2), 225 (2020)). Development of novel therapeutic approaches for patients with PPF are therefore needed. Although PPF pathogenesis is not completely understood, few crucial mechanisms have been identified in this disease (5) such as an abnormal alveolar repair and injuries to lung epithelium, leading to the aberrant reprogramming of alveolar epithelial type (AT)II cells, and the activation of (myo)fibroblasts responsible for the overproduction of abnormal extracellular matrix components mainly collagen (5, 6). In parallel, inflammatory cells are recruited to the lung and secrete pro-fibrotic mediators such as Transforming Growth Factor (TGF)-pi. TGF- P1 is a key profibrotic growth factor overexpressed during PPF which promotes fibroblast transition into pathological myofibroblasts (7, 8). Mechanistically, TGF-pi classically signals via the Smads proteins, a crucial pathway in fibrogenesis (9).

[0007] Heat shock proteins (HSPs) are a set of highly conserved chaperones whose expression is induced by various stresses. Several studies from our group and others have reported that members of the small HSPs family, particularly HSPB5 (also termed aB-crystallin), are overexpressed during fibrosis development in experimental rodent models of pulmonary fibrosis including the widely used bleomycin (BLM) model (10-12). Inventors team has demonstrated that HSPB5 knock-out mice are resistant to BLM-induced fibrosis. At the molecular level, HSPB5 hampers SMAD4 ubiquitination and, consequently, SMAD4 accumulates in the nucleus and promotes TGF-pi signaling and fibrogenesis (11). Consequently, HSPB5 appears as a relevant target for pulmonary fibrosis. Among the strategies to develop HSPB5-targeting inhibitors, inventor’s work has focused on an original approach that has consisted in the development of specific Antisense Oligonucleotides (ASO) against HSPB5. Whereas ASO targeting HSPB1, another small HSP member, have been extensively studied in clinical trials mainly in oncology (13, 14), HSPB5-specific ASO have never been developed so far.

[0008] In this study inventors demonstrate for the first time that ASO targeting HSPB5 can efficiently limit pulmonary fibrosis development and may be a novel therapeutic strategy to hamper lung fibrosis progression.

[0009] SUMMARY OF THE INVENTION:

[0010] A first object of the invention concerns an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 in a subject in need thereof and targets the gene or the mRNA of HSPB5.

[0011] A second object of the present invention concerns the inhibitor and / or an antisense oligonucleotide according to the invention for use in the treatment of Fibrotic interstitial lung diseases (Fibrotic ILDs) in a subject in need thereof.

[0012] In particular embodiment Fibrotic ILDs is progressive pulmonary fibrosis (PPF)

[0013] The present invention also relates to antisense oligonucleotides efficiency in reducing the expression of HSPB5 in a subject suffering of Fibrotic interstitial lung diseases (Fibrotic ILDs). Particularly, the invention is defined by its claims.

[0014] DETAILED DESCRIPTION OF THE INVENTION:

[0015] The inventors previously demonstrated the importance of the heat shock protein aB- crystallin (HSPB5) in the Transforming-growth-factor (TGF)- 1 profibrotic signaling, which suggest that HSPB5 could be a new therapeutic target for the treatment of pulmonary fibrosis. The purpose of the current study was to develop antisense oligonucleotides targeting HSPB5 and study their effects on the development of experimental pulmonary fibrosis. Specific antisense oligonucleotides (ASO) were designed and screened in vitro, based on their ability to inhibit both human and murine HSPB5 expression. One of them, ASO22, was selected by its capacity to inhibit TGF-pi -induced expression ofHSPB5 and additional key markers of fibrosis such as PAI-1, collagen, fibronectin and a-SMA in fibroblastic human CCD-19Lu cells as well as PAI-1 and a-SMA in pulmonary epithelial A549 cells. Intra-tracheal or intravenous administration of ASO22 in bleomycin-induced pulmonary fibrotic mice decreased HSPB5 expression and reduced fibrosis as measured by the decrease in pulmonary remodeling, collagen accumulation and Acta2 and Col lai expression. Altogether, these results suggest a real interest of using an antisense oligonucleotide strategy targeting HSPB5 for the treatment of pulmonary fibrosis.

[0016] The present invention relates to antisense oligonucleotides efficiency in reducing the expression of HSPB5 in a subject suffering of fibrotic interstitial lung diseases (ILDs), in particular progressive pulmonary fibrosis (PPF) such as idiopathic pulmonary fibrosis (IPF).

[0017] Sequences of the invention

[0018] A first aspect of the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the gene or the mRNA of HSPB5.

[0019] In a particular embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the nucleic acids sequence SEQ ID NO: 27.

[0020] In a further embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets a region comprising at least between 15 nucleic acids to 25 nucleic acids of SEQ ID NO: 27.

[0021] In a particular embodiment, the inhibitor targets at least, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 consecutive nucleic acids of SEQ ID NO: 27. In one embodiment, the invention also relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets at least the region comprising or consisting of the nucleic acids 256-783 of SEQ ID NO: 27.

[0022] In a specific embodiment, the invention also relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the region selected from the list comprising or consisting of the nucleic acids 356-375 of SEQ ID NO: 27, the nucleic acids 536-555 of SEQ ID NO: 27, the nucleic acids 676-695 of SEQ ID NO: 27, the nucleic acids 736-755 of SEQ ID NO:27 and the nucleic acids 756-775 of SEQ ID NO: 27.

[0023] In a more embodiment, the invention also relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets at least the region comprising or consisting of the nucleic acids 676-695 of SEQ ID NO: 27.

[0024] As used herein, the term “HSPB5” for “Probable ATP-dependent RNA helicase DDX5” and also knows as “heat shock protein oB-crystallin” or “Alpha-crystallin B chain” (CRY AB) is member of the small heat shock protein (sHSP also known as the HSP20) family and can be induced by heat shock, ischemia, and oxidation. HSPB5 is a protein that in humans is encoded by the CRYAB gene (gene ID 1410). HSPB5 functions as molecular chaperone that primarily binds misfolded proteins to prevent protein aggregation, as well as inhibit apoptosis and contribute to intracellular architecture (Yamamoto S, et al. (2014). ". Biochemical and Biophysical Research Communications. 455 (3-4): 241-5). Post-translational modifications decrease the ability to chaperone (van de Schootbrugge C, et al (2014). BMC Cancer. 14: 252). Mutations in CRYAB cause different cardiomyopathies, (Brodehl, A. et al (2017). Human Mutation. 38 (8): 947-952) skeletal myopathies (Vicart, P.; et al. (1998). Nature Genetics. 20 (1): 92-95) mainly myofibrillar myopathy (Fichna JP, et al (2018). Journal of Applied Genetics. 59 (4): 431-439) and also cataracts ( Fichna JP et al. (2016). BBA Clinical. 7: 1-7). In addition, defects in this gene / protein have been associated with cancer and neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease (Yamamoto S, et al (2014). . Biochemical and Biophysical Research Communications. 455 (3-4): 241-5; van de Schootbrugge C, et al. (2014). BMC Cancer. 14: 252).

[0025] The naturally occurring human HSPB5 gene has a nucleotide sequence as shown in NCBI accession number Entrez Gene ID 1410 or Ensembl accession number ENSG00000109846. According to the NCBI database, HSPB5 has 6 major protein- coding mRNA sequences, which are NM_001885.3, NM_001289807.1, NM_001289808.2, NM 001330379.1, NM_001368245.1; NM_001368246.1 corresponding to the mRNA variant 1, variant 2, variant 3, variant 4, variant 5 and variant 6, respectively. The variant 1, variant 2, variant 3, variant 5 concern HSPB5 isoform 1 protein and variant 4, variant 6 concern HSPB5 isoform 2 protein

[0026] The CDSs are strictly identical among the 4 HSPB5 transcript variants (variant 1, variant 2, variant 3, variant 5 encode the same isoform: HPB5 isoform 1). The two other variants (variant 4 and 6 which encode for HPSBP5 isoform 2) have a distinct N terminus and are shorter length as the main isoform. The reference sequence used to design ASOs was from the 1st transcript variant of HSPB5 i.e. NM_001885 and restricted to the CDS, which is defined as CCDS83 1.1 (between nucleotides 256 and 783 of SEQ ID NO: 27).

[0027] Thus, in a particular embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets any variants 1, 2, 3 4, 5 and / or 6 ofHSPB5.

[0028] In another particular embodiment, said inhibitor targets the nucleic acids sequence SEQ ID NO: 27 (mRNA of Homo sapiens HSPB5 (variant 1)).

[0029] Thus, in a particular embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the nucleic acids sequence SEQ ID NO: 27.

[0030] In a further embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets at least between 15 nucleic acids to 25 nucleic acids of SEQ ID NO: 27.

[0031] The nucleotide sequence of mRNA (CDS in bold) of Homo sapiens HSPB5 (variant 1) is defined by the sequence SEQ ID NO: 27:

[0032] ACACCCAGGCCGGCAAAGAGCAGGTATCAGCACTGCAAGCACCAAGTGTG TCTTGAGCTCAGTGAGTACTGGGTATGTGTCACATTGCCAAATCCCGGATCACAA GTCTCCATGAACTGCTGGTGAGCTAGGATAATAAAACCCCTGACATCACCATTCC AGAAGCTTCACAAGACTGCATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGG AGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA TCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCCAGCCG CCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCG ACGTCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGG CACCCAGCTGGTTTGACACTGGACTCTCAGAGATGCGCCTGGAGAAGGACA GGTTCTCTGTCAACCTGGATGTGAAGCACTTCTCCCCAGAGGAACTCAAAGT TAAGGTGTTGGGAGATGTGATTGAGGTGCATGGAAAACATGAAGAGCGCCA GGATGAACATGGTTTCATCTCCAGGGAGTTCCACAGGAAATACCGGATCCCA GCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGATGGGGTCC TCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCC CATCACCCGTGAAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAGATG

[0033] CCCTTTCTTGAATTGCATTTTTTAAAACAAGAAAGTTTCCCCACCAGTGAATGAAA GTCTTGTGACTAGTGCTGAAGCTTATTAATGCTAAGGGCAGGCCCAAATTATCAA GCTAATAAAATATCATTCAGCAACAGATAACTGTCTTGTGTTTGAATATTCCACA CACTTTTAAATAAATATACAGATACCACAGA

[0034] As used herein, the term “inhibitor” refers to a natural or synthetic compound that has a biological effect to inhibit or reduce the expression and / or activity of HSPB5.

[0035] In a particular embodiment, the inhibitor of the invention refers to a natural or synthetic compound that has a biological effect to reduce and / or inhibit the expression of HSPB5 gene. It will be understood to the skilled in the art that inhibiting expression of a gene, e.g. the HSPB5 gene, typically results in a decrease or even abolition of the gene product (ARN and / or protein, e.g. HSPB5 protein) in target cells or tissues, although various levels of inhibition may be achieved. Inhibiting or decreasing expression is typically referred to as knockdown.

[0036] In a particular embodiment, the inhibitor of activity of HSPB5 refers to a natural or synthetic compound that has a biological effect to reduce and / or inhibit the activity of HSPB5.

[0037] In a particular embodiment, the inhibitor of HSPB5 of the invention is a siRNA, a shRNA, an antisense oligonucleotide, miRNA or a ribozyme.

[0038] In one embodiment, the inhibitor of HSPB5 according to the invention is a siRNA.

[0039] Small inhibitory RNAs, also referred to as short interfering RNAs (siRNAs) can also function as HSPB5 expression inhibitors for use in the present invention. HSPB5 activity can be reduced by treating the subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that HSPB5 expression is specifically inhibited (i.e. RNA interference or RNAi) by degradation of mRNAs in a sequence specific manner. Methods for selecting an appropriate dsRNA or dsRNA- encoding vector are known in the art for genes whose sequence is known (e.g. see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836, each of which is incorporated by reference herein in its entirety).

[0040] In a particular embodiment, the invention relates to an inhibitor of HSPB5 wherein said inhibitor is siRNA.

[0041] In a particular embodiment, the siRNA according to the invention targets the region selected from the list consisting of the nucleic acids 356-375, 536-555, 676-695, 736-755, 756- 775 of SEQ ID NO: 27.

[0042] In one embodiment, the inhibitor of HSPB5 according to the invention is a shRNA.

[0043] Short hairpin RNAs (shRNA) can also function as HSPB5 expression inhibitors for use in the present invention. A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA is generally expressed using a vector introduced into cells, wherein the vector utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the siRNA to which it is bound.

[0044] In one embodiment, the inhibitor of HSPB5 according to the invention is a miRNA. miRNAs (miR) can also function as HSPB5 expression inhibitors for use in the present invention. miRNA has its general meaning in the art and refers to microRNA molecules that are generally 21 to 22 nucleotides in length, even though lengths of 19 and up to 23 nucleotides have been reported, and suppress translation of targeted mRNAs. miRNAs are each processed from a longer precursor RNA molecule (“precursor miRNA”). Precursor miRNAs are transcribed from non-protein-encoding genes. The precursor miRNAs have two regions of complementarity that enables them to form a stem-loop- or fold-back-like structure, which is cleaved in animals by a ribonuclease Ill-like nuclease enzyme called Dicer. The processed miRNA is typically a portion of the stem. The processed miRNA (also referred to as “mature miRNA”) becomes part of a large complex to downregulate, e.g. decrease translation, of a particular target gene.

[0045] Multiple miRNAs may be employed to knockdown HSPB5. The miRNAs may be complementary to different target transcripts or different binding sites of a target transcript. Polycistronic transcripts may also be utilized to enhance the efficiency of target gene knockdown In some embodiments, multiple genes encoding the same miRNAs or different miRNAs may be regulated together in a single transcript, or as separate transcripts in a single vector cassette. In one embodiment, the vector is a viral vector, including but not limited to recombinant adeno-associated viral (rAAV) vectors, lentiviral vectors, retroviral vectors and retrotransposon-based vector systems.

[0046] In one embodiment, the inhibitor of HSPB5 is an antisense nucleic acid. linhibitor of HSPB5 expression of the invention is based on antisense oligonucleotide constructs. Anti-sense oligonucleotides, including antisense RNA molecules and antisense DNA molecules, would act to directly block the translation of HSPB5 mRNA by binding thereto and thus preventing protein translation or by increasing mRNA degradation, thus decreasing the level of HSPB5 proteins, and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding HSPB5 can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion. Methods for using antisense techniques for specifically alleviating gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732, each of which is incorporated by reference herein in its entirety).

[0047] The antisense RNA that is complementary to the sense target sequence is encoded by a DNA sequence for the production of any of the foregoing inhibitors (e.g., antisense, siRNAs, shRNAs or miRNAs). The DNA encoding double stranded RNA of interest is incorporated into a gene cassette, e.g. an expression cassette in which transcription of the DNA is controlled by a promoter.

[0048] In a particular embodiment, the inhibitor of HSPB5 gene expression is an antisense oligonucleotide.

[0049] In a particular embodiment, the inhibitor of HSPB5 gene expression is an isolated, synthetic or recombinant antisense oligonucleotide targeting the HSPB5 mRNA transcript. The oligonucleotide of the invention can be of any suitable type.

[0050] In some embodiments, the oligonucleotide is a RNA oligonucleotide. In some embodiments, the oligonucleotide is a DNA oligonucleotide.

[0051] Thus, the invention also relates to an antisense oligonucleotide which reduces the expression and / or activity of HSPB5 and targets the gene or the mRNA of HSPB5.

[0052] In a particular embodiment, the antisense oligonucleotide of the invention reduces the expression and / or activity of HSPB5 and targets the nucleotides sequence SEQ ID NO: 27. In a further embodiment, the antisense oligonucleotide of the invention reduces the expression and / or activity of HSPB5 and targets at least between 15 nucleic acids to 25 nucleic acids of SEQ ID NO: 27.

[0053] In a particular embodiment, the antisense oligonucleotide targets at least, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 consecutive nucleic acids of SEQ ID NO: 27.

[0054] In one embodiment, the antisense oligonucleotide of the invention reduces the expression and / or activity of HSPB5 and targets at least the region comprising or consisting of the nucleic acids 256-783 of SEQ ID NO: 27.

[0055] In one embodiment, the antisense oligonucleotide of the invention reduces the expression and / or activity of HSPB5 and targets at least the region selected from the list consisting of the nucleic acids 356-375 of SEQ ID NO: 27, the nucleic acids 536-555of SEQ ID NO: 27, the nucleic acids 676-695 of SEQ ID NO: 27, the nucleic acids 736-755 of SEQ ID NO: 27, the nucleic acids 756-775 of SEQ ID NO: 27.

[0056] In one embodiment, the antisense oligonucleotide of the invention reduces the expression and / or activity of HSPB5 and targets at least the region comprising or consisting of the nucleic acids 676-695 of SEQ ID NO: 27.

[0057] In some embodiments, the antisense oligonucleotide of the present invention has a length of at least 15 nucleic acids.

[0058] In some embodiments, the antisense oligonucleotide of the present invention has a length from 15 to 25 nucleic acids.

[0059] In particular, the antisense oligonucleotide of the present invention has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleic acids.

[0060] Particularly, the antisense oligonucleotide of the present invention has a length of 20 nucleic acids.

[0061] In a particular embodiment, the antisense oligonucleotide is selected from the group consisting of but not limited to: SEQ ID NO: 1 to SEQ ID NO:26 (see Table 1).

[0062]

[0063] Table 1. Sequences of antisense oligonucleotides useful for their capacity to reduce the expression and / or activity of HSPB5.

[0064] In a particular embodiment, the antisense oligonucleotide is selected from the group consisting of but not limited to: SEQ ID NO: 1 to SEQ ID NO:26 (see Table 1). In a particular embodiment, the antisense oligonucleotide is selected from the group consisting of SEQ ID NO: 6, SEQ ID NO: 15, SEQ ID NO: 22, SEQ ID NO: 25 and SEQ ID NO:26.

[0065] In a particular embodiment, the antisense oligonucleotide is set forth as SEQ ID NO:22. As used herein, the term “acid nucleic” or "nucleotide" is defined as a modified or naturally occurring deoxyribonucleotide or ribonucleotide. Nucleotides typically include purines and pyrimidines, which include thymidine (T), cytidine (C), guanosine (G), adenosine (A) and uridine (U).

[0066] As used herein, the term "oligonucleotide" refers to an oligomer of the nucleotides defined above. The term "oligonucleotide" refers to a nucleic acid sequence, 3 '-5' or 5'-3' oriented, which may be single- or double-stranded. The oligonucleotide used in the context of the invention may in particular be DNA or RNA. The term also includes "oligonucleotide analog" which refers to an oligonucleotide having (i) a modified backbone structure, e.g. , a backbone other than the standard phosphodiester linkage found in natural oligo- and polynucleotides, and (ii) optionally, modified sugar moieties, e g., morpholino moieties rather than ribose or deoxyribose moieties. Oligonucleotide analogs support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analog backbone presents the bases in a manner to permit such hydrogen bonding in a sequencespecific fashion between the oligonucleotide analog molecule and bases in a standard polynucleotide {e.g., single-stranded RNA or single-stranded DNA). Particularly, analogs are those having a substantially uncharged, phosphorus containing backbone. A substantially uncharged, phosphorus containing backbone in an oligonucleotide analog is one in which a majority of the subunit linkages, e.g., between 50-100%, typically at least 60% to 100% or 75% or 80% of its linkages, are uncharged, and contain a single phosphorous atom.

[0067] The term “oligonucleotide” also refers to an oligonucleotide sequence that is inverted relative to its normal orientation for transcription and so correspond to a RNA or DNA sequence that is complementary to a target gene mRNA molecule expressed within the host cell (e.g., it can hybridize to the target gene mRNA molecule through Watson-Crick base pairing).

[0068] An antisense strand can be constructed in a number of different ways, provided that it is capable of interfering with the expression of a target gene. For example, the antisense strand can be constructed by reverse-complementing the coding region (or a portion thereof) of the target gene relative to its normal orientation for transcription to allow the transcription of its complement, (e.g., RNAs encoded by the antisense and sense gene may be complementary). In some embodiments, the oligonucleotide need not have the same intron or exon pattern as the target gene, and noncoding segments of the target gene may be equally effective in achieving antisense suppression of target gene expression as coding segments such as antisense oligonucleotide (ASO). In some embodiments, the oligonucleotide has the same exon pattern as the target gene such as siRNA and antisense oligonucleotide (ASO). As used herein, the term “target” or “targeting” refers to an oligonucleotide able to specifically bind to a CRY AB gene or a HSPB5 mRNA (any variants of the mRNA) encoding a HSPB5 gene product. In particular, it refers to an oligonucleotide able to inhibit said gene or said mRNA by the methods known to the skilled in the art (e.g. antisense, RNA interference).

[0069] According to the invention, the antisense oligonucleotide of the present invention targets an mRNA and / or DNA encoding HSPB5 gene product, and is capable of reducing the amount of HSPB5 expression and / or activity in cells.

[0070] That is to say, the antisense oligonucleotide comprises a sequence that is at least partially complementary, particularly perfectly complementary, to a region of the sequence of said mRNA, said complementarity being sufficient to yield specific binding under intra-cellular conditions. As immediately apparent to the skilled in the art, by a sequence that is “perfectly complementary to” a second sequence is meant the reverse complement counterpart of the second sequence, either under the form of a DNA molecule or under the form of a RNA molecule. A sequence is “partially complementary to” a second sequence if there are one or more mismatches.

[0071] The antisense oligonucleotide of the present invention that targets a cDNA or mRNA encoding HSPB5 gene can be designed by using the sequence of said mRNA as a basis, e.g. using bioinformatic tools.

[0072] Particularly, the antisense oligonucleotide according to the invention is capable of reducing the expression and / or activity of HSPB5 in lung cells. Methods for determining whether an oligonucleotide is capable of reducing the expression and / or activity of HSPB5 in cells are known to those skilled in the art.

[0073] This can be performed for example by analyzing HSPB5 RNA expression such as by RT-qPCR, in situ hybridization or HSPB5 protein expression such as by immunohistochemistry, Western blot, and by comparing HSPB5 protein expression or HSPB5 functional activity in the presence and in the absence of the antisense oligonucleotide to be tested.

[0074] In other embodiments, the oligonucleotide is targeted to a translation initiation site (AUG codon), sequences in the coding region e.g. one or more exons), 5 ’-untranslated region or 3 ’-untranslated region of an mRNA. The aim is to interfere with functions of the messenger RNA include all vital functions including translocation of the RNA to the site for protein translation, actual translation of protein from the RNA, splicing or maturation of the RNA and possibly even independent catalytic activity which may be engaged in by the RNA. The overall effect of such interference with the RNA function is to cause interference with protein expression. In some embodiments, the oligonucleotide of the present invention is further modified, particularly chemically modified, in order to increase the stability and / or therapeutic efficiency in vivo. The one skilled in the art can easily provide some modifications that will improve the efficacy of the oligonucleotide such as stabilizing modifications (C. Frank Bennett and Eric E. Swayze, RNA Targeting Therapeutics: Molecular Mechanisms of Antisense Oligonucleotides as a Therapeutic Platform. Annu. Rev. Pharmacol. Toxicol. 2010.50:259-293; Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48). In particular, the oligonucleotide used in the context of the invention may comprise modified nucleotides. Chemical modifications may occur at three different sites: (i) at phosphate groups, (ii) on the sugar moiety, and / or (iii) on the entire backbone structure of the oligonucleotide. Typically, chemical modifications include backbone modifications, heterocycle modifications, sugar modifications, and conjugation strategies.

[0075] For example the oligonucleotide is be selected from the group consisting of oligodeoxyribonucleotides, oligoribonucleotides, small regulatory RNAs (sRNAs), U7- orUl- mediated ASOs or conjugate products thereof such as peptide-conjugated or nanoparticle- complexed ASOs, chemically modified oligonucleotide by backbone modifications such as morpholinos, phosphorodi ami date morpholino oligomers (Phosphorodi ami date morpholinos, PMO), peptide nucleic acid (PNA), phosphorothioate (PS) oligonucleotides, stereochemically pure phosphorothioate (PS) oligonucleotides, phosphoramidates modified oligonucleotides, thiophosphoramidate-modified oligonucleotides, and methylphosphonate modified oligonucleotides; chemically modified oligonucleotide by heterocycle modifications such as bicycle modified oligonucleotides, Bicyclic Nucleic Acid (BNA), tricycle modified oligonucleotides, tricyclo-DNA-antisense oligonucleotides (ASOs), nucleobase modifications such as 5-methyl substitution on pyrimidine nucleobases, 5-substituted pyrimidine analogues, 2 -Thio-thymine modified oligonucleotides, and purine modified oligonucleotides; chemically modified oligonucleotide by sugar modifications such as Locked Nucleic Acid (LNA) oligonucleotides, 2’, 4’ -Methyleneoxy Bridged Nucleic Acid (BNA), ethylene-bridged nucleic acid (ENA), constrained ethyl (cEt) oligonucleotides, 2’-Modified RNA, 2’- and 4’-modified oligonucleotides such as 2’-0-Me RNA (2’-0Me), 2’-O-Methoxyethyl RNA (MOE), 2’-Fluoro RNA (FRNA), and 4’-Thio-Modified DNA and RNA; chemically modified oligonucleotide by conjugation strategies such as N-acetyl galactosamine (GalNAc) oligonucleotide conjugates such as 5’-GalNAc and 3’-GalNAc ASO conjugates, lipid oligonucleotide conjugates (LASO), cell penetrating peptides (CPP) oligonucleotide conjugates, targeted oligonucleotide conjugates, antibody-oligonucleotide conjugates, polymer-oligonucleotide conjugate such as with PEGylation and targeting ligand; and chemical modifications and conjugation strategies described for example in Bennett and Swayze, 2010 (RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol. 2010;50:259-93); Wan and Seth, 2016 (The Medicinal Chemistry of Therapeutic Oligonucleotides. J Med Chem. 2016 Nov 10;59(21):9645-9667); Juliano, 2016 (The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48); Lundin et al., 2015 (Oligonucleotide Therapies: The Past and the Present. Hum Gene Ther. 2015 Aug;26(8):475-85); and Prakash, 2011 (An overview of sugar-modified oligonucleotides for antisense therapeutics. Chem Biodivers. 2011 Sep;8(9): 1616-41). Indeed, for use in vivo, the oligonucleotide may be stabilized. A “stabilized” oligonucleotide refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. In particular, oligonucleotide stabilization can be accomplished via phosphate backbone modifications, phosphodiester modifications, phosphorothioate (PS) backbone modifications, combinations of phosphodiester and phosphorothioate modifications, thiophosphoramidate modifications, 2' modifications (2'- O-Me, 2'-O-(2-methoxyethyl) (MOE) modifications and 2'-fluoro modifications), methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof.

[0076] In a particular embodiment, the antisense oligonucleotide is lipid-conjugated, known as LASO. In some embodiments, the antisense oligonucleotide of the present invention is modified by substitution at the 3’ or the 5’ end by a moiety comprising at least three saturated or unsaturated, particularly saturated, linear or branched, particularly linear, hydrocarbon chains comprising from 2 to 30 carbon atoms, particularly from 5 to 20 carbon atoms, more particularly from 10 to 18 carbon atoms as described in WO2014 / 195432.

[0077] In some embodiments, the antisense oligonucleotide of the present invention is modified by substitution at the 3 ’ or the 5 ’ end by a moiety comprising at least one ketal functional group, wherein the ketal carbon of said ketal functional group bears two saturated or unsaturated, particularly saturated, linear or branched, particularly linear, hydrocarbon chains comprising from 1 to 22 carbon atoms, particularly from 6 to 20 carbon atoms, in particular 10 to 19 carbon atoms, and even more particularly from 12 to 18 carbon atoms as described in WO2014 / 195430.

[0078] For example, the oligonucleotide may be employed as phosphorothioate derivatives (replacement of a non-bridging phosphoryl oxygen atom with a sulfur atom), which have increased resistance to nuclease digestion. 2’ -methoxy ethyl (MOE) modification (such as the modified backbone commercialized by IONIS Pharmaceuticals) is also effective. Additionally or alternatively, the oligonucleotide of the present invention may comprise completely, partially or in combination, modified nucleotides which are derivatives with substitutions at the 2' position of the sugar, in particular with the following chemical modifications: O-methyl group (2'-O-Me) substitution, 2-methoxyethyl group (2'-0-M0E) substitution, fluoro group (2'- fluoro) substitution, chloro group (2'-Cl) substitution, bromo group (2'-Br) substitution, cyanide group (2'-CN) substitution, trifluoromethyl group (2'-CF3) substitution, OCF3 group (2'-OCF3) substitution, OCN group (2'-OCN) substitution, O-alkyl group (2'-O-alkyl) substitution, S-alkyl group (2'-S-alkyl) substitution, N-alkyl group (2'-N-akyl) substitution, O-alkenyl group (2'-O- alkenyl) substitution, S-alkenyl group (2'-S-alkenyl) substitution, N-alkenyl group (2'-N- alkenyl) substitution, SOCH3 group (2'-SOCH3) substitution, SO2CH3 group (2'-SO2CH3) substitution, ONO2 group (2'-ONO2) substitution, NO2 group (2'-NO2) substitution, N3 group (2'-N3) substitution and / or NH2 group (2'-NH2) substitution. Additionally or alternatively, the oligonucleotide of the present invention may comprise completely or partially modified nucleotides wherein the ribose moiety is used to produce locked nucleic acid (LNA), in which a covalent bridge is formed between the 2' oxygen and the 4' carbon of the ribose, fixing it in the 3'-endo configuration. These molecules are extremely stable in biological medium, able to activate RNase H such as when LNA are located to extremities (Gapmer) and form tight hybrids with complementary RNA and DNA.

[0079] In some embodiments, the oligonucleotide used in the context of the invention comprises modified nucleotides selected from the group consisting of LNA, 2’-0Me analogs, 2'-O-Met, 2'-O-(2-methoxyethyl) (MOE) oligomers, 2’-phosphorothioate analogs, 2’-fluoro analogs, 2’-Cl analogs, 2’-Br analogs, 2’-CN analogs, 2’-CF3 analogs, 2’-OCF3 analogs, 2’- OCN analogs, 2’-O-alkyl analogs, 2’-S-alkyl analogs, 2’-N-alkyl analogs, 2’-O-alkenyl analogs, 2’-S-alkenyl analogs, 2’-N-alkenyl analogs, 2’-SOCH3 analogs, 2’-SO2CH3 analogs, 2’- ONO2 analogs, 2’-NO2 analogs, 2’-N3 analogs, 2’-NH2 analogs, tricyclo (tc)-DNAs, U7 short nuclear (sn) RNAs, tricyclo-DNA-oligoantisense molecules and combinations thereof (U.S. Provisional Patent Application Serial No. 61 / 212,384 For: Tricyclo-DNA Antisense Oligonucleotides, Compositions and Methods for the Treatment of Disease, filed April 10, 2009, the complete contents of which is hereby incorporated by reference).

[0080] In a particular embodiment, the oligonucleotide according to the invention is a LNA oligonucleotide. As used herein, the term "LNA" (Locked Nucleic Acid) (or "LNA oligonucleotide") refers to an oligonucleotide containing one or more bicyclic, tricyclic or polycyclic nucleoside analogues also referred to as LNA nucleotides and LNA analogue nucleotides. LNA oligonucleotides, LNA nucleotides and LNA analogue nucleotides are generally described in International Publication No. WO 99 / 14226 and subsequent applications; International Publication Nos. WO 00 / 56746, WO 00 / 56748, WO 00 / 66604, WO 01 / 25248, WO 02 / 28875, WO 02 / 094250, WO 03 / 006475; U.S. Patent Nos. 6,043,060, 6268490, 6770748, 6639051, and U.S. Publication Nos. 2002 / 0125241, 2003 / 0105309, 2003 / 0125241, 2002 / 0147332, 2004 / 0244840 and 2005 / 0203042, all of which are incorporated herein by reference. LNA oligonucleotides and LNA analogue oligonucleotides are commercially available from, for example, Proligo LLC, 6200 Lookout Road, Boulder, CO 80301 USA.

[0081] Other forms of oligonucleotides of the present invention are oligonucleotide sequences coupled to small nuclear RNA molecules such as U1 or U7 in combination with a viral transfer method based on, but not limited to, lentivirus or adeno-associated virus (Denti, MA, et al, 2008; Goyenvalle, A, et al, 2004).

[0082] Other forms of oligonucleotides of the present invention are peptide nucleic acids (PNA). In peptide nucleic acids, the deoxyribose backbone of oligonucleotides is replaced with a backbone more akin to a peptide than a sugar. Each subunit, or monomer, has a naturally occurring or non-naturally occurring base attached to this backbone. One such backbone is constructed of repeating units of N-(2-aminoethyl)glycine linked through amide bonds. Because of the radical deviation from the deoxyribose backbone, these compounds were named peptide nucleic acids (PNAs) (Dueholm et al., New J. Chem., 1997, 21, 19-31). PNA binds both DNA and RNA to form PNA / DNA or PNA / RNA duplexes. The resulting PNA / DNA or PNA / RNA duplexes are bound with greater affinity than corresponding DNA / DNA, DNA / RNA or RNA / RNA duplexes as determined by Tm's. This high thermal stability might be attributed to the lack of charge repulsion due to the neutral backbone in PNA. The neutral backbone of the PNA also results in the Tm's of PNAZDNA(RNA) duplex being practically independent of the salt concentration. Thus the PNA / DNA(RNA) duplex interaction offers a further advantage over DNA / DNA, DNA / RNA or RNA / RNA duplex interactions which are highly dependent on ionic strength. Homopyrimidine PNAs have been shown to bind complementary DNA or RNA in an anti-parallel orientation forming (PNA)2 / DNA(RNA) triplexes of high thermal stability (see, e.g., Egholm, et al., Science, 1991, 254, 1497; Egholm, et al., J. Am. Chem. Soc., 1992, 114, 1895; Egholm, et al., J. Am. Chem. Soc., 1992, 114, 9677). In addition to increased affinity, PNA has also been shown to bind to DNA or RNA with increased specificity. When a PNA / DNA duplex mismatch is melted relative to the DNA / DNA duplex there is seen an 8 to 20° C. drop in the Tm. This magnitude of a drop in Tm is not seen with the corresponding DNA / DNA duplex with a mismatch present. The binding of a PNA strand to a DNA or RNA strand can occur in one of two orientations. The orientation is said to be anti-parallel when the DNA or RNA strand in a 5' to 3' orientation binds to the complementary PNA strand such that the carboxyl end of the PNA is directed towards the 5' end of the DNA or RNA and amino end of the PNA is directed towards the 3' end of the DNA or RNA. In the parallel orientation the carboxyl end and amino end of the PNA are just the reverse with respect to the 5 '-3' direction of the DNA or RNA. A further advantage of PNA compared to oligonucleotides is that their polyamide backbones (having appropriate nucleobases or other side chain groups attached thereto) is not recognized by either nucleases or proteases and are not cleaved. As a result, PNAs are resistant to degradation by enzymes unlike nucleic acids and peptides. W092 / 20702 describes a peptide nucleic acid (PNA) compounds which bind complementary DNA and RNA more tightly than the corresponding DNA. PNA have shown strong binding affinity and specificity to complementary DNA (Egholm, M., et al., Chem. Soc., Chem. Commun., 1993, 800; Egholm, M., et.al., Nature, 1993, 365, 566; and Nielsen, P., et.al. Nucl. Acids Res., 1993, 21, 197). Furthermore, PNA's show nuclease resistance and stability in cell-extracts (Demidov, V. V., et al., Biochem. Pharmacol., 1994, 48, 1309-1313). Modifications of PNA include extended backbones (Hyrup, B., et.al. Chem. Soc., Chem. Commun., 1993, 518), extended linkers between the backbone and the nucleobase, reversal of the amida bond (Lagriffoul, P. H., et.al ., Biomed. Chem. Lett., 1994, 4, 1081), and the use of a chiral backbone based on alanine (Dueholm, K. L, et.al., BioMed. Chem. Lett., 1994, 4, 1077). Peptide Nucleic Acids are described in U.S. Pat. No. 5,539,082 and U.S. Pat. No. 5,539,083. Peptide Nucleic Acids are further described in U.S. patent application No. 08 / 686,113.

[0083] Typically, the oligonucleotides of the present invention are obtained by conventional methods well known to those skilled in the art. For example, the oligonucleotide of the invention can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphorami dite method (Beaucage et al., 1981); nucleoside H-phosphonate method (Garegg et al., 1986; Froehler et al., 1986, Garegg et al., 1986, Gaffney et al., 1988). These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These nucleic acids may be referred to as synthetic nucleic acids. Alternatively, oligonucleotide can be produced on a large scale in plasmids (see Sambrook, et al., 1989). Oligonucleotide can be prepared from existing nucleic acid sequences using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases. Oligonucleotide prepared in this manner may be referred to as isolated nucleic acids. The one skilled in the art can easily provide some approaches and modifications for enhancing the delivery and the efficacy of oligonucleotides such as chemical modification of the oligonucleotides, lipid- and polymer-based nanoparticles or nanocarriers, ligand- oligonucleotide conjugates by linking oligonucleotides to targeting agents such as carbohydrates, peptides, antibodies, aptamers, lipids or small molecules and small molecules that improve oligonucleotide delivery such as described in Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48. Lipophilic conjugates and lipid conjugates include fatty acid-oligonucleotide conjugates; sterololigonucleotide conjugates and vitamin-oligonucleotide conjugates.

[0084] In a particular embodiment, the oligonucleotide of the present invention is conjugated to a second molecule. Typically said second molecule is selected from the group consisting of aptamers, antibodies or polypeptides. For example, the oligonucleotide of the present invention may be conjugated to a cell penetrating peptide. Cell penetrating peptides are well known in the art and include for example the TAT peptide (Bechara C, Sagan S. Cell-penetrating peptides: 20 years later, where do we stand? FEBS Lett. 2013 Jun 19;587(12): 1693-702).

[0085] In some embodiments, the oligonucleotide of the present invention is associated with a carrier or vehicle, e g., liposomes or micelles, although other carriers could be used, as would be appreciated by one skilled in the art. Liposomes are vesicles made of a lipid bilayer having a structure similar to biological membranes. Such carriers are used to facilitate the cellular uptake or targeting of the oligonucleotide, or improve the oligonucleotide's pharmacokinetic or therapeutic properties. For example, the oligonucleotide of the present invention may also be administered encapsulated in liposomes, pharmaceutical compositions wherein the active ingredient is contained either dispersed or variously present in corpuscles consisting of aqueous concentric layers adherent to lipidic layers. The oligonucleotide, depending upon solubility, may be present both in the aqueous layer and in the lipidic layer, or in what is generally termed a liposomic suspension. The hydrophobic layer, generally but not exclusively, comprises phospholipids such as lecithin and sphingomyelin, steroids such as cholesterol, more or less ionic surfactants such as diacetylphosphate, stearylamine, or phosphatidic acid, or other materials of a hydrophobic nature. The diameters of the liposomes generally range from about 15 nm to about 5 microns. The use of liposomes as drug delivery vehicles offers several advantages. Liposomes increase intracellular stability, increase uptake efficiency and improve biological activity. Liposomes are hollow spherical vesicles composed of lipids arranged in a similar fashion as those lipids, which make up the cell membrane. They have an internal aqueous space for entrapping water-soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver nucleic acids to cells and that the nucleic acids remain biologically active. For example, a liposome delivery vehicle originally designed as a research tool, such as Lipofectin, can deliver intact nucleic acid molecules to cells. Specific advantages of using liposomes include the following: they are nontoxic and biodegradable in composition; they display long circulation half-lives; and recognition molecules can be readily attached to their surface for targeting to tissues. Finally, cost-effective manufacture of liposome-based pharmaceuticals, either in a liquid suspension or lyophilized product, has demonstrated the viability of this technology as an acceptable drug delivery system.

[0086] In some embodiments, the oligonucleotide of the present invention is complexed with a complexing agent to increase cellular uptake of oligonucleotides. An example of a complexing agent includes cationic lipids. Cationic lipids can be used to deliver oligonucleotides to cells. The term “cationic lipid” includes lipids and synthetic lipids having both polar and non-polar domains and which are capable of being positively charged at or around physiological pH and which bind to polyanions, such as nucleic acids, and facilitate the delivery of nucleic acids into cells. In general cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. Straight-chain and branched alkyl and alkenyl groups of cationic lipids can contain, e.g., from 1 to about 25 carbon atoms. Particularly, straight chain or branched alkyl or alkene groups have six or more carbon atoms. Alicyclic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions) including, e.g., C1-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate. Examples of cationic lipids include: polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, Lipofectamine, DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif ). Cationic liposomes may comprise the following: N-[l-(2,3- dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[l-(2,3-dioleoloxy)- propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP), 3p-[N-(N ' ,N ' dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2,3,-dioleyloxy-N-

[0087] [2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), l,2-dimyristyloxypropyl-3-dimethy-l-hydroxyethyl ammonium bromide; and dimethyldioctadecylammonium bromide (DDAB). The cationic lipid N-(l-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), for example, was found to increase 1000-fold the antisense effect of a phosphorothioate oligonucleotide. (Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108). Oligonucleotides can also be complexed with, e.g., poly(L-lysine) or avidin and lipids may, or may not, be included in this mixture (e.g., steryl-poly(L-lysine). Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Pat. Nos. 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099; Lewis et al. 1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al. 1998. Molecular Membrane Biology 15:1). Other lipid compositions which can be used to facilitate uptake of the instant oligonucleotides can be used in connection with the claimed methods. In addition to those listed supra, other lipid compositions are also known in the art and include, e.g., those taught in U.S. Pat. No. 4,235,871; U.S. Pat. Nos. 4,501,728; 4,837,028; 4,737,323.

[0088] In a particular embodiment, the antisense oligonucleotide according to the invention comprises a sequence consisting of any sequences of SEQ ID NO:1 to SEQ ID NO:26.

[0089] In a particular embodiment, the antisense oligonucleotide according to the invention consists of a sequence consisting of any sequences of SEQ ID NO: 1 to SEQ ID NO:26.

[0090] In a particular embodiment, the antisense oligonucleotide is selected from the group consisting of SEQ ID NO:6, SEQ ID NO: 15, SEQ ID NO 22, SEQ ID NO 25 and SEQ ID NO:26.

[0091] In a particular embodiment, the antisense oligonucleotide is set forth as SEQ ID NO:22.

[0092] In a particular embodiment, the inhibitor and / or the antisense oligonucleotide according to the invention is capable of reducing the amount of HSPB5 in lung cells.

[0093] In a particular embodiment, the invention relates to an ASO having at least 70% of identity with an ASO of SEQ ID NO: 1 to SEQ ID NO:26. In a particular embodiment the percentage of identity can be 70; 71; 72; 73; 74; 75; 76; 77; 78; 79; 80; 81; 82; 83; 84; 85; 86; 87; 88, 89; 90; 91; 92, 93; 94; 95; 96, 97; 98; or 99%. Nucleic acid sequence identity is particularly determined using a suitable sequence alignment algorithm and default parameters, such as BLAST N (Karlin and Altschul, Proc. Natl Acad. Sci. USA 87(6):2264-2268 (1990)).

[0094] Vector of the invention

[0095] In a second aspect, the present invention relates to a vector for delivery of a heterologous nucleic acid, wherein the nucleic acid encodes an inhibitor according to the invention.

[0096] In a particular embodiment, the invention relates to a vector for delivery of a heterologous nucleic acid, wherein the nucleic acid encodes for an inhibitor according to the invention that specifically binds to HSPB5 mRNA and inhibits expression of HSPB5 in a cell.

[0097] In a particular embodiment, the vector according to invention, wherein the inhibitor is a siRNA or an antisense oligonucleotide as described above. In a further embodiment, the acid nucleic acid (e.g. antisense nucleic acid) of the invention may be delivered in vivo alone (naked ASO / LASO) or in association with a vector.

[0098] In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the oligonucleotide of the invention to the cells. Particularly, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, naked plasmids, non-viral delivery systems (cationic transfection agents, liposomes, lipid nanoparticles, and the like), phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the oligonucleotide sequences. Viral vectors include, but are not limited to nucleic acid sequences from the following viruses: RNA viruses such as a retrovirus (as for example moloney murine leukemia virus and lentiviral derived vectors), harvey murine sarcoma virus, murine mammary tumor virus, and rous sarcoma virus; adenovirus, adeno-associated virus (AAV); SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus. One can readily employ other vectors not named but known to the art.

[0099] Accordingly, an object of the invention relates to a vector comprising an oligonucleotide sequence that encodes a portion or fragment of HSPB5, or variants thereof.

[0100] In another embodiment, the vector of the invention comprises any variant of the oligonucleotide sequence that encodes a portion or fragment of HSPB5.

[0101] In another embodiment, the vector of the invention comprises any variant of the oligonucleotide sequence that encodes any variant of HSPB5.

[0102] In another embodiment, the invention relates to a vector comprising an antisense oligonucleotide sequence that encodes a portion or fragment of HSPB5, or variants thereof.

[0103] In another embodiment, the invention relates to a vector comprising a shRNA sequence that encodes a portion or fragment of the HSPB5, or variants thereof.

[0104] In another embodiment, the invention relates to a vector comprising a miRNA sequence that encodes a portion or fragment of HSPB5, or variants thereof.

[0105] In another embodiment, the vector according to the invention comprises an antisense oligonucleotide which targets the region selected from the list consisting of the nucleic acids 356-375; 536-555, 676-695, 736-755 and 756-775 of SEQ ID NO: 27.

[0106] In another embodiment, the invention relates to a vector comprising or consisting of any sequences from SEQ ID NO: 1 to SEQ ID NO:26. - l' l -

[0107] In another embodiment, the invention relates to a vector comprising or consisting of any sequences selected from the group consisting of SEQ IDNO:6, SEQ IDNO: 15, SEQ IDNO:22, SEQ ID NO:25 and SEQ ID NO 26.

[0108] In a particular embodiment, to a vector comprising or consisting of the sequences set forth as SEQ ID NO:22.

[0109] In another embodiment, the invention relates to a vector comprising an oligonucleotide sequence that encodes a portion or fragment of HSPB5, or variants thereof and a CAG promoter.

[0110] In another embodiment, the invention relates to a vector comprising a miRNA sequence that encodes a portion or fragment of HSPB5, or variants thereof and a CAG promoter or a PolII promoter.

[0111] In another embodiment, the invention relates to a vector comprising a shRNA sequence that encodes a portion or fragment of HSPB5, or variants thereof and a U6 promoter.

[0112] The variants include, for instance, naturally-occurring variants due to allelic variations between individuals (e.g., polymorphisms), alternative splicing forms, etc. The term variant also includes genes sequences of the invention from other sources or organisms. Variants are preferably substantially homologous to sequences according to the invention, i.e., exhibit a nucleotide sequence identity of typically at least about 75%, preferably at least about 85%, more preferably at least about 90%, more preferably at least about 95% with sequences of the invention. Variants of the genes of the invention also include nucleic acid sequences, which hybridize to a sequence as defined above (or a complementary strand thereof) under stringent hybridization conditions. Typical stringent hybridisation conditions include temperatures above 30° C, preferably above 35°C, more preferably in excess of 42°C, and / or salinity of less than about 500 mM, preferably less than 200 mM. Hybridization conditions may be adjusted by the skilled person by modifying the temperature, salinity and / or the concentration of other reagents such as SDS, SSC, etc.

[0113] In a particular embodiment, the vector use according to the invention is a non-viral vector or a viral vector.

[0114] In a particular embodiment, the non-viral vector is a plasmid comprising a nucleic acid sequence that encodes HSPB5.

[0115] In another particular embodiment, the vector may a viral vector.

[0116] Gene delivery viral vectors useful in the practice of the present invention can be constructed utilizing methodologies well known in the art of molecular biology. Typically, viral vectors carrying transgenes are assembled from polynucleotides encoding the transgene, suitable regulatory elements and elements necessary for production of viral proteins which mediate cell transduction.

[0117] As used herein, the term “transgene” refers to the antisense oligonucleotide of the invention.

[0118] The terms “gene transfer” or “gene delivery” refer to methods or systems for reliably inserting foreign DNA into host cells. Such methods can result in transient expression of nonintegrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e. g. episomes), or integration of transferred genetic material into the genomic DNA of host cells.

[0119] Such recombinant viruses may be produced by techniques known in the art, such as by transfecting packaging cells or by transient transfection with helper plasmids or viruses. Typical examples of virus packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc. Detailed protocols for producing such replication-defective recombinant viruses may be found for instance in WO95 / 14785, WO96 / 22378, US5,882,877, US6,013,516, US4,861,719, US5,278,056 and WO94 / 19478.

[0120] In a particular embodiment, the viral vector may be an adenoviral, a retroviral, a lentiviral, a herpesvirus or an adeno-associated virus (AAV) vectors.

[0121] In a particular embodiment, adeno-associated viral (AAV) vectors are employed.

[0122] In another embodiment, the invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence that targets a portion or fragment HSPB5, or variants thereof.

[0123] In one embodiment, the AAV vector is AAV1, AAV2, AAV3, AAV4, AA5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10 or any other serotypes of AAV that can infect human, rodents, monkeys or other species.

[0124] By an "AAV vector" is meant a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, e.g. the rep and / or cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are necessary for the rescue, replication and packaging of the AAV virion. Thus, an AAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e. g., functional ITRs) of the virus. ITRs do not need to be the wild-type polynucleotide sequences, and may be altered, e.g, by the insertion, deletion or substitution of nucleotides, so long as the sequences provide for functional rescue, replication and packaging. AAV expression vectors are constructed using known techniques to at least provide as operatively linked components in the direction of transcription, control elements including a transcriptional initiation region, the DNA of interest (i.e. the nucleic acid sequences of the invention) and a transcriptional termination region.

[0125] In certain embodiments the viral vectors utilized in the compositions and methods of the invention are recombinant adeno-associated virus (rAAV). The rAAV may be of any serotype, modification, or derivative, known in the art, or any combination thereof (e.g., a population of rAAV that comprises two or more serotypes, e.g., comprising two or more of rAAV2, rAAV8, and rAAV9) known in the art. In some embodiments, the rAAV are rAAVl, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAVIO, rAAV-11, rAAV-12, rAAV-13, rAAV-14, rAAV-15, rAAV-16, rAAV.rh8, rAAV.rhlO, rAAV.rh20, rAAV.rh39, rAAV.Rh74, rAAV.RHM4-l, AAV.hu37, rAAV.Anc80, rAAV.Anc80L65, rAAV.7m8, rAAV.PHP.B, rAAV2.5, rAAV2tYF, rAAV3B, rAAV.LK03, rAAV.HSCl, rAAV.HSC2, rAAV.HSC3, rAAV.HSC4, rAAV.HSC5, rAAV HSC6, rAAV.HSC7, rAAV.HSC8, rAAV HSC9, rAAV.HSClO , rAAV.HSCl 1, rAAV.HSC12, rAAV.HSC13, rAAV.HSC14, rAAV.HSC15, or rAAV.HSCl 6, or other rAAV, or combinations of two or more thereof.

[0126] In some embodiments, the rAAV used in the compositions and methods of the invention comprise a capsid protein from an AAV capsid serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-

[0127] 14, AAV-15, AAV-16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV comprise a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to e.g., vpl, vp2 and / or vp3 sequence of an AAV capsid serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-

[0128] 15, AAV-16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16. In certain embodiments, the AAV that is used in the methods described herein is Anc80 or Anc80L65, as described in Zinn et al., 2015: 1056-1068, which is incorporated by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein comprises one of the following amino acid insertions: LGETTRP (SEQ ID NO: 14) or LALGETTRP (SEQ ID NO: 15), as described in United States Patent Nos. 9,193,956; 9458517; and 9,587,282 and US patent application publication no. 2016 / 0376323, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is AAV.7m8, as described in United States Patent Nos. 9,193,956; 9,458,517; and 9,587,282 and US patent application publication no. 2016 / 0376323, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is any AAV disclosed in United States Patent No. 9,585,971, such as AAV-PHP.B. In certain embodiments, the AAV that is used in the methods described herein is any AAV disclosed in United States Patent No. 9,840,719 and WO 2015 / 013313, such as AAV.Rh74 and RHM4-1, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is any AAV disclosed in WO 2014 / 172669, such as AAV rh.74, which is incorporated herein by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is AAV2 / 5, as described in Georgiadis et al., 2016, Gene Therapy 23: 857-862 and Georgiadis et al., 2018, Gene Therapy 25: 450, each of which is incorporated by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is any AAV disclosed in WO 2017 / 070491, such as AAV2tYF, which is incorporated herein by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is AAVLK03 or AAV3B, as described in Puzzo et al., 2017, Sci. Transl. Med. 29(9): 418, which is incorporated by reference in its entirety. In certain embodiments, the AAV that is used in the methods described herein is any AAV disclosed in US Pat Nos. 8,628,966; US 8,927,514; US 9,923,120 and WO 2016 / 049230, such as HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, or HSC16, each of which is incorporated by reference in its entirety.

[0129] In certain embodiments, the AAV that is used in the methods described herein is an AAV disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: United States Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; US 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; and 9,587,282; US patent application publication nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335. In some embodiments, the rAAV have a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the vpl, vp2 and / or vp3 sequence of an AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: United States Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; US 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; and 9,587,282; US patent application publication nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCI7EP2015 / 053335.

[0130] In some embodiments, the rAAV have a capsid protein disclosed in Inti. Appl. Publ. No. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6), WO 2006 / 110689, (see, e.g., SEQ ID NOs: 5-38) W02009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31), W0 2010 / 127097 (see, e.g., SEQ ID NOs: 5-38), and WO 2015 / 191508 (see, e.g., SEQ ID NOs: 80-294), and U.S. Appl. Publ. No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10), the contents of each of which is herein incorporated by reference in its entirety. In some embodiments, the rAAV have a capsid protein at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e. up to 100% identical, to the vpl, vp2 and / or vp3 sequence of an AAV capsid disclosed in Inti. Appl. Publ. No. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6), WO 2006 / 110689 (see, e g., SEQ ID NOs: 5-38) W02009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31), W0 2010 / 127097 (see, e.g., SEQ ID NOs: 5-38), and WO 2015 / 191508 (see, e.g., SEQ ID NOs: 80-294), and U.S. Appl. Publ. No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10).

[0131] Nucleic acid sequences of AAV based viral vectors and methods of making recombinant AAV and AAV capsids are taught, for example, in United States Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; US 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; and 9,587,282; US patent application publication nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; International Patent Application Nos. PCT7US2015 / 034799; PCI7EP2015 / 053335; WO 2003 / 052051, WO 2005 / 033321, WO 03 / 042397, WO 2006 / 068888, WO 2006 / 110689, W02009 / 104964, WO 2010 / 127097, and WO 2015 / 191508, and U.S. Appl. Publ. No. 20150023924.

[0132] In additional embodiments, the rAAV comprise a pseudotyped rAAV. In some embodiments, the pseudotyped rAAV are rAAV2 / 8 or rAAV2 / 9 pseudotyped rAAV. Methods for producing and using pseudotyped rAAV are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001).

[0133] In additional embodiments, the rAAV comprise a capsid containing a capsid protein chimeric of two or more AAV capsid serotypes. In some embodiments, the capsid protein is a chimeric of 2 or more AAV capsid proteins from AAV serotypes selected from AAV 1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10 , AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16.

[0134] In certain embodiments, a single-stranded AAV (ssAAV) can be used. In certain embodiments, a self-complementary vector, e.g., scAAV, can be used (see, e.g., Wu, 2007, Human Gene Therapy, 18(2): 171-82, McCarty et al, 2001, Gene Therapy, Vol. 8, Number 16, Pages 1248-1254; and U.S. Patent Nos. 6,596,535; 7,125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety).

[0135] In certain embodiments, the recombinant AAV vector used for delivering the transgene have a tropism for cells in the DRG. Such vectors can include non-replicating “rAAV”, particularly those bearing an AAV8 or AAVrhlO capsid are preferred. In certain embodiments, the viral vectors provided herein are AAV9 or AAVrhlO based viral vectors. In certain embodiments, the AAV8 or AAVrhlO based viral vectors provided herein retain tropism for DRG. AAV variant capsids can be used, including but not limited to those described by Wilson in US Patent No. 7,906,111 which is incorporated by reference herein in its entirety, with AAV / hu.31 and AAV / hu.32 being particularly preferred; as well as AAV variant capsids described by Chatterjee in US Patent No. 8,628,966, US Patent No. 8,927,514 and Smith et al., 2014, Mol Ther 22: 1625-1634, each of which is incorporated by reference herein in its entirety.

[0136] In some embodiment, the present invention relates to a recombinant adeno-associated virus (rAAV) comprising (i) an expression cassette containing a transgene under the control of regulatory elements and flanked by ITRs, and (ii) an AAV capsid, wherein the transgene encodes an inhibitory RNA that specifically binds HSPB5 mRNA and inhibits expression of HSPB5 in a cell.

[0137] Provided in particular embodiments are AAV vectors comprising an artificial genome comprising (i) an expression cassette containing the transgene under the control of regulatory elements and flanked by ITRs; and (ii) a viral capsid that has the amino acid sequence of the AAV capsid protein or is at least 95%, 96%, 97%, 98%, 99% or 99.9% identical to the amino acid sequence of the AAV capsid protein while retaining the biological function of the AAV capsid.

[0138] Provided in particular embodiments are AAVrhlO vectors comprising an artificial genome comprising (i) an expression cassette containing the transgene under the control of regulatory elements and flanked by ITRs; and (ii) a viral capsid that has the amino acid sequence of the AAVrhlO capsid protein or is at least 95%, 96%, 97%, 98%, 99% or 99.9% identical to the amino acid sequence of the AAVrhlO capsid protein while retaining the biological function of the AAVrhlOcapsid. In certain embodiments, the encoded AAVrhlO capsid has the sequence of SEQ ID NO: 81 set forth in U.S. Patent No. 9,790,427 which is incorporated by reference herein in its entirety, with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid substitutions and retaining the biological function of the AAVrhlO capsid.

[0139] The control elements are selected to be functional in a mammalian cell. The resulting construct which contains the operatively linked components is flanked by (5’ and 3’) functional AAV ITR sequences. By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art-recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus. AAV ITRs, together with the AAV rep coding region, provide for the efficient excision and rescue from, and integration of a polynucleotide sequence interposed between two flanking ITRs into a mammalian cell genome. The polynucleotide sequences of AAV ITR regions are known. As used herein, an "AAV ITR" does not necessarily comprise the wild-type polynucleotide sequence, but may be altered, e. g., by the insertion, deletion or substitution of nucleotides. Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. Furthermore, 5' and 3' ITRs which flank a selected polynucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i. e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the heterologous sequence into the recipient cell genome when AAV Rep gene products are present in the cell. Additionally, AAV ITRs may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV 5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. Furthermore, 5' and 3' ITRs which flank a selected polynucleotide sequence in an AAV expression vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i. e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the DNA molecule into the recipient cell genome when AAV Rep gene products are present in the cell.

[0140] Particular embodiments are vectors derived from AAV serotypes having tropism for and high transduction efficiencies in cells of the mammalian DRG. A review and comparison of transduction efficiencies of different serotypes is provided in this patent application. In certain examples, AAV2, AAV5, AAV8, AAV9 and rh.10 based vectors direct long-term expression of transgenes in DRG.

[0141] The selected polynucleotide sequence is operably linked to control elements that direct the transcription or expression thereof in the subject in vivo. Such control elements can comprise control sequences normally associated with the selected gene.

[0142] Typically the vector of the present invention comprises an expression cassette. The term “expression cassette” refers to a nucleic acid construct comprising nucleic acid elements sufficient for the expression of the nucleic acid molecule of the present invention. Typically the nucleic acid molecule encodes a heterologous gene and may also include suitable regulatory elements. The heterologous gene refers to a transgene that encodes an RNA of interest.

[0143] One or more expression cassettes may be employed. Each expression cassette may comprise at least a promoter sequence operably linked to a sequence encoding the RNA of interest. Each expression cassette may consist of additional regulatory elements, spacers, introns, UTRs, polyadenylation site, and the like. In some embodiments, the expression cassette is polycistronic with respect to the transgenes encoding e.g. two or more miRNAs. In other embodiments the expression cassette comprises a promoter, a nucleic acid encoding one or more RNA molecules of interest, and a polyA. In further embodiments, the expression cassette comprises 5’ - promoter sequence, a sequence encoding a first RNA of interest, a sequence encoding a second RNA of interest, and a polyadenylation sequence- 3’.

[0144] In some embodiments, an expression cassette may comprise additional elements, for example, an intron, an enhancer, a polyadenylation site, a woodchuck posttranscriptional response element (WPRE), and / or other elements known to affect expression levels of the encoding sequence. Typically, an expression cassette comprises the nucleic acid molecule of the present invention operatively linked to a promoter sequence.

[0145] The term “operatively linked” refers to the association of two or more nucleic acid fragments on a single nucleic acid fragment so that the function of one is affected by the other.

[0146] For example, a promoter is operatively linked with a coding sequence when it is capable of affecting the expression of that coding sequence (e.g., the coding sequence is under the transcriptional control of the promoter). Encoding sequences can be operatively linked to regulatory sequences in sense or antisense orientation.

[0147] As used herein, the term “promoter” sequence refers to a polynucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene which is capable of binding RNA polymerase and initiating transcription of a downstream (3’- direction) coding sequence. Transcription promoters can include “inducible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), “repressible promoters” (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and “constitutive promoters”.

[0148] In some embodiments, the promoter is a heterologous promoter. The term “heterologous promoter”, as used herein, refers to a promoter that is not found to be operatively linked to a given encoding sequence in nature.

[0149] Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the phophoglycerate kinase (PKG) promoter, CAG (composite of the (CMV) cytomegalovirus enhancer the chicken beta actin promoter (CBA) and the rabbit beta globin intron), U6 promoter, neuronal promoters (Human synapsin 1 (hSyn) promoter, NeuN promoters, CamKII promoter, promoter of Dopamine- 1 receptor and Dopamine-2 receptor), the SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a CMV promoter such as the CMV immediate early promoter region (CMV-IE), rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. In addition, sequences derived from nonviral genes, such as the murine metallothionein gene, will also find use herein. Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, CA).

[0150] For purposes of the present invention, both heterologous promoters and other control elements, such as DRG-specific and inducible promoters, enhancers and the like, will be of particular use. An “enhancer” is a polynucleotide sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. In some embodiments, the promoter is derived in its entirety from a native gene. In some embodiments, the promoter is composed of different elements derived from different naturally occurring promoters. In some embodiments, the promoter comprises a synthetic polynucleotide sequence. It will be understood by those skilled in the art that different promoters will direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions or to the presence or the absence of a drug or transcriptional co-factor. Ubiquitous, cell-type- specific, tissue-specific, developmental stage-specific, and conditional promoters, for example, drug-responsive promoters (e.g. tetracycline-responsive promoters) are well known to those of skill in the art.

[0151] In mammalian systems, three kinds of promoters exist and are candidates for construction of the expression vectors: Pol I promoters control transcription of large ribosomal RNAs; Pol II promoters control the transcription of mRNAs (that are translated into protein) and small nuclear RNAs (snRNAs); and Pol III promoters uniquely transcribe small non-coding RNAs. Each has advantages and constraints to consider when designing the construct for expression of the RNAs in vivo. For example, Pol III promoters are useful for synthesizing small interfering RNAs (shRNAs) from DNA templates in vivo. For greater control over tissue specific expression, Pol II promoters are preferred but can only be used for transcription of miRNAs. When a Pol II promoter is used, however, it may be preferred to omit translation initiation signals so that the RNAs function as antisense, siRNA, shRNA or miRNAs and are not translated into peptides in vivo.

[0152] The AAV expression vector which harbors the DNA molecule of interest flanked by AAV ITRs, can be constructed by directly inserting the selected sequence (s) into an AAV genome which has had the major AAV open reading frames ("ORFs") excised therefrom. Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for replication and packaging functions. Such constructs can be designed using techniques well known in the art. See, e.g., U. S. Patents Nos. 5,173, 414 and 5,139, 941; International Publications Nos. WO 92 / 01070 (published 23 January 1992) and WO 93 / 03769 (published 4 March 1993). Alternatively, AAV ITRs can be excised from the viral genome or from an AAV vector containing the same and fused 5' and 3'of a selected nucleic acid construct that is present in another vector using standard ligation techniques. AAV vectors which contain ITRs have been described in, e.g., U. S. Patent No. 5,139,941. In particular, several AAV vectors are described therein which are available from the American Type Culture Collection ("ATCC") under Accession Numbers 53222, 53223, 53224, 53225 and 53226. Additionally, chimeric genes can be produced synthetically to include AAV ITR sequences arranged 5'and 3'of one or more selected nucleic acid sequences. Preferred codons for expression of the chimeric gene sequence in mammalian DRG cells can be used, and in certain embodiments codon optimization of the transgene is performed by well-known methods. The complete chimeric sequence is assembled from overlapping oligonucleotides prepared by standard methods. In order to produce AAV virions, an AAV expression vector is introduced into a suitable host cell using known techniques, such as by transfection. A number of transfection techniques are generally known in the art. Particularly suitable transfection methods include calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-velocity microprojectiles.

[0153] For instance, a particular viral vector comprises, in addition to a nucleic acid sequence of the invention, the backbone of AAV vector plasmid with ITR derived from AAV-2, the promoter, such as the mouse PGK (phosphoglycerate kinase) gene or the cytomegalovirus / p- actin hybrid promoter (CAG) consisting of the enhancer from the CMV immediate gene, the promoter, splice donor and intron from the chicken P-actin gene, the splice acceptor from rabbit P-globin, or any neuronal promoter such as the promoter of Dopamine- 1 receptor or Dopamine- 2 receptor, or the synapsin promoter, with or without the wild-type or mutant form of woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a rabbit betaglobin polyA sequence. The viral vector may comprise in addition, a nucleic acid sequence encoding an antibiotic resistance gene such as the genes of resistance ampicillin (AmpR), kanamycin, hygromycin B, geneticin, blasticidin S or puromycin.

[0154] In one embodiment, retroviral vectors are employed.

[0155] Retroviruses may be chosen as gene delivery vectors due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and for being packaged in special cell-lines. In order to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replicationdefective. In order to produce virions, a packaging cell line is constructed containing the gag, pol, and / or env genes but without the LTR and / or packaging components. When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into this cell line (by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media. The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types.

[0156] In another embodiment, lentiviral vectors are employed.

[0157] In a particular embodiment, the invention relates to a lentivirus vector comprising an oligonucleotide sequence that targets a portion or fragment of HSPB5, or variants thereof.

[0158] Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. The higher complexity enables the virus to modulate its life cycle, as in the course of latent infection. Some examples of lentivirus include the Human Immunodeficiency Viruses (HIV 1, HIV 2) and the Simian Immunodeficiency Virus (SIV). Lentiviral vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe. Lentiviral vectors are known in the art, see, e.g.. U.S. Pat. Nos. 6,013,516 and 5,994,136, both of which are incorporated herein by reference. In general, the vectors are plasmid-based or virus-based, and are configured to carry the essential sequences for incorporating foreign nucleic acid, for selection and for transfer of the nucleic acid into a host cell. The gag, pol and env genes of the vectors of interest also are known in the art. Thus, the relevant genes are cloned into the selected vector and then used to transform the target cell of interest. Recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference. This describes a first vector that can provide a nucleic acid encoding a viral gag and a pol gene and another vector that can provide a nucleic acid encoding a viral env to produce a packaging cell. Introducing a vector providing a heterologous gene into that packaging cell yields a producer cell which releases infectious viral particles carrying the foreign gene of interest. The env preferably is an amphotropic envelope protein which allows transduction of cells of human and other species. Typically, the nucleic acid molecule or the vector of the present invention include “control sequences”, which refers collectively to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.

[0159] Method for treating pulmonary fibrosis

[0160] In a third aspect, the invention relates to the inhibitor and / or the antisense oligonucleotide as described above for use in the treatment of pulmonary fibrosis in a subject in need thereof.

[0161] In a particular embodiment, the invention relates to a method for treating pulmonary fibrosis in a subject in need thereof comprising a step of administering said subject with a therapeutically effective amount of an inhibitor and / or the antisense oligonucleotide as described above.

[0162] As used herein, the term "Fibrotic interstitial lung diseases" or “Fibrotic ILD” or “Pulmonary Fibrosis” refers to a group of diseases affecting the pulmonary interstitium (the tissue and space between the air sacs of the lungs and lung capillaries). Fibrotic ILD refers to more than 200 chronic lung disorders. With fibrotic ILD, the tissue between the air sacs of the lungs (the interstitium) and the lung capillaries is affected by the accumulation of extracellular matrix rich in fibrillary collagens (fibrosis). It concerns alveolar epithelium, pulmonary capillary endothelium, basement membrane, perivascular and perilymphatic tissues. Fibrotic interstitial lung diseases (Fibrotic ILDs) and progressive pulmonary fibrosis (PPF) are defined in the review Marlies Wijsenbeek, and Vincent Cottin “ Spectrum of Fibrotic Lung Diseases “ N Engl J Med 2020;383:958-68.

[0163] As used herein, the term " progressive pulmonary fibrosis " or “(PPF)” among Fibrotic ILDs refers to a disease associated with worsening respiratory symptoms, a decline in lung function, a decreased quality of life, and a risk of early death, independent of the classification of the ILD.

[0164] In a specific embodiment progressive pulmonary fibrosis (PPF) is selected from the list consisting of Idiopathic pulmonary fibrosis (IPF), idiopathic non-specific interstitial pneumonia (NSIP), fibrotic ILD associated with inflammatory rheumatic disease such as rheumatoid arthritis, fibrotic ILD associated with autoimmune connective tissue disease such as systemic sclerosis, Sjogren’s syndrome, undifferentiated connective tissue disease, chronic hypersensitivity pneumonitis, drug induced pulmonary fibrosis, and lung fibrosis associated with unresolving acute respiratory distress syndrome (ARDS) including SARS-COV2 induced ARDS, sarcoidosis or others progressive pulmonary fibrosis. In a preferred embodiment Fibrotic ILD is progressive pulmonary fibrosis (PPF) such as Idiopathic pulmonary fibrosis (IPF).

[0165] As used herein, the terms “Idiopathic pulmonary fibrosis” or “IPF” means an interstitial lung disease for which no obvious cause can be identified (idiopathic), and which is associated with typical findings both radiographic (basal and pleural based fibrosis with honeycombing) and pathologic (usual interstitial pneumonia pattern comprising temporally and spatially heterogeneous fibrosis, histopathologic honeycombing and fibroblastic foci). In a particular embodiment, the method according to the invention wherein said antisense oligonucleotide is administered alone (naked) or in a vector as described above.

[0166] As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]). As used herein, the term “subject” denotes a mammal, such as a rodent, a feline, a canine, and a primate. Particularly, the subject according to the invention is a human, a mouse or a rat. As used herein, the term “subject” encompasses “patient”.

[0167] In a particular embodiment, the subject suffers or is susceptible to suffer from Fibrotic interstitial lung diseases (Fibrotic ILDs) and particularly progressive pulmonary fibrosis (PPF) diseases such as Idiopathic pulmonary fibrosis (IPF).

[0168] As used herein the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., an inhibitor of HSPB5 such as an ASO of the invention) into the subject, such as by, intravenous, intramuscular, enteral, subcutaneous, parenteral, systemic, local, spinal, nasal, topical or epidermal administration (e.g., by injection or infusion). When a disease, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease or symptoms thereof. When a disease or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease or symptoms thereof. In a particular embodiment, the administration is performed by a patch, a paste, an ointment, a suspension, a solution or a cream, a gel or a spray.

[0169] In a particular embodiment, the administration of the inhibitor and / or antisense oligonucleotide is performed by an intrathecal, subcutaneous, topical or intravenous administration.

[0170] In a further embodiment, i) an antisense oligonucleotide according to the invention and a ii) classical treatment for simultaneous, separate or sequential use in the treatment of n as a combined preparation.

[0171] As used herein, the term “classical treatment” refers to any compound, natural or synthetic. In a particular embodiment, the classical treatment is selected from the group consisting of but not limited to: aspirin, paracetamol, Nonsteroidal anti-inflammatory drugs (NSAIDs); codeine, cryotherapy, virtual therapy, cannabis, morphine and its derivatives, opium and its derivatives.

[0172] A “therapeutically effective amount” is intended for a minimal amount of active agent (e.g. ASO according to the invention) which is necessary to impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. It will be understood that the total daily usage of the compounds of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day.

[0173] Pharmaceutical composition

[0174] In a fourth aspect, the invention relates to a pharmaceutical composition which comprises the inhibitor and / or the antisense oligonucleotide according to the invention.

[0175] In a particular embodiment, the invention relates to the pharmaceutical composition according to the invention for use in the treatment of pulmonary fibrosis.

[0176] The inhibitor and / or the antisense oligonucleotide as described above may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions. "Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The pharmaceutical compositions of the present invention for per os (oral), sublingual, subcutaneous, intramuscular, intravenous, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to subjects, such as animals and human beings. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

[0177] In a particular embodiment, the pharmaceutical composition according to the invention is administered by an intratracheal, subcutaneous, aerosol, nasal, topical or intravenous or oral (per os, enteral) administration.

[0178] Typically, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile inj ectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The polypeptide (or nucleic acid encoding thereof) can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatine. Sterile injectable solutions are prepared by incorporating the active polypeptides in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation may be vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

[0179] In a particular embodiment, the present invention provides a topical formulation comprising antisense oligonucleotides. For example, and not by way of limitation, the present invention provides a topical formulation comprising antisense oligonucleotides. Dosage forms for the topical or transdermal administration of the inhibitors of the present invention include, but are not limited to, powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. In certain non-limiting embodiments, a topical formulation comprises antisense oligonucleotides comprised in micelles, liposomes, or non-lipid based microspheres. In certain non-limiting embodiments, such a topical formulation may comprise a permeability enhancing agent such as but not limited to dimethyl sulfoxide, hydrocarbons (for example, alkanes and alkenes), alcohols (for example, glycols and glycerols), acids (for example, fatty acids), amines, amides, esters (for example, isopropyl myristate), surfactants (for example, anionic, cationic, or non- ionic surfactants), terpenes, and lipids (for example, phospholipids).

[0180] In a particular embodiment, the formulation is a patch, a paste, an ointment, a suspension, a solution or a cream, a gel or a spray. In a particular embodiment, the formulation is a cream.

[0181] Pharmaceutical compositions of the present invention may comprise a further therapeutic active agent. The present invention also relates to a kit comprising an agonist, antagonist or inhibitor of the expression according to the invention and a further therapeutic active agent.

[0182] For example, anti- pulmonary fibrosis agents may be added to the pharmaceutical composition as described below.

[0183] Anti-pulmonary fibrosis agents may be pirfenidone and nintedanib (4).

[0184] Additional anti-pulmonary fibrosis agents may be selected from, but are not limited to, modulators targeting cytokines, chemokines, growth factors, tyrosine kinases, hormones, soluble receptors, decoy receptors, corticosteroids, monoclonal or polyclonal antibodies, mono- specific, bi-specific or multi-specific antibodies, monobodies, polybodies. i) In the present methods for treating pulmonary fibrosis the further therapeutic active agent can be an antifibrosis agent. Suitable antifibrosis agents include, but are not limited to treprostinil, an inhaled prostaglandin mimetic, ii) phosphodiesterase 4B (PDE4B) oral inhibitor BI- 1015550, iii) a LPA1 antagonist, BMS-986278. (These drugs are evaluated in phase 3 studies) iv) ., anti-CTGF antibodies.

[0185] In still another embodiment, the other therapeutic active agent can be an opioid or nonopioid analgesic agent (to treat the pulmonary fibrosis symptoms). Suitable opioid analgesic agents include, but are not limited to, morphine, heroin, hydromorphone, hydrocodone, oxymorphone, oxycodone, metopon, apomorphine, nomioiphine, etoipbine, buprenorphine, mepeddine, lopermide, anileddine, ethoheptazine, piminidine, betaprodine, diphenoxylate, fentanil, sufentanil, alfentanil, remifentanil, levorphanol, dextromethorphan, phenazodne, pemazocine, cyclazocine, methadone, isomethadone and propoxyphene. Suitable non-opioid analgesic agents include, but are not limited to, aspirin, celecoxib, rofecoxib, diclofinac, diflusinal, etodolac, fenoprofen, flurbiprofen, ibuprofen, ketoprofen, indomethacin, ketorolac, meclofenamate, mefanamic acid, nabumetone, naproxen, piroxicam and sulindac.

[0186] The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

[0187] FIGURES:

[0188] Figure 1: HSPB5 expression is associated with fibrosis development in pulmonary fibrosis patients.

[0189] HSPB5 expression correlates with A) ACTA2 expression in lung tissue from patients with IPF (data from GSE47460, n=160) and with B) COL 1 Al in fibroblasts derived from patients with IPF (data from GSE17978, n=38 right). Statistics: non-parametric Spearman (A) or parametric Pearson (B) correlation tests.

[0190] Figure 2: Screening of antisense oligonucleotides (ASO) based on HSPB5 inhibition in human fibroblastic cells (CCD-19Lu) in conditions of TGF-pi stimulation. mRNA levels of HSPB5 were evaluated by qRT-PCR (n=3-4). CCD-19Lu were treated 48h with TGF-pi (10 ng / mL) alone (NaCl) or with ASO targeting HSPB5 or the scramble sequence (Scr). Results are expressed as mean and SEM. *: p<0.05, nonparametric Mann- Whitney test.

[0191] Figure 3: Effects of ASO22 on HSPB5 and mesenchymal markers expression of pulmonary cells.

[0192] A) Protein expression tested by western blot in CCD-19Lu (data representative of n=6 western blots) and B) the associated densitometric analysis of collagen expression (relative to TGF-pi condition). C) Quantification of a-SMA immunofluorescence staining performed in CCD-19Lu. D) Protein expression tested by western blot in A549 (data representative of n=5 western blots). mRNA level tested by RT-qPCR (n=8-9) of HSPB5, ACTA2 and SERPINEJ in E) CCD-19Lu and F) A549. Cells were transfected or not with ASO22 (100 ng / mL) or control scramble (Scr, 100 ng / mL) and treated or not with TGF-pi (10 ng / mL). Results are expressed as medians and interquartile range; *P<0,05, **P < 0.01, ***P < 0.001 non-parametric Mann- Whitney test.

[0193] Figure 4. Downregulation of HSPB5 expression attenuates the TGF-pi-induced increase in cell motility. In vitro wound healing assay of A549 cells treated or not with TGF- pi (10 ng / mL) after transfection with ASO22 or scramble (Scr) (100 ng / mL). Quantification of the scratch area was normalized to 0 hour for each group as 100%. Results are expressed as medians and range (n=3). Statistical comparisons: TGF- i + Scr vs TGF-pi + ASO22 (nonparametric ANOVA, P < 0.01 followed by Tukey’s multiple comparison test at 48h, 60h, 72h, * P< 0,05; ** P< 0,01).

[0194] Figure 5: Intravenous ASO22 hampers BLM-induced fibrosis development. (A) Representative images of lung sections of mice, 21 days after i.t. instillation of bleomycin or NaCl, with or without ASO22 or control scramble. (Hematoxylin-Eosin staining). The mice were treated every other day (D) from D9 to D21 by intravenous injections of either control scramble (Scr 6, 12, 18 mg / kg) or ASO22 (6, 12, 18 mg / kg). (B) Collagen quantification using Sircol Assay on the left lung. (C) mRNA levels of Hspb5, Col lai and Acta2 were analyzed by quantitative PCR in the lung tissue. Results are expressed as median with interquartile range (n=4-8 per group); *P < 0.05, **P < 0.01, non-parametric Mann-Whitney test.

[0195] Figure 6: Intra-tracheal injection of ASO22 hampers BLM- induced fibrosis development. (A) Representative images of lung sections of mice, 21 days after i t. instillation of bleomycin, and ASO22 or control scramble treatment (Hematoxylin-Eosin Staining). The mice were treated at day (D)3, D6, D15 and D18 by intra-tracheal injection of either NaCl, control scramble (Scr) or ASO22 at 12 mg / kg. Collagen quantification using (B) Sircol Assay on the left-lung and (C) Picosirius red staining of lung sections of mice. (D) mRNA levels of Hspb5, Collal and Acta2 were analyzed by quantitative PCR in lung tissues of the same animals. Results are expressed as median with interquartile range (n=5-10 per group); *P < 0.05, **P < 0.01, non-parametric Mann-Whitney test.

[0196] Figure 7: Cy5-ASO22 accumulates in the lung after intravenous ou intra-tracheal injection.

[0197] Fluorescence intensity on mouse organs 24h and 48h after i.v. (A) or i.t. (B) administration of Cyanine 5-ASO22 (i.v., n=5 / group, i.t. n= 6-7 per group). Two factor ANOVA analysis followed by the Tuckey test: * P<0.05 for comparison of 24h vs 48h post-intravenous administration.

[0198] EXAMPLE:

[0199] Material & Methods

[0200] Design of antisense oligonucleotides

[0201] To design the antisense oligonucleotides (ASOs) targeting the entire HSPB5 mRNA (accession number gene bank: NM_001885), a specific R software package was developed by Pascal Finetti and Palma Rocchi (PDA16130, 2017). This program uses the sequence of the transcripts of the gene of interest in FASTA format. Firstly, the gene coding part of interest is selected and segmented into consecutive sequences of 20 bases. Subsequently, to define potential ASOs sequences, this software identifies the complementary sequences of the resulting sequences and reverses them to 5'-3' direction. In a second step, the ASOs are selected according to their percentage of GC (40-60%) and their specificity to the gene of interest sequence transcripts. Specificity is determined using the NCBI Basic Local Alignment Search Tool (BLAST), the 'blastn' algorithm and the NCBI reference transcript database 'refseq ma'. The output of the program gives information about the ASO list sequences with their GC level and genes list with significant similarity. Final selection is done manually excluding ASOs showing sequence similarities to other genes (supplemental methods table 1)

[0202] The selected ASO22 sequence corresponding to the HSPB5 mRNA at position 676 and cross-reacting with human and mouse, was 5’-CCATTCACAGTGAGGACCCC-3’(SEQ N°22), whereas the scramble control sequence was 5'-CGTGTAGGTACGGCAGATC-3' (SEQ N°28).

[0203] Synthesis of Oligonucleotides

[0204] Oligonucleotide molecules were synthesized on an automated AKTA OP10 (GE Healthcare) at 40 pmol scale on primer support (loading 350 pmol / g, GE Healthcare, crosslinked polystyrene). Conventional -cyanoethyl phosphorami di te chemistry was used. Phosphorothioate linkage was introduced during the synthesis cycle with Sulfurizing Reagent II (3-((N,N-dimethylaminomethylidene)amino)-3H-l,2,4-dithiazole-5-thione from Glen Research). The deprotection was realized in an ammoniac solution during 4 hours at 55 °C.

[0205] Desalting against a 9% NaCl solution was performed in a 1 kD MWCO membrane (Spectra / Por 6 pre-wetted RC tubbing) to remove the deprotection groups’ residues and the most of the aborted sequences. All ONs were injected before and after desalting on an analytical HPLC (Elite LaChrom system, Hitachi, Japan).

[0206] To analyse ON, the reverse-phase hydrophobic column Xbridge oligonucleotide BEH C18 (4.6 x 50 mm, 2.5 pm, 130 A, Waters, USA) was used at a flow rate of 2.4 mL.min'1for 15 min All molecules were controlled by mass spectrometry before freeze-drying.

[0207] The quantification was obtained using a micro-volume spectrophotometer (mySPEC, VWR, USA) at 260 nm. (data not shown)

[0208] Cell culture

[0209] For all ASO treatments, human lung epithelial A549 cells (ATCC, CCL-185) and human pulmonary fibroblastic CCD-19Lu cells (ATCC, CCL210) at 50-60% density were transfected with ASOs, 24h after cell seeding. ASOs at 100 nM were pre-incubated for 25 min with 3,75 pL TransIT-X2® Dynamic Delivery System (Mirus Bio LLC, USA) in 250 JJ.1 of Gibco Opti-MEM, a serum-reduced medium (Life Technologies SAS, Courtaboeuf, France) before being added drop by drop to the cells in their complete growth medium containing 10% foetal bovine serum (FBS). Following 8h incubation, the medium containing ASOs and Transit- X2 was replaced with the 0% FBS DMEM (A549) or MEM (CCD-19Lu) medium overnight before being stimulated 48h with recombinant human TGF-pi (rTGF- 1 R&D systems, Minneapolis, MN) in complete medium at 10 ng / mL.

[0210] Animal experiments

[0211] All animal studies were conducted in accordance with the legislation on the use of laboratory animals (directive 2010 / 63 / EU) and were approved by accredited Ethical committee (CEEA, Grand Campus n°105) and the French Ministries of Research and Agriculture (project #20745). Eight- week-old female C57 / B16 mice received at Day (D) 0 a single intra-tracheal injection of 1.5 mg / kg of BLM (Santa Cruz biotechnology, USA) or NaCl (Controls) under anaesthesia (3% isoflurane). Depending on the experiments, animals were treated with oligonucleotides (ASO22 or the scramble sequence) by intra-tracheal or intravenous injection, from D3 to DI 8 or from D9 to D21, respectively (33). When indicated animals were treated with ASO22 at 6, 12 or 18 mg / kg. At day 21, mice were euthanized by abdominal aortic bleeding during deep anesthesia. Lungs were collected for histological, transcriptomics and collagen quantification analyses. Blood was collected and plasma separated by centrifugation for quantification of liver and renal markers.

[0212] For the biodistribution experiment, 12 days after bleomycin injection, animals (5 / group) were treated with ASO22 fluorescently labeled using Cyanine 5 (Cyanine 5-ASO22) at a dose of 200 pg by i.v. or i.t. injection. After 24h or 48h, animals were euthanized by cervical dislocation following deep anesthesia (isoflurane 5%, 5 minutes). Seven organs (brain, heart, lungs, kidneys, liver, spleen, muscle) were removed and imaged (exposure time of 8 seconds). Data were collected using IVIS lumina III (Revvity). The resulting images were processed with Living image software (Revvity).

[0213] Collagen quantification

[0214] Histomorphometric assay - The amount of collagen in paraffin-embedded tissue sections was quantified by Picrosirius Red staining as previously described (34).

[0215] Colorimetric assay - The sircol assay was performed on lung left lobe extracts using the “Sircol kit” (Biocolor Ltd., Carrickfergus, UK) and following the manufacturer’s recommendations. Results were expressed as pg collagen / mg lung.

[0216] Human microarrav data Public available microarray datasets were downloaded from the Gene Expression Omnibus portal of the NCBI (https: / / www.ncbi.nlm.nih.gov / geo / ). Microarray data from lung tissue of the Lung Tissue Research Consortium was performed and analyzed, as described by Kim et al. (35). Gene expression from non-cultured pulmonary fibroblasts was analyzed as described by Emblom-Callahan et al. (GSE17978) (36). Gene expression values were extracted from the GSE files and used without additional analysis.

[0217] Quantitative PCR analysis

[0218] Total RNA from lung tissue was extracted with Trizol (Invitrogen). Shortly, 300 ng of total RNA were transcribed into cDNA by M-MLV reverse transcriptase with random primers in the presence of RNaseOUT RNAse inhibitor (Invitrogen). cDNAs were quantified by realtime PCR with a SYBR Green Real-time PCR kit (Applied Biosystems) on a Viaa7 detection system (Applied Biosystems, France). Relative mRNA levels were determined with the AACt method. Oligonucleotides used for RT-qPCR are described in supplemental methods.

[0219] Western Blot

[0220] Samples were prepared in a classical loading buffer and loaded on SDS-PAGE gel before being transferred onto a PVDF membrane (GE Healthcare Europe GmbH) in an ethanol- supplemented glycin buffer. Membranes were saturated with TBS-Tween 0.1% Milk 5% solution for 45 min before overnight incubation at 4 °C with primary antibodies: PAI-1 (NBP1- 19773, dilution of 1 : 1000, Novus biological), collagen (dilution of 1:1000, HPA008405, Sigma), fibronectin (NBP1-91258, dilution of 1: 1000, Novus biological), a-SMA (ab5694, dilution of 1:1000, Abeam), -actin (A1978, dilution of 1 :1000, Sigma) and rabbit HSPB5 (ADI-SPA-223, dilution of 1 :1000, Enzolife). Secondary antibodies used for revelation were conjugated to HRP (Jackson ImmunoResearch, Cambridge, UK). Data acquisition was performed using a chemiluminescent reagent (Western Blotting Luminol Reagent, Santa Cruz Biotechnology) on Chemi-Doc XRS Imaging System (Bio-Rad).

[0221] Liver and renal markers quantification

[0222] The plasma levels of serum Alanine Aminotransferase (ALT), Aspartate Aminotransferase (AST) and Urea were determined using Siemens Atellica CH analyzers.

[0223] Statistical analysis

[0224] Comparison between groups were performed using the Mann-whitney non-parametric test. For testing the concentrations-dependent effects of ASO22 on cell motility, we performed a non-parametric ANOVA associated with Tukey’s multiple comparison test. Results are presented as median with inter-quartile range. A p<0.05 was considered significant (*p<0.05,

[0225] **p<0.01, ***p<0.001). Results

[0226] HSPB5 is associated with fibrosis development in patients with idiopathic pulmonary fibrosis

[0227] We previously demonstrated that HSPB5 was overexpressed in the lungs of mice developing pulmonary fibrosis, and was actively involved in collagen accumulation (11). To substantiate the relevance of these results in patients, we investigated the association of HSPB5 expression with fibrosis markers in two publicly available transcriptomic datasets. In lung biopsies from patients with idiopathic pulmonary fibrosis (GSE47460, n=160), HSPB5 expression was significantly correlated with the expression of an IPF-related 14-gene signature derived from a meta-analysis of IPF transcriptomic studies (Gangwar et al., 2017) and with ACTA2. In patient-derived lung fibroblasts (GSE17978, n=38), HSPB5 expression also correlates with COL1A1 expression (Figure 1).

[0228] Design and selection of antisense oligonucleotides inhibiting human and murine HSPB5

[0229] A total of 26 ASOs targeting HSPB5 were designed as described in material and methods. Their efficiency to inhibit HSPB5 protein and mRNA expression induced by TGF-pi was screened in CCD-19Lu cells. At the mRNA level, three ASO (ASO5, 22 and 25) showed a significant inhibitory effect on HSPB5 expression (Figure 2). At the protein level, four ASOs reproducibly inhibited HSPB5 expression (data not shown) among which one (ASO6) was specific to human HSPB5 while three (ASO15, 22 and 26) were characterized by their crossreactivity with both human and murine HSPB5. Since among them ASO22 was the most efficient to inhibit human and mouse HSPB5 both at the mRNA and protein levels, this ASO was used in the following experiments in vitro and in vivo.

[0230] ASO22 inhibits TGF-PI downstream signaling in pulmonary human cells.

[0231] In lung fibroblast CCD-19Lu cells, ASO22 (100 ng / mL) inhibited the TGF-pi -induced expression of HSPB5, as well as PAI-1, collagen, fibronectin and a-SMA (Figure 3A, B). The effects of ASO22 on a-SMA expression were confirmed by immunofluorescence (Figure 3C). Similarly, ASO22 decreased HSPB5, ACTA2 and SERPINE1 gene expression upon TGF-pi stimulation (Figure 3D). Consistently, in lung alveolar A549 cells, the TGF-pi -induced expression of HSPB5, PAI-1 (SERPINE1), a-SMA (ACTA2) were inhibited by ASO22 at the protein and mRNA levels (Figure 3 E, F).

[0232] ASO22 attenuates TGF-PI -induced cells motility

[0233] To assess the effect of ASO22 on cell migration, a wound-healing assay was performed on A549 cells. As expected, TGF-pi increased cell migration towards the center of the scratch. Compared to our scrambled ASO, ASO22 treatment significantly attenuated TGF-pi -induced cell motility within 48 hours after stimulation (Figure 4).

[0234] ASQ22 limits bleomycin-induced fibrosis.

[0235] ASO22 or a control scramble ASO were administered intravenously (i.v.) in a dosedependent manner (6-12-18 mg / kg) in our model of bleomycin-induced lung fibrosis every other day from D9 to D21 after BLM or NaCl intra-tracheal (i.t.) administration (Figure 5).

[0236] As expected, the control scramble ASO did not have any effect on the alveolar architecture and on collagen accumulation neither in non-fibrotic mice (i.t. NaCl) nor in fibrotic mice (i.t. bleomycin). On the contrary, ASO22 restrained the remodeling of the alveolar structure as suggested by H&E staining of lung sections (Figure A). This result was completed using a Sircol assay demonstrating a decrease in collagen accumulation in ASO22-treated mice compared to the respective control scramble ASO (fold decrease of 1.41; 1.56; 1.49 for BLM mice treated with 6, 12 or 18 mg / kg of ASO22 compared to mice treated with 6, 12 or 18 mg / kg of ASO scramble, Figure 5B). Similar results were observed using Picrosirius red staining (data not shown). Moreover, the BLM-induced increase in Hspb5, Col lai and Acta2 mRNA expression in lung tissue was significantly reduced in ASO22-treated mice compared to saline and control scramble ASO treated mice at 12 mg / kg (fold decrease of 1.83; 2.49; 1.28 for BLM mice treated with 6, 12 or 18 mg / kg of ASO22 compared to mice treated with 6, 12 or 18 mg / kg of scramble, Figure 5C).

[0237] ASO22 does not induce liver or kidney toxicity in mice

[0238] We next explored the safety profile of i.v. ASO22 or control scramble ASO (6, 12 or 18 mg / kg) in healthy mice by following the weight change, plasmatic transaminases as hepatic function markers and plasmatic urea as a renal marker. ASO22 or control scramble ASO administration did not induce any significant modification of the weight gain profile compared to the control animals treated with NaCl (data not shown). Further, control scramble ASO and ASO22 treatment did not induce either significant changes in hepatic alanine aminotransferase (ALT) aspartate aminotransferase (AST) or urea levels (data not shown).

[0239] Intra-tracheal ASO22 hampers the development of BLM-induced fibrosis.

[0240] To assess ASO22 efficacy when directly distributed to the lungs, ASO22 was administered 4 times from day 3 to day 18 post-BLM, directly in the lung via i.t. injection. Twenty-one days after bleomycin-treatment, mice which received i.t. ASO22 showed limited pulmonary alveolar structure remodeling and decreased collagen accumulation throughout the lungs compared with fibrotic mice which received saline or the control scramble ASO (Figure 6A). Accordingly, quantification by Sircol assay showed a significant decrease in collagen lung content in fibrotic mice receiving ASO22 compared with those receiving saline or control scramble ASO (1.4 and 1.7 fold decrease respectively) (Figure 6B). This result was confirmed using Picrosirius red staining of lung sections (1.93- and 1.94-fold decrease respectively, Figure 6C). Furthermore, the BLM-induced expression of Collal, Acta2, Hspb5 (Figure 6D) and Serpinel, Lefl and Mmp2 (data not shown) mRNA expression in lungs was also significantly reduced in ASO22-treated mice compared to mice injected with control scramble ASO.

[0241] ASO distribution in pulmonary tissues

[0242] We studied in vivo in our mouse model of bleomycin-induced lung fibrosis, ASO22 biodistribution upon its systemic i.v. administration or by the intratracheal (i.t.) route. Cyanine-5- ASO22 was administrated, at day 12 post-bleomycin injection. Labeling of the fluorescence in mouse organs 24 and 48h post-Cyanine5-ASO22 administration showed that i.v. ASO22 distributed strongly in lung tissues, and that this distribution decreased 2-fold from 24 to 48h post-administration. When administered by the intratracheal (i.t.) route, Cyanine-5-ASO22 distribution was also mainly distributed within the lungs with no decrease when comparing 24 and 48h (Figure 7).

[0243] Discussion

[0244] TGF-P 1 signaling is a seminal pathway involved in a large panel of pathologies from fibrotic disorders to cancer (15, 16). Consequently, the inhibition of TGF-pi signaling has been extensively investigated leading to the development of many inhibitors targeting the cytokine itself or its receptors. However, clinical studies in cancer have demonstrated that these molecules had mitigated efficacy and sometimes an unacceptable toxicity (17), due to the pleiotropic properties of TGF-pi. Therefore, research is now focused on upstream or downstream events and regulatory mechanisms of TGF-pi signaling (17). In the fibrosis field, different strategies have been developed in the last decade (18) such as the inhibition of the av 6 integrin, involved in TGF-pi activation, which successfully restrains fibrosis development in preclinical models and is being tested in patients with lung fibrosis (1 , 20). In addition, HSPs have also been reported as critical regulators of the TGF-pi signaling (11, 21). Notably, inhibitors of HSP90, a chaperon of the type I TGF- receptor, have been tested in preclinical models of lung fibrosis and hold promise to counteract TGF-P 1 signal in IPF (22). We previously demonstrated that HSPB5, a small HSP that regulates TGF-pi signaling through the promotion of SMAD4 nuclear location, was overexpressed in myofibroblasts and hyperplastic alveolar epithelial cells in IPF patients (11). Furthermore, the lack of HSPB5 in mice significantly reduced pulmonary fibrosis development in different animal models (11). In the present study, we observed using the LTRC cohort including 255 IPF patients that HSPB5 expression was associated with fibrosis development, further substantiating the clinical relevance of targeting HSPB5.

[0245] With the aim of developing specific HSPB5 inhibitors, we show here for the first time that HSPB5 can be targeted both in vitro and in vivo by silencing oligonucleotides. Our screening based on the inhibition of HSPB5 expression at both RNA and protein levels allowed us to identify ASO22. It reproductively inhibited HSPB5 expression in human cell lines of alveolar epithelial cells and human pulmonary fibroblasts, as well as their differentiation into myofibroblasts induced by TGF- 1.

[0246] ASO22 was also efficient to limit pulmonary fibrosis progression in the murine bleomycin model, when applied both systemically (intravenous) or locally (intra-tracheal administration). ASO22 significantly reduced collagen accumulation and lung architecture disorganization, and this was associated with a reduction of HSPB5 expression in lung tissues. These results are consistent with those of Tanguy et al. (23) that demonstrated that the chemical molecule NCI-41356, reported among other things to inhibit HSPB5, was able to limit TGF- pi signaling and the lung fibrosis in a BLM mice model, thus supporting the concept of HSPB5 as an antifibrotic therapeutic target. In what concerns the use of a RNA silencing strategy for a more specific targeting, Wettstein et al. (10) demonstrated the effects of OGX427, an ASO directed against HSPB1 and its efficiency to reduce pulmonary fibrosis in rats, and Park et al. (24) showed that Hspbl -specific siRNA effectively suppressed experimental pulmonary fibrosis in mice.

[0247] In contrast to the experiments in cultured cells that required the transfection of the ASO, in vivo experiments were performed by direct delivery of the oligonucleotides by either i.v. or i.t. route. ASOs are usually described as having limited biodistribution following systemic administration (25) and one of the greatest challenges in ASO therapies is the delivery of the drug to the site of action. One possible explanation of the efficacy of ASO22 observed after its systemic administration may be due because we added a phosphorothioate backbone, which gives nuclease resistance and favors binding to proteins in the plasma compared to classic ASO (26). Such interactions, for example with the albumin, can decrease its clearance and thus promote ASO half-life in the circulation. Noteworthy, on the pharmacodynamic aspect, the phosphorothioate backbone modifications are well tolerated in ASO structure and does not modified the action of RNase H. Also, recent studies using ASO LNA gapmers featuring a similar phosphorothioate chemistry as the one we have used for ASO22 have demonstrated their non-immunogenicity and safety after intranasal delivery (27). Local administration of ASO, for example by aerosol has been extensively studied. For instance, Crosby et al. (28) showed a good distribution in airway epithelial cells of an inhaled ASO targeting ENaC or the anti-inflammatory efficacy of an aerosolized ASO targeting CD86 in a mouse asthma model (29). Here, we also demonstrated the efficacy of ASO22 locally (i.t.) administered, and our next objective will be to study the possibility to administrate ASO22 by aerosol. Another strategy to improve ASO biodistribution can be the use of liposomal ASO nanoparticles (30). This strategy may certainly improve the concentration-effect relationship of our compound.

[0248] Gene-targeting ASOs have been extensively studied in cancer, mostly in combination with other compounds, such as chemotherapeutic agents, and have been shown to have synergistic anti -neoplastic effects in several tumor models (31). In the context of pulmonary fibrosis, the field moves forward and is also looking to implement combinatorial therapies for optimal patient management (32). Testing the efficacy of HSPB5 targeting ASO in combination with already approved drugs is a perspective of our current work. It is worth noting that our preliminary experiments did not show any sign of toxicity of the ASOs at the concentrations used in this study, although further studies are needed to complete the characterization of ASO22 safety profile.

[0249] All in all, the current study describes the development of an ASO that specifically inhibits HSPB5 and mitigates fibrosis progression in preclinical models, via the inhibition of the TGF-pi pathway. We provide a proof of concept underlining the efficacy of HSPB5- targeting ASOs to modulate TGF-P 1 signaling. Further research is needed to test the rational of proposing ASO22 in other diseases beyond pulmonary fibrosis.

[0250] REFERENCES:

[0251] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

[0252] 1. Wynn TA. Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J Clin Invest. 2007;l 17(3):524-9.

[0253] 2. WijsenbeekM, and Cottin V. Spectrum of Fibrotic Lung Diseases. N Engl J Med. 2020;383(10):958-68.

[0254] 3. Martinez FJ, et al. The diagnosis of idiopathic pulmonary fibrosis: current and future approaches. Lancet Respir Med. 2017;5(l):61-71.

[0255] 4. Raghu G, and Richeldi L. Current approaches to the management of idiopathic pulmonary fibrosis. Respir Med. 2017;129:24-30.

[0256] 5. Burgy O, et al. Pathogenesis of fibrosis in interstitial lung disease. Curr Opin Pulm Med. 2020;26(5):429-35.

[0257] 6. Wang F, et al. Regulation of epithelial transitional states in murine and human pulmonary fibrosis. J Clin Invest. 2023; 133(22).

[0258] 7. Su J, et al. TGF-beta orchestrates fibrogenic and developmental EMTs via the RAS effector RREB1. Nature. 2020;577(7791):566-71.

[0259] 8. Massague I, and Sheppard D. TGF-beta signaling in health and disease. Cell. 2023;186(19):4007-37.

[0260] 9. Bonniaud P, et al. TGF-beta and Smad3 signaling link inflammation to chronic fibrogenesis. J Immunol. 2005;175(8):5390-5.

[0261] 10. Wettstein G, et al. Inhibition of HSP27 blocks fibrosis development and EMT features by promoting Snail degradation. FASEB J. 2013.

[0262] 11. Bellaye PS, et al. The small heat-shock protein alphaB-crystallin is essential for the nuclear localization of Smad4: impact on pulmonary fibrosis. J Pathol. 2014;232(4):458-72.

[0263] 12. Sontake V, et al. Hsp90 regulation of fibroblast activation in pulmonary fibrosis. ICI Insight. 2017;2(4):e91454.

[0264] 13. Spigel DR, et al. A Randomized, Double-Blinded, Phase II Trial of Carboplatin and Pemetrexed with or without Apatorsen (OGX-427) in Patients with Previously Untreated Stage IV Non-Squamous-Non-Small-Cell Lung Cancer: The SPRUCE Trial. Oncologist. 2019;24(12):el409-el6. 14. Ko AH, et al. A Randomized, Double - Blinded, Phase II Trial of Gemcitabine and Nab - Paclitaxel Plus Apatorsen or Placebo in Patients with Metastatic Pancreatic Cancer: The RAINIER Trial. The Oncologist. 2017;22(12): 1427-el29.

[0265] 15. Massague J. TGFbeta in Cancer. Cell. 2008;134(2):215-30.

[0266] 16. Border WA, and Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med. 1994;331(19): 1286-92.

[0267] 17. Huynh LK, et al. A Perspective on the Development of TGF-beta Inhibitors for Cancer Treatment. Biomolecules. 2019;9(l 1).

[0268] 18. Burgy O, et al. Targeting the nasty nestin to shoot lung fibrosis. Eur Respir J. 2022;59(5).

[0269] 19. Henderson NC, et al. Targeting of alphav integrin identifies a core molecular pathway that regulates fibrosis in several organs. Nat Med. 2013; 19(12): 1617-24.

[0270] 20. John AE, et al. Translational pharmacology of an inhaled small molecule alphavbeta6 integrin inhibitor for idiopathic pulmonary fibrosis. Nat Common. 2020;l l(l):4659.

[0271] 21. Bonniaud P, et al. Heat shock protein: a hot topic in idiopathic pulmonary fibrosis. Eur Respir J. 2017;49(2).

[0272] 22. Bonniaud P, et al. Heat shock protein-90 toward theranostics: a breath of fresh air in idiopathic pulmonary fibrosis. Eur Respir J. 2018;51(2).

[0273] 23. Tanguy J, et al. HSPB5 Inhibition by NCI-41356 Reduces Experimental Lung Fibrosis by Blocking TGF-betal Signaling. Pharmaceuticals (Basel). 2023; 16(2).

[0274] 24. Park AM, et al. Heat Shock Protein 27 Plays a Pivotal Role in Myofibroblast Differentiation and in the Development of Bleomycin-Induced Pulmonary Fibrosis. PLoS One. 2016;l l(2):e0148998.

[0275] 25. Gagliardi M, and Ashizawa AT. The Challenges and Strategies of Antisense Oligonucleotide Drug Delivery. Biomedicines. 2021;9(4).

[0276] 26. Gaus HJ, et al. Characterization of the interactions of chemically-modified therapeutic nucleic acids with plasma proteins using a fluorescence polarization assay. Nucleic Acids Res. 2019;47(3): 1110-22.

[0277] 27. Zhu C, et al. An intranasal ASO therapeutic targeting SARS-CoV-2. Nature Communications. 2022;13(l):4503.

[0278] 28. Crosby JR, et al. Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice. J Cyst Fibres. 2017;16(6):671-80. 29. Crosby JR, et al. Inhaled CD86 Antisense Oligonucleotide Suppresses Pulmonary Inflammation and Airway Hyper-Responsiveness in Allergic Mice. Journal of Pharmacology and Experimental Therapeutics. 2007;321(3):938-46.

[0279] 30. Sicard G, et al. Enhanced Antisense Oligonucleotide Delivery Using Cationic Liposomes Grafted with Trastuzumab: A Proof-of-Concept Study in Prostate Cancer. Pharmaceutics. 2020; 12(12).

[0280] 31. Baylot V, et al. OGX-427 inhibits tumor progression and enhances gemcitabine chemotherapy in pancreatic cancer. Cell Death Dis. 2011;2(10):e221.

[0281] 32. Saito S, et al. Pharmacotherapy and adjunctive treatment for idiopathic pulmonary fibrosis (IPF). J Thorac Dis. 2019;l l(Suppl 14):S1740-S54.

[0282] 33. Kolb P, et al. The importance of interventional timing in the bleomycin model of pulmonary fibrosis. Eur Respir J. 2020;55(6).

[0283] 34. Decologne N, et al. TGF-betal induces progressive pleural scarring and subpleural fibrosis. J Immunol. 2007;179(9):6043-51.

[0284] 35. Kim S, et al. Integrative phenotyping framework (iPF): integrative clustering of multiple omics data identifies novel lung disease subphenotypes. BMC Genomics. 2015;16:924.

[0285] 36. Emblom-Callahan MC, et al. Genomic phenotype of non-cultured pulmonary fibroblasts in idiopathic pulmonary fibrosis. Genomics. 2010;96(3): 134-45.

[0286] 37. Gangwar I, et al. Detecting the Molecular System Signatures of Idiopathic Pulmonary Fibrosis through Integrated Genomic Analysis. Sci Rep. 2017; 7(1): 1554.

Claims

CLAIMS:

1. An inhibitor of HSPB5 wherein said inhibitor reduces the expression and / or activity of HSPB5 in a subject in need thereof and targets the gene or the mRNA of HSPB5.

2. The inhibitor of HSPB5 according to claim 1 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the nucleic acids sequence SEQ ID NO: 27.

3. The inhibitor of HSPB5 according to claims 1 to 2 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets at least between 15 nucleic acids to 25 nucleic acids of SEQ ID NO: 27.

4. The inhibitor of HSPB5 according to claims 1 to 3 wherein said inhibitor reduces the expression and / or activity of HSPB5 and targets the region selected from the list consisting of the nucleic acids 356-375; 536-555; 676-695; 736-755; 756-775 of SEQ ID NO: 27.

5. The inhibitor of HSPB5 according to claims 1 to 4 wherein said inhibitor is a siRNA, a shRNA, an antisense oligonucleotide, miRNA or a ribozyme.

6. The inhibitor of HSPB5 according to claim 5 wherein said inhibitor is an antisense oligonucleotide selected from the group consisting of: SEQ ID NO: 1 to SEQ ID NO:26.

7. The inhibitor of HSPB5 according to claim 5 wherein said inhibitor is an antisense oligonucleotide is selected from the group consisting of: SEQ ID NO:6, SEQ ID NO: 15, SEQ ID NO:22, SEQ ID NO:25 and SEQ ID NO:26.

8. The inhibitor of HSPB5 according to claim 7 wherein said inhibitor is an antisense oligonucleotide set forth as SEQ ID NO:22.

9. A vector for delivery of a heterologous nucleic acid, wherein the nucleic acid encodes an inhibitor according to claims 1 to 8.

10. An inhibitor and / or an antisense oligonucleotide according to claims 1 to 8 for use in the treatment of the Fibrotic interstitial lung diseases (Fibrotic ILD) in a subject in need thereof.

11. An inhibitor and / or an antisense oligonucleotide for use according to claims 10 wherein the Fibrotic interstitial lung diseases (Fibrotic ILDs) is Progressive pulmonary fibrosis (PPF).

12. An inhibitor and / or an antisense oligonucleotide for use according to claims 11 wherein Progressive pulmonary fibrosis (PPF) is selected from the list consisting of Idiopathic pulmonary fibrosis (IPF), idiopathic non specific interstitial pneumonia (NSIP), fibrotic ILD associated with inflammatory rheumatic disease such as rheumatoid arthritis, fibrotic ILD associated with autoimmune connective tissue disease such as systemic sclerosis, Sjogren’s syndrome, undifferentiated connective tissue disease, and chronic hypersensitivity pneumonitis.

13. The inhibitor for use according to claim 11, wherein the Progressive pulmonary fibrosis (PPF) is Idiopathic pulmonary fibrosis (IPF).

14. A pharmaceutical composition which comprises an inhibitor and / or an antisense oligonucleotide according to claims 1 to 8.

15. A method for treating Fibrotic interstitial lung diseases (Fibrotic ILD) in a subject in need thereof comprising a step of administering said subject with a therapeutically effective amount of an inhibitor and / or an antisense oligonucleotide according to claims

Citation Information

Patent Citations

  • Electric water heater with pulsed electronic control and detection

    US20020125241A1

  • Novel nucleoside and oligonucleotide analogues

    US20020147332A1

  • Novel bicyclonucleoside and oligonucleotide analogue

    US20030105309A1

  • Therapeutic uses of LNA-modified oligonucleotides in infectious diseases

    US20030125241A1

  • Valve

    US20040244840A1