Compositions containing the secretome of dsrna-primed cells and methods of use thereof for tissue regeneration / repair

Abstract

Provided herein are cell-free compositions containing the secretome / exosomes of dsRNA primed cells ("herein dsRNA-primed secretome / exosome). The dsRNA-primed secretome is obtained from conditioned media following cell culture (for an effective amount of time) of cells treated with dsRNA, either by transfecting the cells with dsRNA or incubating the cells with dsRNA. The dsRNA-primed secretome / / exosome can be administered to a subject in need thereof, by administering an effective amount of the dsRNA-primed secretome / exosomes to a subject in need thereof. Exemplary subjects / sites of treatment include subjects include, but are not limited to in need of wound healing such as skin wound healing, burn sites, subjects in need of bone repair such as osteochondral bone repair, bone fracture sites, corneal wound sites. Other subjects include osteoporotic subjects and subjects with intervertebral disc degeneration.

Description

[0001]ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT COMPOSITIONS CONTAINING THE SECRETOME OF DSRNA-PRIMED CELLS AND METHODS OF USE THEREOF FOR TISSUE REGENERATION / REPAIR REFERNCE TO CROSS RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional application No. 5 63 / 651,661, filed May 24, 2024, which is hereby incorporated by reference in its entirety. FIELD OF THE INVENTION The field of the invention generally relates to cell-free compositions including the secretome from dsRNA primed cells, methods of making and methods of use thereof. BACKGROUND OF THE INVENTION 10 Repetitive elements are in origin parasitic transposable elements (TE) of viral derivation which have been co-opted in evolution to become regulatory modules of gene expression, eventually integrated in developmental, resilience and cell identity programs.1 2 3Although cells have evolved several defense mechanisms to prevent deleterious uncontrolled retrotransposon reactivation,4increasing evidence demonstrates that retrotransposons are also involved in non- 15 pathological contexts, particularly as non-coding RNAs.2As part of resilience mechanisms, all retrotransposons are a major source of endogenous double stranded RNA (dsRNA), which serves as a cellular signaling molecule to coordinate inflammatory and immune response in various physiological processes.5 6 7 8 9 10The transient and controlled breaching of the activation threshold of dsRNA sensors allows the integration of the immune functions within the frame of physiological 20 processes.9For example, repetitive elements transcribed during development drive RIG-I-like receptors (RLR)-mediated inflammatory signals that regulate hematopoietic stem and progenitor cells (HSPC) formation.11During cell replication, dsRNA-mediated activation of PKR ensures proper progression of mitosis.12Epigenetically mediated derepression of repetitive elements leads to dsRNA production and to the activation of an inflammatory response stimulating anti-tumor T 25 cell immunity.13Further, after skin injury, dsRNAs induce inflammatory pathways contributing to wound healing and hair regeneration.14Several studies have demonstrated a positive effect of proinflammatory mediators on bone anabolism in vitro and in vivo,15 16 17 18 19suggesting that an inflammatory reaction may be harnessed for bone regenerative purposes. Indeed, sterile inflammation is a fundamental component of the osteogenic microenvironment; the inflammatory 30 reaction is the earliest response to injury and is crucial to initiate and orchestrate fracture repair and activate bone anabolic processes.20 21 22Accordingly, a dysregulated inflammation negatively impact optimal bone regeneration,23 24 25 26 27and often precedes the excessive bone formation associated with heterotopic ossification and several vertebral column pathological conditions.28 29Identifying the key molecular factors triggering the sterile inflammation that precedes regeneration 45735311.11 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT in bone would allow modulation the inflammatory reaction in a spatiotemporal and contextual manner as well as to develop new anabolic strategies for the treatment of bone loss conditions, such as osteoporosis, or impaired bone repair.30There remains a need for compositions and methods of improving tissue repair and 5 regeneration in subjects in need thereof. It is an object of the present invention to provide compositions for improving tissue repair and regeneration. It is also an object of the present invention to provide methods for tissue repair and regeneration in subjects in need thereof. 10 Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application. BRIEF SUMMARY OF THE INVENTION 15 Provided herein are cell-free compositions containing the secretome of dsRNA primed cells (“herein dsRNA-primed secretome). The dsRNA-primed secretome is obtained from conditioned media following cell culture (for an effective amount of time) of cells treated with dsRNA, either by transfecting the cells with dsRNA (dsRNA as PKR activator) or incubating the cells with dsRNA by adding dsRNA to the cell media without any transfectant (dsRNA as TLR3 activator) 20 The dsRNA-primed secretome includes a collection of chemicals such as proteins, DNAs, RNAs, metabolites, microRNAs, growth factors, antioxidants, proteasomes, and exomes secreted by cells in response to dsRNA treatment. The dsRNA-primed secretome also contains extracellular vesicles (EVs), including exosomes. Also provided are exosomes secreted by dsRNA-primed cells (“herein dsRNA-primed exosomes). In some forms, when compared to the same cells not primed 25 with dsRNA as disclosed herein, the dsRNA-primed secretome is enriched in Interleukin 8 (IL-8), necrosis factor-inducible gene 6 (TSG6), ATG7 (Autophagy related 7), and Type 1 lysophosphatidic acid receptor (LPAR1). In some forms, the dsRNA-primed secretome / exosomes are frozen or lyophilized. In some forms, the dsRNA-primed secretome / exosomes are cryopreserved. To mimic dsRNA a synthetic 30 polyinosinic-polycytidylic acid (poly(I:C)) or Polyadenylic-polyuridylic acid (poly(A:U)) can be used. It includes strands of inosine poly(I) / adenine poly(A) homopolymer annealed to strands of cytidine poly(C) / uridine poly(U) homopolymer. It can be LMW (Low Molecular Weight), with an average size of 0.2 kb to 1 kb, and / or HMW (High Molecular Weight), with a size above 1 Kb. 45735311.12 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Alternatively, retrotransposon RNA sequences (such as LINE-1 RNA sequence) or their antisense sequence can be used. Cells which can be primed with dsRNA include mesenchymal stem cells, osteoblasts, fibroblasts, endothelial cells, cardiomyocytes, epatocytes, dermofibroblasts, keratinocytes, epithelial 5 cells, dental pulp stem cells, myoblasts, fibro-adipogenic progenitors (FAPS), induced pluripotent stem cells (iPSCs), satellite cells, adipocytes, glial cells, neurons. Also disclosed are methods of treating a subject in need thereof, by administering an effective amount of the dsRNA-primed secretome / exosomes to a subject in need thereof. Exemplary subjects / sites of treatment include subjects include, but are not limited to in need of 10 wound healing such as skin wound healing, burn sites, subjects in need of bone repair such as osteochondral bone repair, bone fracture sites, corneal wound sites. Other subjects include osteoporotic subjects and subjects with intervertebral disc degeneration. Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or can be learned 15 by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. 20 BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings illustrate several embodiments of the disclosed method and compositions and together with the description, serve to explain the principles of the disclosed method and compositions. FIG.1A-E shows TE expression is induced after fracture and in mechanical loaded bone. 25 FIG.1A) Heatmap representation of RNAseq differentially expressed TE (LogFC>0.5) between 4h and intact at different time points of bone healing process. FIG.1B) Heatmap representation of RNAseq upregulated TE (LogFC>0.5) between 4h and intact at different time points of bone healing process. FIG.1C) Heatmap representation of RNAseq differentially expressed TE analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in femoral (n=27) and iliac 30 (n=34) bone biopsies from healthy donors. FIG.1D) Pie charts showing the number and percentage of differentially expressed TE subfamilies between femoral and iliac healthy bone. FIG.1E) Heatmap representation of RNAseq differentially expressed TE analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in femoral (n=27) and iliac (n=34) bone biopsies from healthy donors. One heatmap for each TE order is shown. 45735311.13 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT FIG.2A-2D shows TE expression correlation with bone mineral density in human weight bearing bone. FIG.2A) Heatmap representation of RNAseq differentially expressed TE analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in femoral bone from healthy (n=27), osteopenic (n=12), and osteoporotic (n=9) donors. FIG.2B) Heatmap 5 representation of RNAseq differentially expressed TE analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in femoral bone with high BMD (FN T-score >-1) (n=27) and low BMD (FN T-score <-1) (n=21). FIG.2C) Upper panels: pie charts showing the number and percentage of differentially expressed TE subfamilies between high BMD and low BMD femoral bone. Lower panels: heatmap representation of RNAseq differentially expressed TE 10 analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in femoral bone with high BMD (n=27) and low BMD (n=21). One heatmap for each TE order is shown. FIG.2D) Upper panels: Heatmap representation of correlation analysis (P value<0.05) between TE expression (FPKM) and local BMD (FN T-score) in femoral bone biopsies (n=48). Lower panels: Pie charts showing the percentage of TE subfamilies positively correlated to local BMD. 15 FIG.3A-3E. L1 RNA delivery stimulates mineralization of differentiating osteoblasts. FIG. 3A) Experimental workflow and flow cytometer analysis showing the percentage of positive cells 6 hours after L1 RNA delivery at day 5 of ex vivo osteogenesis. Intracellular localization of cy5 conjugated synthetic L1 RNA (red spots) three days after transfection is also shown from a typical experiment (right). FIG.3B) qPCR analysis of intracellular L1 RNA level 24 h (d6), 5 days (d10), 20 and 9 days (d14) post-transfection. FIG.3C) cy5 conjugated synthetic L1 RNA (red) and osteoimage stained mineral matrix (green) detection 9 days post L1 RNA transfection. FIG.3D) Osteoimage stained mineral matrix quantification (upper panels), images (central panels), and Alizarin Red (lower panels) 9 days after L1 RNA or RFP RNA delivery in 2 healthy donors-derived MSC (D188 and D170). N=11 technical replicates for each condition for each donor. RFU= 25 Relative Fluorescence Units. FIG.3E) Alizarin Red staining of osteoblasts transfected with increasing doses of RFP RNA (upper panels) and L1 RNA (lower panels). FIG.3F) Alizarin Red images (upper panel) and quantification (lower panel) of MSC mineralization after 14, 17 and 21 days of ex vivo differentiation. MSC were obtained from the femur of 4 healthy (D188, D239, D247, D170) and 4 OP patients (HUK7, HUK9, HUK12, HUK16). N=9 technical replicates for 30 each donor and timepoint. FIG.3G) Osteoimage stained mineral matrix quantification (upper panels), images (central panels), and Alizarin Red (lower panels) 9 days after L1 RNA or RFP RNA delivery in 3 OP patients derived MSC (HUK9, HUK12, HUK16). N=10-12 technical replicates for each condition for each patient. RFU= Relative Fluorescence Units. FIG.3H) qRT-PCR of early 45735311.14 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT osteogenic genes in RFP and L1 transfected osteoblasts at different time points of osteogenic differentiation. Expression level is normalized on day 5 (not transfected osteoblasts). FIG.4A-4D. L1 RNA delivery induces an inflammatory response characteristic of bone repair process. FIG.4A) Left panel: heatmap representation of RNAseq differentially expressed 5 gene analysis [Fragments Per Kilobase of transcript per Million (FPKM) fold change] in osteoblasts transfected with negative control RNA (RFP) or L1 RNA. Right panel: bubble plot showing gene ontology (GO) enrichment analysis of L1 upregulated biological processes. FIG.4B) Tree plot showing gene ontology (GO) enrichment analysis of L1 upregulated biological processes (left) and cellular components (right). FIG.4C) Top 25 upregulated biological processes 24h post L1 RNA 10 delivery in vitro (yellow) and 4h post fracture in vivo (blue). Shared GO terms are shown in green. FIG.4D) qPCR analysis of “inflammatory response” (GO:0006954) and “immune response” (GO:0006955) genes at different time points post L1 RNA transfection at day 5. FIG.5A-5G. PKR mediates L1 RNA induced stress response and mineralization. FIG.5A) Upper panel: schematic representation of the pathway inhibited by Lamivudine 3TC and 15 G140. Lower panel: Alizarin Red staining of differentiating osteoblasts transfected with L1 RNA and treated with Lamivudine 3TC and G140. FIG.5B) IF on RFP and L1 transfected osteoblasts, 6h post-transfection, shows the colocalization between cy5 signal (L1 RNA, red) and 488-Anti- dsRNA signal (dsRNA, green). Nuclei are stained with Hoechst (blue). FIG.5C) Western blot analysis showing the ratio between total eIF2a and phosphorylated eIF2a (P- eIF2a). H3: 20 endogenous standard Histone 3. FIG.5D) Volcano plot (left) showing the number of significantly upregulated and downregulated protein 24h post L1 RNA transfection. Right: tree plots showing gene ontology (GO) enrichment analysis of biological processes (upper panel) and cellular components (lower panel) downregulated by L1 RNA delivery (Mass spec data). FIG.5E) qPCR analysis of “inflammatory response” (GO:0006954) and “immune response” (GO:0006955) genes 25 24h post L1 RNA transfection with and without PKR inhibitor C16. FIG.5F) Alizarin Red staining of differentiating osteoblasts transfected with L1 RNA with and without PKR inhibitor C16. FIG. 5G) Tree plots showing gene ontology (GO) enrichment analysis of biological processes upregulated by L1 RNA 24h after transfection (Mass spec data). FIG.6A-6D. L1-RNA-induced changes in osteoblast secretome. FIG.6A) Left: Alizarin 30 red staining on recipient OB 9 days after the delivery of conditioned media. Right: Microscope images of recipient OB 24h from the delivery of conditioned media. Mineralized nodules in OB receiving conditioned media from L1 treated OB are shown (orange arrows). FIG.6B) Heat map of differentially expressed proteins in bulk secretome and exosomes derived from untransfected (NT), RFP- and L1-transfected osteoblasts. FIG.6C) GO enrichment analysis of differentially expressed 45735311.15 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT protein in the bulk secretome of L1 compared to RFP transfected osteoblasts. FIG.6D) GO enrichment analysis of differentially expressed protein in the exosomes of L1 compared to RFP transfected osteoblasts. FIG.7. Shows timeline expression of late differentiation markers in L1 treated osteoblasts. 5 FIG.8 shows ORF1p expression in L1 transfected cells. FIG.9A-9C shows effect of cGAS and PKR knockdown on L1 RNA-induced mineralization. FIG.10 shows common and specific metabolites in the secretome of human mesenchymal stem cells in the following condition: CM Lipo (lipofectamine only), CM IC (transfected with 10 poly(I:C), CM L1 (transfected with L1 RNA). DETAILED DESCRIPTION OF THE INVENTION The disclosed method and compositions can be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description. 15 Data in the present application shows that 1) In mice, immediately after bone fracture, a transient upregulation of repeats concurs with the initiation of the inflammatory stage; 2) in humans, an increased expression of repeats is observed in bones with a higher microfracture- induced anabolic demand and repeat expression correlates with local mineral density; 3) The delivery of L1 RNA, but not control RNA, to human bone marrow-derived mesenchymal stem cells 20 committed to osteoblasts stimulates a unique mineralizing phenotype in a dose dependent manner; 4) L1-treated osteoblasts show upregulation of inflammatory genes and transcriptional changes characteristic for the earliest stage of bone repair; 5) cytoplasmic L1 RNA is sensed by dsRNA- activated protein kinase (PKR), which mediates eIF2α phosphorylation and a global attenuation of protein synthesis; 6) the inhibition of PKR prevents inflammation, translation reduction and 25 mineralization induced by increased levels of cytoplasmic L1 RNA; 7) cells transfected with L1 RNA undergo significant changes in their secretome composition and initiate a paracrine effect stimulating the mineralization of osteogenic competent recipient cells. The date demonstrates a positive contribution of repeats expression in fracture repair through mechanisms activated by dsRNA sensing and mediated by cell to cell signaling. 30 It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. 45735311.16 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT I. DEFINITIONS Conditioned Media: a formulation containing extracellular protein(s), RNAs, DNAs and cellular metabolites, which has previously supported the growth of any desired eukaryotic cell type, said cells having been cultured in either two or three dimensions. Also called “Conditioned Cell 5 Media” or “Conditioned Cell and Tissue Culture Media”. As used herein, the term “carrier” or “excipient” refers to an organic or inorganic ingredient, natural or synthetic inactive ingredient in a formulation, with which one or more active ingredients are combined. “Pharmaceutically acceptable” as used herein refers to those compounds, materials, 10 compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio. As used herein, the term “pharmaceutically acceptable carrier” encompasses any of the 15 standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil / water or water / oil emulsion, and various types of wetting agents. As used herein, a “vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. The vectors described herein can be expression vectors. 20 As used herein, an “expression vector” is a vector that includes one or more expression control sequences. As used herein, an “expression control sequence” is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence. As used herein, the term "pharmaceutically acceptable carrier" encompasses any of the 25 standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil / water or water / oil emulsion, and various types of wetting agents. As used herein, the term “treating” includes alleviating the symptoms associated with a specific disorder or condition and / or preventing or eliminating the symptoms. “Operably linked” refers to a juxtaposition wherein the components are configured so as to 30 perform their usual function. For example, control sequences or promoters operably linked to a coding sequence are capable of effecting the expression of the coding sequence, and an organelle localization sequence operably linked to protein will direct the linked protein to be localized at the specific organelle. 45735311.17 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT As used herein, the term “host cell” refers to a cell into which a recombinant vector can be introduced. As used herein, “transformed” and “transfected” encompass the introduction of a nucleic acid (e.g. a vector) into a cell by a number of techniques known in the art. 5 "Effective amount" and “therapeutically effective amount,” used interchangeably, as applied to the nanoparticles, therapeutic agents, and pharmaceutical compositions described herein, mean the quantity necessary to render the desired therapeutic result. For example, an effective amount is a level effective to treat, cure, or alleviate the symptoms of a disease for which the composition and / or therapeutic agent, or pharmaceutical composition, is / are being administered. 10 “Individual,” “subject,” and “patient” as used herein are used interchangeably to refer to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. The subject can be a human or veterinary patient. “Treatment” as used herein refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term 15 includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative 20 treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. As used herein, the term “purified,” “isolated,” and like terms relate to the isolation of a 25 molecule or compound in a form that is substantially free (at least 60% free, preferably 75% free, and most preferably 90% free) from other components normally associated with the molecule or compound in a native environment. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated 30 herein, and each separate value is incorporated into the specification as if it were individually recited herein. Use of the term “about” is intended to describe values either above or below the stated value in a range of approx. + / - 10%; in other forms the values may range in value either above or below the stated value in a range of approx. + / - 5%; in other forms the values may range in value either 45735311.18 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT above or below the stated value in a range of approx. + / - 2%; in other forms the values may range in value either above or below the stated value in a range of approx. + / - 1%. The preceding ranges are intended to be made clear by context, and no further limitation is implied. II. COMPOSTIONS 5 A. dsRNA-primed secretome / exosomes Cell-free compositions are provided, which contain the secretome of dsRNA-primed cells (“herein dsRNA-primed secretome). The dsRNA-primed secretome is obtained from conditioned media following cell culture (for an effective amount of time) of cells treated / transfected with dsRNA. In some forms, when compared to the same cells not primed with dsRNA as disclosed 10 herein, the dsRNA-primed secretome is enriched in Interleukin 8 (IL-8), necrosis factor-inducible gene 6 (TSG6), ATG7 (Autophagy related 7), and Type 1 lysophosphatidic acid receptor (LPAR1). The dsRNA-primed secretome includes a collection of chemicals such as proteins, DNAs, RNAs, metabolites, microRNA, growth factors, antioxidants, proteasomes, and exomes secreted by cells in response to dsRNA treatment. 15 The dsRNA-primed secretome also contains extracellular vesicles (EVs), including exosomes. Also provided are exosomes secreted by dsRNA-primed cells (“herein dsRNA-primed exosomes). In some forms, the dsRNA-primed secretome / exosomes are frozen or lyophilized. In some forms, the dsRNA-primed secretome / exosomes are cryopreserved. 20 As is known in the art, cells are cultured by adding the cells to a media, often referred to as culture media, that include the nutrients necessary to support the cells as they grow and multiply. Culture media compositions may typically include essential amino acids, salts, vitamins, minerals, trace metals, sugars, lipids, nucleosides as well as other components and elements necessary for the cells' growth and development. Cell culture media attempts to supply the components necessary to 25 meet the nutritional needs required to grow cells in a controlled, artificial and in vitro environment. Nutrient formulations, pH, and osmolarity may vary in accordance with parameters such as cell type, cell density, and the culture system employed. Once the culture media is incubated with cells, the culture media may be referred to as “conditioned media. The examples demonstrate culturing cells to obtained conditioned medium, which is administered to recipient cells. 30 As the cells grow, they secrete a variety of cellular metabolites and secreted proteins, including, for example, biologically active growth factors, inflammatory mediators and other extracellular proteins. These secretions may be generally referred to as “factors” or “secretomes”. In this way, the conditioned media may contain many of the original components of the media, as well as the secreted factors from the cells. A secretome is obtained following cell culture for an 45735311.19 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT effective amount of time for the cells to produce a secretome, for example, at least 1 day, 2 days, 3 days, 4 days, 5days, 6 days, 7 days, 8 days, 9 days, etc. Methods of isolating exosomes from a composition are known in the art. Traditional methods for exosome isolation include ultracentrifugation-based methods, size-based methods 5 (size-exclusion chromatography and ultrafiltration), precipitation, and immunoaffinity capture (Reviewed in Gao, Recent developments in isolating methods for exosomes. Front Bioeng Biotechnol.2023;10:1100892). Exosomes Exosomes belong to a class known as Extracellular vesicles (EVs). Extracellular vesicles 10 (EVs) are cell-derived membrane-surrounded vesicles carrying various types of molecules. Classical EVs are exosomes, microvesicles, and apoptotic bodies, while recent studies discovered autophagic EVs, stressed EVs, and matrix vesicles. EVs are classified based on their biogenesis mechanism (e.g., exosome, microvesicle, apoptosome, and autophagic EV); concept (e.g., oncosome, matrix vesicle, stress EV, and migrasome); and size (e.g., small EV and large EV) 15 (reviewed in Sheta, et al., Biology (Basel).2023 Jan 10;12(1):110. doi: 10.3390 / biology12010110; its Table 1, which classifies EVs is reproduced below. Table 1. Classification of extracellular vesicles. 45735311.110 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Category Name EV Class Size Markers Biogenesis ) Exosomes are endosome-originated EVs generated through three steps: biogenesis, transport, and release. They have a lipid bilayer with an average thickness of ~5 nm (see e.g., Li, Theranostics, 7(3):789-804 (2017) doi: 10.7150 / thno.18133). The lipid components of exosomes 5 include ceramide (sometimes used to differentiate exosomes from lysosomes), cholesterol, sphingolipids, and phosphoglycerides with long and saturated fatty-acyl chains. The outer surface 45735311.111 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT of exosomes is typically rich in saccharide chains, such as mannose, polylactosamine, alpha-2,6 sialic acid, and N-linked glycans. Exosomes are vesicles with the size of 30-150 nm, often 40–100 nm, and are observed in most cell types. Exosomes are often similar to mirovesicles (MVs) with an important difference: 5 instead of originating directly from the plasma membrane, they are generated by inward budding into multivesicular bodies (MVBs). The formation of exosomes includes three different stages: (1) the formation of endocytic vesicles from plasma membrane, (2) the inward budding of the endosomal vesicle membrane resulting in MVBs that consist of intraluminal vesicles (ILVs), and (3) the fusion of these MVBs with the plasma membrane, which releases the vesicular contents, 10 known as exosomes. The disclosed exosome-containing compositions contain a population of exosomes which provide a rich blend of growth factors, anti-inflammatory, and immunomodulatory substances. This composition makes them highly effective in promoting tissue repair and regeneration, potentially offering improved outcomes in various medical conditions. For example, exosomes contain 15 proteins such as platelet derived growth factor receptor, lactadherin, transmembrane proteins and lysosome associated membrane protein-2B, membrane transport and fusion proteins like annexins, flotillins, GTPases, heat shock proteins, tetraspanins, proteins involved in multivesicular body biogenesis, as well as lipid-related proteins and phospholipases, etc. These characteristic proteins also serve as good biomarkers for the isolation and quantification of exosomes. 20 B. Formulations Provided herein are formulations for delivering dsRNA-primed secretome / exosomes to a subject in need of tissue injury repair / tissue regeneration. The dsRNA-primed secretome / exosomes described herein (active agents) can be formulated for parenteral administration, parenteral administration or topical administration to the skin. The disclosed dsRNA-primed 25 secretome / exosomes can be administered to the skin using dosage forms and methods for delivering therapeutic agents and nucleic acids to the skin, in effective amounts. In certain embodiments, the formulations include one or more cell penetration agents, e.g., transfection agents. i. Parenteral Formulations The compounds described herein can be formulated for parenteral administration. 30 For example, parenteral administration may include administration to a patient intravenously, intradermally, intraperitoneally, intralesionally, intramuscularly, subcutaneously, by injection, by infusion, etc. Parenteral formulations can be prepared as aqueous compositions using techniques is known in the art. Typically, such compositions can be prepared as injectable formulations, for example, 45735311.112 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a reconstitution medium prior to injection; emulsions, such as water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions, and microemulsions thereof, liposomes, or emulsomes. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, 5 one or more polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), oils, such as vegetable oils (e.g., peanut oil, corn oil, sesame oil, etc.), and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and / or by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium 10 chloride. Solutions and dispersions of the active compounds as the free acid or base or pharmacologically acceptable salts thereof can be prepared in water or another solvent or dispersing medium suitably mixed with one or more pharmaceutically acceptable excipients including, but not limited to, surfactants, dispersants, emulsifiers, pH modifying agents, viscosity modifying agents, 15 and combination thereof. Suitable surfactants may be anionic, cationic, amphoteric or nonionic surface-active agents. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate and sulfate ions. Examples of anionic surfactants include sodium, potassium, ammonium of long chain alkyl sulfonates and alkyl aryl sulfonates such as sodium dodecylbenzene sulfonate; dialkyl 20 sodium sulfosuccinates, such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinates, such as sodium bis-(2-ethylthioxyl)-sulfosuccinate; and alkyl sulfates such as sodium lauryl sulfate. Cationic surfactants include, but are not limited to, quaternary ammonium compounds such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyl dimethylbenzyl ammonium chloride, polyoxyethylene and coconut amine. Examples of nonionic surfactants include 25 ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, sorbitan acylate, sucrose acylate, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbates, polyoxyethylene octylphenylether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, Poloxamer® 401, stearoyl monoisopropanolamide, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric 30 surfactants include sodium N-dodecyl-.beta.-alanine, sodium N-lauryl-.beta.-iminodipropionate, myristoamphoacetate, lauryl betaine and lauryl sulfobetaine. The formulation can contain a preservative to prevent the growth of microorganisms. Suitable preservatives include, but are not limited to, parabens, chlorobutanol, phenol, sorbic acid, 45735311.113 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT and thimerosal. The formulation may also contain an antioxidant to prevent degradation of the active agent(s). The formulation is typically buffered to a pH of 3-8 for parenteral administration upon reconstitution. Suitable buffers include, but are not limited to, phosphate buffers, acetate buffers, 5 and citrate buffers. Water-soluble polymers are often used in formulations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinylpyrrolidone, dextran, carboxymethylcellulose, and polyethylene glycol. Sterile injectable solutions can be prepared by incorporating the active compounds in the 10 required amount in the appropriate solvent or dispersion medium with one or more of the excipients listed above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are 15 vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The powders can be prepared in such a manner that the particles are porous in nature, which can increase dissolution of the particles. Methods for making porous particles are well known in the art. 1. Controlled Release Formulations 20 The parenteral formulations described herein can be formulated for controlled release including immediate release, delayed release, extended release, pulsatile release, and combinations thereof. a. Nano- and microparticles For parenteral administration, the active agents, and optional one or more additional active 25 agents, can be incorporated into microparticles, nanoparticles, or combinations thereof that provide controlled release of the compounds and / or one or more additional active agents. In embodiments wherein the formulations contains two or more agents, the agents can be formulated for the same type of controlled release (e.g., delayed, extended, immediate, or pulsatile) or the agents can be independently formulated for different types of release (e.g., immediate and delayed, immediate and 30 extended, delayed and extended, delayed and pulsatile, etc.). For example, the compounds and / or one or more additional active agents can be incorporated into polymeric microparticles, which provide controlled release of the drug(s). Release of the agent(s) is controlled by diffusion of the agent(s) out of the microparticles and / or 45735311.114 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT degradation of the polymeric particles by hydrolysis and / or enzymatic degradation. Suitable polymers include ethylcellulose and other natural or synthetic cellulose derivatives. Polymers, which are slowly soluble and form a gel in an aqueous environment, such as hydroxypropyl methylcellulose or polyethylene oxide, can also be suitable as materials for drug 5 containing microparticles. Other polymers include, but are not limited to, polyanhydrides, poly(ester anhydrides), polyhydroxy acids, such as polylactide (PLA), polyglycolide (PGA), poly(lactide-co-glycolide) (PLGA), poly-3-hydroxybutyrate (PHB) and copolymers thereof, poly-4- hydroxybutyrate (P4HB) and copolymers thereof, polycaprolactone and copolymers thereof, and combinations thereof. 10 Alternatively, the agent(s) can be incorporated into microparticles prepared from materials which are insoluble in aqueous solution or slowly soluble in aqueous solution, but are capable of degrading within the GI tract by means including enzymatic degradation, surfactant action of bile acids, and / or mechanical erosion. As used herein, the term “slowly soluble in water” refers to materials that are not dissolved in water within a period of 30 minutes. Preferred examples include 15 fats, fatty substances, waxes, wax-like substances and mixtures thereof. Suitable fats and fatty substances include fatty alcohols (such as lauryl, myristyl stearyl, cetyl or cetostearyl alcohol), fatty acids and derivatives, including but not limited to fatty acid esters, fatty acid glycerides (mono-, di- and tri-glycerides), and hydrogenated fats. Specific examples include, but are not limited to hydrogenated vegetable oil, hydrogenated cottonseed oil, hydrogenated castor oil, hydrogenated oils 20 available under the trade name Sterotex®, stearic acid, cocoa butter, and stearyl alcohol. Suitable waxes and wax-like materials include natural or synthetic waxes, hydrocarbons, and normal waxes. Specific examples of waxes include beeswax, glycowax, castor wax, carnauba wax, paraffins and candelilla wax. As used herein, a wax-like material is defined as any material, which is normally solid at room temperature and has a melting point of from about 30 to 300ºC. 25 In some cases, it may be desirable to alter the rate of water penetration into the microparticles. To this end, rate-controlling (wicking) agents can be formulated along with the fats or waxes listed above. Examples of rate-controlling materials include certain starch derivatives (e.g., waxy maltodextrin and drum dried corn starch), cellulose derivatives (e.g., hydroxypropylmethyl-cellulose, hydroxypropylcellulose, methylcellulose, and carboxymethyl- 30 cellulose), alginic acid, lactose and talc. Additionally, a pharmaceutically acceptable surfactant (for example, lecithin) may be added to facilitate the degradation of such microparticles. Proteins, which are water insoluble, such as zein, can also be used as materials for the formation of agent containing microparticles. Additionally, proteins, polysaccharides and combinations thereof, which are water-soluble, can be formulated with agent into microparticles 45735311.115 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT and subsequently cross-linked to form an insoluble network. For example, cyclodextrins can be complexed with individual agent molecules and subsequently cross-linked. 2. Method of making Nano- and Microparticles Encapsulation or incorporation of agent into carrier materials to produce agent-containing 5 microparticles can be achieved through known pharmaceutical formulation techniques. In the case of formulation in fats, waxes or wax-like materials, the carrier material is typically heated above its melting temperature and the agent is added to form a mixture comprising agent particles suspended in the carrier material, agent dissolved in the carrier material, or a mixture thereof. Microparticles can be subsequently formulated through several methods including, but not limited to, the processes 10 of congealing, extrusion, spray chilling or aqueous dispersion. In a preferred process, wax is heated above its melting temperature, agent is added, and the molten wax-agent mixture is congealed under constant stirring as the mixture cools. Alternatively, the molten wax-agent mixture can be extruded and spheronized to form pellets or beads. These processes are known in the art. For some carrier materials it may be desirable to use a solvent evaporation technique to produce agent-containing 15 microparticles. In this case agent and carrier material are co-dissolved in a mutual solvent and microparticles can subsequently be produced by several techniques including, but not limited to, forming an emulsion in water or other appropriate media, spray drying or by evaporating off the solvent from the bulk solution and milling the resulting material. In some embodiments, agent in a particulate form is homogeneously dispersed in a water- 20 insoluble or slowly water soluble material. To minimize the size of the agent particles within the composition, the agent powder itself may be milled to generate fine particles prior to formulation. The process of jet milling, known in the pharmaceutical art, can be used for this purpose. In some embodiments drug in a particulate form is homogeneously dispersed in a wax or wax like substance by heating the wax or wax like substance above its melting point and adding the drug particles 25 while stirring the mixture. In this case a pharmaceutically acceptable surfactant may be added to the mixture to facilitate the dispersion of the drug particles. The particles can also be coated with one or more modified release coatings. Solid esters of fatty acids, which are hydrolyzed by lipases, can be spray coated onto microparticles or drug particles. Zein is an example of a naturally water-insoluble protein. It can be coated onto drug 30 containing microparticles or drug particles by spray coating or by wet granulation techniques. In addition to naturally water-insoluble materials, some substrates of digestive enzymes can be treated with cross-linking procedures, resulting in the formation of non-soluble networks. Many methods of cross-linking proteins, initiated by both chemical and physical means, have been reported. One of the most common methods to obtain cross-linking is the use of chemical cross-linking agents. 45735311.116 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Examples of chemical cross-linking agents include aldehydes (gluteraldehyde and formaldehyde), epoxy compounds, carbodiimides, and genipin. In addition to these cross-linking agents, oxidized and native sugars have been used to cross-link gelatin. Cross-linking can also be accomplished using enzymatic means; for example, transglutaminase has been approved as a GRAS substance for 5 cross-linking seafood products. Finally, cross-linking can be initiated by physical means such as thermal treatment, UV irradiation and gamma irradiation. To produce a coating layer of cross-linked protein surrounding drug containing microparticles or drug particles, a water-soluble protein can be spray coated onto the microparticles and subsequently cross-linked by the one of the methods described above. Alternatively, drug- 10 containing microparticles can be microencapsulated within protein by coacervation-phase separation (for example, by the addition of salts) and subsequently cross-linked. Some suitable proteins for this purpose include gelatin, albumin, casein, and gluten. Polysaccharides can also be cross-linked to form a water-insoluble network. For many polysaccharides, this can be accomplished by reaction with calcium salts or multivalent cations, 15 which cross-link the main polymer chains. Pectin, alginate, dextran, amylose and guar gum are subject to cross-linking in the presence of multivalent cations. Complexes between oppositely charged polysaccharides can also be formed; pectin and chitosan, for example, can be complexed via electrostatic interactions. 3. Injectable / Implantable formulations 20 The compounds described herein can be incorporated into injectable / implantable solid or semi- solid implants, such as polymeric implants. In one embodiment, the compounds are incorporated into a polymer that is a liquid or paste at room temperature, but upon contact with aqueous medium, such as physiological fluids, exhibits an increase in viscosity to form a semi-solid or solid material. Exemplary polymers include, but are not limited to, hydroxyalkanoic acid polyesters derived from the 25 copolymerization of at least one unsaturated hydroxy fatty acid copolymerized with hydroxyalkanoic acids. The polymer can be melted, mixed with the active substance and cast or injection molded into a device. Such melt fabrication require polymers having a melting point that is below the temperature at which the substance to be delivered and polymer degrade or become reactive. The device can also be prepared by solvent casting where the polymer is dissolved in a solvent and the drug dissolved or 30 dispersed in the polymer solution and the solvent is then evaporated. Solvent processes require that the polymer be soluble in organic solvents. Another method is compression molding of a mixed powder of the polymer and the drug or polymer particles loaded with the active agent. Alternatively, the compounds can be incorporated into a polymer matrix and molded, compressed, or extruded into a device that is a solid at room temperature. For example, the compounds 45735311.117 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT can be incorporated into a biodegradable polymer, such as polyanhydrides, polyhydroalkanoic acids (PHAs), PLA, PGA, PLGA, polycaprolactone, polyesters, polyamides, polyorthoesters, polyphosphazenes, proteins and polysaccharides such as collagen, hyaluronic acid, albumin and gelatin, and combinations thereof and compressed into solid device, such as disks, or extruded into a 5 device, such as rods. Polyamides for nucleic acid delivery are described in U.S. Patent No.8,236,280 The release of the one or more compounds from the implant can be varied by selection of the polymer, the molecular weight of the polymer, and / or modification of the polymer to increase degradation, such as the formation of pores and / or incorporation of hydrolyzable linkages. Methods for modifying the properties of biodegradable polymers to vary the release profile of the compounds 10 from the implant are well known in the art. ii. Enteral Formulations Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be made using compression or molding techniques well known in the art. Gelatin or non-gelatin capsules can prepared as hard or soft capsule shells, which can encapsulate 15 liquid, solid, and semi-solid fill materials, using techniques well known in the art. Formulations may be prepared using a pharmaceutically acceptable carrier. As generally used herein “carrier” includes, but is not limited to, diluents, preservatives, binders, lubricants, disintegrators, swelling agents, fillers, stabilizers, and combinations thereof. Carrier also includes all components of the coating composition, which may include 20 plasticizers, pigments, colorants, stabilizing agents, and glidants. Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are 25 commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides. Additionally, the coating material may contain conventional carriers such as plasticizers, pigments, colorants, glidants, stabilization agents, pore formers and surfactants. “Diluents”, also referred to as "fillers," are typically necessary to increase the bulk of a solid 30 dosage form so that a practical size is provided for compression of tablets or formation of beads and granules. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starches, pregelatinized starch, silicone dioxide, titanium oxide, magnesium aluminum silicate and powdered sugar. 45735311.118 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT “Binders” are used to impart cohesive qualities to a solid dosage formulation, and thus ensure that a tablet or bead or granule remains intact after the formation of the dosage forms. Suitable binder materials include, but are not limited to, starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, waxes, natural and 5 synthetic gums such as acacia, tragacanth, sodium alginate, cellulose, including hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and veegum, and synthetic polymers such as acrylic acid and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid / polymethacrylic acid and polyvinylpyrrolidone. 10 “Lubricants” are used to facilitate tablet manufacture. Examples of suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glycerol behenate, polyethylene glycol, talc, and mineral oil. “Disintegrants” are used to facilitate dosage form disintegration or "breakup" after administration, and generally include, but are not limited to, starch, sodium starch glycolate, sodium 15 carboxymethyl starch, sodium carboxymethylcellulose, hydroxypropyl cellulose, pregelatinized starch, clays, cellulose, alginine, gums or cross linked polymers, such as cross-linked PVP (Polyplasdone® XL from GAF Chemical Corp). “Stabilizers” are used to inhibit or retard drug decomposition reactions, which include, by way of example, oxidative reactions. Suitable stabilizers include, but are not limited to, 20 antioxidants, butylated hydroxytoluene (BHT); ascorbic acid, its salts and esters; Vitamin E, tocopherol and its salts; sulfites such as sodium metabisulphite; cysteine and its derivatives; citric acid; propyl gallate, and butylated hydroxyanisole (BHA). 1. Controlled Release Enteral Formulations Oral dosage forms, such as capsules, tablets, solutions, and suspensions, can for formulated 25 for controlled release. For example, the one or more compounds and optional one or more additional active agents can be formulated into nanoparticles, microparticles, and combinations thereof, and encapsulated in a soft or hard gelatin or non-gelatin capsule or dispersed in a dispersing medium to form an oral suspension or syrup. The particles can be formed of the agent and a controlled release polymer or matrix. Alternatively, the agent particles can be coated with one or 30 more controlled release coatings prior to incorporation in to the finished dosage form. In another embodiment, the one or more compounds and optional one or more additional active agents are dispersed in a matrix material, which gels or emulsifies upon contact with an aqueous medium, such as physiological fluids. In the case of gels, the matrix swells entrapping the 45735311.119 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT active agents, which are released slowly over time by diffusion and / or degradation of the matrix material. Such matrices can be formulated as tablets or as fill materials for hard and soft capsules. In still another embodiment, the one or more compounds, and optional one or more additional active agents are formulated into a sold oral dosage form, such as a tablet or capsule, and 5 the solid dosage form is coated with one or more controlled release coatings, such as a delayed release coatings or extended release coatings. The coating or coatings may also contain the compounds and / or additional active agents. a. Extended release dosage forms The extended release formulations are generally prepared as diffusion or osmotic systems, 10 which are known in the art. A diffusion system typically consists of two types of devices, a reservoir and a matrix, and is well known and described in the art. The matrix devices are generally prepared by compressing the agent with a slowly dissolving polymer carrier into a tablet form. The three major types of materials used in the preparation of matrix devices are insoluble plastics, hydrophilic polymers, and fatty compounds. Plastic matrices include, but are not limited to, methyl 15 acrylate-methyl methacrylate, polyvinyl chloride, and polyethylene. Hydrophilic polymers include, but are not limited to, cellulosic polymers such as methyl and ethyl cellulose, hydroxyalkylcelluloses such as hydroxypropyl-cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and Carbopol® 934, polyethylene oxides and mixtures thereof. Fatty compounds include, but are not limited to, various waxes such as carnauba wax and glyceryl 20 tristearate and wax-type substances including hydrogenated castor oil or hydrogenated vegetable oil, or mixtures thereof. In certain preferred embodiments, the plastic material is a pharmaceutically acceptable acrylic polymer, including but not limited to, acrylic acid and methacrylic acid copolymers, methyl methacrylate, methyl methacrylate copolymers, ethoxyethyl methacrylates, cyanoethyl 25 methacrylate, aminoalkyl methacrylate copolymer, poly(acrylic acid), poly(methacrylic acid), methacrylic acid alkylamine copolymer poly(methyl methacrylate), poly(methacrylic acid)(anhydride), polymethacrylate, polyacrylamide, poly(methacrylic acid anhydride), and glycidyl methacrylate copolymers. In certain preferred embodiments, the acrylic polymer is comprised of one or more 30 ammonio methacrylate copolymers. Ammonio methacrylate copolymers are well known in the art, and are described in NF XVII as fully polymerized copolymers of acrylic and methacrylic acid esters with a low content of quaternary ammonium groups. In one preferred embodiment, the acrylic polymer is an acrylic resin lacquer such as that which is commercially available from Rohm Pharma under the tradename EUDRAGIT t®. In 45735311.120 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT further preferred embodiments, the acrylic polymer comprises a mixture of two acrylic resin lacquers commercially available from Rohm Pharma under the tradenames EUDRAGIT® RL30D and EUDRAGIT ® RS30D, respectively. EUDRAGIT® RL30D and EUDRAGIT ® RS30D are copolymers of acrylic and methacrylic esters with a low content of quaternary ammonium groups, 5 the molar ratio of ammonium groups to the remaining neutral (meth)acrylic esters being 1:20 in EUDRAGIT ® RL30D and 1:40 in EUDRAGIT® RS30D. The mean molecular weight is about 150,000. EUDRAGIT ® S-100 and EUDRAGIT ® L-100 are also preferred. The code designations RL (high permeability) and RS (low permeability) refer to the permeability properties of these agents. EUDRAGIT ® RL / RS mixtures are insoluble in water and in digestive fluids. 10 However, multiparticulate systems formed to include the same are swellable and permeable in aqueous solutions and digestive fluids. The polymers described above such as EUDRAGIT ® RL / RS may be mixed together in any desired ratio in order to ultimately obtain a sustained-release formulation having a desirable dissolution profile. Desirable sustained-release multiparticulate systems may be obtained, for 15 instance, from 100% EUDRAGIT® RL, 50% EUDRAGIT® RL and 50% EUDRAGIT t® RS, and 10% EUDRAGIT® RL and 90% EUDRAGIT® RS. One skilled in the art will recognize that other acrylic polymers may also be used, such as, for example, EUDRAGIT® L. Alternatively, extended release formulations can be prepared using osmotic systems or by applying a semi-permeable coating to the dosage form. In the latter case, the desired agent release 20 profile can be achieved by combining low permeable and high permeable coating materials in suitable proportion. The devices with different agent release mechanisms described above can be combined in a final dosage form comprising single or multiple units. Examples of multiple units include, but are not limited to, multilayer tablets and capsules containing tablets, beads, or granules An immediate 25 release portion can be added to the extended release system by means of either applying an immediate release layer on top of the extended release core using a coating or compression process or in a multiple unit system such as a capsule containing extended and immediate release beads. Extended release tablets containing hydrophilic polymers are prepared by techniques commonly known in the art such as direct compression, wet granulation, or dry granulation. Their 30 formulations usually incorporate polymers, diluents, binders, and lubricants as well as the active pharmaceutical ingredient. The usual diluents include inert powdered substances such as starches, powdered cellulose, especially crystalline and microcrystalline cellulose, sugars such as fructose, mannitol and sucrose, grain flours and similar edible powders. Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphate or sulfate, inorganic 45735311.121 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT salts such as sodium chloride and powdered sugar. Powdered cellulose derivatives are also useful. Typical tablet binders include substances such as starch, gelatin and sugars such as lactose, fructose, and glucose. Natural and synthetic gums, including acacia, alginates, methylcellulose, and polyvinylpyrrolidone can also be used. Polyethylene glycol, hydrophilic polymers, ethylcellulose 5 and waxes can also serve as binders. A lubricant is necessary in a tablet formulation to prevent the tablet and punches from sticking in the die. The lubricant is chosen from such slippery solids as talc, magnesium and calcium stearate, stearic acid and hydrogenated vegetable oils. Extended release tablets containing wax materials are generally prepared using methods known in the art such as a direct blend method, a congealing method, and an aqueous dispersion 10 method. In the congealing method, the agent is mixed with a wax material and either spray- congealed or congealed and screened and processed. b. Delayed release dosage forms Delayed release formulations can be created by coating a solid dosage form with a polymer film, which is insoluble in the acidic environment of the stomach, and soluble in the neutral 15 environment of the small intestine. The delayed release dosage units can be prepared, for example, by coating an agent or an agent-containing composition with a selected coating material. The agent-containing composition may be, e.g., a tablet for incorporation into a capsule, a tablet for use as an inner core in a "coated core" dosage form, or a plurality of agent-containing beads, particles or granules, for incorporation 20 into either a tablet or capsule. Preferred coating materials include bioerodible, gradually hydrolyzable, gradually water-soluble, and / or enzymatically degradable polymers, and may be conventional "enteric" polymers. Enteric polymers, as will be appreciated by those skilled in the art, become soluble in the higher pH environment of the lower gastrointestinal tract or slowly erode as the dosage form passes through the gastrointestinal tract, while enzymatically degradable 25 polymers are degraded by bacterial enzymes present in the lower gastrointestinal tract, particularly in the colon. Suitable coating materials for effecting delayed release include, but are not limited to, cellulosic polymers such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxymethyl cellulose, hydroxypropyl methyl cellulose, hydroxypropyl methyl cellulose acetate succinate, hydroxypropylmethyl cellulose phthalate, methylcellulose, ethyl cellulose, cellulose acetate, 30 cellulose acetate phthalate, cellulose acetate trimellitate and carboxymethylcellulose sodium; acrylic acid polymers and copolymers, preferably formed from acrylic acid, methacrylic acid, methyl acrylate, ethyl acrylate, methyl methacrylate and / or ethyl methacrylate, and other methacrylic resins that are commercially available under the tradename Eudragit® (Rohm Pharma; Westerstadt, Germany), including EUDRAGIT® L30D-55 and L100-55 (soluble at pH 5.5 and 45735311.122 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT above), EUDRAGIT® L-100 (soluble at pH 6.0 and above), EUDRAGIT® S (soluble at pH 7.0 and above, as a result of a higher degree of esterification), and EUDRAGITS® NE, RL and RS (water-insoluble polymers having different degrees of permeability and expandability); vinyl polymers and copolymers such as polyvinyl pyrrolidone, vinyl acetate, vinylacetate phthalate, 5 vinylacetate crotonic acid copolymer, and ethylene-vinyl acetate copolymer; enzymatically degradable polymers such as azo polymers, pectin, chitosan, amylose and guar gum; zein and shellac. Combinations of different coating materials may also be used. Multi-layer coatings using different polymers may also be applied. The preferred coating weights for particular coating materials may be readily determined by 10 those skilled in the art by evaluating individual release profiles for tablets, beads and granules prepared with different quantities of various coating materials. It is the combination of materials, method and form of application that produce the desired release characteristics, which one can determine only from the clinical studies. The coating composition may include conventional additives, such as plasticizers, pigments, 15 colorants, stabilizing agents, glidants, etc. A plasticizer is normally present to reduce the fragility of the coating, and will generally represent about 10 wt. % to 50 wt. % relative to the dry weight of the polymer. Examples of typical plasticizers include polyethylene glycol, propylene glycol, triacetin, dimethyl phthalate, diethyl phthalate, dibutyl phthalate, dibutyl sebacate, triethyl citrate, tributyl citrate, triethyl acetyl citrate, castor oil and acetylated monoglycerides. A stabilizing agent 20 is preferably used to stabilize particles in the dispersion. Typical stabilizing agents are nonionic emulsifiers such as sorbitan esters, polysorbates and polyvinylpyrrolidone. Glidants are recommended to reduce sticking effects during film formation and drying, and will generally represent approximately 25 wt. % to 100 wt. % of the polymer weight in the coating solution. One effective glidant is talc. Other glidants such as magnesium stearate and glycerol monostearates may25 also be used. Pigments such as titanium dioxide may also be used. Small quantities of an anti- foaming agent, such as a silicone (e.g., simethicone), may also be added to the coating composition. iii. Topical Formulations Suitable dosage forms for topical administration include creams, ointments, salves, sprays, gels, lotions, emulsions, and transdermal patches. The formulation may be formulated for 30 transmucosal, transepithelial, transendothelial, or transdermal administration. The formulations can include known excipients used in topical formulations, included but not limited to sunscreens, surfactants, preservatives, desquamation agents, antiperspirants, colorants, thickeners, skin lighteners, vitamins and other therapeutically active agents in a cosmetically acceptable carrier. The compositions may further contain one or more chemical penetration enhancers, membrane 45735311.123 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT permeability agents, membrane transport agents, emollients, surfactants, stabilizers, buffers, and combination thereof. “Penetration enhancers” are known in the art and include, but are not limited to, fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithins, 5 cholate salts, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, modified celluloses, and diimides), macrocyclics, such as macrocylic lactones, ketones, and anhydrides and cyclic ureas, surfactants, N-methyl pyrrolidones and derivatives thereof, DMSO and related compounds, ionic compounds, azone and related compounds, and solvents, such as alcohols, ketones, amides, polyols (e.g., glycols). Examples of these classes are known in the art. 10 “Preservatives” can be used to prevent the growth of fungi and microorganisms. Suitable antifungal and antimicrobial agents include, but are not limited to, benzoic acid, butylparaben, ethyl paraben, methyl paraben, propylparaben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, and thimerosal. 15 “Surfactants” are surface-active agents that lower surface tension and thereby increase the emulsifying, foaming, dispersing, spreading and wetting properties of a product. Suitable non-ionic surfactants include emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polysorbate, sorbitan esters, benzyl alcohol, benzyl benzoate, cyclodextrins, glycerin monostearate, poloxamer, povidone and combinations thereof. In 20 one embodiment, the non-ionic surfactant is stearyl alcohol. Topical nucleic acid delivery using topical application, for example, topical application of naked DNA, DNA / liposomes or emulsion complex, liposomal cream, as well as physical methods such as stripping, electroporation, and micromechanical disruption methods Methods of delivering nucleic acids (NAs) to the skin are known in the art. Physical 25 methods include microneedle injection, microporation, electroporation, iontophoresis, sonophoresis, or passive delivery using polymeric nanoparticles; liposomes; peptides; or dendrimers. (Reviewed in Zakrewsky, et al., J. Control Release, 219: 445–456 (2015)). Intradermal injections are the simplest and most direct method for delivering NAs into the skin. Here, the barrier properties of the SC are overcome completely by injecting NAs directly into 30 the viable tissue layers of the skin. Useful intradermal needles include microneedle arrays. Microneedle arrays comprise needles that are only 100–700 µm in length. When placed on the skin, their sharp tips allow easy insertion into the stratum corneum, while the short length ensures adequate penetration into the skin without disrupting nerves in deeper skin tissue. Microneedles can 45735311.124 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT be used for delivery of nucleic acids disclosed herein, for example, plasmid DNA encoding L1 RNA, cationic lipid-DNA complexes (~100 nm diameter), etc. Microporation is another technique that employs physical disruption of the SC (statun corneum) for delivery of large therapeutics or therapeutic carriers. An array of resistive elements 5 can be placed on the skin. An electric current pulsed through the array results in localized ablation of corneocytes in contact with the array. Alternatively, erbium:yttrium-aluminum-garnet (Er:YAG) laser arrays can be used for localized ablation of the SC and epidermis. This techniques has been used to successfully deliver plamid DNA, CpG oligonucleotides etc., to the skin. Electroporation can be used to permeabilize the skin and enhance passive diffusion of agent. 10 The mechanism of electroporation is quite different from that of electrically-induced microporation. Electrically-induced microporation utilizes electric fields to induce thermal ablation of SC microstructure creating pores in the skin. On the other hand, electroporation is the application of short duration (< 0.5 s) and high intensity (< 100 V) electric pulses to the skin which result in transient permeabilization of the lipid bilayers in the skin and concurrently permeabilize cell 15 membranes of epidermal keratinocytes. Electroporation is also expected to create aqueous pores through the skin. Efficient delivery of nucleic acid molecules into skin by combined use of microneedle roller and flexible interdigitated electroporation array is disclosed in Huang, et al., Theranostics 2018; 8(9):2361-2376. Iontophoresis can be used to drive transport of charged drugs like NAs. Applying a 20 continuous low intensity (< 10 V) electric field at a constant current. Liposomes have also been studied extensively for nucleic acid delivery for the treatment of skin disease. Highly ordered spherical complexes of nucleic acids (spherical nucleic acids) have shown potential for treating skin disease due to their enhanced delivery into skin, internalization into skin 25 cells, and protection of NAs from degradation. For example, gold nanoparticles coated with a dense layer of highly-ordered and covalently bound siRNA resulted in passive transport through intact mouse SC and localized exclusively in the dermis and epidermis. The formulations can include known skin penetration enhancers. Several peptides have been identified which possess the ability to enhance transport of NAs into the skin and elicit a therapeutic 30 response. The first of these peptides discovered using phage-display screening was TD-1 (ACSSSPSKHCG) (SEQ ID NO:36). Hsu and Mitragotri identified another peptide using phage- display screening, SPACE peptide (ACTGSTQHQCG) (SEQ ID NO:37), with the ability to not only enhance delivery of siRNA across the skin but also enhance intracellular uptake (Hsu T, Mitragotri S Proc Natl Acad Sci U S A.2011108(38):15816-21). 45735311.125 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT The present invention will be further understood by means of the following non-limiting examples. III. METHODS OF MAKING AND USING A. Methods of Making 5 The disclosed compositions are obtained from cells transfected with Long Interspersed Nuclear Element (LINE) 1 RNA, long terminal repeats (LTR) retrotransposon RNA, or dsRNA and maintained in cell culture for an effective among of time, following which the cell culture medium is obtained and optionally, exosomes are isolated therefrom. In some forms, the cells are incubated with dsRNA which is internalized into the cell, following incubation. 10 Double stranded RNAs are known in the art and are reviewed in Sadeq, et al., Noncoding RNA. 2021 Feb 19;7(1):15. doi: 10.3390 / ncrna7010015. LINEs: Long interspersed nuclear elements (LINEs) are 6–7 kb in size and constitute up to 20% of the human genome. Full-length copies contain two open reading frames (ORF1 and ORF2) which encode proteins essential for retro-transposition. 15 To mimic dsRNA a synthetic polyinosinic-polycytidylic acid (poly(I:C)) or Polyadenylic- polyuridylic acid (poly(A:U)) can be used. It includes strands of inosine poly(I) / adenine poly(A) homopolymer annealed to strands of cytidine poly(C) / uridine poly(U) homopolymer. It can be LMW (Low Molecular Weight), with an average size of 0.2 kb to 1 kb, and / or HMW (High Molecular Weight), with a size above 1 Kb. Alternatively, retrotransposon RNA sequences (such as 20 LINE-1 RNA sequence) or their antisense sequence can be used. L1 RNA can be synthetized in vitro and then introduced into cells of interest, in vitro. One approach includes nucleic acid transfer into primary cells in culture. An exemplary L1RNA is the human L1 RNA (L1-Ta subfamily), whose sequence is shown below, and it can be introduced alone, or in a vector, transferred into primary cells. Although L1- 25 Ta subfamily sequence can be replaced by any L1 RNA sequence, and they known in the art. CCATAAGAAACTTTTTAAAAATAAAAAAAACTATAATAAAAATTATAAGACACTGTAAATGAAT GGTTTTAGTCATCTGAATTTTCTCTGACCCTTAGAATTAAGGAAAAAAAAAACACACAATAGTTATGGCC AATAATAATTCCTCCTTCTTTGAGGAAATTCAACAGTTTTAGAACCAACTTTAAACTATACAACCTGGCAT ATACACATTTTTAAAAACACACACACAAAATTGTTTACTAAGCAAGAAGGAGAATTCATTAAAGAGCCAC 30 GCCAGCTACAGGAAGTTTAGATTTTAAATGTAAAGAGAGGAGGCAATGGTACCTGACTTTTCACATTTTG ATTTATATTGGCTTCTTTCCAGAAAACGCTTTCACTGGCTTTCAAAAAATTTTTATTTTATCTCCAACCCTT AGACGGAAACCATCTTCAACTGGAAATCAGAACACCTAGGTTTTACTTTTTATTTAGGCAAAAATGTATTT GGAGCCAGGCATGGTGGATCACAACTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATAATCTG TGGTCAGGAGTTCGAGATGAGCCTGGCCAACATGGCAAAACCCCATCTCTACTAAAAATATAAAAATTAG 35 CCAGGTGTGGTCTTGCATGCCTGTGGTCTCAGGTACTTGGAAGGCTGAGGCAGGAGAATCACTTAAGCCC AGGAAACGGAGGTTGCAGTGAGCCAAGATCACACCATTGCACTGGGCGACAGAGCGAGACTCCATCAAA 45735311.126 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT AATAATAATAATGAAATAAATAAATAAATAAAAAGCACATTTGGTCTCCACCTACTGGAAAACAGGCAG GAATTGCTGTGTGTTTCACAGACATGGACCACGAAGAGGATAAAGTGAGTTAACTTGTTAAGTGCTAAGA AATATTCTCCATAAACCCAAGCTATTATAGTTACGTAATATGAGTCTCTTCTCTGGAGGCGGTCTTCATGG ATTGTTTGCCAGCCTAGCCTTAAAAATGTCAGGCATCGAAGATGGCCGAATAGCAACAGCTCCCGTCTAC 5 AGCTCCCAGCGTGAGCGACGCAGAAGACGGGTGATTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTC ACTAGGGAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGCGCACCGTGTGCCAGCCGAAGCAGGGCG AGGCATTGCCTCACCTGGGAAGCGCAAGGGGTCAGGGAGTTCCCTTTCCGAGTCAAAGAAAGGGGTGAC CGACGCACCTGGAAAATCGGGTCACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTAAGAAACGGCG CACCACGAGACTATATCCCACACCTGGCTCAGAGGGTCCTACGCCCACGGAATCTCGCTGATTGCTAGCA 10 CAGCAGTCTGAGATCAAACTGCAAGGCGGCAACGAGGCTGGGGGAGGGGCGCCCGCCATTGCCCAGGCT TGCTTAGGTAAACAAAGCAGCCAGGAAGCTCGAACTGGGTGGAGCCCACCACAGCTCAAGGAGGCCTGC CTGCCTCTGTAGGCTCCACCTCTGGGGGCAGGGCACAGACAAACAAAAAGACAGCAGTAACCTCTGCAG ACTTAAATGTCCCTGTCTGACAGCTTTGAAGAGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGATCTGAG AACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGACCCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCC 15 CCCAGCAGGGGCACACTGACACCTCACACGGCAGGGTATTCCAACAGACCTGCAGCTGAGGGTCCTGTCT GTTAGAAGGAAAACTAACAACCAGAAAGGACATCTACACCGAAAACCCATCTGTACATCACCATCATCA AAGACCAAAAGTAGATAAAACCACAAAGATGGGGAAAAAACAGAACAGAAAAACTGGAAACTCTAAAA CACAGAGCGCCTCTCCTCCTCCAAAGGAACGCAGTTCCTCACCAGCAACAGAACAAAGCTGGATGGAGA ATGATTTTGACGAGCTGAGAGAAGAAGGCTTCAGACGATCAAATTACTCTGAGCTACGGGAGGACATTCA 20AACCAAAGGCAAAGAAGTTGAAAACTTTGAAAAAAATTTAGAAGAATGTATAACTAGAATAACCAATACAGAGAAGTGCTTAAAGGAGCTGATGGAGCTGAAAACCAAGGCTCGAGAACTACGTGAAGAATGCAGAAG CCTCAGGAGCCGATGCGATCAACTGGAAGAAAGGGTATCAGCAATGGAAGATGAAATGAATGAAATGAA GCGAGAAGGGAAGTTTAGAGAAAAAAGAATAAAAAGAAATGAGCAAAGCCTCCAAGAAATATGGGACT ATGTGAAAAGACCAAATCTACGTCTGATTGGTGTACCTGAAAGTGATGTGGAGAATGGAACCAAGTTGGA 25 AAACACTCTGCAGGATATTATCCAGGAGAACTTCCCCAATCTAGCAAGGCAGGCCAACGTTCAGATTCAG GAAATACAGAGAACGCCACAAAGATACTCCTCAAGAAGAGCAACTCCAAGACACATAATTGTCAGATTC ACCAAAGTTGAAATGAAGGAAAAAATGTTAAGGGCAGCCAGAGAGAAAGGTCGGGTTACCCTCAAAGGA AAGCCCATCAGACTAACAGCGGATCTCTCGGCAGAAACCCTACAAGCCAGAAGAGAGTGGGGGCCAATA TTCAACATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAAACTAAGCTTCATAAGTG 30 AAGGACAAATAAAATACTTTATAGACAAGCAAATGCTGAGAGATTTTGTCACCACCAGGCCTGCCCTAAA AGAGCTCCTGAAGGAAGCGCTAAACATGGAAAGGAACAATCGGTACCAGCCGCTGCAAAATCATGCCAA AATGTAAAGACCATCAAGACTAGGAAGAAACTGCATCAACTAATGAGCAAAATCACCAGCTAACATCAT AATGACAGGATCAAATTCACACATAACAATATTAACTTTAAATGTAAATGGACTAAATTCTGCAATTAAA AGACACAGACTGGCAAGTTGGATAAAGAGTCAAGACCCATCAGTGTGCTGTATTCAGGAAACCCATCTCG 35 CGTGCAGAGACACACATAGGCTCAAAATAAAAGGATGGAGGAAGATCTACCAAGCCAATGGAAAACAA AAAAAGGCAGGGGTTGCAATCCTAGTCTCTGATAAAACAGACTTTAAACCAACAAAGATCAAAAGAGAC AAAGAAGGCCATTACATAATGGTAAAGGGATCAATTCAACGAGAGGAGCTAACTATCCTAAATATTTATG CACCCAATACAGGAGCACCCAGATTCATAAAGCAAGTCCTGAGTGACCTACAAAGAGACTTAGACTCCC ACACATTAATAATGGGAGACTTTAACACCCCACTGTCAACATTAGACAGATCAACGAGACAGAAAGTCA 40 ACAAGGATACCCAGGAATTGAACTCAGCTCTGCACCAAGCAGACCTAATAGACATCTACAGAACTCTCCA CCCCAAATCAACAGAATATACATTTTTTTCAGCACCACACCACACCTATTCCAAAATTGACCACATAGTTG 45735311.127 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT GAAGTAAAGCTCTCCTCAGCAAATGTAAAAGAACAGAAATTATAACAAACTATCTCTCAGACCACAGTGC AATCAAACTAGAACTCAGGATTAAGAATCTCACTCAAAGCCGCTCAACTACATGGAAACTGAACAACCTG CTCCTGAATGACTACTGGGTACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAACGAG AACAAAGACACCACATACCAGAATCTCTGGGACGCATTCAAAGCAGTGTGTAGAGGGAAATTTATAGCA 5 CTAAATGCCCACAAGAGAAAGCAGGAAAGATCCAAAATTGACACCCTAACATCACAATTAAAAGAACTA GAAAAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATAACTAAAATCAGAGCAGAACT GAAGGAAATAGAGACACAAAAAACCCTTCAAAAAATCAATGAATCCAGGAGCTGGTTTTTTGAAAGGAT CAACAAAATTGATAGACCGCTAGCAAGACTAATAAAGAAAAAAAGAGAGAAGAATCAAATAGACACAA TAAAAAATGATAAAGGGGATATCACCACCGATCCCACAGAAATACAAACTACCATCAGAGAATACTACA 10 AACACCTCTACGCAAATAAACTAGAAAATCTAGAAGAGATGGATACATTCCTCGACACATACACTCTCCC AAGACTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCAATAACAGGCTCTGAAATTGTGGCAATAAT CAATAGTTTACCAACCAAAAAGAGTCCAGGACCAGATGGATTCACAGCCGAATTCTACCAGAGGTACAT GGAGGAACTGGTACCATTCCTTCTGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCCTAACTCA TTTTATGAGGCCAGCATCATTCTGATACCAAAGCCGGGCAGAGACACAACCAAAAAAGAGAATTTTAGA 15 ACAATATCCTTGATGAACATTGATGCAAAAATCCTCAATAAAATACTGGCAAACCGAATCCAGCAGCACA TCAAAAAGCTTATCCACCATGATCAAGTGGGCTTCATCCCTGGGATGCAAGGCTGGTTCAATATACGCAA ATCAATAAATGTAATCCAGCATATAAACAGAGCCAAAGACAAAAACCACATGATTATCTCAATAGATGC AGAAAAAGCCTTTGACAAAATTCAACAACCCTTCATGCTAAAAACTCTCAATAAATTAGGTATTGATGGG ATGTATTTCAAAATAATAAGAGCTATCTATGACAAACCCACAGCCAATATCATTCTGAATGGGCAAAAAC 20CGGAAACATTCCCTTTGAAAATTGGCACAAGACAGGGATGCCCTCTCTCACCGCTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATCAGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGAAAAAGAGGA AGTCAAATTGTCCCTGTTTGCAGACGACATGATTGTTTATCTAGAAAACCCCATCGTCTCAGCCCAAAATC TCCTTAAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATACAAAATCAATGTACAAAAATCACAAGCATT CTTATACACCAACAACAGACAAACAGAGAGCCAAATCATGAGTGAACTCCCATTCACAATTGCTTCAAAG 25 AGAATAAAATACCTAGGAATCCAACTTACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTACAAACCA CTGCTCAAGGAAATAAAAGAGGACACAAACAAATGGAAGAACATTCCATGCTCATGGGTAGGAAGAATC AATATCGTGAAAATGGCCATACTGCCCAAGGTAATTTACAGATTCAATGCCATCCCCATCAAGCTACCAA TGACTTTCTTCACAGAATTGGAAAAAACTACTTTAAAGTTCATATGGAACCAAAAAAGAGCCCGCATCGC CAAGTCAATCCTAAGCCAAAAGAACAAAGCTGGAGGCATCACACTACCTGACTTCAAACTATACTACAA 30 GGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGAGCAATGGAACAGAACAGA GCCCTCAGAAATAATGCCACATATCTACAACTATCTGAGCTTTGACAAACCTGAGAAAAACAAGCAATGG GGAAAGGATTCCCTATTTAATAAATGGTGCTGGGAAAACTGGCTGGCCATATGTAGAAAGCTGAAACTGG ATCCCTTCCTTACACCTTATACAAAAATTAATTCAAGATGGATTAAAGATTTAAACGTTAGACCTAAAACC ATAAAAACCCTAGAAGAAAACCTAGGCATTACCATTCAGGACATAGGCGTGGGCAAGGACTTCATGTCT 35 AAAACACCAAAAGCAATGGCAACAAAAGCCAAAATTGACAAATGGGATCTAATTAAACTAAAGAGCTCC TGCACAGCAAAAGAAACTACCATCAGAGAGAACAGGCAACCTACAACATGGGAGAAAATTTTCGCAACC TACTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACAAGAAAAAAACA AACAACCCCATCAAAAAGTGGGCGAAGGACATGAACAGACACTTCTCAAAAGAAGACATTTATGCAGCC AAAAAACACATGAAAAAATGCTCACCATCACTGGCCATCAGAGAAATGCAAATCAAAACCACAATGAGA 40 TACCATCTCACACCAGTTAGAATGGCAATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGT GGAGAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGT 45735311.128 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT GGCGATTCCTCAGGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCC AAAGGACTATAAATCATGCTGCTATAAAGACACATGCACATGTATGTTTATTGCGGCACTATTCACAATA GCAAGGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGAAAATGTGGCACATATAC ACCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATGAAATTGG 5 AAACCATCATTCTCAGTAAACTATCACAAGAACAAAAAACCAAACACCGCATATTCTCACTCATAGGTGG GAATTGAACAATGAGATCACTTGGACACAGGAAGGGGAATATCACACTCTGGGGACTGTTGTGGGGTGG GGGGAGGGGGGAGGGATAGCATGGGAGATATACCTAATGCTAGATGACACGTTAGTGGGTGCAGCGCAC CAGCATGGCACATGTATACATATGTAACTAACCTGCACAATGTGCACATGTACCCTAAAACTTAGAGTAT AATAAAAAAAAAAAAATTTAAAAAAAAAAAAAAAATGCAAGTTTAGTTAACATTTTCAGCCAGCATGCT 10 AAACCTTGTGATGAAGTCATAGGGTCTTATACTCACGATTTGATAACATAATAGAACTATTAAAAGAAGT CTGATTCATTAAAAAAAAAAAAAAATGTCAGGCATCACAAACAGGGAAACCTATAAATGAGAAATTTGG CTGCAGTCAGTCCCAGGGGACTCTCTGGCACTGGTGCTGTGGGGACTCACAGTTTAATCAGTTAAATCTG CATCAGGAAGTCAGCTCCCCTTCTGCTGCACCCGCTGGTGTCACAGAGGTCCTGAGCATCAAGCCAACAC CTCCTGCTGAGTAGCAAAACGCTTGTGCCACCTGCCATCCTGGGGAAAACAGCCATGCTGCTGGAGAGTG 15 TAATCAATGGAGAGAGAGCCCGGTCACTTCTGCCATCTTGCTCTCCTCCCACCTGGGAATAGAAGTGACA ACTATTGAGCCATCAGAATGAAAATCTTTACTAGCCCTGCAGTGATCCAGGTACATAGAGTGACCTGCAA CACTACAGTTTTAGGAAGGATATTGATTGTCTTATCTAACAGGAAAATGTGAACCCAGTTTATATTTTAGG TTAACTCTGTCTCAGGCTTTCTCACTTTGGTTCTTTCACACATATTCAACAAACATCCATTGTCTGTAATGT TCCAGGCACTGTTCTAGGTCATATGAAAAATCAGAATTGAACAGACATAGCCACTTACTCTCAAAGAGTT 20TACTATTCAGTAAAAGGAAAGAAGATAAGTGCAATATAAAGTTATAATGATACAAGACAGGTGTGTCTATTTGCATATATATTTATATAAAAATGAATAAAATCTTGAGGCTATTTTTATTTAATAACGTCTCAGGATACT ATAAGAGGTGAGGAGAAGGGCCAATGGATTGAGATTCACTAATGACTCAAGGTATGATAATTACTATTCT CTGTTGTTTTTAAAAAAACTTTTCTTCATGTAATGATCTACGGGCATTTTT (SEQ ID NO:1). However, the composition can include fragments of L1 RNA, for example. The L1 open 25 reading frame 1 (ORF1), alone or preceded by a 5΄ untranslated region (UTR), or the an open reading frame 2 (ORF2). ORF2 expression constructs are disclosed for example, in Gasior, et al., J. Mol. Biol., 357(5):1383-1393 (2006). The methods can include for example, the steps of harvesting cells from a subject, culturing the cells, transducing them with an expression vector including DNA encoding L1 RNA or L1 30 RNA, and maintaining the cells under conditions suitable for expression of the encoded RNA. These methods are known in the art of molecular biology. In a preferred embodiment, the cells are autologous to the subject being treated. A preferred host cells are mesenchymal stem cells. 1. Vectors Vectors encoding L1 RNA also provided. Nucleic acids, such as those described 35 above, can be inserted into vectors for expression in cells. As used herein, a “vector” is a replicon, such as a plasmid, phage, virus or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Vectors can be expression vectors. An “expression vector” is a vector that includes one or more expression control sequences, and an 45735311.129 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT “expression control sequence” is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence. Nucleic acids in vectors can be operably linked to one or more expression control sequences. For example, the control sequence can be incorporated into a genetic construct so that 5 expression control sequences effectively control expression of a coding sequence of interest. Examples of expression control sequences include promoters, enhancers, and transcription terminating regions. A promoter is an expression control sequence composed of a region of a DNA molecule, typically within 100 nucleotides upstream of the point at which transcription starts (generally near the initiation site for RNA polymerase II). To bring a coding sequence under the 10 control of a promoter, it is necessary to position the translation initiation site of the translational reading frame of the polypeptide between one and about fifty nucleotides downstream of the promoter. Enhancers provide expression specificity in terms of time, location, and level. Unlike promoters, enhancers can function when located at various distances from the transcription site. An 15 enhancer also can be located downstream from the transcription initiation site. A coding sequence is “operably linked” and “under the control” of expression control sequences in a cell when RNA polymerase is able to transcribe the coding sequence into mRNA, which then can be translated into the protein encoded by the coding sequence. Suitable expression vectors include, without limitation, plasmids and viral vectors derived 20 from, for example, bacteriophage, baculoviruses, tobacco mosaic virus, herpes viruses, cytomegalo virus, retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen Life Technologies (Carlsbad, CA). Recent transfection studies have investigated minicircle DNA (mcDNA), nucleic 25 acids that are derived from pDNA by recombination that removes bacterial sequences. L1 RNA can be introduced into host cells using mcDNA using methods known in the art (Mun et al. Biomaterials, 2016;101:310–320). Nonviral vectors for oligonucleotide delivery include inorganic material-based delivery systems, lipid based nanocarriers, polymeric vectors, for example, poly(lactide-co-glycolide) 30 (PLGA) is a copolymer of poly lactic acid (PLA) and poly glycolic ac 3D scaffold-based delivery systems, chitosan, dendrimer based vectors, cell derived membrane vesicles and 3D scaffold-based delivery systems (reviewed in Fu, et al., ExRNA 1, 24 (2019). https: / / doi.org / 10.1186 / s41544-019- 0024-y). 45735311.130 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Inorganic materials, including gold nanoparticles (AuNPs), mesoporous silicon, graphene oxide and Fe3O4-mediated NPs, are widely used in nanotechnologies and have been developed as vectors to deliver NA. Functional groups such as thiol and amino groups can be easily attached to the surface of AuNPs, and these chemically modified AuNPs have been employed as NA vehicles. 5 Dendrimers are three-dimensional, hyperbranched globular nanopolymeric materials. A carrier denoted as NGO-PEG-dendrimers for miRNA delivery is known and can be adapted for delivery of the nucleic acids disclosed herein. For example, NGO-PEG-dendrimers / anti-miRNA-21 have been fabricated by conjugating PAMAM dendrimers and PEG-functionalized nanographene oxide (NGO) to 2′-O-methyl-modified NA. 10 3D biomaterial scaffolds can efficiently maintain the therapeutic effects of delivered NBA. At present, various 3D-scaffold types have been developed for NA delivery, including hydrogels, electrospun fibers, and other more abundantly porous or spongy 3D-scaffolds. 2. Host Cell Transformation Vectors containing nucleic acids to be expressed can be transferred into host cells. The term 15 “host cell” is intended to include bone progenitor cells into which a recombinant expression vector can be introduced. As used herein, “transformed” and “transfected” encompass the introduction of a nucleic acid molecule (e.g., a vector) into a cell by one of a number of techniques. Although not limited to a particular technique, a number of these techniques are well established within the art. Nucleic acids can be transfected into mammalian cells by techniques including, for example, 20 calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, or microinjection. Preferred host cells include mesenchymal stem cells. The transduction step can be accomplished by any standard means used for ex vivo gene therapy, including, for example, calcium phosphate, lipofection, electroporation, viral infection, and biolistic gene transfer. Alternatively, liposomes or polymeric microparticles can be used. Cells that 25 have been successfully transduced then can be selected, for example, for expression of the coding sequence or of a drug resistance gene. The cells then can be lethally irradiated (if desired) and injected or implanted into the subject. Effective strategies for nonviral transfection of MSCs ex vivo typically employ disruption of cell membranes to transfer nucleic acids into cells (e.g. microinjection, electroporation, and 30 microporation) or packaging of nucleic acids with nanocarrier materials that facilitate cellular internalization through endocytosis. The primary alternative to electroporation for nucleic acid transfer into MSCs ex vivo is transfection with nanocarriers, materials that electrostatically condense or encapsulate nucleic acids into nanoparticles or aggregate complexes that favorably associate with cell membranes through 45735311.131 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT charge interactions or surface receptor binding, and are subsequently internalized via macropinocytosis, clathrin-mediated endocytosis, or caveolae-mediated endocytosis, depending primarily on nanoparticle size and charge. Carriers have been demonstrated to facilitate transfection of MSCs, including, but are not limited to, polymers, lipids, polysaccharides, peptides, and 5 inorganic materials. Examples include, but are not limited to nano-hydroxyapatite (nHA), the ubiquitous cationic polymer transfection reagent 25 kDa branched polyethylenimine (bPEI), preferably functionalized with hyaluronic acid, and repeating arginine–alanine-leucine-alanine (RALA) amphipathic peptide, poly(amidoamine) (PAMAM), poly(β-amino-esters) (PBAE), PEI- coated PLGA nanoparticles etc., reviewed in Hamann, et al., J. Biol. Eng., 13:7 (2019). 10 Cell culture conditions for improving transcription efficiency can be used to ensure efficient uptake of the nucleic acid being introduced into the cell. Transformed cells are preferably separated and cultured to harvest dsRNA-primed secretome / exosomes. The transformed cells may be cultured in any suitable system, including, but not limited to, 15 two and / or three-dimensional scaffolds using any form of suspension, traditionally a liquid / gel suspension and in a controlled static or dynamic system, such as spinner bottles and / or bioreactors. In general, the process starts with cells being transfected with Line 1 RNA or dsRNA and then cultured in culture media. The media may be conditioned by dsRNA primed-stromal cells, parenchymal cells, 20 mesenchymal stem cells, liver reserve cells, neural stem cells, pancreatic stem cells, and / or embryonic stem cells. This is described in detail in U.S. Pat. No.6,372,494, the entire contents of which are hereby fully incorporated herein by reference for all purposes. Stromal Cells: fibroblasts with or without other cells and / or elements found in loose connective tissue, including but not limited to, endothelial cells, pericytes, macrophages, 25 monocytes, plasma cells, mast cells, adipocytes, mesenchymal stem cells, liver reserve cells, neural stem cells, pancreatic stem cells, chondrocytes, prechondrocytes, etc. Tissue-Specific or Parenchymal Cells: the cells which form the essential and distinctive tissue of an organ as distinguished from its supportive framework. Once the cell medium is conditioned as described herein, it may be used in any state. 30 Physical embodiments of the conditioned medium include, but are not limited to, liquid or solid, frozen, lyophilized or dried into a powder. Additionally, the medium may be formulated with a pharmaceutically acceptable carrier as a vehicle for internal administration, formulated with a salve or ointment for topical applications, or, for example, made into or added to surgical glue to 45735311.132 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT accelerate healing of sutures following invasive procedures. In some forms, the medium is further subjected to processing steps required to isolate exosomes. A preferred method of producing dsRNA-primed secretome / exosomes from is provided in the Examples (incorporated herein by reference), using mesenchymal stem cells. 5 B. Methods of Using The compositions are administered to a subject in need of tissue repair. Data in the present application demonstrates enrichment of several factors, including the ones listed below, in the dsRNA secretome: Interleukin 8 (IL-8), which is an inflammatory chemokine involved in several regenerative 10 processes, such as skin wound healing,71therapeutic angiogenesis after stroke and ischemia,72 73and osteochondral bone repair.74 75Tumor necrosis factor-inducible gene 6 (TSG6) is among the top 10 proteins enriched in the bulk secretome of L1-primed osteoblasts compared to RFP. TSG6 is an inflammatory factor whose administration was proven to have therapeutic effect in corneal wounds, myocardial infarction, injured central nervous system, chronic liver damage and intervertebral disc 15 degeneration.76 77 787980Moreover, TSG6 induces autophagy influx in vivo and in vitro.79This is particularly relevant in bone, as osteoblasts use autophagic vacuoles to secrete apatite crystal.70Another protein positively involved in autophagy and found specifically in the secretome of L1 primed osteoblasts is ATG7 (Autophagy related 7), whose osteoblast specific conditional knockout in mice reduces bone mass at both developmental and adult age.81 Type 1 lysophosphatidic acid 20 receptor (LPAR1) is also specifically secreted by L1-primed osteoblasts and positively involved in bone mineralization in vitro and in vivo.82 83In one embodiment the tissue repair is a bone fracture site. One of ordinary skill in the art appreciates that sites such as an osteoporotic site have a different microenvironment than a bone fracture / injury site or a burn injury site. 25 In other embodiments, the tissue repair site is not a bone fracture site. In some forms, the tissue repair site is a wound healing site. Exemplary subjects include post-menopausal women, subjects diagnosed with osteoporosis, subjects on antiretroviral therapy, for example, NRT1. In preferred embodiment, the conditioned medium of the invention is used in wound 30 healing. Examples include, but are not limited to, applying the conditioned cell medium to the gauze of a bandage (adhesive or non-adhesive) and used in topical applications to promote and / or accelerate wound healing. Again, the conditioned medium may be processed to concentrate or reduce one or more components to enhance wound healing. The compositions may be lyophilized / freeze-dried and added as a wound filler or added to existing wound filling 45735311.133 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT compositions to accelerate wound healing. Alternatively, the medium may be added to a hydrogel composition and used as a film for topical wound treatments and anti-adhesion applications. In some forms, the secretome is incorporated into or formulated into an eye drops for corneal regeneration and products for tooth remineralization. 5 The present invention can be further understood in view of the following non-limiting examples. EXAMPLES Materials and Methods 10 Participants and ethics Femoral bone biopsies were obtained from the caput region of postmenopausal women or men with a wide BMD range, i.e., from healthy to osteoporotic, who were undergoing hip replacement surgery due to osteoarthritis or fracture at Lovisenberg Diaconal Hospital (Oslo, Norway) or Diakonhiemmet Hospital (Oslo, Norway), respectively. The donors of femoral bone are 15 listed in Table 1. The postmenopausal iliac bone donors were recruited from the outpatient clinic of Lovisenberg Diaconal Hospital (Oslo, Norway). Candidates filled out a questionnaire including medication and lifestyle factors and selected donors were deemed representative of the Oslo-based Norwegian ethnic female population aged 50 to 86 years. The iliac bone donors are listed in Table 20 2, and have been described previously in detail.94All donors taking medication or having diseases other than primary osteoporosis known to affect bone metabolism, were excluded. Presence of bone impairing diseases / conditions was excluded by extensive biochemical serum and urine analyses supported by X-ray examinatioons. Site-specific BMD of all donors was evaluated with Lunar Prodigy DEXA (GE Lunar, Madison, WI, USA) following the manufacturer's instructions. The 25 precision of the instrument for measuring the lumbar spine (L2–L4) and hip BMD was 1.7% and 1.1%, respectively. The study was approved by the Norwegian regional Ethical Committee (REK no 2010 / 2539, Norway), all volunteers gave their written informed consent, and sampling and procedures were according to the Act of Biobanking in Norway. Cell culture 30 For L1 RNA transfection experiments, human MSCs were isolated from osteoporotic femoral heads with the consent of the patient according to Swiss (BASEC-Nr.2016-02159) ethical guidelines. Femoral heads were crushed and incubated in DMEM (PAN Biotech, Germany, Cat. No. P04-03550) supplemented with 1% (v / v) 100× Penicillin-Streptomycin Solution (Biowest, France, Cat. No. L0022), 10% (v / v) FCS (Biowest, France, Cat. No. S181S), 1% (v / v) 200 mM L- 45735311.134 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT glutamine solution (Sigma, USA, Cat. No. G7513), 5 ng / ml FGF-2 (Sigma, USA, Cat. No. F0291), and 10 ng / ml FGF-4 (Sigma, USA, Cat. No. F8424) in a humidified atmosphere containing 5% CO2. To induce osteogenic differentiation, MSCs were seeded on Nunc™ 24-well plates (Thermo Fisher, USA, Cat. No.142475) or 48-well plates (Thermo Fisher, USA, Cat. No.150687) at a 5 density of 1.5 × 104cells / cm2. After 24 h, differentiation was induced using StemPro® Osteogenesis Kit (Gibco / Life Technologies, USA, Cat. No. A10072-01). The medium was exchanged every 3 days. Cells were treated with Lamivudine 3TC (Sigma), 1 μMfinal concentration; C16 (Merck), 500 nMfinal concentration; G140 (InvivoGen), and 150 μMfinal concentration. 10 L1 RNA transfection The vector human-L1_pBluescript II sk (+) carrying the full-length L1 sequence was custom-prepared by GenScript, USA. Large-scale human L1 mRNA was in vitro transcribed, modified, and purified by TriLink Biotechnologies, USA, (ARCA capped and 2’Omethy- malted (CapI), fully substituted with 5-methyl-C, 25% substitution of Cyanine-5-U and 75% substitution of 15 Pseudo-U, enzymatically polyadenylated, DNase and phosphatase treated, silica membrane purified). Synthetic L1 RNA was transfected in MSCs differentiat- ing to osteoblasts at day 5 using LipofectamineTMMessengerMAXTM(Invitrogen, USA, Cat. No. LMRNA003) with a modified protocol for low RNA amount. RFP mRNA (System Bioscience, USA, Cat. No. MR800A-1) was used as a negative control. Bone matrix was quantified with OsteoImage Mineralization Assay 20 (Lonza, Basel, Switzerland, Cat. No. LOPA503) and Alizarin Red staining. In conditioned media experiments, the medium was exchanged 6 h after transfection. Conditioned medium was collected after three days and delivered to the recipient, differentiating osteoblasts at day 5. In knockdown experiments, siRNAs were transfected with Lipofectamine RNAiMAX (Thermo Scientific) in differentiating osteoblasts at day 3, followed by L1 RNA transfection at day 7. 25 siRNAs: EIF2AK2- Targeting SMARTpool (Dharmacon, Horizon, E-003527-00-0010), MB21D1-Targeting SMARTpool (Dharmacon, Horizon, L-015607-02-0020), Non-targeting Pool (D-001810-10). Quantitative mineralization assay Cells were washed in PBS and fixed in 4% (v / v) formaldehyde (Sigma, USA, Cat. No. 30 F8775) in 1× PBS for 15 minutes. Mineralization was assessed by using the OsteoImage Mineralization Assay (Lonza, Basel, Switzerland, Cat. No. LOPA503) according to manufacturer’s indication. Mineralization was quantified with GloMax® discover microplate reader (Promega, USA) selecting appropriate excitation (492) / emission (520) wavelengths. 45735311.135 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Table 1: COHORT OF FEMORAL BONE BIOPSIES45735311.136 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Table 3. Primers Primer Name FW Sequence Rev Sequence Ll S'UTR-ORFl GAATGATTTTGACGAGCTGAGAGAA GTCCTCCCGTAGCTCAGAGTAATT 45735311.137 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT ALPL ACTGGTACTCAGACAACGAGAT ACGTCAATGTCCCTGATGTTATG Osteoblasts were washed with 1× PBS (Kantonsapotheke Zürich, Switzerland, Cat. No. A171012) and fixed with 4% (v / v) formaldehyde (Sigma, USA, Cat. No. F8775) in 1× PBS for 5 30 min. After washing twice with ddH2O, Alizarin Red staining solution (0.7 g Alizarin Red S (Sigma, USA, Cat. No. A5533) diluted in 50 ml ddH2O at pH = 4.2) was added for 20 min. Afterwards, cells were washed four times with ddH2O, dried, and stored in the dark until image acquisition. For absorbance measurement, Alizarin Red S was eluted from stained osteoblasts with 300 μl 10% (w / v) cetylpyridinium chloride in an aqueous 0.01 M Na2HPO4 / NaH2PO4solution at 10 pH = 7 for 1 h. One hundred fifty microliters were transferred on a 96-well plate, and absorbance was measured at 560 nm. Ten percent (w / v) cetylpyridinium chloride in an aqueous 0.01 M Na2HPO4 / NaH2PO4 solution was used as blank. Immages were acquired, processed and analysed as previously described95ALPL activity assay 15 ALPL activity as previously described.96Briefly, cells were fixed in 3.7% formaldehyde at RT for 10’ and then stained with a solution of 25% naphthol AS-BI phosphate (Thermo) and 0.75% Fast Blue BB (Sigma) dissolved in 0.1 M Tris buffer (pH 9.3) at RT for 15’. After staining, cells were quickly washed with PBS five times. ENPP1 activity assay 20 ENPP1 activity was calculated colorimetrically using the chromogenic substrate p- nitrophenyl-thymidine-5′-monophosphate, as described in (Ferreira et al., 2013). After PBS washing, cells were lysed in a solution of 0.1% Triton X-100, 0.2 M Tris-base, 1.6 mM MgCl2, pH 8.1. About 50 ml of 1mM thymidine monophosphate p-nitrophenyl ester (Sigma) were added to 50 ml of cell lysate and incubated for 1 hour at 37°C. Then, four volumes of 0.1M NaOH were added 25 to stop the reaction and absorbance was read at 410 nm using a spectrophotometer (Tecan Nanoquant Infinite 200 Pro Multimode). Absorbance was normalized to DNA content. 45735311.138 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Table 2: COHORT OF ILIAC BONE BIOPSIES45735311.139 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Immunohistochemistry Cells were fixed in 4% paraformaldehyde in PBS at room temperature (RT) for 10’. After fixation, cells were permeabilized in 3% Triton X-100 in PBS for 3’ at RT. Blocking was performed with 4% BSA in PBS for 30’ at RT. After blocking, cells were incubated with primary 5 antibodies overnight at 4°C, then washed with PBS and incubated with secondary antibodies for 1 hour at RT. After washing with PBS, nuclei were stained with Hoechst (Thermo Scientific) and mounted using Fluoro Gel with DABCO™ Mounting Medium (Electron Microscopy Sciences). Primary antibodies: DNA-RNA Hybrid (mouse, Merck Millipore, MABE1095), dsRNA (mouse, Merck Millipore, MABE1134). 10 RNA extraction and cDNA preparation Cells were harvested and resuspended in 1ml of QIAzol Lysis reagent (Qiagen, Cat. No.79306). Total RNA was then purified with RNeasy Plus Mini kit (Qiagen, cat. No.74134) with minimal modifications to manufacturer’s instructions. DNase treatment (RNase free DNase set, Qiagen, Cat. No.79254) was performed to remove any residual DNA. RNA quality and 15 concentration were checked using a NanodropTM2000 spectrophotometer (ThermoFisher). cDNA was synthesized from 200ng of each RNA sample using a Superscript III first-strand cDNA synthesis system (ThermoFisher, cat. No.18080051) according to manufacturer’s protocol. Processing of human bone biopsies and RNA isolation has been described previously.94Gene expression analysis 20 Real time quantitative polymerase chain reaction (qPCR) was performed with 7900HT Fast Real Time PCR system (Applied Biosystems). Each sample was analyzed in triplicate and normalized with the endogenous control Ribosomal Protein L13A (RPL13A) for cDNA input concentration. No template and no RT were included as negative controls. For each 15 µl reaction, 10ng (1ng for L1) of cDNA was mixed with 1 µM specific primers mix and 7.5 µl of SybrTMSelect 25 Master mix (Applied Biosystems, USA, Cat. No.4472908). The reaction was incubated at 95°C for 10 minutes, followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds and elongation at 72°C for 30 seconds. Ct values were calculated by 7900HT Fast Real Time PCR RQ manager software (Applied Biosystems, USA) and then normalized as ΔCt between the gene of interest and the endogenous calibrator. Primers used in this study for gene expression 30 analysis were designed using Primer3 (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). In all primer pairs each primer matches a different exon. Amplicons length was 80-130 nucleotides. Primers sequences are reported in Table 3. 45735311.140 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Cell cycle analysis 2x105MSCs were trypsinized for 5 min at 37°C, washed with PBS and 2% BSA, passed through a 70 µM strainer (Corning, USA, Cat. No.352350) and then fixed at -20°C for 30 min in 70% ethanol. After washing with PBS and 4% BSA, cells were resuspended in PBS and incubated 1 5 hour at 37°C with RNase. Cells were then washed and resuspended in 100 µl of Flow Cytometry Staining Buffer (R&D System, USA, Cat. No. FC001).10 µl of 1mg / ml Propidium iodide (PI) staining solution (Invitrogen, USA, Cat. No. P3566) was added to the single cell solution, gently mixed, and incubated 5 min in the dark. Cell cycle analysis was performed on BD FACSCanto II Flow Cytometry System (BD-Biosciences), using BD FACSDiva Software (BD-Biosciences). 10 RNA-seq and data analysis RNA from human bone biopsies was sequenced at the Human Genotyping facility (HuGe-F) of Erasmus MC. Total RNA-seq library, from L1 RNA delivery experiments, was prepared with CORALL Total RNA library prep with RiboCop rRNA for Human / Mouse / Rat depletion kit (Lexogen GmbH, Vienna, Austria) following manufacturer’s instructions (library type: fr- 15 secondstrand) by IGA Technology service (Italy). Final libraries were checked with both Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) and Agilent Bioanalyzer DNA assay or Caliper (PerkinElmer, Waltham, MA). Libraries were then prepared for sequencing and sequenced on paired-end 150 bp mode on NovaSeq6000 (Illumina, San Diego, CA). RNA-seq read quality control (QC) analyses and filtering of high-quality reads were executed using FastQC v0.11.9 20 (http: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ) and BBDuk v35.85 (https: / / jgi.doe.gov / data-and-tools / software-tools / bbtools / bb-tools-user-guide / bbduk-guide / ) by setting a minimum read length of 35 bp and a minimum Phred-quality score of 25. After trimming quality control, high-quality reads were aligned to the human genome reference (GRCh38) with STAR 2.7.3a,97while FeatureCounts 1.6.3 package98was used to assign reads to genes. Next, lowly 25 expressed genes across one or more experimental conditions were filtered to eliminate the “uninformative” genes using HTSFilter v1.30.1.99Filtered gene data were further processed with the EdgeR package v3.32.1100to normalize (Trimmed Mean of M-7 values, TMM, method) the raw counts and perform differential gene expression analysis. Multiple testing correction was performed with the FDR method101and significance level was set at FDR < 0.05. Gene Ontology (GO) term 30 enrichment was analyzed performing hypergeometric tests11 for each individual term and FDR correction was applied (FDR < 0.05). Expression of Interspersed Repeat elements was quantified using SQuiRE 0.9.9.92 (https: / / github.com / wyang17 / SquIRE). SQuiRE provides locus-specific expression quantification along with subfamily-level expression estimates counting unambiguously mapped reads, as well as ambiguously mapped reads using an expectation– maximization (EM) 45735311.141 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT algorithm.102Briefly, reference genome and Repeatmasker annotation were dowloaded from UCSC and prepared for the analysis with squire Fetch and squire Clean, respectively. High-quality reads were mapped against the reference genome with STAR using squire Map and expression was quantified with squire Call. Differential expression analysis was performed with squire Call. 5 DIA-MS analysis using TimsTOF MS Total protein extracts were prepared with RIPA buffer (50mMTris-cl pH 8.0, 5 mM EDTA, 150 mM Nacl, 15mM MgCl2, 1% NP-40, 1 mM PMSF and 1X Protease Inhibitor Cocktail (PIC)). Further sonication step was included: (30S ON, 30S OFF, 10 cycles with Bioruptor). Equal 50 mg protein extracts were concentrated to 30 ml volume, then diluted in 8M urea in 0.1M Tris-HCl, 10 followed by protein digestion with trypsin, according to the FASP protocol.103After an overnight digestion, the peptides were eluted from the filters with 25mM ammonium bicarbonate buffer. The eluted peptides were processed in the desalting step by using Sep-Pag C18 Column (waters) based on the manufacture’s instruction. Approximately 200 ng of peptide mixture per sample was analyzed using a timsTOF Pro 2 QTOF mass spectrometer coupled with a nanoElute liquid 15 chromatography system (Bruker Daltonik GmbH, Germany). The sample was injected directly into a RP-C18 Aurora emitter column (75 µm i.d.× 250 mm, 1.6 μm, 120 Å pore size) (Ion Opticks, Australia) using a one-column separation method. An 80-min gradient was established using mobile phase A (0.1% FA in H2O) and mobile phase B (0.1% FA in Acetonitrile): 2–25% B for 60 min, 25–37% for 10 min, ramping 37% to 95% in 5 min, and maintaining 95% B for 5 min. The column 20 temperature was set at 50oC and the flow rate at 250 nl / min. The sample eluting from the separation column was introduced into the mass spectrometer via a CaptiveSpray nano-electrospray ion source (Bruker Daltonik GmbH) with an electrospray voltage of 1.6 kV. The ion source temperature set to 180 °C and a dry gas of 3 l / min. The samples were analyzed using diaPASEF scheme104consisting of 24 cycles including a total of 48 mass width windows (13 Da (m / z) from m / z 400 to 1,000 and 25 TIMS scan range from 0.63 to 1.35 Vs cm−2 (1 / K0). The collisional energy increased linearly from 20.01 eV at 0.6 (1 / K0) to 52.00 eV at 1.35 Vs cm−2 (1 / K0). The scan range for MS and MS / MS spectra was set to 100-1700 m / z. TIMS ramping time and accumulation time were set to 100 milliseconds. The diaPASEF data were analyzed by directDIA approach using Spectronaut software (version 14) following manufacture instructions. Up or down-regulated proteins were determined 30 using the DEP (differential enrichment analysis of proteomics data) R package. Significant results (adjusted p value <0.05) were subjected to Gene Ontology enrichment analysis with clusterProfiler R package. 45735311.142 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT Western Blot Total protein extracts were prepared by lysing cells in extraction buffer (HEPES KOH [pH 8.5], NaCl 400 mM, EDTA 0.1 mM, EGTA 0.1 mM, DTT 1 mM, 1× protease inhibitor, SDS 1%). Proteins were separated by electrophoresis on BOLT 4%–12% bis-tris polyacrylamide precast gels 5 in MES buffer (Life Technologies) and transferred on 0,2um nitrocellulose membrane. Non-specific signals were blocked with 5% Milk-PBS-Tween0.5% and the membrane hybridized overnight at 4°C with primary and secondary antibodies diluted in blocking buffer. Horseradish peroxidase- conjugated secondary antibodies were revealed with the ECL chemiluminescence kit (Amersham) and signals detected with ChemiDoc (Bio-Rad). Primary antibodies: PKR (rabbit, Abcam, 10 ab32052), cGAS (rabbit, Abcam, ab224144), LINE-1 ORF1 (mouse, Merck Millipore, MABC1152), EIF2a (mouse, Abcam, ab5369), phospho-EIF2a (rabbit, Abcam, ab32157), Histone H3 (rabbit, Merk, 06-755). Exosome isolation Exosomes were isolated using Total Exosome Isolation Reagent (from cell culture media) 15 (Thermo), following manufacturer’s instructions. Exosome pellet was resuspended in 50 ml of RIPA buffer and kept on ice for 30’, mixing every 5’. Samples were then sonicated (30’’ ON / 30” OFF, 10 cycles), centrifuged at 13,000 x g for 20’ at 4°C and collected as supernatants. Statistical analysis Statistic tests used for data analysis are indicated in the figure legends. 20 Results Retrotransposon expression is triggered by fracture in vivo and correlates with bone mineral density in human weight bearing bone Inflammation is the earliest response in fracture healing. To investigate a possible involvement of transposable elements (TEs) in the sterile inflammatory response triggered by bone25 injury, TEs expression was analyzed in available time course RNA-seq data obtained from full- fracture bone healing mice model.31The analysis focused on TEs expression dynamics immediately after fracture (inflammatory stage) and observed 4 clusters of differentially expressed TEs (logFC > 0.5) between intact and post-fracture bone after 4h, a timepoint corresponding to the initiation of acute inflammation (Figure 1A). Cluster 1 includes TEs subfamilies whose expression is slightly 30 increased after fracture and during the whole healing process. Clusters 2 and 4 include TEs subfamilies that are downregulated after fracture but show increased expression at later timepoints. The major group, cluster 3, is represented by TEs subfamilies whose expression is highly and transiently upregulated after fracture (Figure 1A and 1B). Interestingly, the induction of these TEs, mostly Long Interspersed Nuclear Elements (LINEs) and Long Terminal Repeats (LTRs) (Figure 45735311.143 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 1B), is transient and limited to the earliest phase of the inflammatory stage required to initiate and orchestrate fracture repair and activate bone anabolic processes.20,21This result suggests that, in bone, retrotransposon reactivation is an early event in response to fracture, possibly linked to inflammation initiation which is fundamental for a healthy healing. Indeed, retrotransposon 5 involvement in posttraumatic regeneration was previously found in other organisms.32,33In humans, assessing gene expression dynamics immediately after fracture represents a technical and ethical hurdle. A comparison between bones experiencing different degrees of mechanical loading may represent an alternative model to study stress-induced bone anabolism in humans. Mechanically loaded bones like the femur, which are subject to recurring microfractures 10 that need to be repaired, are indicated to be more metabolically active than less loaded bones, like the iliac crest. The analysis compared the expression of TEs in trabecular bone from ilium and femoral head, two different skeletal sites, the latter experiencing higher degree of mechanical loading, anabolic demand and bone turnover.34Femur (n=48) and ilium biopsies (n=71) were isolated from a cohort of clinically well characterized donors (refer to cohort description and Table15 1 and 2). Each cohort was divided into normal (BMD T-score >-1), osteopenic (−2.5 < BMD T- score ≤ −1), and osteoporotic (BMD T-score ≤ −2.5, with at least one fragility fracture). The data showed that, globally, TEs are upregulated in healthy femur (n=27) compared to healthy ilium (n= 34) (Fig.1C and 1E). Each TEs order showed a high percentage of upregulated subfamilies, from 60% of DNA transposon to 75% of LINEs, and a low percentage of downregulated subfamilies, 20 from 9% of LTRs to 3% of SINEs and LINEs, in femur compared to ilium (Fig.1D). These results suggested a positive correlation between TEs global expression and bone anabolic activity. To further test the hypothesis, TEs expression in femur from healthy donors (n=27), osteopenic (n=12) and osteoporotic patients (n=9) whose bone anabolism is increasingly compromised was compared. As shown in Fig.2A, the global expression of TE is reduced in 25 patients. To further assess whether TEs expression is involved in local anabolism and mineral density, the femur cohort was divided according to DXA T-score measured directly in the femoral neck (FN). The cohort was divided into “high BMD” (FN T-score >-1) and “low BMD” (FN T- score <-1). Globally, TEs are upregulated in femur with high bone mineral density (Fig.2B). In particular, more than 90% of differentially expressed TEs subfamilies are upregulated (Fig.2C). 30 Interestingly, almost all SINE elements are unchanged between the two groups (Fig.2C). Finally, studies assessed whether a positive correlation exists between TEs expression levels and local mineral density (FN T-score). The data showed that approximately 30% of L1 and LTR subfamilies expressed in the femoral bone are positively correlated with local BMD (Fig.2D). Altogether these 45735311.144 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT results strongly suggest a positive involvement of TEs in response to stress-induced anabolic demand and bone mineralization. Increased cytoplasmic L1 repeat RNA stimulates osteoblast mineralization activity The in vivo evidence suggested a positive involvement of retrotransposons in post-traumatic 5 bone repair in mice, and a strong correlation between retrotransposon expression and bone mineral density in humans, differential between loaded and unloaded bone. The results were then corroborated, studying the effects of increased repeat RNA on bone-forming cells in culture. Isolated mesenchymal stem cells (MSC) from femur of healthy donors were differentiated to osteoblasts ex vivo. At day 5, a Cy5-conjugated full-length L1 RNA consensus sequence was 10 transfected. Importantly, L1 RNA is able to form intramolecular double stranded structures.35Capping, 2’-O-Methylation of 5’ end, polyadenylation (200 adenosines), full substitution with 5‐ methylcytidine (m5C) and 75% substitution with pseudouridine were used to stabilize the RNA and to bypass the intracellular innate immune system.36 37 38 39 40 41 42 43Red fluorescent protein (RFP) mRNA, with the same modifications, was included as negative control. The exogenous L1 RNA 15 accumulated in the cytoplasm (Fig.3A), and was gradually cleared by secretion along with matrix components (Fig.3B and 3C). The effect of L1 RNA delivery was tested in differentiating MSCs from two different and unrelated healthy donors. As shown, L1 RNA transfection stimulated markedly the production of mineralized matrix (Fig.3D). Osteoblast mineralization increased dose dependently with the concentration of the delivered L1 RNA, in agreement with saturation kinetics 20 (Fig.3E). Moreover, the strongly enhanced mineralization was highly specific for L1 RNA, as demonstrated by the lack of significant changes in mineral deposition in cells transfected with negative control RNA, even at concentrations 100-200-fold higher (Fig.3E). MSCs from femur of osteoporotic patients were also isolated and selected those showing a markedly delayed and reduced in vitro production of bone matrix in contrast to those derived from healthy donors (Fig.3F). 25 Strikingly, the delivery of L1 RNA triggered a strong mineralization response also in these cells, despite their clearly compromised anabolic activity (Fig.3G). These results demonstrate that the ectopic delivery of L1 RNA stimulates the mineralization of bone forming cells regardless of their prior intrinsic differentiation / anabolic potential. Osteoporotic patient-derived cells transfected with L1 RNA show a higher expression of early marker genes, with a peak 48h after L1 transfection 30 (day7) (Fig.3H). Bone Sialoprotein (IBSP), a late osteogenic gene, shows a similar profile being almost 6 times more expressed in L1 compared to RFP at day 7 (Fig.7). Strikingly, although ALP expression slightly increases at later time points (Fig.7) its activity is not enhanced in L1 treated cells. However, the activity of ectonucleotide pyrophosphatase / phosphodiesterase 1 (ENPP1) is gradually and significantly reduced by L1 RNA transfection. As ENPP1 is a major osteoblast 45735311.145 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT source of inorganic pyrophosphate (PPi), the main physiological inhibitor of mineralization,44 45 46the reduction of its activity may contribute to the enhanced mineralization observed in L1 RNA transfected cells. Altogether, these data suggest that L1 RNA induces a unique mineralizing phenotype not 5 strictly related to canonical differentiation mechanisms. L1 RNA delivery induces inflammatory pathways significantly overlapping those involved in bone fracture repair To investigate the molecular response of osteoblasts to L1 RNA transfection their transcriptome was profiled by Illumina RNA-seq 24h post-transfection. The study showed that 482 10 differentially expressed genes (DEG) (FDR<0.05) between L1 and RFP RNA-treated OB (268 upregulated and 214 downregulated). Gene ontology (GO) enrichment analysis revealed that the early transcriptional signature of L1 treated osteoblasts is typical of that of an inflammatory response (Fig.4A and 4B). This is in accordance with the recent evidence of a link between L1 and other retrotransposons accumulation in the cytoplasm and inflammatory response in vitro and in 15 vivo.5 47 7GO term enrichment analysis comparison between the early stage of fracture-induced bone healing in vivo31and differentiating osteoblasts in vitro 24h post-L1 delivery (Fig.4A) revealed a matching inflammatory response and shared upregulated pathways (Fig.4C) essential for effective bone repair.48 49 50Recruitment of neutrophil at the site of injury is also indicative of a healthy repair process, particularly in bone.51Extracellular signal-regulated kinase 1(ERK1) and 2 20 (ERK2), play crucial roles in bone formation52 53 54 55 56and seem to be the most upstream initiators of tissue regeneration in planaria.57Upon bone injury, an initial transient stage of acute inflammation is a key factor to ensure an effective regeneration48while an excessive / prolonged (chronic) inflammation is deleterious for the healing environment.58 26 59 60 61 62 63The expression of “inflammatory response” (GO:0006954) and “immune response” (GO:0006955) genes upregulated 25 by L1 RNA immediately after transfection was followed over time. As shown (Fig.4D), their expression is already strongly reduced at day 10 and almost completely silenced by day 14, suggesting the transient dynamics of the inflammatory response directly triggered by L1 RNA. This is coherent with our previous observation that exogenous L1 RNA is gradually cleared from the cell by secretion along with matrix components (Fig.3B and C), eventually terminating the initial 30 inflammatory stimulus. Cellular response to increased cytoplasmic level of L1 RNA is mediated by PKR sensor It has been previously demonstrated that the cytoplasmic accumulation of L1-derived cDNA triggers an inflammatory response mediated by the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) cytosolic DNA sensing pathway.6Immunofluorescence (IF) analysis 45735311.146 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT revealed that the exogenous L1 RNA forms DNA:RNA hybrids (Fig 10), suggesting that L1 RNA is reversed transcribed after its transfection. Notably, ORF1p is not expressed in differentiating osteoblasts nor in L1 transfected osteoblasts (Fig.8) suggesting exogenous L1 RNA is not translated. To assess whether L1-induced inflammation was dependent on the sensing of L1-derived 5 cDNA Lamivudine 3TC, G140 (Fig.5A) and siRNA-mediated knockdown of cGAS (Figure 12A- V) was used to inhibit the ORF2-mediated reverse transcription of L1 RNA and cGAS activation, respectively.64 65Unexpectedly, none of the treatments impaired the mineralization induced by L1 RNA delivery (Fig.5A, Fig.12C), suggesting that the RNA is responsible for the observed cellular response. As previously mentioned, repeats are a major source of endogenous dsRNA,8 9and L1 10 RNA, in particular, forms intramolecular dsRNA structures.35Not surprisingly, a tight colocalization between L1 RNA and dsRNA IF signal (Figure 5B) was observed. One of the main cellular sensors of dsRNA, including those derived from retrotransposons, is PKR.66PKR activation results in the phosphorylation of eukaryotic translation initiation factor 2a (eIF2α) and in the subsequent inhibition of global protein synthesis and cell growth.67Interestingly, eIF2α 15 phosphorylation has been demonstrated to promote autophagy in osteoblasts and to counteract BMD reduction in osteoporotic ovariectomized mice.68To demonstrate that L1 RNA is sensed by PKR, L1 RNA was transfected with and without the PKR inhibitor C16 and evaluated eIF2α phosphorylation by western blot (Fig.5C). The delivery of L1 RNA, but not RFP, strongly induces eIF2α phosphorylation and this effect is prevented by PKR inhibition (Fig.5C). Notably, eIF2α 20 phosphorylation occurs already 6 hours post transfection. This observation suggests that PKR activation is one of the first events induced by L1 RNA, thus corroborating the hypothesis of PKR as L1 RNA endogenous sensor. The proteome of cells was characterized 24h post-L1 RNA transfection, by diaPASEF mass spectrometry (MS).69Almost 8000 proteins were detected in each sample, noting that more than 88% of significantly differentially expressed proteins (DEP) between 25 L1 and RFP treated cells were downregulated (Figure 5D, left panel). Moreover, among the top 15 downregulated biological processes and cellular components were translation and ribosomal subunits (Fig.5C, right panels, yellow circles), indicating that L1 RNA induces the global attenuation of protein synthesis. Indeed, a cap-dependent translation shutdown is the main consequence of eIF2α phosphorylation.67Finally, the data shows that PKR Knockdown (Fig.9A, 30 B) and its enzymatic inhibition by C16 treatment (Fig.5E and 5F) prevents L1 RNA induction of inflammatory genes (Fig.5E) and mineral matrix deposition (Fig.5F, Fig.9B). As previously mentioned, a global reduction of protein synthesis occurs 24h post-L1 transfection, and only a little percentage of DEP is upregulated in L1 compared to RFP control (Fig.5D). Interestingly, these few upregulated proteins are mostly involved in autophagy and vesicle trafficking (Fig.5G). Autophagy 45735311.147 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT is a crucial process for mineralization and bone homeostasis in vitro and in vivo,70employing autophagic vacuoles as vehicles to secrete apatite crystals. Fig.10 shows the results of the metabolomic analysis of the secretomes from primed mesenchymal stem cells. This analysis is particularly noteworthy, as it demonstrates: A) The metabolic profiles of the secretomes from 5 L1RNA-primed MSCs and poly(I:C)-primed MSCs are virtually identical and distinct from that of non-primed MSCs. B) Compared to the non-primed MSC secretome, those from L1RNA- or poly(I:C)-primed MSCs are enriched with metabolites known to support tissue regeneration. Altogether these data demonstrate that the PKR-mediated sensing of L1-derived dsRNA globally attenuates the translation via eIF2α phosphorylation and indicate autophagy as a possible 10 mechanism involved in L1-induced osteoblasts mineralization. L1 RNA delivery reshapes the secretory profile of differentiating osteoblasts An inflammatory response translates into a strong secretory activity and production of paracrine signals,. Therefore, the effect of “L1-primed” osteoblast-derived conditioned medium in recipient differentiating osteoblasts was tested (Fig.6A). The data showed that the “secretome” of 15 cells transfected with L1 RNA has a significant paracrine effect on recipient osteoblasts which showed earlier formation of mineralized nodules, already 24h post the addition of conditioned media (Figure 6A, right panel), and higher deposition of mineral matrix at day 10 (Figure 6A, left panel). Bulk proteins and exosomes-derived proteins were isolated from the conditioned media of untreated, RFP- and L1-treated differentiating osteoblasts and characterized them by mass 20 spectrometry. “Bulk” as used herein refers to the whole set of proteins (soluble or contained in vesicles) that are isolated from the conditioned media. Differential expression analysis of mass spec data revealed a unique secretome content profile (for both bulk and proteoms) of L1-primed osteoblasts compared to RFP-primed and untreated osteoblasts (Fig.6B). Gene Ontology (GO) analysis of differentially expressed proteins showed an enrichment of proinflammatory factors (i.e., 25 interleukins and chemokines) involved in immune response and chemotaxis migration of immune cells (Fig.6C and D), crucial processes for tissue repair mechanisms in vivo. Proinflammatory molecules are also a major constituent of the senescence-associated secretory phenotype (SASP) whose transient delivery supports cellular plasticity and tissue regeneration. In particular, the most enriched protein in L1-specific bulk secretome is Interleukin 8 (IL-8), an inflammatory chemokine 30 involved in several regenerative processes, such as skin wound healing,71therapeutic angiogenesis after stroke and ischemia,72 73and osteochondral bone repair.74 75Tumor necrosis factor-inducible gene 6 (TSG6) is among the top 10 proteins enriched in the bulk secretome of L1-primed osteoblasts compared to RFP. TSG6 is an inflammatory factor whose administration was proven to have therapeutic effect in corneal wounds, myocardial infarction, injured central nervous system, 45735311.148 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT chronic liver damage and intervertebral disc degeneration.76 77 78 79 80Moreover, TSG6 induces autophagy influx in vivo and in vitro.79This is particularly relevant in bone, as osteoblasts use autophagic vacuoles to secrete apatite crystal.70Another protein positively involved in autophagy and found specifically in the secretome of L1 primed osteoblasts is ATG7 (Autophagy related 7), 5 whose osteoblast specific conditional knockout in mice reduces bone mass at both developmental and adult age.81Type 1 lysophosphatidic acid receptor (LPAR1) is also specifically secreted by L1- primed osteoblasts and positively involved in bone mineralization in vitro and in vivo.82 83Altogether these studies findings demonstrate that cytoplasmic L1 RNA is sensed by PKR, whose activation leads to eIF2α phosphorylation (Fig.5C) with consequent reprogramming of 10 transcription (Fig.4) and translation (Fig.5D). The ultimate consequence of L1-induced, and PKR mediated, stress response in osteoblasts is a change in the secretory content (Fig.6), the initiation of a paracrine effect (Figure 6A) and the acquisition of a unique mineralizing phenotype (Fig.3). Discussion The concerted co-option of TEs markedly changed whole regulatory networks and 15 integrated new functions into eukaryote genome.1 2 84However, while the role of TEs in evolution and phenotype variation is known, their contribution to cell physiology, particularly in somatic cells, remains to be elucidated. Indeed, aside from their role in the nucleus85 3 86 87TEs represent a major source of endogenous dsRNA whose role in triggering inflammatory and innate immune responses in various physiological processes is increasingly being demonstrated.8 9Fracture 20 healing is a physiological process where early acute inflammation plays a crucial role to initiate and orchestrate bone repair and activate bone anabolism.20 21 22Moreover, several studies demonstrated a positive effect of proinflammatory mediators on bone mineralization in vitro and in vivo,15 16 17 18indicating that the modulation of inflammatory reaction as a tool to pursue regenerative strategies in bone.30In newly fractured mice bone a group of TEs, mostly LINE and LTR, was early, 25 markedly and transiently upregulatedFig). Interestingly, the expression of these TE is limited to the earliest phase of the inflammatory stage. In line with the hypothesis of a positive correlation between stress-induced bone mineralization and TEs activation, the analysis of TEs expression dynamics in human bone biopsies revealed a significant induction of TEs in femur, subjected to recurring microfractures, high turnover and anabolism, compared to iliumFig. , a lower TEs 30 transcription in donors with compromised bone mineralizationFig.), and a significant correlation between TEs expression and local BMD. The hypothesis that the expression dynamics of TEs in fracture / mechanical stress observed in vivo could mimic the immunological threshold model of the sterile activation of dsRNA sensors as a response to stressful conditions. Indeed, the transient and controlled breaching of the activation threshold of dsRNA sensors may lead to sterile inflammation 45735311.149 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT being integrated into physiological processes. To test this hypothesis, some experiments delivered a full length L1 consensus sequence, source of dsRNA35(Figure 5B), to differentiating osteoblasts in vitro and the data showed that L1 RNA initially accumulated in the cytoplasm and is gradually cleared by secretion. The increased cytoplasmic levels of L1 RNA are immediately sensed by PKR, 5 a cytoplasmic dsRNA sensor whose activation induces the phosphorylation of eIF2a66 67leading to the attenuation of global protein synthesis67, induction of inflammatory response), and stimulation of mineral matrix deposition (Fig.3). In support of the evidence that PKR is the early sensor of increased L1 RNA cytoplasmic levels, the data shows that inhibition of PKR activation by C16 prevents L1-induced eIF2a phosphorylation, induction of inflammatory genes, and mineral matrix 10 deposition . Moreover, the inhibition of L1 cDNA formation and sensing by Lamivudine 3TC, G140, or cGAS Knockdown, respectively, does not affect the L1-induced phenotype . Thus, the evidence excludes that L1-induced inflammation is causally connected with the sensing of L1- derived cDNA accumulated in the cytoplasm and mediated by cGAS-STING sensing pathway, a mechanism demonstrated operative in senescence.615 L1 RNA response showed high specificity, as demonstrated by the dose dependent increase of mineralization and the lack of significant changes in mineral deposition when negative control RNA is transfected, even at a concentration 100-200-fold higher (Figure 3E). L1-induced stress response stimulates the unique mineralizing phenotype and the results indicate that L1 stimulates the mineralization of bone forming cells regardless of their prior intrinsic anabolic potential. 20 Moreover, mass spec results suggest that increased autophagy, a process crucial for mineralization and bone homeostasis in vitro and in vivo,70may contribute to L1-induced hydroxyapatite deposition. Intriguingly, the osteoinductive properties of “L1-primed” osteoblast-derived secretome , and the observation that L1 RNA is gradually secreted by the cells may suggest an involvement of L1 RNA in cell-to-cell communication, in line with the recent finding of other retrotransposons (i.e. 25 ERV) acting as paracrine molecules.88This, together with the observed L1-dependent induction of CCL and CXCL chemokines and cytokines, which are chemoattractant of immune cells and endothelial cells,89 90 91and the composition of L1-primed osteoblast secretome (discussed in results), makes the in vivo delivery of L1 RNA a necessary step to evaluate its actual contribution to the paracrine processes that orchestrate bone repair mechanisms.92 9330 The identification of repeats RNA, particularly L1, as potential resilient molecular factors involved in stress induced, inflammation-mediated bone production, points out new avenue to develop anabolic strategies for the treatment of bone loss conditions, such as osteoporosis, or impaired bone repair.30On the other hand, repeats may be novel targets in the treatment of those 45735311.150 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT conditions characterized by excessive or heterotopic ossification preceded by deregulated / chronic inflammation.28 29References 1. Cosby, R. L., Chang, N. C. & Feschotte, C. Host-transposon interactions: conflict, 5 cooperation, and cooption. Genes Dev.33, 1098–1116 (2019). 2. Mangiavacchi, A., Liu, P., Della Valle, F. & Orlando, V. New insights into the functional role of retrotransposon dynamics in mammalian somatic cells. Cell. Mol. Life Sci.78, 5245– 5256 (2021). 3. Jachowicz, J. W. et al. LINE-1 activation after fertilization regulates global chromatin 10 accessibility in the early mouse embryo. Nat. Genet. (2017) doi:10.1038 / ng.3945. 4. Slotkin, R. K. & Martienssen, R. Transposable elements and the epigenetic regulation of the genome. Nat. Rev. Genet.8, 272–285 (2007). 5. Fukuda, S. et al. Cytoplasmic synthesis of endogenous Alu complementary DNA via reverse transcription and implications in age-related macular degeneration. Proc. Natl. Acad. Sci. U. 15 S. A.118, (2021). 6. De Cecco, M. et al. L1 drives IFN in senescent cells and promotes age-associated inflammation. Nature 566, 73–78 (2019). 7. Simon, M. et al. LINE1 Derepression in Aged Wild-Type and SIRT6-Deficient Mice Drives Inflammation. Cell Metab.29, 871-885.e5 (2019). 20 8. Sadeq, S., Al-Hashimi, S., Cusack, C. M. & Werner, A. Endogenous Double-Stranded RNA. Non-Coding RNA 7, 15 (2021). 9. Chen, Y. G. & Hur, S. Cellular origins of dsRNA, their recognition and consequences. Nat. Rev. Mol. Cell Biol.23, 286–301 (2022). 10. Zhang, X., Zhang, R. & Yu, J. New Understanding of the Relevant Role of LINE-1 25 Retrotransposition in Human Disease and Immune Modulation. Front. cell Dev. Biol.8, 657 (2020). 11. Lefkopoulos, S. et al. Repetitive Elements Trigger RIG-I-like Receptor Signaling that Regulates the Emergence of Hematopoietic Stem and Progenitor Cells. Immunity 53, 934- 951.e9 (2020). 30 12. Kim, Y. et al. PKR is activated by cellular dsRNAs during mitosis and acts as a mitotic regulator. Genes Dev.28, 1310–1322 (2014). 13. Sheng, W. et al. LSD1 Ablation Stimulates Anti-tumor Immunity and Enables Checkpoint Blockade. Cell 174, 549-563.e19 (2018). 45735311.151 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 14. Nelson, A. M. et al. dsRNA Released by Tissue Damage Activates TLR3 to Drive Skin Regeneration. Cell Stem Cell 17, 139–151 (2015). 15. Croes, M. et al. Proinflammatory Mediators Enhance the Osteogenesis of Human Mesenchymal Stem Cells after Lineage Commitment. PLoS One 10, e0132781 (2015). 5 16. Croes, M. et al. Proinflammatory T cells and IL-17 stimulate osteoblast differentiation. Bone 84, 262–270 (2016). 17. Li, C., Li, G., Liu, M., Zhou, T. & Zhou, H. Paracrine effect of inflammatory cytokine- activated bone marrow mesenchymal stem cells and its role in osteoblast function. J. Biosci. Bioeng.121, 213–219 (2016). 10 18. Croes, M. et al. Inflammation-Induced Osteogenesis in a Rabbit Tibia Model. Tissue Eng. Part C Methods 23, 673–685 (2017). 19. Laroche, M., Livideanu, C., Paul, C. & Cantagrel, A. Interferon Alpha and Pamidronate in Osteoporosis with Fracture Secondary to Mastocytosis. Am. J. Med.124, 776–778 (2011). 20. Mountziaris, P. M., Spicer, P. P., Kasper, F. K. & Mikos, A. G. Harnessing and Modulating 15 Inflammation in Strategies for Bone Regeneration. Tissue Eng. Part B. Rev.17, 393 (2011). 21. Marsell, R. & Einhorn, T. A. The biology of fracture healing. Injury 42, 551–555 (2011). 22. Bahney, C. S. et al. Cellular biology of fracture healing. J. Orthop. Res.37, 35–50 (2019). 23. Wheatley, B. M. et al. Effect of NSAIDs on Bone Healing Rates. J. Am. Acad. Orthop. Surg. 27, e330–e336 (2019). 20 24. Gerstenfeld, L. C. et al. Impaired Intramembranous Bone Formation during Bone Repair in the Absence of Tumor Necrosis Factor-Alpha Signaling. Cells Tissues Organs 169, 285–294 (2001). 25. Recknagel, S. et al. Systemic inflammation induced by a thoracic trauma alters the cellular composition of the early fracture callus. J. Trauma Acute Care Surg.74, 531–537 (2013). 25 26. Hurtgen, B. J. et al. Severe muscle trauma triggers heightened and prolonged local musculoskeletal inflammation and impairs adjacent tibia fracture healing. J. Musculoskelet. Neuronal Interact.16, 122 (2016). 27. Jiao, H., Xiao, E. & Graves, D. T. Diabetes and Its Effect on Bone and Fracture Healing. Curr. Osteoporos. Rep.13, 327–335 (2015). 30 28. Lories, R. J. U. & Schett, G. Pathophysiology of New Bone Formation and Ankylosis in Spondyloarthritis. Rheum. Dis. Clin. North Am.38, 555–567 (2012). 29. Balboni, T. A., Gobezie, R. & Mamon, H. J. Heterotopic ossification: Pathophysiology, clinical features, and the role of radiotherapy for prophylaxis. Int. J. Radiat. Oncol.65, 1289–1299 (2006). 45735311.152 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 30. Roberts, S. J. & Ke, H. Z. Anabolic Strategies to Augment Bone Fracture Healing. Curr. Osteoporos. Rep.16, 289–298 (2018). 31. Coates, B. A. et al. Transcriptional Profiling of Intramembranous and Endochondral Ossification after Fracture in Mice. Bone 127, 577 (2019). 5 32. Mashanov, V. S., Zueva, O. R. & García-Arrarás, J. E. Posttraumatic regeneration involves differential expression of long terminal repeat (LTR) retrotransposons. Dev. Dyn.241, 1625– 1636 (2012). 33. Zhu, W. et al. Retrotransposon long interspersed nucleotide element-1 (LINE-1) is activated during salamander limb regeneration. Dev. Growth Differ.54, 673–685 (2012). 10 34. Aerssens, J., Boonen, S., Joly, J. & Dequeker, J. Variations in trabecular bone composition with anatomical site and age: potential implications for bone quality assessment. J. Endocrinol.155, 411–421 (1997). 35. Hur, S. Double-Stranded RNA Sensors and Modulators in Innate Immunity. Annu. Rev. Immunol.37, 349–375 (2019). 15 36. Koski, G. K. et al. Cutting Edge: Innate Immune System Discriminates between RNA Containing Bacterial versus Eukaryotic Structural Features That Prime for High-Level IL-12 Secretion by Dendritic Cells. J. Immunol. (2004) doi:10.4049 / jimmunol.172.7.3989. 37. Pardi, N., Muramatsu, H., Weissman, D. & Karikó, K. In vitro transcription of long RNA containing modified nucleosides. Methods Mol. Biol. (2013) doi:10.1007 / 978-1-62703-260- 20 5_2. 38. Ludwig, J. et al. Structural and functional insights into 5′-ppp RNA pattern recognition by the innate immune receptor RIG-I. Nat. Struct. Mol. Biol. (2010) doi:10.1038 / nsmb.1863. 39. Karikó, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by Toll- like receptors: The impact of nucleoside modification and the evolutionary origin of RNA. 25 Immunity (2005) doi:10.1016 / j.immuni.2005.06.008. 40. Nallagatla, S. R. & Bevilacqua, P. C. Nucleoside modifications modulate activation of the protein kinase PKR in an RNA structure-specific manner. RNA (2008) doi:10.1261 / rna.1007408. 41. Karikó, K. et al. Incorporation of pseudouridine into mRNA yields superior 30 nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. (2008) doi:10.1038 / mt.2008.200. 42. Anderson, B. R. et al. Incorporation of pseudouridine into mRNA enhances translation by diminishing PKR activation. Nucleic Acids Res. (2010) doi:10.1093 / nar / gkq347. 45735311.153 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 43. Kormann, M. S. D. et al. Expression of therapeutic proteins after delivery of chemically modified mRNA in mice. Nat. Biotechnol. (2011) doi:10.1038 / nbt.1733. 44. FLEISCH, H., RUSSELL, R. G. G. & STRAUMANN, F. Effect of Pyrophosphate on Hydroxyapatite and Its Implications in Calcium Homeostasis. Nature 212, 901–903 (1966). 5 45. Johnson, K. A. et al. Osteoblast tissue-nonspecific alkaline phosphatase antagonizes and regulates PC-1. Am. J. Physiol. Regul. Integr. Comp. Physiol.279, R1365-77 (2000). 46. Hessle, L. et al. Tissue-nonspecific alkaline phosphatase and plasma cell membrane glycoprotein-1 are central antagonistic regulators of bone mineralization. Proc. Natl. Acad. Sci. U. S. A.99, 9445–9 (2002). 10 47. De Cecco, M. et al. L1 drives IFN in senescent cells and promotes age-associated inflammation. Nature 566, 73–78 (2019). 48. Maruyama, M. et al. Modulation of the Inflammatory Response and Bone Healing. Front. Endocrinol. (Lausanne).11, 386 (2020). 49. Gerstenfeld, L. C., Cullinane, D. M., Barnes, G. L., Graves, D. T. & Einhorn, T. A. Fracture 15 healing as a post-natal developmental process: Molecular, spatial, and temporal aspects of its regulation. J. Cell. Biochem.88, 873–884 (2003). 50. Kon, T. et al. Expression of osteoprotegerin, receptor activator of NF-kappaB ligand (osteoprotegerin ligand) and related proinflammatory cytokines during fracture healing. J. Bone Miner. Res.16, 1004–1014 (2001). 20 51. Kovtun, A. et al. The crucial role of neutrophil granulocytes in bone fracture healing. Eur. Cells Mater.32, 152–162 (2016). 52. Xiao, G. et al. MAPK Pathways Activate and Phosphorylate the Osteoblast-specific Transcription Factor, Cbfa1 *. J. Biol. Chem.275, 4453–4459 (2000). 53. Xiao, G., Jiang, D., Gopalakrishnan, R. & Franceschi, R. T. Fibroblast growth factor 2 25 induction of the osteocalcin gene requires MAPK activity and phosphorylation of the osteoblast transcription factor, Cbfa1 / Runx2. J. Biol. Chem.277, 36181–36187 (2002). 54. Xiao, G. et al. Bone morphogenetic proteins, extracellular matrix, and mitogen-activated protein kinase signaling pathways are required for osteoblast-specific gene expression and differentiation in MC3T3-E1 cells. J. Bone Miner. Res.17, 101–110 (2002). 30 55. Matsushita, T. et al. Extracellular signal-regulated kinase 1 (ERK1) and ERK2 play essential roles in osteoblast differentiation and in supporting osteoclastogenesis. Mol. Cell. Biol.29, 5843–5857 (2009). 45735311.154 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 56. Ge, C., Xiao, G., Jiang, D. & Franceschi, R. T. Critical role of the extracellular signal– regulated kinase–MAPK pathway in osteoblast differentiation and skeletal development. J. Cell Biol.176, 709 (2007). 57. Owlarn, S. et al. Generic wound signals initiate regeneration in missing-tissue contexts. Nat. 5 Commun.2017818, 1–13 (2017). 58. Chan, J. K. et al. Alarmins: awaiting a clinical response. J. Clin. Invest.122, 2711 (2012). 59. Clark, D., Nakamura, M., Miclau, T. & Marcucio, R. Effects of Aging on Fracture Healing. Curr. Osteoporos. Rep.15, 601 (2017). 60. Brem, H. & Tomic-Canic, M. Cellular and molecular basis of wound healing in diabetes. J. 10 Clin. Invest.117, 1219–1222 (2007). 61. Timmen, M. et al. Influence of antiTNF-alpha antibody treatment on fracture healing under chronic inflammation. BMC Musculoskelet. Disord.15, 184 (2014). 62. Schmidt-Bleek, K. et al. Inflammatory phase of bone healing initiates the regenerative healing cascade. Cell Tissue Res.347, 567–573 (2012). 15 63. Weckbach, S. et al. Inflammatory and apoptotic alterations in serum and injured tissue after experimental polytrauma in mice: distinct early response compared with single trauma or ‘double-hit’ injury. J. Trauma Acute Care Surg.74, 489–498 (2013). 64. Jones, R. B. et al. Nucleoside analogue reverse transcriptase inhibitors differentially inhibit human LINE-1 retrotransposition. PLoS One (2008) doi:10.1371 / journal.pone.0001547. 20 65. Lama, L. et al. Development of human cGAS-specific small-molecule inhibitors for repression of dsDNA-triggered interferon expression. Nat. Commun.10, 2261 (2019). 66. Kim, Y. et al. PKR Senses Nuclear and Mitochondrial Signals by Interacting with Endogenous Double-Stranded RNAs. Mol. Cell 71, 1051-1063.e6 (2018). 67. Donnelly, N., Gorman, A. M., Gupta, S. & Samali, A. The eIF2α kinases: their structures and 25 functions. Cell. Mol. Life Sci.70, 3493–3511 (2013). 68. Li, J. et al. eIF2α signaling regulates autophagy of osteoblasts and the development of osteoclasts in OVX mice. Cell Death Dis.10, 921 (2019). 69. Meier, F. et al. diaPASEF: parallel accumulation-serial fragmentation combined with data- independent acquisition. Nat. Methods 17, 1229–1236 (2020). 30 70. Nollet, M. et al. Autophagy in osteoblasts is involved in mineralization and bone homeostasis. Autophagy 10, 1965–1977 (2014). 71. JIANG, W. G., SANDERS, A. J., RUGE, F. & HARDING, K. G. Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications. Exp. Ther. Med.3, 231–236 (2012). 45735311.155 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 72. Choi, J. et al. FGF2-primed 3D spheroids producing IL-8 promote therapeutic angiogenesis in murine hindlimb ischemia. NPJ Regen. Med.6, 48 (2021). 73. Hou, Y. et al. IL-8 enhances the angiogenic potential of human bone marrow mesenchymal stem cells by increasing vascular endothelial growth factor. Cell Biol. Int.38, 1050–9 (2014). 5 74. Lin, D. et al. Rapid initiation of guided bone regeneration driven by spatiotemporal delivery of IL-8 and BMP-2 from hierarchical MBG-based scaffold. Biomaterials 196, 122–137 (2019). 75. Yang, A. et al. IL-8 Enhances Therapeutic Effects of BMSCs on Bone Regeneration via CXCR2-Mediated PI3k / Akt Signaling Pathway. Cell. Physiol. Biochem.48, 361–370 (2018). 10 76. Zhang, R. et al. Anti-inflammatory and immunomodulatory mechanisms of mesenchymal stem cell transplantation in experimental traumatic brain injury. J. Neuroinflammation 10, 106 (2013). 77. Lee, M. J. et al. Topical TSG-6 Administration Protects the Ocular Surface in Two Mouse Models of Inflammation-Related Dry Eye. Invest. Ophthalmol. Vis. Sci.56, 5175–81 (2015). 15 78. Lee, R. H. et al. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell 5, 54–63 (2009). 79. Wang, S. et al. Tumor necrosis factor-inducible gene 6 protein ameliorates chronic liver damage by promoting autophagy formation in mice. Exp. Mol. Med.49, e380 (2017). 20 80. Yang, H. et al. TSG-6 secreted by bone marrow mesenchymal stem cells attenuates intervertebral disc degeneration by inhibiting the TLR2 / NF-κB signaling pathway. Lab. Investig.98, 755–772 (2018). 81. Li, H. et al. Defective autophagy in osteoblasts induces endoplasmic reticulum stress and causes remarkable bone loss. Autophagy 14, 1726–1741 (2018). 25 82. Alioli, C. A. et al. Expression of the type 1 lysophosphatidic acid receptor in osteoblastic cell lineage controls both bone mineralization and osteocyte specification. Biochim. Biophys. Acta - Mol. Cell Biol. Lipids 1865, 158715 (2020). 83. Gennero, I. et al. Absence of the lysophosphatidic acid receptor LPA1 results in abnormal bone development and decreased bone mass. Bone 49, 395–403 (2011). 30 84. Carelli, F. N. et al. Widespread transposon co-option in the Caenorhabditis germline regulatory network. Sci. Adv.8, (2022). 85. Della Valle, F. et al. LINE-1 RNA causes heterochromatin erosion and is a target for amelioration of senescent phenotypes in progeroid syndromes. Sci. Transl. Med.14, eabl6057 (2022). 45735311.156 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 86. Lu, J. Y. et al. Homotypic clustering of L1 and B1 / Alu repeats compartmentalizes the 3D genome. Cell Res.31, 613–630 (2021). 87. Percharde, M. et al. A LINE1-Nucleolin Partnership Regulates Early Development and ESC Identity. Cell (2018) doi:10.1016 / j.cell.2018.05.043. 5 88. Liu, X. et al. Resurrection of human endogenous retroviruses during aging reinforces senescence. bioRxiv (2021). 89. Bischoff, D. S. et al. CXC receptor knockout mice: characterization of skeletal features and membranous bone healing in the adult mouse. Bone 48, 267–274 (2011). 90. Eash, K. J., Greenbaum, A. M., Gopalan, P. K. & Link, D. C. CXCR2 and CXCR4 10 antagonistically regulate neutrophil trafficking from murine bone marrow. J. Clin. Invest. 120, 2423–2431 (2010). 91. Strieter, R. M., Burdick, M. D., Gomperts, B. N., Belperio, J. A. & Keane, M. P. CXC chemokines in angiogenesis. Cytokine Growth Factor Rev.16, 593–609 (2005). 92. Chaparro, O. & Linero, I. Regenerative Medicine: A New Paradigm in Bone Regeneration. 15 in Advanced Techniques in Bone Regeneration (InTech, 2016). doi:10.5772 / 62523. 93. Nimiritsky, P. et al. Unveiling Mesenchymal Stromal Cells’ Organizing Function in Regeneration. Int. J. Mol. Sci.20, 823 (2019). 94. Reppe, S. et al. Eight genes are highly associated with BMD variation in postmenopausal Caucasian women. Bone (2010) doi:10.1016 / j.bone.2009.11.007. 20 95. Eggerschwiler, B., Canepa, D. D., Pape, H. C., Casanova, E. A. & Cinelli, P. Automated digital image quantification of histological staining for the analysis of the trilineage differentiation potential of mesenchymal stem cells. Stem Cell Res. Ther. (2019) doi:10.1186 / s13287-019-1170-8. 96. Liu, W. et al. GDF11 decreases bone mass by stimulating osteoclastogenesis and inhibiting 25 osteoblast differentiation. Nat. Commun.7, 12794 (2016). 97. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013). 98. Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2014). 30 99. Rau, A., Gallopin, M., Celeux, G. & Jaffrézic, F. Data-based filtering for replicated high- throughput transcriptome sequencing experiments. Bioinformatics 29, 2146–2152 (2013). 100. Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140 (2010). 45735311.157 ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT 101. Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B 57, 289–300 (1995). 102. Yang, W. R., Ardeljan, D., Pacyna, C. N., Payer, L. M. & Burns, K. H. SQuIRE reveals locus-specific regulation of interspersed repeat expression. Nucleic Acids Res.47, e27–e27 5 (2019). 103. Wiśniewski, J. R., Zougman, A., Nagaraj, N. & Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 6, 359–362 (2009). 104. Meier, F. et al. diaPASEF: parallel accumulation-serial fragmentation combined with data- independent acquisition. Nat. Methods 17, 1229–1236 (2020). 10 It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended 15 claims. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims. 45735311.158

Claims

ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT CLAIMS We claim:

1. A cell free composition comprising a secretome obtained from cells primed with double stranded RNA (dsRNA), wherein the cells are primed with dRNA by genetically engineering the cells to express dsRNA or incubating the cells with dsRNA and maintaining the cells in culture for an effective amount of time to obtain a secretome.

2. The composition of claim 1, wherein the dsRNA is selected from the group consisting of Line 1 RNA, a synthetic polyinosinic-polycytidylic acid (poly(I:C)) and polyadenylic-polyuridylic acid (poly(A:U)).

3. The composition of claim 1 wherein the dsRNA is L1 RNA.

4. The composition of claim 2 or 3, wherein the L1 RNA is L1HS-Ta1.

5. The composition of any one of claims 1-4, wherein genetically engineering the cells to express dsRNA comprises contacting the cells with an expression vector comprising a nucleic acid sequence encoding the ORF1 or ORF2 of the L1 RNA.

6. The composition of any one of claims 1-5, comprising incubating the cells with the ORF1 or ORF2 of the L1 RNA.

7. The composition of any one of claims 1-6, wherein the expression vector is selected from the group consisting of plasmid, minicircle DNA (mcDNA) and viral vector.

8. The composition of claim 7, wherein the vector is selected from the group consisting of bacteriophage, baculoviruses, tobacco mosaic virus, herpes virus, cytomegalo virus, retrovirus, vaccinia virus, adenovirus and adeno-associated virus.

9. The composition of any one of claims 1-8, wherein the cells are selected from the group consisting of stem cells, osteoblasts, fibroblasts, endothelial cells, cardiomyocytes, epatocytes, dermofibroblasts, keratinocytes, epithelial cells, dental pulp stem cells, bone progenitor cells, myoblasts, fibro-adipogenic progenitors (FAPS), induced pluripotent stem cells (iPSCs), satellite cells, adipocytes, glial cells, and neurons.

10. The composition of claim 9, wherein the cells are bone progenitor cells.

11. The composition of claim 9 or 10, wherein the bone progenitor cells are bone marrow derived mesenchymal stem cells.

12. The composition of any one of claims 1-11, wherein the L1 RNA comprises SEQ ID NO:

1.

13. The composition of any one of claims 1-12, wherein the composition comprises one or more agents selected from the group consisting of proteins, DNAs, RNAs,45735311.159ATTORNEY DOCKET NO. KAUST 2024-101-02 PCT metabolites, microRNAs, growth factors, antioxidants, proteasomes, and exosomes, secreted by the cells in response to dsRNA treatment.

14. The composition of any one of claims 1-13, comprising increased levels in ine or more of Interleukin 8 (IL-8), necrosis factor-inducible gene 6 (TSG6), ATG7 (Autophagy related 7), and Type 1 lysophosphatidic acid receptor (LPAR1), compared to a secreome obtained from same cells not primed with a dsRNA.

15. A method of treating a subject in need of in a of tissue repair / regeneration, comprising administering to the subject, the composition of any one of claims 1-13 in an effective amount to increase tissue repair / regeneration in the subject.

16. The method of claim 15 comprising administering the formulation for tissue repair / regeneration for would healing such as skin wound healing, burn sites, to a subject in need of bone repair such as osteochondral bone repair, bone fracture sites or to a corneal wound site.

17. The method of claim 16, comprising administering the composition to a wound site.

18. The method of claim 17, wherein the wound site is a skin wound or a corneal wound.

19. The method of claim 16, wherein the subject has been diagnosed with osteoporosis.

20. The method of claim 16, wherein the subject has been diagnosed with intervertebral disc degeneration.45735311.160

Images