Methods and compositions for inhibition of mutant GNAQ and GNA11

Abstract

The invention relates to the inhibition of expression of mutant G protein subunit alpha q (GNAQ) or a mutant G protein subunit alpha 11 (GNA11) gene using siRNA, shRNA, gene editing systems, and compositions thereof. The invention further relates to methods of treating uveal melanoma using the siRNA, shRNA, gene editing systems, and compositions thereof.

Description

Attorney Docket No.5470.972.WO METHODS AND COMPOSITIONS FOR INHIBITION OF MUTANT GNAQ AND GNA11 STATEMENT OF PRIORITY

[0001] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 650,097, filed May 21, 2024, the entire contents of which are incorporated by reference herein. STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0002] A Sequence Listing in XML format, entitled 5470-972WO_ST26.xml, 109,212 bytes in size, generated on May 20, 2025, and filed herewith, is hereby incorporated by reference in its entirety for its disclosures. FIELD OF THE INVENTION

[0003] The invention relates to the inhibition of expression of the mutant form of the alpha subunit of G protein Gq (Gαq) and G11 (Gα11) using siRNAs, shRNAs, and / or gene editing systems. The invention further relates to methods of treating mutant form of Gαq and Gα11 related uveal melanoma. BACKGROUND OF THE INVENTION

[0004] Uveal melanoma (UVM) is the most common intraocular tumor in adults, with about 2500 cases per year in North America. UVM arises from melanocytes in the choroid, ciliary body and iris. First line treatments for UVM are initially successful; however, up to 50% of patients will develop liver micrometastases within ten to fifteen years. Liver metastases refractory to radiation, chemotherapy, targeted therapy and immunotherapy and were almost always fatal within 6 months of detection. See, Durante et al, 2019, Cold Spring Harb Mol Cas Studies, 5:a004051. Tebentafusp, a T-cell receptor–bispecific molecule that targets glycoprotein 100 and CD3 approved for some people with uveal melanoma in 2022, has the ability to extend life about 5 months on average; however, less than half of metastatic patients are eligible for tebentafusp.

[0005] Uveal melanoma tumor genetics are unique, with Q209L / P mutations occurring in one of two Gα subunits GNAQ and GNA11 genes encoding for Gα subunits of G-proteins GαQ and Gα11, respectively, in greater than 90% of uveal melanomas. In uveal melanoma GNAQ and GNA11 mutations are mutually exclusive. Estimates of GNAQ / GNA11 pointAttorney Docket No.5470.972.WO mutations in UVM are: GNAQ Q209P: 34%, GNAQ Q209L: 13% and GNA11 Q209L: 43%. These mutations converge on common downstream signaling pathways such as PKC / MAPK, PI3K / AKT, and YAP / TAZ. See Croce et al., 2019, Figure 1 (showing main signaling pathways downstream from GαQ or Gα11). Additionally, these point mutations constitutively activate the downstream pathways, allowing the growth and survival of uveal melanoma.

[0006] The present disclosure overcomes the deficiencies in the art by providing compositions and methods using RNA interference and / or knockdown for specific inhibition of the constitutively active pathway, with specific targeting of the point mutations in GNAQ and GNA11 to inhibit the mutants and / or induce uveal melanoma cell death. SUMMARY OF THE INVENTION

[0007] The present invention is based on the identification of RNA molecules that inhibit expression of mutant forms of Gα subunits. Accordingly, one aspect of the invention relates to an siRNA molecule comprising an antisense strand and a sense strand for allele specific knock down of primary and metastatic tumor G protein subunit alpha q (GNAQ) or primary and metastatic G protein subunit Alpha 11 (GNA11) in uveal melanoma (UVM).

[0008] An aspect of the invention is directed to an siRNA molecule targeted to mRNA of a GNAQ or a GNA11 gene, the GNAQ or GNA11 mRNA encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11 (Gα11), respectively.

[0009] In some embodiments, the mRNA comprises a single point mutation at a nucleotide position that encodes a mutation at position Q209 of mutated Gαq or Gα11.

[0010] In an aspect of the invention, an shRNA is provided comprising an siRNA molecule described herein.

[0011] In an aspect of invention, a gene editing system is provided comprising a CRISPR- Cas protein and an sgRNA targeted to the GNAQ or GNA11 gene.

[0012] In another aspect, an expression cassette is provided comprising the shRNA.

[0013] In an aspect, a composition is provided comprising an siRNA or an shRNA as described herein.

[0014] In a further aspect, a vector is provided comprising an siRNA, an shRNA, or an expression cassette as described herein. In some embodiments, the vector is a viral vector, for example, an AAV vector.

[0015] In an aspect, a method of treating UVM, e.g., ocular and / or metastatic UVM, is provided, the method comprising administering an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector as described herein to a subject in needAttorney Docket No.5470.972.WO thereof. Also provided is the use of an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector or viral vector as described herein for treating uveal melanoma, or for the preparation of a medicament for treating uveal melanoma.

[0016] An additional aspect of the invention provides a method of reducing mutant Gαq and / or Gα11 transcript in a cell, the method comprising contacting a cell with an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector as described herein to a subject in need thereof to thereby reduce the mutant Gαq and / or Gα11 transcript in the cell. Also provided is the use of an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector or viral vector as described herein for reducing mutant Gαq and / or Gα11 transcript in a cell, or for the preparation of a medicament for reducing mutant Gαq and / or Gα11 transcript in a cell.

[0017] In a further aspect, a method of modulating expression of GNAQ or GNA11 encoding a mutated alpha subunit of G protein Gq or of G protein G11, respectively, in a target cell is provided, comprising contacting the target cell with an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector as described herein. Also provided is the use of an siRNA, an shRNA, a gene editing system, an expression cassette, a composition, or a vector or viral vector as described herein for modulating expression of GNAQ or GNA11 encoding a mutated alpha subunit of G protein Gq or of G protein G11, respectively, in a target cell, or for the preparation of a medicament for modulating expression of GNAQ or GNA11 encoding a mutated alpha subunit of G protein Gq or of G protein G11, respectively, in a target cell.

[0018] These and other aspects of the invention are set forth in more detail in the description of the invention below. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] FIG.1 shows siRNAs specifically deplete the mutant form of Gαq including clonogenic survival based on position of point mutation in the siRNA; reduction in total Gαq and mutant transcripts using siRNA with mutation at the fifth position; and depletion of mutant Gαq reduces YAP transcriptional targets.

[0020] FIG.2 shows wild-type GNAQ gene fragment, mutant GNAQ gene fragment encoding Q209L and Q209L siRNAs (SEQ ID NOs:1-22). GNAQwtand GNAQQ209Ltranscript sequences are depicted and aligned to 19 different anti-sense GNAQQ209L-targeting siRNA sequences. The mutant-targeted and wild-type mismatched nucleotide is identified by a box. P1 refers to the Q209L wild-type mismatched nucleotide in the first position relative toAttorney Docket No.5470.972.WO the 5’ end, while P19 refers to the nucleotide in the last position relative to the 5’ end of the antisense strand. All 19 siRNAs were examined for toxicity in Mel202 cells (GNAQQ209L).

[0021] FIG.3 shows siRNAs specifically deplete the mutant form of Gα11.

[0022] FIG.4 shows wild-type GNA11 gene fragment, mutant GNA11 gene fragment encoding Q209L, and Q209P siRNAs (SEQ ID NOs:23-43).

[0023] FIGS.5A-5D show (5A) example gene therapy-based approach using Adeno- Associated Virus (AAV) using scAAV GNAQ / GNA11-targeting RNA cassette (5B) ssAAV2-shGNAQ transduction does not affect cell viability in GNAQ wt cells; (5C) ssAAV2-shGNAQ transduction reduces cell viability in GNAQ mutant cells; and (5D) non- targeting control AAV construct also reduces cell viability in the GNAQ mutant cells.

[0024] FIG.6 shows AAV-shGNAQP5 reduces colony formation 5 fold over AAV-GFP alone.

[0025] FIG.7 shows wild-type GNAQ gene fragment, mutant GNAQ gene fragment encoding Q209P, and Q209L siRNAs (SEQ ID NOs:1 and 44-64).

[0026] FIGS. 8A-8C show two siRNA sequences reduced clonogenic survival in a GNAQQ209LUVM cell line. (8A) Clonogenic survival on day 20 after P5 GNAQQ209L-targeting siRNA transfection was significantly decreased to an average of 40.4% (±33.1%; p < 0.001; n=12) of the non-targeting control (NTC) siRNA (n=9). (8B) alamarBlue™ metabolic activity on day 6 after P5 transfection is significantly decreased to 55.7% (±18.5%; p < 0.001; n = 12) of the NTC (n = 12). (8C) Representative brightfield microscopy images of bulk transfections with NTC (top) and P5 (bottom) GNAQQ209L-targeting siRNA in Mel202 cells, 72-hours post- transfection, are depicted. Solid bar graphs represent the mean of each data set, and error bars represent ± the standard deviation of the mean. Statistical significance was determined using an unpaired t-test. Significance levels are indicated by the following: * - p < .05.

[0027] FIGS. 9A-9B. P5 GNAQQ209L-targeting siRNA preferentially reduces GNAQQ209Ltranscripts and YAP transcriptional activity. (9A) The results of next-generation Amplicon-EZ sequencing (NGS) of a 263-base pair GNAQ cDNA amplicon from NTC and P5 GNAQQ209L- targeting siRNA transfected Mel202 cells are depicted as the percentage of total sequences. Each replicate is a single independent experiment, with a total of five independent experiments performed. Total sequence number varied among samples, with an average of 3.9×105(±1.0×105) total sequences analyzed per sample.54.1% (±1.5%, n = 5) of total NTC-transfected Mel202 transcripts contained the wild-type nucleotide (adenine) and 45.9% (±1.5%, n = 5) contained the mutant nucleotide (thymine) (p < .001). For the P5 GNAQQ209L-targeting siRNA transfected Mel202 cells, 75.7% (±8.3%, n = 5) of reads contained the wild-type nucleotide,Attorney Docket No.5470.972.WO while 24.3% (±8.3%, n = 5) contained the mutant (p < .001). FIG. 9A also depicts a representative image of the Partek™Flow™software analysis, portraying the abundance of recovered GNAQ sequences from NTC and P5 GNAQQ209L-targeting siRNA-transfected Mel202 cells from one independent experiment. A black box is placed around the mutant nucleotide at position 626 on the GNAQ cDNA sequence. (9B) The functional impacts of the constitutively active Gαqprotein in UVM were measured via the relative abundance of CYR61 and CTGF transcripts for both NTC and P5 GNAQQ209L-targeting transfected Mel202 cells. Gene expression was normalized to the housekeeping gene Human GAPDH. CYR61 relative expression decreased to a mean of 0.74 (±0.20, p = 0.002) of the NTC, and CTGF relative expression decreased to a mean of 0.84 (±.13, p = .005). The data shown are a compilation of three independent experiments with three technical replicates each. Error bars represent ± the standard deviation of the mean. Statistical significance was determined using an unpaired t- test. Significance levels are indicated by the following: * - p < .05.

[0028] FIGS.10A-10B. P5 GNAQQ209L-targeting siRNA does not affect viability or GNAQwttranscript abundance in GNAQwtUVM. (10A) P5 GNAQQ209L-targeting siRNA transfections of Mel285 (GNAQwt) UVM cells are shown for clonogenic survival and alamarBlue™ metabolic activity. The percentage of CFUs among P5-transfected cells (109.3%) was not different from that of the NTC-transfected cells (±18.9%; p = .132; n = 17). alamarBlue™ metabolic activity among P5-transfected cells increased to 110.7% (±3.2%, p < .001, n = 18) of the NTC. (10B) P5 GNAQQ209L-targeting siRNA transfection of 92.1 (GNAQQ209L) UVM cells are shown for clonogenic survival and alamarBlue™ metabolic activity. The percentage of CFUs among P5 GNAQQ209L-targeting siRNA transfected cells decreased to 56.4% (±13.2%, p < .001, n = 22) of the NTC. alamarBlue™ metabolic activity among P5 GNAQQ209L-targeting siRNA transfected cells decreased to 76.8% (±13.4%, p < .001, n = 20). Data consists of at least three independent experiments with at least four technical replicates each. Solid bars represent the mean of each data set, and error bars represent ± standard deviation of the mean. Statistical significance was determined using an unpaired t-test. Significance levels are indicated by the following: ns - not significant, p > .05; * - p < .05.

[0029] FIGS. 11A-11B show Adeno-associated virus serotype 2 (AAV2) efficiently transduces UVM cell lines. (11A) Mel285, Mel202, and 92.1 human UVM cell lines were transduced with self-complementary AAV (scAAV) preparations of serotypes 1, 2, 3, 4, 5, 6, 8, and 9 at 1.0×104vg / cell.72 hours post-transduction, cells were harvested and the percentage of GFP+cells were quantified via flow cytometry. The mean of at least four replicates is displayed in a heatmap. Cell lines are displayed on the y-axis, and AAV serotypes are displayedAttorney Docket No.5470.972.WO on the x-axis. The key corresponding to the percent of cells that were GFP+is displayed on the right. Serotype 2 transduced all three cell lines with the highest efficiency among all examined serotypes. (11B) Representative GFP fluorescence microscopy images are displayed for scAAV2-transduced Mel285, Mel202, and 92.1 cell lines. Images shown were taken three days post-transduction of 1.0×104vg / cell scAAV2-CMV-GFP (top) and PBS (bottom).

[0030] FIGS. 12A-12C show rAAV2-shGNAQQ209Ltransduction results in GNAQQ209LUVM cell death, similar to that observed with P5 GNAQQ209L-targeting siRNA. (12A) The cis- regulatory elements and genetic cassettes of the single-stranded (ss) AAV vector are depicted (ITR = inverted terminal repeat; pU6 = U6 RNA polymerase III promoter; pCMV = cytomegalovirus promoter; GFP = green fluorescent protein; SV40 = simian virus 40). Black arrows indicate promoter sequences, direction, and location, and the large arrow indicates the GFP open reading frame. Solid rectangles represent other coding and non-coding elements. (12B) alamarBlue™ metabolic activity for PBS (vehicle control), and 1.0×104vg / cell of rAAV2-shNTC and rAAV2-shGNAQQ209Ltransduced Mel285 (GNAQwt), Mel202 (GNAQQ209L), and 92.1 (GNAQQ209L) cells are shown. Cells were analyzed seven days post- transduction of vectors, and data consist of three independent experiments with at least four technical replicates each. (12C) Representative brightfield and GFP fluorescence microscopy images for PBS (top), rAAV-shNTC (middle), and rAAV-shGNAQQ209L(bottom) treated Mel285 (left), Mel202 (middle), and 92.1 (right) cells are shown six days following PBS and vector addition. Solid bars represent the mean of each data set, and error bars represent ± standard deviation of the mean. Statistical significance was determined using an unpaired t- test. Significance levels are indicated by the following: ns - not significant, p > .05; * - p < .05.

[0031] FIGS. 13A-13B show P2 and P5 GNAQQ209L-targeting siRNAs reduce clonogenic survival and alamarBlue™ metabolic activity in a GNAQQ209LUVM cell line. The results of a non-targeting control siRNA (NTC) and the P1-P19 GNAQQ209L-targeting siRNA transfections on clonogenic survival (13A) and alamarBlue™ metabolic activity (13B) are displayed above. Solid bars represent the means of each data set. Error bars represent ± standard deviation of the mean. Transfection with only the P2 and the P5 sequences resulted in decreased viability of the Mel202 cell lines. Statistical significance was determined using an unpaired t-test. Significance levels are indicated by the following: no asterisk – not significant, p > .05; * - p < .05. All data presented are normalized to the mean of NTC siRNA.

[0032] FIG. 14 shows the P5 GNAQQ209L-targeting siRNA reduces total GNAQ transcript Q209L levels in Mel202 cells (GNAQ ). The results of RT-qPCR on total GNAQ cDNA harvestedAttorney Docket No.5470.972.WO Q209L from non-targeting control (NTC) siRNA and P5 GNAQ -targeting siRNA-transfected Mel202 cells (24-hours post-transfection) are displayed above. GNAQ cDNA is relative to Human GAPDH expression and normalized to NTC siRNA. Total GNAQ expression is partially decreased in the P5 transfected samples. Data consists of three experimental replicates with three technical replicates each (n=9). Solid bars represent the means of each data set. Error bars represent ± standard deviation of the mean. Statistical significance was determined using an unpaired t-test. Significance levels are indicated by the following: * - p < .05.

[0033] FIGS. 15A-15B show total GNAQ transcript abundance is unchanged in Mel285 wt Q209L (GNAQ ) cells (15A) and is reduced in 92.1 cells (GNAQ ) (15B). The results of RT-qPCR Q209L on total GNAQ cDNA from the non-targeting control (NTC) siRNA and P5 GNAQ - targeting siRNA-transfected Mel285 and 92.1 cells are shown (24-hours post-transfection). GNAQ cDNA is relative to Human GAPDH expression and is normalized to the NTC siRNA. Data consists of three experimental replicates with three technical replicates each (n=9). Solid bars represent the means of each data set. Error bars represent ± standard deviation of the mean. Statistical significance was determined using an unpaired t-test. Significance levels are indicated by the following: ns – not significant, p > .05; * - p < .05.

[0034] FIG. 16 shows AAV2 transduces three uveal melanoma cell lines with the highest efficiency. The transduction efficiency of self-complementary (sc) adeno-associated virus (AAV) serotypes 1, 2, 3, 4, 5, 6, 8, and 9 in Mel285, Mel202, and 92.1 cells as measured through the % of GFP+ cells are displayed above. Cells were harvested and fixed for analysis three days following scAAV transduction. Data is the same as displayed in FIG. 11A, with bars representing the means of each data set and error bars representing ± standard deviation of each mean.

[0035] FIGS.17A-17B show characterization of single-stranded (ss) AAV preparations used 10 in vitro. (17A) Roughly 1.1×10 vector genomes were loaded and run on an alkaline gel to visualize the approximate size in nucleotides of each packaged genome. A ladder was also run consisting of DNA strands of size 7452, 4759, and 2681 nucleotides. Among both AAV2 vector preparations, the dominant species appears to be single-stranded. *However, another species appears at roughly double the size of the single-stranded packaged genome, indicating that some vector genomes were packaged as a self-complementary (sc) genome. (17B) The viral genome (vg) titer of each preparation are displayed, quantified via qPCR with a customer primer / probe targeting the CMV promoter. Data shown are the means of three technical replicates each. (sh = short hairpin; NTC = non-targeting control).Attorney Docket No.5470.972.WO DETAILED DESCRIPTION OF THE INVENTION

[0036] The present invention will now be described in more detail with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. This invention may, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. All publications, patent applications, patents, patent publications and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0038] Nucleotide sequences are presented herein by single strand only, in the 5' to 3' direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. §1.822 and established usage.

[0039] Except as otherwise indicated, standard methods known to those skilled in the art may be used for cloning genes, amplifying and detecting nucleic acids, and the like. Such techniques are known to those skilled in the art. See, e.g., Green et al., Molecular Cloning: A Laboratory Manual 4th Ed. (Cold Spring Harbor, NY, 2012); Ausubel et al. Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York).

[0040] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination.

[0041] Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted.

[0042] To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.Attorney Docket No.5470.972.WO Definitions

[0043] As used in the description of the invention and the appended claims, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0044] Also as used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0045] The term “about,” as used herein when referring to a measurable value such as an amount of polypeptide, dose, time, temperature, enzymatic activity or other biological activity and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount.

[0046] As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.”

[0047] The term “consists essentially of” (and grammatical variants), as applied to a polynucleotide sequence of this invention, means a polynucleotide that consists of both the recited sequence (e.g., SEQ ID NO) and a total of ten or less (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides on the 5' and / or 3' ends of the recited sequence such that the function of the polynucleotide is not materially altered. The total of ten or less additional nucleotides includes the total number of additional nucleotides on both ends added together. The term “materially altered,” as applied to polynucleotides of the invention, refers to an increase or decrease in ability to inhibit expression of a target mRNA of at least about 50% or more as compared to the expression level of a polynucleotide consisting of the recited sequence.

[0048] The term “enhance” or “increase” refers to an increase in the specified parameter of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, twelve- fold, or even fifteen-fold.

[0049] The term “inhibit” or “reduce” or grammatical variations thereof as used herein refers to a decrease or diminishment in the specified level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments, theAttorney Docket No.5470.972.WO inhibition or reduction results in little or essentially no detectible activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).

[0050] A “therapeutically effective” amount as used herein is an amount that provides some improvement or benefit to the subject. Alternatively stated, a “therapeutically effective” amount is an amount that will provide some alleviation, mitigation, or decrease in at least one clinical symptom in the subject (e.g., in the case of cancer, reduction in tumor burden, including metastatic tumors, prevention of further tumor growth, prevention of metastasis, or increase in survival time). Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.

[0051] By the terms “treat,” “treating,” or “treatment of,” it is intended that the severity of the subject's condition is reduced or at least partially improved or modified and that some alleviation, mitigation or decrease in at least one clinical symptom is achieved.

[0052] “Prevent” or “preventing” or “prevention” refer to prevention or delay of the onset of the disorder and / or a decrease in the severity of the disorder in a subject relative to the severity that would develop in the absence of the methods of the invention. The prevention can be complete, e.g., the total absence of cancer in a subject. The prevention can also be partial, such that the occurrence or severity of cancer in a subject is less than that which would have occurred without the present invention.

[0053] As used herein, “nucleic acid,” “nucleotide sequence,” and “polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The term polynucleotide, nucleotide sequence, or nucleic acid refers to a chain of nucleotides without regard to length of the chain. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be a sense strand or an antisense strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases. The present invention further provides a nucleic acid that is the complement (which can be either a full complement or a partial complement) of a nucleic acid, nucleotide sequence, or polynucleotide of this invention. When dsRNA is produced synthetically, less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others can also be used for antisense, dsRNA, and ribozyme pairing. For example, polynucleotides that contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression. OtherAttorney Docket No.5470.972.WO modifications, such as modification to the phosphodiester backbone, or the 2'-hydroxy in the ribose sugar group of the RNA can also be made.

[0054] An “isolated polynucleotide” is a nucleotide sequence (e.g., DNA or RNA) that is not immediately contiguous with nucleotide sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment, an isolated nucleic acid includes some or all of the 5' non-coding (e.g., promoter) sequences that are immediately contiguous to a coding sequence. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment), independent of other sequences. It also includes a recombinant DNA that is part of a hybrid nucleic acid encoding an additional polypeptide or peptide sequence. An isolated polynucleotide that includes a gene is not a fragment of a chromosome that includes such gene, but rather includes the coding region and regulatory regions associated with the gene, but no additional genes naturally found on the chromosome.

[0055] The term “isolated” can refer to a nucleic acid, nucleotide sequence or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (when produced by recombinant DNA techniques), or chemical precursors or other chemicals (when chemically synthesized). Moreover, an “isolated fragment” is a fragment of a nucleic acid, nucleotide sequence or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. “Isolated” does not mean that the preparation is technically pure (homogeneous), but it is sufficiently pure to provide the polypeptide or nucleic acid in a form in which it can be used for the intended purpose.

[0056] An “isolated cell” refers to a cell that is separated from other components with which it is normally associated in its natural state. For example, an isolated cell can be a cell in culture medium and / or a cell in a pharmaceutically acceptable carrier of this invention. Thus, an isolated cell can be delivered to and / or introduced into a subject. In some embodiments, an isolated cell can be a cell that is removed from a subject and manipulated as described herein ex vivo and then returned to the subject.

[0057] The term “fragment,” as applied to a polynucleotide, will be understood to mean a nucleotide sequence of reduced length relative to a reference nucleic acid or nucleotide sequence and comprising, consisting essentially of, and / or consisting of a nucleotide sequence of contiguous nucleotides identical or almost identical (e.g., 90%, 92%, 95%, 98%,Attorney Docket No.5470.972.WO 99% identical) to the reference nucleic acid or nucleotide sequence. Such a nucleic acid fragment according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. In some embodiments, such fragments can comprise, consist essentially of, and / or consist of oligonucleotides having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the invention.

[0058] The term “fragment,” as applied to a polypeptide, will be understood to mean an amino acid sequence of reduced length relative to a reference polypeptide or amino acid sequence and comprising, consisting essentially of, and / or consisting of an amino acid sequence of contiguous amino acids identical or almost identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference polypeptide or amino acid sequence. Such a polypeptide fragment according to the invention may be, where appropriate, included in a larger polypeptide of which it is a constituent. In some embodiments, such fragments can comprise, consist essentially of, and / or consist of peptides having a length of at least about 4, 6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more consecutive amino acids of a polypeptide or amino acid sequence according to the invention.

[0059] A “vector” is any nucleic acid molecule for the cloning of and / or transfer of a nucleic acid into a cell. A vector may be a replicon to which another nucleotide sequence may be attached to allow for replication of the attached nucleotide sequence. A “replicon” can be any genetic element (e.g., plasmid, phage, cosmid, chromosome, viral genome) that functions as an autonomous unit of nucleic acid replication in vivo, i.e., capable of replication under its own control. The term “vector” includes both viral and nonviral (e.g., plasmid) nucleic acid molecules for introducing a nucleic acid into a cell in vitro, ex vivo, and / or in vivo. A large number of vectors known in the art may be used to manipulate nucleic acids, incorporate response elements and promoters into genes, etc. For example, the insertion of the nucleic acid fragments corresponding to response elements and promoters into a suitable vector can be accomplished by ligating the appropriate nucleic acid fragments into a chosen vector that has complementary cohesive termini. Alternatively, the ends of the nucleic acid molecules may be enzymatically modified or any site may be produced by ligating nucleotide sequences (linkers) to the nucleic acid termini. Such vectors may be engineered to contain sequences encoding selectable markers that provide for the selection of cells that contain the vector and / or have incorporated the nucleic acid of the vector into the cellular genome. Such markers allow identification and / or selection of host cells that incorporate and express the proteins encoded by the marker. A “recombinant” vector refers to a viral or non-viral vectorAttorney Docket No.5470.972.WO that comprises one or more heterologous nucleotide sequences (i.e., transgenes), e.g., two, three, four, five or more heterologous nucleotide sequences.

[0060] Viral vectors have been used in a wide variety of gene delivery applications in cells, as well as living animal subjects. Viral vectors that can be used include, but are not limited to, retrovirus, lentivirus, adeno-associated virus, poxvirus, alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr virus, and / or adenovirus vectors. Non-viral vectors include, but are not limited to, plasmids, liposomes, electrically charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to a nucleic acid of interest, a vector may also comprise one or more regulatory regions, and / or selectable markers useful in selecting, measuring, and monitoring nucleic acid transfer results (delivery to specific tissues, duration of expression, etc.).

[0061] Vectors may be introduced into the desired cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a nucleic acid vector transporter (see, e.g., Wu et al., J. Biol. Chem.267:963 (1992); Wu et al., J. Biol. Chem.263:14621 (1988); and Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar.15, 1990).

[0062] In some embodiments, a polynucleotide of this invention can be delivered to a cell in vivo by lipofection. Synthetic cationic lipids designed to limit the difficulties and dangers encountered with liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of a nucleotide sequence of this invention (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413 (1987); Mackey, et al., Proc. Natl. Acad. Sci. U.S.A.85:8027 (1988); and Ulmer et al., Science 259:1745 (1993)). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Felgner et al., Science 337:387 (1989)). Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO95 / 18863 and WO96 / 17823, and in U.S. Patent No.5,459,127. The use of lipofection to introduce exogenous nucleotide sequences into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is clear that directing transfection to particular cell types would be particularly preferred in a tissue with cellular heterogeneity, such as pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting (Mackey, et al., 1988, supra). Targeted peptides, e.g., hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules can be coupled to liposomes chemically.Attorney Docket No.5470.972.WO

[0063] In various embodiments, other molecules can be used for facilitating delivery of a nucleic acid in vivo, such as a cationic oligopeptide (e.g., WO95 / 21931), peptides derived from nucleic acid binding proteins (e.g., WO96 / 25508), and / or a cationic polymer (e.g., WO95 / 21931).

[0064] It is also possible to introduce a vector in vivo as naked nucleic acid (see U.S. Patent Nos.5,693,622, 5,589,466 and 5,580,859). Receptor-mediated nucleic acid delivery approaches can also be used (Curiel et al., Hum. Gene Ther.3:147 (1992); Wu et al., J. Biol. Chem.262:4429 (1987)).

[0065] As used herein, the terms “protein” and “polypeptide” are used interchangeably and encompass both peptides and proteins, unless indicated otherwise.

[0066] A “fusion protein” is a polypeptide produced when two heterologous nucleotide sequences or fragments thereof coding for two (or more) different polypeptides not found fused together in nature are fused together in the correct translational reading frame. Illustrative fusion polypeptides include fusions of a polypeptide of the invention (or a fragment thereof) to all or a portion of glutathione-S-transferase, maltose-binding protein, or a reporter protein (e.g., Green Fluorescent Protein, β-glucuronidase, β-galactosidase, luciferase, etc.), hemagglutinin, c-myc, FLAG epitope, etc.

[0067] By the term “express” or “expression” of a polynucleotide coding sequence, it is meant that the sequence is transcribed, and optionally, translated. Typically, according to the present invention, expression of a coding sequence of the invention will result in production of the polypeptide of the invention. The entire expressed polypeptide or fragment can also function in intact cells without purification.

[0068] As used herein, the term “over-expression” or “over-expressing” refers to increased levels of a polypeptide being produced and / or increased time of expression (e.g., constitutively expressed) compared to a wild-type cell.

[0069] As used herein, the term “gene” refers to a nucleic acid molecule capable of being used to produce mRNA, antisense RNA, miRNA, and the like. Genes may or may not be capable of being used to produce a functional protein. Genes can include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences and 5’ and 3’ untranslated regions). A gene may be “isolated” by which is meant a nucleic acid that is substantially or essentially free from components normally found in association with the nucleic acid in its natural state. Such components include other cellularAttorney Docket No.5470.972.WO material, culture medium from recombinant production, and / or various chemicals used in chemically synthesizing the nucleic acid.

[0070] As used herein, “complementary” polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form a combination of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. For example, the sequence “A-G-T” binds to the complementary sequence “T-C-A.” It is understood that two polynucleotides may hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other.

[0071] The terms “complementary” or “complementarity,” as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base- pairing. Complementarity between two single-stranded molecules may be “partial,” in which only some of the nucleotides bind, or it may be complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.

[0072] As used herein, the terms “substantially complementary” or “partially complementary” mean that two nucleic acid sequences are complementary at least about 50%, 60%, 70%, 80% or 90% of their nucleotides. In some embodiments, the two nucleic acid sequences can be complementary at least at 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. The terms “substantially complementary” and “partially complementary” can also mean that two nucleic acid sequences can hybridize under high stringency conditions and such conditions are well known in the art.

[0073] As used herein, “heterologous” refers to a nucleic acid sequence that either originates from another species or is from the same species or organism but is modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence derived from an organism or species different from that of the cell into which the nucleotide sequence is introduced, is heterologous with respect to that cell and the cell’s descendants. In addition, a heterologous nucleotide sequence includes a nucleotide sequence derived from and inserted into the same natural, original cell type, but which is present in a non-natural state, e.g., a different copy number, and / or under the control of different regulatory sequences than that found in nature.Attorney Docket No.5470.972.WO

[0074] As used herein, the terms “contacting,” “introducing” and “administering” are used interchangeably, and refer to a process by which dsRNA of the present invention or a nucleic acid molecule encoding a dsRNA of this invention is delivered to a cell, in order to inhibit or alter or modify expression of a target gene. The dsRNA may be administered in a number of ways, including, but not limited to, direct introduction into a cell (i.e., intracellularly) and / or extracellular introduction into a cavity, interstitial space, or into the circulation of the organism.

[0075] “Introducing” in the context of a cell or organism means presenting the nucleic acid molecule to the organism and / or cell in such a manner that the nucleic acid molecule gains access to the interior of a cell. Where more than one nucleic acid molecule is to be introduced these nucleic acid molecules can be assembled as part of a single polynucleotide or nucleic acid construct, or as separate polynucleotide or nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Accordingly, these polynucleotides can be introduced into cells in a single transformation event or in separate transformation events. Thus, the term “transformation” as used herein refers to the introduction of a heterologous nucleic acid into a cell. Transformation of a cell may be stable or transient.

[0076] “Transient transformation” or “transient transfection” in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell.

[0077] By “stably introducing” or “stably introduced” in the context of a polynucleotide introduced into a cell, it is intended that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide.

[0078] “Stable transformation” or “stable transfection” as used herein means that a nucleic acid molecule is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid molecule is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. “Genome” as used herein includes the nuclear and mitochondrial genome, and therefore includes integration of the nucleic acid into, for example, the mitochondrial genome. Stable transformation or stable transfection as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a minichromosome.

[0079] Transient transformation or transient tranfection may be detected by, for example, an enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of a peptide or polypeptide encoded by one or more transgene introduced into an organism. Stable transformation or stable transfection of a cell can be detected by, forAttorney Docket No.5470.972.WO example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism. Stable transformation or stable transfection of a cell can be detected by, for example, a Northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism. Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0080] Embodiments of the invention are directed to expression cassettes designed to express the nucleic acids of the present invention. As used herein, “expression cassette” means a nucleic acid molecule having at least a control sequence operably linked to a nucleotide sequence of interest. In this manner, for example, promoters in operable interaction with the nucleotide sequences for the siRNAs of the invention are provided in expression cassettes for expression in an organism or cell.

[0081] As used herein, the term “promoter” refers to a region of a nucleotide sequence that incorporates the necessary signals for the efficient expression of a coding sequence. This may include sequences to which an RNA polymerase binds, but is not limited to such sequences and can include regions to which other regulatory proteins bind together with regions involved in the control of protein translation and can also include coding sequences.

[0082] Furthermore, a “promoter” of this invention is a promoter capable of initiating transcription in a cell of an organism. Such promoters include those that drive expression of a nucleotide sequence constitutively, those that drive expression when induced, and those that drive expression in a tissue- or developmentally-specific manner, as these various types of promoters are known in the art.

[0083] For purposes of the invention, the regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) can be native / analogous to the organism or cell and / or the regulatory regions can be native / analogous to the other regulatory regions. Alternatively, the regulatory regions may be heterologous to the organism or cell and / or to each other (i.e., the regulatory regions). Thus, for example, a promoter can be heterologous when it is operably linked to a polynucleotide from a species different from the species from which the polynucleotide was derived. Alternatively, a promoter can also beAttorney Docket No.5470.972.WO heterologous to a selected nucleotide sequence if the promoter is from the same / analogous species from which the polynucleotide is derived, but one or both (i.e., promoter and polynucleotide) are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0084] The choice of promoters to be used depends upon several factors, including, but not limited to, cell- or tissue-specific expression (e.g., melanocyte-specific), desired expression level, efficiency, inducibility and selectability. For example, where expression in a specific tissue or organ is desired, a tissue-specific promoter can be used. In contrast, where expression in response to a stimulus is desired, an inducible promoter can be used. Where continuous expression is desired throughout the cells of an organism, a constitutive promoter can be used. It is a routine matter for one of skill in the art to modulate the expression of a nucleotide sequence by appropriately selecting and positioning promoters and other regulatory regions relative to that sequence.

[0085] In addition to the promoters described above, the expression cassette also can include other regulatory sequences. As used herein, “regulatory sequences” means nucleotide sequences located upstream (5' non-coding sequences), within or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include, but are not limited to, enhancers, introns, translation leader sequences and polyadenylation signal sequences.

[0086] The expression cassette also can optionally include a transcriptional and / or translational termination region (i.e., termination region) that is functional in the organism. A variety of transcriptional terminators are available for use in expression cassettes and are responsible for the termination of transcription beyond the transgene and correct mRNA polyadenylation. The termination region may be native to the transcriptional initiation region, may be native to the operably linked nucleotide sequence of interest, may be native to the host, or may be derived from another source (i.e., foreign or heterologous to the promoter, the nucleotide sequence of interest, the host, or any combination thereof).

[0087] A signal sequence can be operably linked to nucleic acids of the present invention to direct the nucleotide sequence into a cellular compartment. In this manner, the expression cassette will comprise a nucleotide sequence encoding the siRNA operably linked to a nucleic acid sequence for the signal sequence. The signal sequence may be operably linked at the N- or C-terminus of the siRNA.Attorney Docket No.5470.972.WO

[0088] Regardless of the type of regulatory sequence(s) used, they can be operably linked to the nucleotide sequence of the siRNA. As used herein, “operably linked” means that elements of a nucleic acid construct such as an expression cassette are configured so as to perform their usual function. Thus, regulatory or control sequences (e.g., promoters) operably linked to a nucleotide sequence of interest are capable of effecting expression of the nucleotide sequence of interest. The control sequences need not be contiguous with the nucleotide sequence of interest, so long as they function to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, sequences can be present between a promoter and a coding sequence, and the promoter sequence can still be considered “operably linked” to the coding sequence. A nucleotide sequence of the present invention (e.g.,., a dsRNA, e.g., an siRNA, e.g., an shRNA) can be operably linked to a regulatory sequence, thereby allowing its expression in a cell and / or subject.

[0089] The expression cassette also can include a nucleotide sequence for a selectable marker, which can be used to select a transformed organism or cell. As used herein, “selectable marker” means a nucleic acid that when expressed imparts a distinct phenotype to the organism or cell expressing the marker and thus allows such transformed organisms or cells to be distinguished from those that do not have the marker. Such a nucleic acid may encode either a selectable or screenable marker, depending on whether the marker confers a trait that can be selected for by chemical means, such as by using a selective agent (e.g., an antibiotic or the like), or on whether the marker is simply a trait that one can identify through observation or testing, such as by screening. Of course, many examples of suitable selectable markers are known in the art and can be used in the expression cassettes described herein.

[0090] In some embodiments of the present invention, the expression cassette can comprise an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of the dsRNA. In further embodiments, a promoter can flank either end of the template nucleotide sequence, wherein the promoters drive expression of each individual DNA strand, thereby generating two complementary (or substantially complementary) RNAs that hybridize and form the dsRNA. In alternative embodiments, the nucleotide sequence is transcribed into both strands of the dsRNA on one transcription unit, wherein the sense strand is transcribed from the 5' end of the transcription unit and the antisense strand is transcribed from the 3' end, wherein the two strands are separated by about 3 to about 500 basepairs, and wherein after transcription, the RNA transcript folds on itself to form a short hairpin RNA (shRNA) molecule.Attorney Docket No.5470.972.WO

[0091] As used herein “sequence identity” refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. “Identity” can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0092] As used herein, the term “substantially identical” or “corresponding to” means that two nucleic acid sequences have at least 60%, 70%, 80% or 90% sequence identity. In some embodiments, the two nucleic acid sequences can have at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of sequence identity.

[0093] An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence.

[0094] As used herein, the term “percent sequence identity” or “percent identity” refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) polynucleotide molecule (or its complementary strand) as compared to a test (“subject”) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison). In some embodiments, “percent identity” can refer to the percentage of identical amino acids in an amino acid sequence.

[0095] Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., Burlington, Mass.). Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-lengthAttorney Docket No.5470.972.WO polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of this invention “percent identity” may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.

[0096] The percent of sequence identity can be determined using the “Best Fit” or “Gap” program of the Sequence Analysis Software PackageTM(Version 10; Genetics Computer Group, Inc., Madison, Wis.). “Gap” utilizes the algorithm of Needleman and Wunsch (Needleman and Wunsch, J Mol. Biol.48:443-453, 1970) to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. “BestFit” performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (Smith and Waterman, Adv. Appl. Math., 2:482-489, 1981, Smith et al., Nucleic Acids Res.11:2205-2220, 1983).

[0097] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D., (Applied Math 48:1073(1988)). More particularly, preferred computer programs for determining sequence identity include but are not limited to the Basic Local Alignment Search Tool (BLAST) programs which are publicly available from National Center Biotechnology Information (NCBI) at the National Library of Medicine, National Institute of Health, Bethesda, Md.20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol.215:403-410 (1990)); version 2.0 or higher of BLAST programs allows the introduction of gaps (deletions and insertions) into alignments; for peptide sequence BLASTX can be used to determine sequence identity; and, for polynucleotide sequence BLASTN can be used to determine sequence identity. RNA Molecules

[0098] The invention provides an approach for mRNA of a G protein subunit alpha q (GNAQ) or a G protein subunit alpha 11 (GNA11) gene, the GNAQ or GNA11 mRNA encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11 (Gα11), respectively. In an embodiment, the invention comprises dsRNA molecules (e.g., short interfering RNAs (siRNAs); e.g., short hairpin RNAs (shRNAs)) that can complementarily bind to GNA11 or GNAQ messenger RNA with a single point mutation at a nucleotide position that encodes a mutation at position Q209 of mutated Gαq or Gα11, inducing gene knockdown.Attorney Docket No.5470.972.WO

[0099] As provided herein, siRNA with complementarity to the allele specific mutant GNAQ or GNA11 effectively reduces mutant transcripts when the antisense strand of the siRNA is complementary to the point mutation of the mRNA at a specific position of the antisense strand. In some embodiments, a mutation at position 2 or position 5 of the antisense strand is specific for GNAQ mutated mRNA encoding a Q209L mutant Gαq. In some embodiments, the antisense strand comprises one of SEQ ID NOs:17 (P5), 18 (P5v2), or 21 (P2).

[0100] In some embodiments, the antisense strand is specific for GNA11 mutated mRNA encoding a Q209L mutant Gα11. In some embodiments, the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 4 of the antisense strand. In some embodments, the antisense strand comprises SEQ ID NO:40.

[0101] In some embodiments, the antisense strand is specific for GNAQ mutated mRNA encoding a Q209P mutant of Gαq. In some embodiments, the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 5 of the antisense strand. In some embodiments, the antisense strand comprises SEQ ID NO:59 (P5) or SEQ ID NO:60 (P5v2). In some embodiments, the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 2 of the antisense strand. In some embodiments, the antisense strand comprises SEQ ID NO:63 (P2).

[0102] In some embodiments, the siRNA molecule comprises an antisense strand and a sense strand, wherein the nucleotide sequence of the antisense strand is complementary to a region of the nucleotide sequence of mRNA of a G protein subunit alpha q (GNAQ) or a G protein subunit Alpha 11 (GNA11) gene, the GNAQ or GNA11 mRNA encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11(Gα11), respectively, the region comprising, consisting essentially of, or consisting of between about 18 to about 24 consecutive nucleotides; wherein the siRNA molecule inhibits expression of a mutant Gαq or of mutant Gα11. The RNA molecules provide decreased expression of mutant Gαq or of mutant Gα11 in a cell as compared to cells without the RNA molecules (e.g., a control cell or nontransformed cell). In some embodiments, expression of mutant Gαq or of mutant Gα11 is inhibited by at least about 30%, e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0103] The siRNA molecule can comprise, consist essentially of, or consist of about 18 to about 24 nucleotides (e.g., 18, 19, 20, 21, 22, 23, or 24, or any value or range therein). Additional nucleotides can be added at the 3’ end, the 5’ end, or both the 3’ and 5’ ends to facilitate manipulation of the RNA molecule but that do not materially affect the basicAttorney Docket No.5470.972.WO characteristics or function of the siRNA. Additionally, one or two nucleotides can be deleted from one or both ends of any of the sequences disclosed herein that do not materially affect the basic characteristics or function of the siRNA. The term “materially affect” as used herein refers to a change in the ability to inhibit expression of the protein encoded by the mRNA by no more than about 50%, e.g., no more than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or less. Such additional nucleotides can be nucleotides that extend the complementarity of the antisense strand along the target sequence and / or such nucleotides can be nucleotides that facilitate manipulation of the RNA molecule or a nucleic acid molecule encoding the RNA molecule, as would be known to one of skill in the art. For example, a TT overhang at the 3’ end may be present, which is used to stabilize the siRNA duplex and does not affect the specificity of the siRNA.

[0104] The siRNA of the invention may optionally comprise a single stranded overhang at either or both 3' and 5' ends. The RNA may be introduced in an amount that allows delivery of at least one copy per cell. Higher doses of double-stranded material may yield more effective inhibition.

[0105] In particular embodiments, the present invention provides siRNA containing a nucleotide sequence that is fully complementary to a region of the target gene for inhibition. However, it is to be understood that 100% complementarity between the antisense strand of the siRNA molecule and the target sequence is not required to practice the present invention. However, complementarity to the point mutation is conserved. Thus, sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence can be tolerated.

[0106] In some embodiments, the nucleotide sequence of the antisense strand comprises, consists essentially of, or consists of a nucleotide sequence that is at least about 80% identical to the nucleotide sequence of any of SEQ ID NOs:17, 18, 21, 40, 59, 60, or 63, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the nucleotide sequence of any of SEQ ID NOs:17, 18, 21, 40, 59, 60, or 63.

[0107] In some embodiments, one or both of the sense strand and the antisense strand comprises a TT overhang or other dinucleotide overhang at the 3’ end.

[0108] In some embodiments of this invention, the sense strand of the siRNA molecule can be fully complementary to the antisense strand or the sense strand can be substantially complementary or partially complementary to the antisense strand. By substantially or partially complementary is meant that the sense strand and the antisense strand can be mismatched at about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide pairings. Such mismatches canAttorney Docket No.5470.972.WO be introduced into the sense strand sequence, e.g., near the 3’ end, to enhance processing of the double stranded RNA molecule by Dicer, to duplicate a pattern of mismatches in an siRNA molecule, as would be known to one of skill in the art. Such modification will weaken the base pairing at one end of the duplex and generate strand asymmetry, therefore enhancing the chance of the antisense strand, instead of the sense strand, being processed and silencing the intended gene (Geng and Ding “Double-mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing Allele1” Acta Pharmacol. Sin.29:211-216 (2008); Schwarz et al. “Asymmetry in the assembly of the RNAi enzyme complex” Cell 115:199-208 (2003)).

[0109] In some embodiments, the RNA molecule is a short hairpin RNA (shRNA) molecule. The shRNA can comprise a strand of about 18 to about 24 nucleotides (e.g., an antisense strand) followed by a short nucleotide loop (approximately 4 to 11 nt, or 5 to 9 nt) followed by an analogous sense strand. When the shRNA of the invention includes a hairpin loop, it may optionally comprise an intron and / or a nucleotide spacer, which is a stretch of nucleotides between the complementary RNA strands, to stabilize the hairpin sequence in cells. Accordingly, the shRNA can comprise the siRNA as described herein, which is processed by Dicer to form an siRNA. In some embodiments, the antisense siRNA sequence is placed on the 5’ side of the hairpin loop of an shRNA. In some embodiments, the antisense siRNA sequence is placed on the 3’ side of the hairpin loop of an shRNA.

[0110] In some embodiments, the shRNA loop can be modeled to comprise a hairpin found in naturally occurring miRNA.

[0111] In some embodiments, the siRNA or shRNA can comprise as least one chemical modification. In certain embodiments, an siRNA disclosed herein can comprise substitutions or modifications, including chemically modified nucleotides, and non-nucleotides which may include incorporation in the backbone, sugars, bases, or nucleosides. The use of substituted or modified siRNA can be designed to have an increased half-life in a subject. Furthermore, certain substitutions or modifications can be used to improve the bioavailability of siRNA by targeting particular cells or tissues or improving cellular uptake of the siRNA. In some embodiments, one or more nucleotide in the siRNA molecule is modified with a 2'-O-methyl group or a 2'-fluoro group. In some embodiments, one or more nucleotide linkage in the siRNA is chemically modified. In some embodiments, the siRNA comprises at least one phosphorothioate linkage. Exemplary modifications and locations within a RNAi polynucleotide such as siRNA and the like are described in Hu et al. “Therapeutic siRNA: state of the art” Signal Transduction and Targeted Therapy 5, Article number 100 (2020),Attorney Docket No.5470.972.WO incorporated herein by reference, see, e.g., Figures 2 and 3, specifically for its teachings of modifications.

[0112] The siRNA molecule or shRNA molecule may be constructed using chemical synthesis and enzymatic ligation reactions by procedures known in the art. For example, an siRNA molecule or shRNA molecule may be chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the siRNA molecule or shRNA molecule and target nucleotide sequences. Alternatively, the RNA can be produced using an expression vector into which a nucleic acid encoding the double stranded RNA has been cloned. See e.g., Furdon et al., Nucleic Acids Res.17:9193 (1989); Agrawal et al., Proc. Natl. Acad. Sci. USA 87:1401 (1990); Baker et al., Nucleic Acids Res.18:3537 (1990); Sproat et al., Nucleic Acids Res.17:3373 (1989); Walder and Walder, Proc. Natl. Acad. Sci. USA 85:5011 (1988); incorporated by reference herein in their entireties for their teaching of methods of making polynucleotide molecules, including those containing modified nucleotide bases). Gene Editing Systems

[0113] Gene editing systems are provided herein and may comprise a CRISPR system, a zinc finger nuclease system, a meganuclease, or a TALE / TALEN system. A CRISPR-Cas system can comprise a Class 1 or Class 2 CRISPR-Cas system, which may comprise a guide sequence engineered to specifically bind a polynucleotide of interest. A polynucleotide encoding the CRISPR-Cas polypeptide and a guide sequence designed to complex with the CRISPR-Cas polypeptide at a target of interest, e.g., GNAQ or GNA11 can be provided in the CRISPR-Cas system.

[0114] Class 1 CRISPR-Cas systems are divided into types I, III, and IV. Makarova et al. 2020. Nat. Rev.18: 67-83., particularly as described in Figure 1. Type I CRISPR-Cas systems include Types I-A, I-B, I-C, I-D, I-E, I-F1, I-F2, I-F3, and IG; Type III CRISPR-Cas systems can be Types III-A, III-B, III-C, III-D, III-E, and III-F; which can contain a Cas10 that can include an RNA recognition motif called Palm and a cyclase domain that can cleave polynucleotides; Type IV CRISPR-Cas systems include Types IV-A, IV-B, and IV-C. Class 2 systems comprise a single, large, multi-domain effector protein and can be a Type II, Type V, or Type VI system, which are described in Makarova et al. “Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants” Nature Reviews Microbiology, 18:67-81 (Feb 2020), incorporated herein by reference. Class 2, Type II systems include II-A, II-B, II-C1, and II-C2; Type V systems include V-A, V-B1, V-B2, V-C, V-D, V-E, V-F1, V-Attorney Docket No.5470.972.WO F1(V-U3), V-F2, V-F3, V-G, V-H, V-I, V-K (V-U5), V-U1, V-U2, and V-U4. Class 2, Type VI systems include VI-A, VI-B1, VI-B2, VI-C, and VI-D. Design of guides for targeting a nucleic acid for modification is known in the art, see, e.g., IDTdna.com and Synthego.com for guidance on custom guide RNAs. Reduction of off-target effects can be tailored using programs such as GUIDE-seq for the design of guide sequences for a desired target. See, e.g., Malinin, et al., Nature Protocols, 16, 5592-5615 (2012). TALEN based gene editing is also contemplated and can be used in in vivo applications. See, S Becker, J Boch - Gene and Genome Editing, 2021. Zinc finger nuclease editing can also be utilized, and further modified to ensure high-precision gene editing. See, e.g., Conway et al., Molecular Therapy, 27:4, 10 April 2019, Pages 866-877; Paschon et al. Nature Comm, 10:1133 (2019). Similarly, editing can be made by meganucleases, characterized by a large recognition site of 12 to 40 based pairs of a double-stranded DNA sequence. See, e.g., U.S. Patent Nos.8,119,381, 10,273,524. Gene editing tools are well known in the art, with advantages and comparison of the tools that can be considered for the desired application. Rahim et al., Int’l J. of Innovative Science and Research Tech., 6:8 (2021), incorporated herein by reference. Transposases may be used with the methods of the present invention. Transposases include those comprising RNase H-like nuclease domains, such as Tn5, MuA, Mos1, Hermes, Serine and Tyrosine recombinases, including CTnDOT, Tn916, IS607 and TnpX, transposases comprising an HUH domain, including TnpA of IS91 or ISHp608, and helitron transposases, which can be as detailed in International Patent Publication WO2022056309, page 26, line 26 – page 27, line 17, specifically incorporated by reference. See also nuclease guided transposase as described in WO2022150651 (DNA nuclease guided Transposases systems, Tn7-like transposition proteins with a Cas12k protein), WO2022147321 (Type I-B CRISPR Associated Transposase systems), WO2022076830 (Type I CRISPR Associated transposase systems), WO2021257997 (CAST); Li, et al., Int. J. Mol. Sci.2020, 21(21), 8329; doi: 10.3390 / ijms21218329 (Tn5 transposase in applied genomic research). Base editors can be used for targeting the mutation. In some embodiments, the Cas polypeptide can comprise a base editor domain, for example, an adenosine deaminase or cytosine deaminase that can effect a single nucleotide alteration of the mutations described herein. Base editing systems are known in the art, for example, at Gaudelli, N. M. et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nature biotechnology 38, 892–900 (2020); Abudayyeh, O. O. et al. A cytosine deaminase for programmable single-base RNA editing. Science 365, 382–386 (2019); Zhao, N., Zhou, J., Tao, T. et al. Evolved cytidine and adenine base editors with highAttorney Docket No.5470.972.WO precision and minimized off-target activity by a continuous directed evolution system in mammalian cells. Nat Commun 15, 8140 (2024), each of which is incorporated herein by reference.

[0115] In some embodiments, the Class 2 CRISPR-Cas polypeptide is a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide is Staphylococcus aureus Cas9 (SaCas9) or Streptococcus pyogenes Cas9 (SpCas9). In some embodiments, the SaCas9 can be modified to allow for targeting of different PAM sequences. Kleinstiver, B.P., et al., Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol, 2015.33(12): p.1293-1298.

[0116] Design of guide molecules, e.g., sgRNAs or guide RNAs, for targeting a nucleic acid for modification can be developed, see, e.g., IDTdna.com and Synthego.com for guidance on custom sgRNAs. Reduction of off-target effects can be tailored using programs such as GUIDE-seq for the design of guide sequences for a desired target. See, e.g., Malinin, et al., Nature Protocols, 16, 5592-5615 (2012). For example, the sgRNA may comprise 16 to 30 nucleotides. In some embodiments, the target nucleotide, e.g., the mutated alpha subunit of G protein Gq (Gαq) or of G protein G11 (Gα11), is 1 to 20 nucleotides away from a PAM sequence in the target polynucleotide sequence. A guide sequence specific for a target sequence comprising the mutated Gαq or Gα11 can be developed. In some embodiments, the sgRNA sequence is configured to bind to SaCas9 and the target polynucleotide comprising mutated Gαq or Gα11 can be developed. One or both of the CRISPR-Cas system components can be provided in the same or in different vectors, as described in more detail below. Expression Vectors

[0117] In some embodiments, an expression cassette is provided herein. In an embodiment, the shRNA comprises an siRNA molecule as described herein and an expression cassette is provided comprising the shRNA described herein. The isolated nucleic acid encoding the siRNA can be incorporated into an expression vector. In some embodiments, an isolated nucleotide comprising a component of the gene editing system, for example a guide polynucleotide, is provided. Expression vectors compatible with various host cells are well known in the art and contain suitable elements for transcription and translation of nucleic acids. Typically, an expression vector contains an “expression cassette,” which includes, in the 5’ to 3’ direction, a promoter, a coding sequence encoding a double stranded RNA (e.g., siRNA, shRNA) operatively associated with the promoter, and, optionally, a termination sequence including a stop signal for RNA polymerase and a polyadenylation signal for polyadenylase. In some embodiments, the expression cassette comprises HSV TK as anAttorney Docket No.5470.972.WO inducible suicide gene. See, e.g., Greco, et al., Improving the safety of cell therapy with the TK-suicide gene, Front. Pharmacol., 23:6 (2015). In some embodiments, the expression cassette further comprises micro-RNA-122 target sequences which helps inhibit or prevent ectopic liver expression. See, e.g., Qiao et al., Liver-specific microRNA-122 target sequences incorporated in AAV vectors efficiently inhibits transgene expression in the liver. Gene Ther. 2011 Apr;18(4):403-10. doi: 10.1038 / gt.2010.157.

[0118] In an embodiment an expression cassette comprising shRNA is provided. The expression cassette can be according to one of SEQ ID NOs:65, 66, 69, 70, 73, 74, or 75. Non-limiting examples of animal and mammalian promoters known in the art include, but are not limited to, the SV40 early (SV40e) promoter region, the promoter contained in the 3' long terminal repeat (LTR) of Rous sarcoma virus (RSV), the promoters of the E1A or major late promoter (MLP) genes of adenoviruses (Ad), the cytomegalovirus (CMV) early promoter, the herpes simplex virus (HSV) thymidine kinase (TK) promoter, baculovirus IE1 promoter, elongation factor 1 alpha (EF1) promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin (Ubc) promoter, an albumin promoter, the regulatory sequences of the mouse metallothionein-L promoter and transcriptional control regions, the ubiquitous promoters (HPRT, vimentin, α-actin, tubulin and the like), the promoters of the intermediate filaments (desmin, neurofilaments, keratin, GFAP, and the like), the promoters of therapeutic genes (of the MDR, CFTR or factor VIII type, and the like), and pathogenesis and / or disease-related promoters.

[0119] In some embodiments, the expression cassette comprises a melanoma specific promoter, for example, the M-box of the human tyrosinase gene with AP1 and GRE cell- cycle-specific elements (see, Martinelli, et al., FEBS Letters, 579(1), January 2005, p 153- 156), cox-2 promoter (see, Nettlebeck et al., Melanoma Research 13(3): p 287-292, June 2003), and surviving promoter, (See, Lu et al., Gene Therapy volume 12, p 330–338 (2005)). In some embodiments, the expression cassette comprises a MITF-M, DCT, MCR1, or a TYRL1 promoter. See, e.g., Pleshkan et al., Acta Naturae.2011 Apr-Jun; 3(2): 13–21. In some embodiments, the expression cassette comprises a polynucleotide encoding Herpes Simplex Virus-Thymidine Kinase (HSV-TK) or Varicella zoster thymidine kinase (VSV-tk).

[0120] In addition, any of these expression sequences of this invention can be modified by addition of enhancer and / or regulatory sequences and the like. Enhancers that may be used in embodiments of the invention include, but are not limited to, an SV40 enhancer, a cytomegalovirus (CMV) enhancer, an elongation factor I (EF1) enhancer, yeast enhancers, viral gene enhancers, and the like.Attorney Docket No.5470.972.WO

[0121] Termination control regions, i.e., terminator or polyadenylation sequences, may be derived from various genes native to the preferred hosts. In some embodiments of the invention, the termination control region may comprise or be derived from a synthetic sequence, a synthetic polyadenylation signal, an SV40 late polyadenylation signal, an SV40 polyadenylation signal, a bovine growth hormone (BGH) polyadenylation signal, viral terminator sequences, or the like.

[0122] In a representative embodiment, a nucleic acid molecule (e.g., a plasmid) can be entrapped in a lipid particle bearing positive charges on its surface and, optionally, tagged with antibodies against cell surface antigens of the target tissue (see, Mizuno et al., No Shinkei Geka 20:547 (1992); PCT publication WO 91 / 06309; Japanese patent application 1047381; and European patent publication EP-A-43075).

[0123] Nuclear localization signals can also be used to enhance the targeting of the RNA or expression vector into the proximity of the nucleus and / or its entry into the nucleus. Such nuclear localization signals can be a protein or a peptide such as the SV40 large Tag NLS or the nucleoplasmin NLS. These nuclear localization signals interact with a variety of nuclear transport factors such as the NLS receptor (karyopherin alpha) which then interacts with karyopherin beta.

[0124] Expression vectors can be designed for expression of siRNA or sgRNA in mammalian cells. Examples of mammalian expression vectors include but are not limited to pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, PBPV, pMSG, PSVL (Pharmacia), pCDM8 (Seed, Nature 329:840 (1987)) and pMT2PC (Kaufman et al., EMBO J.6:187 (1987)). When used in mammalian cells, the control functions of the expression vector are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and Simian Virus 40.

[0125] In addition to the regulatory control sequences discussed above, a recombinant expression vector can contain additional nucleotide sequences. For example, the recombinant expression vector can encode a selectable marker gene to identify host cells that have incorporated the vector.

[0126] Another aspect of the invention relates to a composition comprising an siRNA molecule, an shRNA molecule, a guide RNA, or an expression cassette of the invention and another component, e.g., a suitable carrier. In some embodiments, the composition comprises two or more of the siRNA molecules, shRNA molecules, or expression cassettes of the invention. In some embodiments, the composition is a pharmaceutical compositionAttorney Docket No.5470.972.WO comprising the RNA molecule(s), or expression cassette(s) of the invention and a pharmaceutically acceptable carrier.

[0127] It is understood that the compositions of this invention can comprise, consist essentially of, or consist of any of the siRNA molecules, shRNA molecules, sgRNA molecules and / or expression cassettes in any combination and in any ratio relative to one another. Furthermore, by “two or more” is meant 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., up to a total number of siRNA molecules, shRNA molecules, sgRNA molecules and / or expression cassettes of this invention.

[0128] In some aspects of the invention, the composition or pharmaceutical composition further comprises additional components that enhance the delivery of the siRNA molecule(s), shRNA molecule(s), or expression cassette(s) of the invention to a subject, e.g., by enhancing the stability of the siRNA molecule(s), shRNA molecule(s), or expression cassette(s). In some embodiments, the additional component may be a particle, e.g., a microparticle or nanoparticle. In some embodiments, the particle is a lipid particle, e.g., a lipid microparticle or lipid nanoparticle or a liposome, e.g., a microliposome or a nanoliposome. The liposome, microliposome, or nanoliposome may contain any components known in the art to be suitable for preparing liposomes. In some embodiments, the liposome comprises 1,2-dioleoyl-sn- glycero-3-phosphatidylcholine (DOPC). Liposomes may be prepared by methods known in the art, e.g., as described in Pecot et al., Mol. Cancer Ther.13:2876 (2014), incorporated by reference herein in its entirety. In some embodiments, the RNA molecule is formed into a stable nucleic acid lipid particle (SNALP), e.g., using particles such as those provided by Arbutus Biopharma (Doylestown, PA). In certain embodiments, the lipid particle comprises, consists essentially of, or consists of cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), PEG-cDMA or PEG-cDSA, and 1,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane (DLinDMA) (see Judge et al., J. Clin. Invest.119:661 (2009)). In some embodiments, the additional component is a targeted delivery moiety to which the siRNA molecule(s), shRNA molecule(s), or expression cassette(s) are covalently or noncovalently conjugated, e.g., ligands, aptamers, or monoclonal antibodies.

[0129] In some embodiments, a vector (e.g., a delivery vector) comprising an siRNA, an shRNA, one or more components of a gene editing system (e.g., sgRNA) and / or an expression cassette as described herein is provided. The delivery vector may be any type of vector known to be useful for delivering a polynucleotide or other cargo to a cell. In some embodiments, the delivery vector is a non-viral vector. Examples of non-viral vectors include, without limitation, a plasmid, lipid nanoparticle, liposome, electrically charged lipid,Attorney Docket No.5470.972.WO nucleic acid-protein complex, or biopolymer. In an embodiment, a protein can be delivered in a non-viral vector, such as a nanoparticle or liposome.

[0130] Exemplary non-viral vectors include functionalized polymer-based materials such as calcium phosphate silicate nanoparticle, a calcium phosphate nanoparticle, a silica nanoparticle, and poly(amido-amine), poly-beta amino-esters (PBAEs), and polyethylenimine (PEI), and modified polyester dendrimers are envisioned. In an embodiment, the vector is a nanoparticle, liposome, stable nucleic acid lipid particle (SNALP), hydrogel, or micelle. SNALP components typically include ionizable lipid (e.g., Dlin-MC3-DMA or lipid cationic at low pH), a neutral lipid (e.g., DOPE) PEGylated lipid (e.g., Ceramide-PEG), and cholesterol. Hydrogels from proteins (e.g., collagen, gelatin, fibrin) and polysaccharides (e.g., alginate, chitosan, agarose and hyaluronic acid) as well as synthetic hydrogels from PEG, poly(vinyl alcohol) and poly(acrylic acid) can be utilized in the present invention. See, e.g., Wan J. Polymers.2012; 4(2):1084-1108.

[0131] Viral vectors have been used in a wide variety of gene delivery applications in cells, as well as living animal subjects. Viral vectors that can be used include, but are not limited to, retrovirus, lentivirus, adeno-associated virus, poxvirus, alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr virus, adenovirus, geminivirus, and caulimovirus vectors. Non-limiting examples of non-viral vectors include plasmids, liposomes, electrically charged lipids (cytofectins), nucleic acid-protein complexes, and biopolymers. In addition to a nucleic acid of interest, a vector may also comprise one or more regulatory regions, and / or selectable markers useful in selecting, measuring, and monitoring nucleic acid transfer results (delivery to specific tissues, duration of expression, etc.).

[0132] In some embodiments of the invention, the delivery vector is a viral vector, for example, parvovirus vector. The term “parvovirus” as used herein encompasses the family Parvoviridae, including autonomously-replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, muscovy duck parvovirus, snake parvovirus, and B19 virus. Other autonomous parvoviruses are known to those skilled in the art. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).

[0133] In some embodiments of the invention, the delivery vector is a parvovirus within the genus Dependovirus. The genus Dependovirus contains the adeno-associated viruses (AAV),Attorney Docket No.5470.972.WO including but not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, goat AAV, snake AAV, equine AAV, and ovine AAV. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A number of additional AAV serotypes and clades have been identified (see, e.g., Gao et al., (2004) J. Virol.78:6381-6388), which are also encompassed by the term “AAV”. Recombinant AAVs, for example rAAV2, can be utilized as a delivery vector in the methods and compositions disclosed herein.

[0134] It will further be appreciated that a variety of promoter / enhancer elements can be used depending on the level and tissue-specific expression desired. The promoter can be constitutive or inducible, depending on the pattern of expression desired. The promoter can be native or foreign and can be a natural or a synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. The promoter is chosen so that it will function in the target cell(s) of interest, including melanoma and / or melanocyte specific cells. In some embodiments, the promoter comprises a melanocyte / melanoma specific promoter, such as, for example, MITF-M, DCT, MCR1, and / or TYRL1. In embodiments, the expression cassette further includes miRNA-122 target sequences to prevent ectopic liver expression.

[0135] Inducible promoter / enhancer elements include hormone-inducible and metal- inducible elements, and other promoters regulated by exogenously supplied compounds, including without limitation, the zinc-inducible metallothionein (MT) promoter; the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter; the T7 polymerase promoter system (see WO 98 / 10088); the ecdysone insect promoter (see No et al., Proc. Natl. Acad. Sci. USA 93:3346 (1996)); the tetracycline-repressible system (see Gossen et al., Proc. Natl. Acad. Sci. USA 89:5547 (1992)); the tetracycline-inducible system (see Gossen et al., Science 268:1766 (1995); see also Harvey et al., Curr. Opin. Chem. Biol. 2:512 (1998)); the RU486-inducible system (see Wang et al., Nat. Biotech.15:239 (1997); Wang et al., Gene Ther., 4:432 (1997)); and the rapamycin-inducible system (see Magari et al., J. Clin. Invest.100:2865 (1997)).

[0136] Moreover, specific initiation signals can be required for efficient translation of inserted RNA coding sequences. These translational control sequences, which can include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.Attorney Docket No.5470.972.WO Methods

[0137] Various methods are provided herein, employing the nucleic acid molecules (e.g., siRNA, shRNA), gene editing systems, expression cassettes, and / or compositions of this invention. Thus, in one aspect, the present invention provides a method of reducing mutant Gαqand / or Gα11transcript in a cell, the method comprising contacting the cell with the siRNA molecule, shRNA molecule, gene editing system, expression cassette, vector, composition, and / or pharmaceutical composition of the invention, thereby reducing the mutant Gαqand / or Gα11transcript in the cell.

[0138] Also provided herein is a method of treating uveal melanoma in a subject in need thereof, the method comprising administering the siRNA, shRNA, expression cassette, gene editing system, composition, vector, or viral vector as described herein, to a subject in need thereof. In embodiments, the subject has a mutation at position Q209 of mutated Gαqor Gα11. In embodiments, the subject has the mutation Q209P of mutated Gαq, or Q209L of mutated Gαqor Gα11. In some embodiments, the uveal melanoma is localized to the iris, ciliary body and / or choroid. In some embodiments, the uveal melanoma is a primary tumor. In some embodiments, the uveal melanoma is metastatic, for example, as a separate tumor separate from the primary tumor in tissue of the eye socket, one or more lymph nodes, liver, brain, lung, bone, or tissue under the skin.

[0139] Methods of modulating expression of G protein subunit alpha q (GNAQ) or G protein subunit alpha 11 (GNA11) encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11(Gα11), respectively, in a target cell are provided, comprising contacting the target cell with the siRNA, shRNA, gene editing system, expression cassette, composition, vector or viral vector as described herein. In some embodiments, the contacting occurs in vivo. Routes of administration can comprise, for example, intravenous admininstration, hepatic portal vein injection for delivery to liver metastases, intravenous and intraocular administration. In some embodiments, the contacting comprises intravenous or intraocular administration. As described herein, modulating comprises reducing the mutant Gαqand / or Gα11transcript in the cell, for example, by 10% or more, e.g., 10% 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more relative to a cell without the siRNA, shRNA, gene editing system, expression cassette, composition, vector or viral vector of the invention.

[0140] In one embodiment of each of these aspects, the subject may be one that has been diagnosed with uveal melanoma. In a further embodiment, the subject may be one that has been identified as expressing or over-expressing a mutant Gαqand / or Gα11transcript or mutant GNAQ or GNA11 gene and has or has not been diagnosed with cancer.Attorney Docket No.5470.972.WO

[0141] The siRNA or shRNA molecule of the invention can be delivered directly into a cell by any method known in the art, e.g., by transfection or microinjection, e.g., as part of a composition comprising lipid particles. In other embodiments, the siRNA, sgRNA, or shRNA can be delivered to a subject in the form of polynucleotides encoding the RNA to produce expression of the siRNA within the cells of the subject. Those skilled in the art will appreciate that the isolated polynucleotides encoding the RNAs of the invention will typically be associated with appropriate expression control sequences, e.g., transcription / translation control signals and polyadenylation signals.

[0142] It will be apparent to those skilled in the art that any suitable vector can be used to deliver the polynucleotide to a cell or subject. The vector can be delivered to cells in vivo. In other embodiments, the vector can be delivered to cells ex vivo, and then cells containing the vector are delivered to the subject. The choice of delivery vector can be made based on a number of factors known in the art, including age and species of the target host, in vitro versus in vivo delivery, level and persistence of expression desired, intended purpose (e.g., for therapy or screening), the target cell or organ, route of delivery, size of the isolated polynucleotide, safety concerns, and the like.

[0143] Non-viral transfer methods can also be employed. Many non-viral methods of nucleic acid transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In particular embodiments, non-viral nucleic acid delivery systems rely on endocytic pathways for the uptake of the nucleic acid molecule by the targeted cell. Exemplary nucleic acid delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.

[0144] In particular embodiments, plasmid vectors are used in the practice of the present invention. For example, naked plasmids can be introduced into muscle cells by injection into the tissue. Expression can extend over many months, although the number of positive cells is typically low (Wolff et al., Science 247:247 (1989)). Cationic lipids have been demonstrated to aid in introduction of nucleic acids into some cells in culture (Felgner and Ringold, Nature 337:387 (1989)). Injection of cationic lipid plasmid DNA complexes into the circulation of mice has been shown to result in expression of the DNA in lung (Brigham et al., Am. J. Med. Sci.298:278 (1989)). One advantage of plasmid DNA is that it can be introduced into non- replicating cells.

[0145] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” refer to a variety of art-recognized techniques for introducing foreign nucleicAttorney Docket No.5470.972.WO acids (e.g., DNA and RNA) into a host cell, including, but are not limited to, calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection, DNA-loaded liposomes, lipofectamine-DNA complexes, cell sonication, gene bombardment using high velocity microprojectiles, and viral-mediated transfection. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor, NY, 1989), and other laboratory manuals.

[0146] If stable integration is desired, often only a small fraction of cells (in particular, mammalian cells) integrate the foreign DNA into their genome. In order to identify and select integrants, a nucleic acid that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the nucleic acid of interest. Preferred selectable markers include those that confer resistance to drugs, such as but not limited to G418, hygromycin and methotrexate. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that comprising the nucleic acid of interest or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0147] In one embodiment, the siRNA or shRNA molecule of the invention is administered directly to the subject. Generally, the compounds of the invention will be suspended in a pharmaceutically-acceptable carrier (e.g., physiological saline) and administered intraocularly, orally, topically, or by intravenous infusion, or injected subcutaneously, intramuscularly, intracranially, intrathecally, intraperitoneally, intrarectally, intravaginally, intranasally, intragastrically, intratracheally, and / or intrapulmonarily. The compositions are preferably delivered directly to the site of the disease or disorder, e.g., intraocularly, hepatic portal vein injection for delivery to liver metastases, and / or intravenous administration. The dosage required depends on the choice of the route of administration; the nature of the formulation; the nature of the patient's illness; the subject's size, weight, surface area, age, and sex; other drugs being administered; and the judgment of the attending physician. Suitable dosages may be in the range of 0.01-100.0 μg / kg. Wide variations in the needed dosage are to be expected in view of the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by i.v. injection (e.g., 2-, 3-, 4-, 6-, 8-, 10-; 20-, 50-, 100-, 150-, or more fold). Variations in these dosage levels can be adjusted using standard empirical routines for optimization as is well understood in the art. Administrations can be single or multiple.Attorney Docket No.5470.972.WO Encapsulation of the inhibitor in a suitable delivery vehicle (e.g., polymeric microparticles or implantable devices) may increase the efficiency of delivery, particularly for oral delivery.

[0148] According to certain embodiments, the siRNA, gene editing system, or shRNA molecule can be targeted to specific cells or tissues in vivo. Targeting delivery vehicles, including liposomes and viral vector systems are known in the art. For example, a liposome can be directed to a particular target cell or tissue by using a targeting agent, such as an antibody, soluble receptor or ligand, incorporated with the liposome, to target a particular cell or tissue to which the targeting molecule can bind. Targeting liposomes are described, for example, in Ho et al., Biochemistry 25:5500 (1986); Ho et al., J. Biol. Chem.262:13979 (1987); Ho et al., J. Biol. Chem.262:13973 (1987); and U.S. Pat. No.4,957,735 to Huang et al., each of which is incorporated herein by reference in its entirety). Enveloped viral vectors can be modified to deliver a nucleic acid molecule to a target cell by modifying or substituting an envelope protein such that the virus infects a specific cell type. Alternatively, the route of administration can be used to target a specific cell or tissue. Finally, a recombinant nucleic acid molecule can be selectively (i.e., preferentially, substantially exclusively) expressed in a target cell by selecting a transcription control sequence, and preferably, a promoter, which is selectively induced in the target cell and remains substantially inactive in non-target cells.

[0149] The siRNA, gene editing system, or shRNA molecule of the present invention can optionally be delivered in conjunction with other therapeutic agents. The additional therapeutic agents can be delivered concurrently with the siRNA, gene editing system, or shRNA molecule of the invention. As used herein, the word “concurrently” means sufficiently close in time to produce a combined effect (that is, concurrently can be simultaneously, or it can be two or more events occurring within a short time period before or after each other). In one embodiment, the siRNA or shRNA molecule of the invention are administered in conjunction with agents useful for treating uveal melanoma, such as: ipilimumab, pembrolizumab, nivolumab, entinostat, melphalan PHP, Tebentafusp (Kimmtrak), or a combination thereof. Pharmaceutical compositions

[0150] As a further aspect, the invention provides pharmaceutical formulations and methods of administering the same to achieve any of the therapeutic effects (e.g., treatment of uveal melanoma) discussed above. The pharmaceutical formulation may comprise any of the reagents discussed above in a pharmaceutically acceptable carrier.Attorney Docket No.5470.972.WO

[0151] By “pharmaceutically acceptable” it is meant a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject without causing any undesirable biological effects such as toxicity.

[0152] The formulations of the invention can optionally comprise medicinal agents, pharmaceutical agents, carriers, adjuvants, dispersing agents, diluents, and the like.

[0153] The siRNA, shRNA, gene editing system, expression cassette or vector of the invention can be formulated for administration in a pharmaceutical carrier in accordance with known techniques. See, e.g., Remington, The Science And Practice of Pharmacy (9thEd. 1995). In the manufacture of a pharmaceutical formulation according to the invention, the siRNA or shRNA molecule (including the physiologically acceptable salts thereof) is typically admixed with, inter alia, an acceptable carrier. The carrier can be a solid or a liquid, or both, and is preferably formulated with the siRNA, shRNA, molecule as a unit-dose formulation, for example, a tablet, which can contain from 0.01 or 0.5% to 95% or 99% by weight of the siRNA or shRNA molecule. One or more siRNA or shRNA molecules can be incorporated in the formulations of the invention, which can be prepared by any of the well- known techniques of pharmacy.

[0154] Non-limiting examples of formulations of the invention include those suitable for oral, rectal, buccal (e.g., sub-lingual), vaginal, parenteral (e.g., subcutaneous, intramuscular including skeletal muscle, cardiac muscle, diaphragm muscle and smooth muscle, intradermal, intravenous, intraperitoneal), topical (i.e., both skin and mucosal surfaces, including airway surfaces), intranasal, transdermal, intraarticular, intracranial, intrathecal, and inhalation administration, administration to the liver by intraportal delivery, as well as direct organ injection (e.g., into the liver, into a limb, into the brain or spinal cord for delivery to the central nervous system, into the pancreas, or into a tumor or the tissue surrounding a tumor). The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular compound which is being used. In some embodiments, it may be desirable to deliver the formulation locally to avoid any side effects associated with systemic administration. For example, local administration can be accomplished by direct injection at the desired treatment site, by introduction intravenously at a site near a desired treatment site (e.g., into a vessel that feeds a treatment site). In some embodiments, the formulation can be delivered locally to ischemic tissue. In certain embodiments, the formulation can be a slow release formulation, e.g., in the form of a slow release depot.Attorney Docket No.5470.972.WO

[0155] For injection, the carrier will typically be a liquid, such as sterile pyrogen-free water, pyrogen-free phosphate-buffered saline solution, bacteriostatic water, or Cremophor EL[R] (BASF, Parsippany, N.J.). For other methods of administration, the carrier can be either solid or liquid.

[0156] For oral administration, the compound can be administered in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as elixirs, syrups, and suspensions. Compounds can be encapsulated in gelatin capsules together with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate and the like. Examples of additional inactive ingredients that can be added to provide desirable color, taste, stability, buffering capacity, dispersion or other known desirable features are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, edible white ink and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric- coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.

[0157] Formulations suitable for buccal (sub-lingual) administration include lozenges comprising the compound in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the compound in an inert base such as gelatin and glycerin or sucrose and acacia.

[0158] Formulations of the present invention suitable for parenteral administration comprise sterile aqueous and non-aqueous injection solutions of the compound, which preparations are preferably isotonic with the blood of the intended recipient. These preparations can contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions can include suspending agents and thickening agents. The formulations can be presented in unit / dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for-injection immediately prior to use.Attorney Docket No.5470.972.WO

[0159] Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described. For example, in one aspect of the present invention, there is provided an injectable, stable, sterile composition comprising a compound of the invention, in a unit dosage form in a sealed container. The compound or salt is provided in the form of a lyophilizate which is capable of being reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection thereof into a subject. The unit dosage form typically comprises from about 10 mg to about 10 grams of the compound or salt. When the compound or salt is substantially water- insoluble, a sufficient amount of emulsifying agent which is pharmaceutically acceptable can be employed in sufficient quantity to emulsify the compound or salt in an aqueous carrier. One such useful emulsifying agent is phosphatidyl choline.

[0160] Formulations suitable for rectal administration are preferably presented as unit dose suppositories. These can be prepared by admixing the compound with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.

[0161] Formulations suitable for topical application to the skin preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers which can be used include petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof.

[0162] Formulations suitable for transdermal administration can be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Formulations suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Tyle, Pharm. Res.3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the compound. Suitable formulations comprise citrate or bis\tris buffer (pH 6) or ethanol / water and contain from 0.1 to 0.2M of the compound.

[0163] The compound can alternatively be formulated for nasal administration or otherwise administered to the lungs of a subject by any suitable means, e.g., administered by an aerosol suspension of respirable particles comprising the compound, which the subject inhales. The respirable particles can be liquid or solid. The term “aerosol” includes any gas-borne suspended phase, which is capable of being inhaled into the bronchioles or nasal passages. Specifically, aerosol includes a gas-borne suspension of droplets, as can be produced in a metered dose inhaler or nebulizer, or in a mist sprayer. Aerosol also includes a dry powder composition suspended in air or other carrier gas, which can be delivered by insufflation from an inhaler device, for example. See Ganderton & Jones, Drug Delivery to the RespiratoryAttorney Docket No.5470.972.WO Tract, Ellis Horwood (1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier Systems 6:273-313; and Raeburn et al., J. Pharmacol. Toxicol. Meth.27:143 (1992). Aerosols of liquid particles comprising the compound can be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Patent No.4,501,729. Aerosols of solid particles comprising the compound can likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.

[0164] Alternatively, one can administer the compound in a local rather than systemic manner, for example, in a depot or sustained-release formulation.

[0165] Further, the present invention provides liposomal formulations of the compounds disclosed herein and salts thereof. The technology for forming liposomal suspensions is well known in the art. When the compound or salt thereof is an aqueous-soluble salt, using conventional liposome technology, the same can be incorporated into lipid vesicles. In such an instance, due to the water solubility of the compound or salt, the compound or salt will be substantially entrained within the hydrophilic center or core of the liposomes. The lipid layer employed can be of any conventional composition and can either contain cholesterol or can be cholesterol-free. When the compound or salt of interest is water-insoluble, again employing conventional liposome formation technology, the salt can be substantially entrained within the hydrophobic lipid bilayer which forms the structure of the liposome. In either instance, the liposomes which are produced can be reduced in size, as through the use of standard sonication and homogenization techniques.

[0166] The liposomal formulations containing the compounds disclosed herein or salts thereof, can be lyophilized to produce a lyophilizate which can be reconstituted with a pharmaceutically acceptable carrier, such as water, to regenerate a liposomal suspension.

[0167] In the case of water-insoluble compounds, a pharmaceutical composition can be prepared containing the water-insoluble compound, such as for example, in an aqueous base emulsion. In such an instance, the composition will contain a sufficient amount of pharmaceutically acceptable emulsifying agent to emulsify the desired amount of the compound. Particularly useful emulsifying agents include phosphatidyl cholines and lecithin.

[0168] In particular embodiments, the compound is administered to the subject in a therapeutically effective amount, as that term is defined above. Dosages of pharmaceutically active compounds can be determined by methods known in the art, see, e.g., Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa). The therapeutically effective dosage of any specific compound will vary somewhat from compound to compound, andAttorney Docket No.5470.972.WO patient to patient, and will depend upon the condition of the patient and the route of delivery. As a general proposition, a dosage from about 0.001 to about 50 mg / kg will have therapeutic efficacy, with all weights being calculated based upon the weight of the compound, including the cases where a salt is employed. Toxicity concerns at the higher level can restrict intravenous dosages to a lower level such as up to about 10 mg / kg, with all weights being calculated based upon the weight of the compound, including the cases where a salt is employed. A dosage from about 10 mg / kg to about 50 mg / kg can be employed for oral administration. Typically, a dosage from about 0.5 mg / kg to 5 mg / kg can be employed for intramuscular injection. Particular dosages are about 1 µmol / kg to 50 µmol / kg, and more particularly to about 22 µmol / kg and to 33 µmol / kg of the compound for intravenous or oral administration, respectively.

[0169] In particular embodiments of the invention, more than one administration (e.g., two, three, four, or more administrations) can be employed over a variety of time intervals (e.g., hourly, daily, weekly, monthly, etc.) to achieve therapeutic effects.

[0170] The present invention finds use in veterinary and medical applications. Suitable subjects include both avians and mammals, with mammals being preferred. The term “avian” as used herein includes, but is not limited to, chickens, ducks, geese, quail, turkeys, and pheasants. The term “mammal” as used herein includes, but is not limited to, humans, bovines, ovines, caprines, equines, felines, canines, lagomorphs, etc. Human subjects include neonates, infants, juveniles, and adults. In other embodiments, the subject is an animal model of cancer. In certain embodiments, the subject has or is at risk for cancer.

[0171] Also provided herein is a kit comprising a composition of the present invention, and optional instructions for the use thereof.

[0172] Kits that include particles of this invention and / or a pharmaceutical composition as described herein are also provided herein. Some kits include particles and / or compositions in a container (e.g., vial or ampule), for example, siRNA, shRNA, sgRNA, gene editing systems, expression vectors, and may also include instructions for use of the particles and / or composition in the various methods disclosed above. The particles and / or composition can be in various forms, including, for instance, as part of a solution or as a solid (e.g., lyophilized powder). The instructions may include a description of how to prepare (e.g., dissolve or resuspend) the particles in an appropriate fluid and / or how to administer the particles for the treatment of the diseases and disorders described herein. The kits may also include various other components, such as buffers, salts, complexing metal ions and other agents describedAttorney Docket No.5470.972.WO above in the section on pharmaceutical compositions. These components may be included with the chimeric protein or may be in separate containers. The kits may also include other therapeutic agents for administration with the chimeric protein. Examples of such agents include, but are not limited to, agents to treat the disorders or conditions described above.

[0173] The following examples are not intended to limit the scope of the claims to the invention, but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the present invention. As will be understood by one skilled in the art, there are several embodiments and elements for each aspect of the claimed invention, and all combinations of different elements are hereby anticipated, so the specific combinations exemplified herein are not to be construed as limitations in the scope of the invention as claimed. If specific elements are removed or added to the group of elements available in a combination, then the group of elements is to be construed as having incorporated such a change. EXAMPLES Example 1. siRNA reduction of mutant GNAQ and GNA11 transcripts

[0174] Applicant conducted experiments with siRNAs having a single point mutation at varying positions within the siRNAs, identified as P1-P19 (FIG.2), specifically depleted the mutant form of Gαq including clonogenic survival when using specific positions of the point mutation in the siRNA (FIG.1). The siRNA with a point mutation at position 5 provided a reduction in total Gαq and mutant transcripts using siRNA; and depletion of mutant Gαq reduced downstream YAP transcriptional targets (FIG.1).

[0175] siRNAs specific for GNA11 Q209L with complementarity to the point mutation at varying positions in the siRNA were developed (FIG.4). As shown in FIG.3, the siRNA with complementarity at position 4 to the point mutation showed efficacy for depleting the mutant form of Gα11.

[0176] FIGS.5A-5D show an example gene therapy-based approach explored using Adeno-Associated Virus (AAV) using an scAAV GNAQ / GNA11-targeting RNA cassette (FIG.5A). ssAAV2-shGNAQ transduction did not affect cell viability in GNAQ wt cells (FIG.5B); but reduced cell viability in GNAQ mutant cells (FIG.5C). Non-targeting control AAV construct also reduced cell viability in the GNAQ mutant cells (FIG.5D). As shown in FIG.6, AAV-shGNAQP5 reduced colony formation 5 fold over AAV-GFP alone. Methods Cell CultureAttorney Docket No.5470.972.WO

[0177] GNAQ Q209L mutant Mel202 (CVCL_C301) and 92.1 (CVCL_8607) human uveal melanoma cell lines were purchased from Sigma-Aldrich Inc (Saint Louis, MO, USA). Mel202 and 92.1 lines were cultured with RPMI Medium 1x (Gibco, Carlsbad, CA, USA), 10% Fetal Bovine Serum (Omega Scientific Inc., Tarzana, CA, USA), 2mM L-Glutamine (Gibco, Carlsbad, CA, USA), and 1% antibiotic-antimycotic 100x solution (Gibco, Carlsbad, CA, USA) at 5% CO2 and 37 °C. UM cultures were fed with fresh media every 2-3 days and subcultured at approximately 60-80% confluency. siRNA Transfection

[0178] P1-P19 siRNA targeting GNAQ Q209L mutant were designed as described by Schwarz et. al., Designing siRNA that distinguish between genes that differ by a single nucleotide. PLoS Genet.2006 Sep 8;2(9):e140. doi: 10.1371 / journal.pgen.0020140. siRNA was transfected into UM cells using a Lipofectamine RNAiMAX kit (Invitrogen / ThermoFisher Scientific Inc., Carlsbad, CA, USA) following the manufacturer’s instructions for a total of twenty experimental groups. siRNA sequences were custom ordered from MilliporeSigma (Burlington, MA, USA). An siRNA that has no known targeting capability for human or mouse sequences (non-targeting control, or NTC) was used as a control siRNA. Cell Sorting

[0179] Due to low transfection efficiencies, UM cells were sorted 24-hours following transfection of 6-FAM labeled siRNA using a Becton Dickinson FACSAria II system. Propidium iodide was used as a live / dead discrimination dye. One-hundred thousand 6-FAM- positive live cells were collected for each sample and subsequently divided for clonogenic survival, alamarBlue viability testing, RT-qPCR, and Next Generation Sequencing (NGS) analyses. Clonogenic Survival Assay

[0180] One thousand cells were plated on 100 x 20 mm tissue culture dishes (#25-202, Genesee Scientific, El Cajon, CA, USA) in replicates of four for each of the twenty experimental groups (P1-P19) to ensure single cell dispersion. Cultures were fed with fresh media every 2-3 days for 14-21 days until colonies containing > fifty cells became visible. Media was removed from each plate, stained with .05% crystal violet / 40% methanol, washed with phosphate-buffered saline (PBS) solution (pH ~ 7.4), and dried overnight. Plates were imaged using the Amersham ImageQuant 800 system (Cytiva, Marlborough, MA, USA) and analyzed for colony numbers with a hand count. The data shown are compiled from three independent experiments with at least 10 replicates for each group.Attorney Docket No.5470.972.WO RT-qPCR

[0181] To quantify the total number of GNAQ transcript copies (both mutant and wild- type), RT-qPCR was performed in triplicate for each sample. Briefly, RNA was isolated from 24-hour post-siRNA-transfected cells with RNeasy kits (Qiagen, Hilden, Germany) and treated with a DNA-free DNA removal kit (Invitrogen / Thermo Fisher Scientific Inc., Vilnius, Lithuania). First-strand synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems / Thermo Fisher Scientific Inc., Vilnius, Lithuania) according to the manufacturer’s instructions.

[0182] GAPDH transcripts were quantified using PowerTrack SYBR Green Master Mix, 500 nM forward primer Human-GAPDH-R3 (5’-TTCAGCTCAGGGATGACCTT-3’; SEQ ID NO:76) and 500 nM reverse primer Human-GAPDH-F3 (5’- ACCCAGAAGACTGTGGATGG-3’; SEQ ID NO:77) to target Human GAPDH (Eton Bioscience, Research Triangle Park, NC, USA), in a 20 uL total volume. Standard curves were generated using known quantities of genomic DNA isolated from a diploid human lymphoblast cell line. SYBR Green reactions were quantified on a StepOnePlus Real-Time PCR System (Applied Biosystems / Thermo Fisher Scientific Inc., Vilnius, Lithuania) using the following cycling parameters: 95 °C for 20 seconds followed by 40 cycles of 95 °C for 20 seconds, 57 °C for 20 seconds, and 72 °C for 20 seconds. For GNAQ transcript copy numbers, a TaqMan Universal PCR Master Mix (Applied Biosystems / Thermo Fisher Scientific Inc., Vilnius, Lithuania) was used containing TaqMan gene expression assay probe / primer mix (Hs00387073_m1) in a total volume of 20 uL following the manufacturer’s instructions (900 nM forward primer, 900 nM reverse primer, 250 nM probe). A standard curve was generated using known concentrations of a GNAQ overexpression plasmid. TaqMan reactions were performed on the StepOnePlus Real-Time PCR System (Applied Biosystems / Thermo Fisher Scientific Inc., Vilnius, Lithuania) with the following thermal cycling parameters: 50 °C for 2 minutes and 95 °C for 10 minutes, followed by 45 cycles of 95 °C at 10 seconds, 60 °C for 30 seconds, and 72 °C for 1 second. All samples were quantified in triplicate and RNA was isolated from three independent experiments.

[0183] The values of transcript copies for both Human GAPDH and Gαq were quantified using a protocol as previously described (Song, Bower, Hirsch, Preparation and Administration of Adeno-associated Virus Vectors for Corneal Gene Delivery. Methods Mol Biol.2020;2145:77-102. doi: 10.1007 / 978-1-0716-0599-8_7.) and are presented as the Gαq transcript number / GAPDH transcript.Attorney Docket No.5470.972.WO Quantification of mutant and wild-type GNAQ / 11 transcripts

[0184] To differentiate the total number of wild-type and mutant (Gln209Leu; p.626 A > T) Gαq transcripts, next-generation sequencing (NGS) was completed on each sample. First, the region of interest was subject to PCR amplification using a Phusion High Fidelity PCR kit (New England Biolabs, Ipswich, MA, USA). Then, amplified cDNA of P5 siRNA-treated and NTC-treated samples were briefly purified using a QIAquick PCR Purification kit following the manufacturer’s instructions (Qiagen, Hilden, Germany). To ensure the success of PCR amplification for NGS, PCR products (263 bp amplicons) were subjected to electrophoresis on a 2% agarose gel and sizes were measured with a 1 kb DNA ladder (New England Biolabs, Ipswich, MA, USA).

[0185] Samples were then shipped to Genewiz (Azenta Life Sciences, South Plainfield, NJ, USA) for EZ-Amplicon Next Generation Sequencing. The Parktek Flow software (Partek Incorporated, Chesterfield, MO, USA) was used for analysis. Sequences were aligned with a BWA Alignment, and variants between transcripts were called using FreeBayes. The total number of transcripts with the A (Wild-type) allele versus the T (Mutant) allele at position 626 were quantified using the “chromosome” view for each sample. The data shown were compiled from five independent experiments. Statistical Analyses

[0186] Statistically significant differences between control and experimental groups were determined using GraphPad Prism (Version 9.5.1. for Windows 10, San Diego, CA, USA) and MS Excel (Microsoft 365 for Microsoft Corporation, Redmond, WA, USA) using an unpaired t-test at a 95% confidence interval (p-value < .05). Statistical significance tests were completed within each replicated experimental set-up. Graphical depictions of data were created using GraphPad Prism. Sequences GNAQ P5 Q209L shRNA cassettes: U6 promoter – shRNA GNAQ Q209L P5 – Terminator Cassettes: A. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGT ACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCCT TAGGCCCCCTACATCGCTCGAGCGATGTAGGGGGCCTAAGGTTTTT (SEQ ID NO:65) B. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGT ACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCGAAttorney Docket No.5470.972.WO TGTAGGGGGCCTAAGGCTCGAGCCTTAGGCCCCCTACATCGTTTTT (SEQ ID NO:66) Hairpin Loops: A. CCTTAGGCCCCCTACATCGCTCGAGCGATGTAGGGGGCCTAAGG (SEQ ID NO:67) B. CGATGTAGGGGGCCTAAGGctcgagCCTTAGGCCCCCTACATCG (SEQ ID NO:68) GNA11 P4 Q209L shRNA cassette U6 promoter -shGNA11 Q209L P4 – Terminator Cassettes: A. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGT ACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCGC AGGCCCCCCACATCCACTCGAGTGGATGTGGGGGGCCTGCGTTTTT (SEQ ID NO:69) C. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGT ACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTGG ATGTGGGGGGCCTGCGCTCGAGCGCAGGCCCCCCACATCCATTTTT (SEQ ID NO:70) Hairpin Loops: A. TGGATGTGGGGGGCCTGCGctcgagCGCAGGCCCCCCACATCCA (SEQ ID NO:71) B. TGGATGTGGGGGGCCTGCGCTCGAGCGCAGGCCCCCCACATCCA (SEQ ID NO:72) GNAQ P5 Q209P shRNA cassettes: U6 promoter – shRNA GNAQ Q209L P5 – Terminator Cassettes: A. gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaa CACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTG GGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTA CCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAG GACGAAACACCGGCCTTGGGCCCCCTACATCGCTCGAGCGATGTAGGGGG CCCAAGGTTTTT (SEQ ID NO:73) B. GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGT ACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTT AAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTA TTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCGA TGTAGGGGGCCCAAGGCTCGAGCCTTGGGCCCCCTACATCGTTTTT (SEQ ID NO:74) Hairpin Loops: A. CCTTAGGCCCCCTACATCGCTCGAGCGATGTAGGGGGCCTAAGG (SEQ ID NO:67)Attorney Docket No.5470.972.WO B. CGATGTAGGGGGCCTAAGGctcgagCCTTAGGCCCCCTACATCG (SEQ ID NO:68) shRNA and Herpes Simplex Virus Thymidine Kinase Cassette (U6 promoter – GNAQ Q209L P5 shRNA cassette – terminator – CMV promoter – HSV-TK-bGH Poly A signal) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTA GAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATA CGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTT AAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTT ATATATCTTGTGGAAAGGACGAAACACCGGCCTTAGGCCCCCTACATCGCTCGA GCGATGTAGGGGGCCTAAGGTTTTTGAATTCACGCGTGGTACCCGTTACATAACT TACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCA ATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGT AAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTAT TGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGT GATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGG ATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAAT CAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGC GGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGT CAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGG GACCGATCCAGCCTCCGGACTCTAGAGGATCCGGTACTCGATGTAGAAGCGCGT ATGGCTTCGTACCCCTGCCATCAACACGCGTCTGCGTTCGACCAGGCTGCGCGTT CTCGCGGCCATAGCAACCGACGTACGGCGTTGCGCCCTCGCCGGCAGCAAGAAG CCACGGAAGTCCGCCTGGAGCAGAAAATGCCCACGCTACTGCGGGTTTATATAG ACGGTCCTCACGGGATGGGGAAAACCACCACCACGCAACTGCTGGTGGCCCTGG GTTCGCGCGACGATATCGTCTACGTACCCGAGCCGATGACTTACTGGCAGGTGCT GGGGGCTTCCGAGACAATCGCGAACATCTACACCACACAACACCGCCTCGACCA GGGTGAGATATCGGCCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAAC AATGGGCATGCCTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATGTCGGGGGG GAGGCTGGGAGTTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCC ATCCCATCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCAT GACCCCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGC ACAAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTCGC CGCGTTTACGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGGGTCGT GGTGGGAGGATTGGGGACAGCTTTCGGGGACGGCCGTGCCGCCCCAGGGTGCCG AGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGTTATTTACCC TGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTATAACGTGTTTGC CTGGGCCTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCACGTCTTTATCCTG GATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGCAACTTACCTCCG GGATGGTCCAGACCCACGTCACCACCCCAGGCTCCATACCGACGATCTGCGACCT GGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCTAACTGAAACACGGAAGTCGA CTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTT TGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTC CTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTG GGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAG GCATGCTGGGGA (SEQ ID NO:75) Example 2. Allele-specific depletion of GNAQQ209Lvia siRNA or a rAAV2-shRNA vector induces selective toxicity in GNAQQ209Luveal melanoma cellsAttorney Docket No.5470.972.WO Design of the GNAQQ209Lspecific siRNA panel

[0187] Previous work has demonstrated that some sequence-specific siRNAs can discriminate between RNA transcripts that differ by a single nucleotide.42-45Because the majority of oncogenic driver mutations that result in UVM initiation and / or progression occur as a single-base adenine-to-thymine substitution at codon 209 (Q209L) on one allele of GNAQ or GNA11, it was hypothesized that this unique property could be exploited by designing an siRNA molecule to selectively target GNAQQ209Ltranscripts while maintaining expression of GNAQwttranscripts. Depletion of GNAQQ209Lwould be expected to downregulate signaling cascades required for UVM proliferation and survival and ultimately culminate in UVM specific cell death.46To test this hypothesis, a panel of nineteen siRNA sequences were designed to target GNAQQ209Lin which the antisense nucleotide of the Q209L mutant was placed in the first position relative to the 5’ end of the siRNA and sequentially shifted towards the 3’ end in each successive molecule, generating a total of nineteen different Q209L-targeted sequences (FIG. 2). This creates a mismatch between the mutant-targeting siRNA sequence and wild-type transcript at each position (P) in the siRNA molecule, which was hypothesized to prevent GNAQwtdepletion by impeding Dicer-mediated cleavage of the wild-type transcripts as previously demonstrated by Schwarz et. al. (FIG. 2).42These siRNA sequences were subsequently examined for the potential to induce cell death in Mel202 cells, a cell line isolated from a primary human uveal melanoma tumor and harbors a single GNAQQ209Lallele.47,48Two siRNA sequences reduced clonogenic survival in a UVM cell line harboring GNAQQ209L

[0188] To examine the impact of GNAQQ209L-targeting siRNA on the viability of Mel202 GNAQQ209LUVM cells, transient transfections were performed with each GNAQQ209L-targeting siRNA or a non-targeting control (NTC) siRNA labeled with a 6-FAM fluorophore. Twenty- four hours post-transfection, flow cytometry enrichment of the 6-FAM positive population was performed. alamarBlue™ metabolic activity, a fluorescence-based indirect measure of cell viability, and clonogenic survival were measured 6- and 14-days post-enrichment, respectively. Overall, colony forming units (CFUs) were highly variable among GNAQQ209L-targeting siRNA-transfected cells compared to NTCs (FIG. 13A). Notably, transfection with GNAQQ209L-targeting siRNAs containing a mismatch to the wild-type allele at position 2 (P2) and position 5 (P5) significantly decreased clonogenic survival by ~51% (±19.1%; p < .001) and ~60% (±33.1%; p < .001) of the NTC, respectively (FIG.8A, 13A). Consistently, changes in alamarBlue™ fluorescence were measured six days post-enrichment and demonstrated thatAttorney Docket No.5470.972.WO transfection with either the P2 or P5 GNAQQ209L-targeting siRNA sequences resulted in a reduction in metabolic activity (FIG.13B) of ~18% (±22.4%; p = .027) and ~45% (±18.5%; p < .001) of the NTC, respectively (FIGS. 8A, 13A). Representative brightfield microscopy images of Mel202 cells transfected with NTC or the P5 GNAQQ209L-targeting siRNA sequence (72-hours post-transfection) depict that P5 GNAQQ209L-targeting siRNA treated cells exhibit a detached, aggregated, and non-refractive phenotype indicative of cell death (FIG. 8B).49Because the P5 GNAQQ209L-targeting siRNA sequence demonstrated the largest reduction in Mel202 cell viability by two independent assays, it was subsequently investigated for its specificity towards the GNAQQ209Ltranscript (FIGS.2, 8A, 8B). P5 GNAQQ209L-targeting siRNA preferentially reduces GNAQQ209Ltranscripts and YAP transcriptional activity

[0189] Due to the reduction in cell viability observed post-transfection with the P5 GNAQQ209L-targeting siRNA, GNAQ transcript levels were also measured to investigate the siRNA’s specificity for mutant transcripts.42To quantify total GNAQ transcripts, RNA was isolated from the 6-FAM enriched population samples 24 hours post-transfection and subjected to RT-qPCR. Residual DNA was not detected in samples that lacked reverse transcriptase (Data Not Shown, DNS). Total GNAQ, relative to host GAPDH, was depleted by ~60% (±4%; p < .001; FIG.14) in the P5 GNAQQ209L-targeting siRNA treated cells compared to NTC samples. To characterize individual GNAQ transcripts, a 263-base-pair region of GNAQ cDNA containing codon 209 was amplified by PCR and next-generation Amplicon-EZ sequencing (NGS) was performed by Azenta / Genewiz (South Plainfield, NJ, USA). Allele-specific quantification was completed based on the presence of an adenine (GNAQwt) or a thymine (GNAQQ209L) nucleotide at base-pair position 626 on codon 209 and expressed as a percentage of the total number of sequencing reads. The NGS results demonstrated that the proportion of GNAQwtto GNAQQ209Ltranscripts among the NTC samples was approximately 1:1 with 54% containing the wild-type sequence and 46% containing the Q209L sequence (FIG. 9A). For Mel202 cells transfected with the P5 GNAQQ209L-targeting siRNA, the proportion of GNAQwtto GNAQQ209Lsignificantly increased by a ratio of 3:1 with 76% containing the wild-type sequence and 24% containing the Q209L mutant sequence (p < .001; FIG.9A), suggesting that the P5 GNAQQ209L-targeting siRNA preferentially depleted Q209L transcripts.

[0190] Previous reports have suggested that a reduction in both wild-type and mutant GNAQ using pooled siRNAs or Gα protein small-molecule inhibitors significantly decrease downstream YAP activity which then inhibits transcriptional activation of its target genes CYR61 and CTGF in GNAQ mutant UVM cell lines.22,36,46To characterize the functionalAttorney Docket No.5470.972.WO impact of P5 GNAQQ209L-targeting siRNA depletion, cDNA from samples with confirmed GNAQQ209L-specific depletion were subjected to RT-qPCR using primer / probe sets that amplify / detect CYR61 and CTGF cDNA. The P5 GNAQQ209L-targeting siRNA significantly reduced both CYR61 and CTGF cDNA abundance, relative to host GAPDH, by 26% (±23%; p = .005; FIG.9B) and 16.3% (±12%; p = .002; FIG.9B), respectively, twenty-four hours post- transfection. P5 GNAQQ209L-targeting siRNA does not affect viability or GNAQwttranscript abundance in GNAQwtUVM

[0191] To ensure that the effects of the P5 GNAQQ209L-targeting siRNA observed in the Mel202 cell line were due to its GNAQQ209Lmutation status, similar clonogenic survival and alamarBlue™ assays were performed on two additional previously characterized human UVM cell lines, Mel285 (GNAQwt) and 92.1 (GNAQQ209L).48,50,51Flow cytometry enrichment of siRNA-transfected cell populations was completed for both Mel285 and 92.1 in the same manner as described for Mel202 cells. In both assays, P5 GNAQQ209L-targeting siRNA failed to reduce viability in Mel285 cells (FIG. 10A). Although a slight increase in alamarBlue™ fluorescence (110.7% ±3.2%; p = .001; FIG. 10A) was observed in Mel285 cells transfected with the P5 GNAQQ209L-targeting siRNA, there was no difference between these samples via the clonogenic survival assay (p = 0.132; FIG. 10A). Additionally, P5 GNAQQ209L-targeting siRNA did not alter total GNAQ transcripts in Mel285 cells (p = .347, FIG.15B). Conversely, transfection with the P5 GNAQQ209L-targeting siRNA in the 92.1 GNAQQ209Lcell line significantly reduced clonogenic survival and alamarBlue™ fluorescence to 57% (±13.7%; p < .001; FIG.10B) and 76.8% (±13.4%; p < .001; FIG. 10B) of the NTC-transfected control cells, respectively, demonstrating that the reduction in cell viability after treatment with the P5 GNAQQ209L-targeting siRNA occurs in multiple GNAQQ209Lcell lines. Partial depletion of total GNAQ transcripts in 92.1 cells was also confirmed through RT-qPCR and was significantly reduced by ~33% (±17%, p < .001, FIG.15A). Adeno-associated virus serotype 2 (AAV2) efficiently transduces UVM cell lines

[0192] Due to the short half-life of siRNA within cells and for a more efficient delivery method to UVM cells, an adeno-associated virus (AAV) strategy was pursued with the intent to constitutively express the P5 GNAQQ209L-targeting siRNA as an shRNA cassette.52-56Although a multitude of AAV serotypes have been isolated across several species that exhibit selective tropism for the transduction of different tissue types,57to date, a comprehensive analysis regarding AAV transduction efficiency in UVM cell lines has not been reported. Thus, the transduction efficiency of eight natural AAV capsid serotypes (AAV1-9, except AAV7)Attorney Docket No.5470.972.WO was investigated. The AAV capsids were packaged with a self-complementary (sc) vector genome encoding the green fluorescent protein (GFP) reporter transcribed from the ubiquitous cytomegalovirus (CMV) promotor (scAAV-CMV-GFP).58All three UVM cell lines utilized in this study (Mel285, Mel202, and 92.1) were transduced with each of the eight serotypes at 1.0×104viral genomes per cell (vg / cell) and the percentage of GFP positive cells was measured by flow cytometry three days post-transduction. Of all serotypes examined, serotype 2 (scAAV2-CMV-GFP) transduced all tested UVM cell lines with the highest efficiency (FIG. 11A, 16). On average, 60% (±14%) of Mel285 cells, 64% (±1.3%) of Mel202 cells, and 59% (±4.0%) of 92.1 cells were GFP+(FIGS.11A, 16). Furthermore, AAV1 and AAV3 transduced UVM cell lines with varying efficiencies, while little to no transduction was observed using AAV4, AAV5, AAV6, AAV8, and AAV9 capsids (FIGS. 11A, 16). Representative GFP fluorescence microscopy images of scAAV2-transduced and PBS control Mel285, Mel202, and 92.1 cells are shown in FIG.11B. rAAV2-shGNAQQ209Lvector design

[0193] Because rAAV2 transduced all tested UVM cell lines with high efficiency in vitro, the P5 GNAQQ209L-targeting siRNA sequence was converted to an shRNA cassette and vectorized for delivery via rAAV2 in a single-stranded (ss) genome context (FIG. 12A). Following the flanking 5’ inverted terminal repeat of serotype 2 (ITR2), the P5 GNAQQ209L- targeting shRNA cassette was placed under the control of the U6 promotor, and a RNA Polymerase III terminator sequence was added to the 3’ end.59Downstream of the shRNA cassette, the GFP open reading frame (ORF) was placed under the control of the CMV promoter and the simian virus 40 (SV40) poly A tail as a separate expression cassette, followed by the 3’ flanking ITR. Henceforth, this vector is referred to as rAAV2-shGNAQQ209L(FIG.12A). A near identical control vector was also generated that replaced the P5 GNAQQ209L-targeting siRNA sequence with the NTC control sequence (rAAV2-shNTC). The NTC sequence was confirmed to lack sequence similarity to any known human or mouse RNA sequences, with at least seven mismatches between the NTC sequence and other known RNAs through a National Center for Biotechnology Information (NCBI) BLAST®search.60Both rAAV2-shGNAQQ209Land rAAV2-shNTC viruses were obtained from VectorBuilder (Chicago, IL, USA) and the preparations were characterized via alkaline gel electrophoresis to confirm packaged vector size and qPCR to determine viral genome titer (FIG.17A). SYBR Gold staining of packaged vector genomes revealed that the majority of packaged species were single-stranded, as expected; however, some suspected scAAV genomes were noted, which is predicted to occur given the approximately 2.2 kilobase transgenic genome (FIG.17A).58Attorney Docket No.5470.972.WO rAAV2-shGNAQQ209Ltransduction results in GNAQQ209LUVM cell death, similar to that observed with P5 GNAQQ209L-targeting siRNA

[0194] To assess the effects of the vectorized P5 GNAQQ209L-targeting shRNA sequence, Mel285, Mel202, and 92.1 cells were treated with vehicle control (PBS) or 1.0×104vg / cell of either rAAV2-shNTC or rAAV2-shGNAQQ209Land assessed for metabolic activity via alamarBlue™ fluorescence. Seven days post-transduction, rAAV2-shGNAQQ209Lreduced fluorescence in Mel202 and 92.1 UVM cells by an average of ~32% (±2.8%; p > .001) and ~61% (±6.2%; p > .001), respectively (FIG.12B). Surprisingly, the rAAV2-shNTC vector also reduced fluorescence by ~23% in Mel202 (±6.3%; p > .001) and ~28% in 92.1 (±6.1%; p > .001) (FIG. 12B). 1.0×104vg / cell of rAAV2-shNTC and rAAV2-shGNAQQ209Lslightly reduced fluorescence in Mel285 cells by ~22% (±4.1%; p > .001) and 25% (±3.9%; p > .001), respectively, but there was no significant difference between the vectors (FIG.12B).

[0195] Representative images for both brightfield and GFP fluorescence microscopy indicate Mel285 cells that Mel285 cells appear normal and exhibit similar morphology across treatments; however, vector-treated Mel202 and 92.1 cells show a reduction in the number of adherent cells post-transduction of both rAAV2-shNTC and rAAV2-GNAQQ209L, with rAAV2-GNAQQ209Ldemonstrating the largest reduction in viability (FIG. 12C). The dark, small, and circular objects visible in the brightfield images exhibit autofluorescence in both Mel202 and 92.1 cells, possibly indicating the release of melanin or melanosomes following uveal melanocyte death (FIGS.12C).61,62These morphological changes were not observed in the GNAQwtMel285 cells (FIG.12C, left panels). Taken together, these data suggest that the rAAV2-shGNAQQ209Lvector induced cell death in GNAQQ209LUVM cells, and, to a lesser extent, the rAAV2-shNTC vector also exhibited GNAQQ209LUVM cell death. DISCUSSION

[0196] For UVM patients diagnosed with liver metastases, there are very few treatment options, and the outcome is an almost 100% fatality rate within 6-12 months.3,4,63-65Previous efforts to target the oncogenic driver mutations responsible for UVM initiation and survival have proven challenging, often resulting in systemic toxicity in vivo due to an inability to distinguish between the mutant and wild-type forms32,33,35-37, and targeting of the Gαqpathway at downstream signaling nodes has thus far proven ineffective.66Here, evidence is presented demonstrating that, first, a siRNA molecule designed to target the GNAQQ209Ldriver mutation can selectively deplete GNAQQ209Ltranscripts while maintaining at least a three-fold higher ratio of GNAQwttranscripts, ultimately resulting in significant cell death in multiple GNAQQ209LUVM cell lines established from different primary human tumors (FIGS. 8A-10B). In aAttorney Docket No.5470.972.WO GNAQwtcell line, transfection with the P5 GNAQQ209L-targeting siRNA did not lead to a significant reduction in total GNAQ transcripts nor did it result in cell death, illustrating the selectivity of the P5 GNAQQ209L-targeting siRNA. A second approach employing an shRNA cassette based on the P5 GNAQQ209L-targeting sequence delivered via an AAV vector (rAAV2- shGNAQQ209L) also induced cell death in multiple GNAQQ209Lcell lines (FIGS. 11A-12C). Taken together, these data suggest that allele-specific depletion of GNAQQ209Ltranscripts via siRNA or an shRNA cassette coupled with an AAV delivery vector is a feasible and promising gene therapy approach for the treatment of UVM.

[0197] One of the most important aspects of the work presented herein is the demonstration that GNAQQ209LUVM cell survival is dependent on GNAQQ209Ltranscript expression, which can be exploited to induce cell death. Importantly, this approach directly targets the mutant form of a Gα protein, which has historically been considered an undruggable target. Nineteen different siRNA sequences were initially screened to identify sequences that could reduce GNAQQ209LUVM cell survival (FIG. 8A-8C), and, ultimately, the P2 and P5 GNAQQ209L- targeting siRNAs were the only sequences that reduced cell viability (FIGS. 13A-13B). The siRNA’s positional- and sequence-specific effects described herein are consistent with the findings of Schwarz et. al. and others, likely because the position of the mismatched base pair occurs at the RNA-induced silencing complex (RISC) cleavage site, thus allowing the wild- type mRNA to escape degradation.42,67-71The P5 GNAQQ209L-targeting siRNA was chosen for further characterization as this sequence induced the largest percentage of cell death in Mel202 cells (FIGS. 8A-8C, 13A-13B). Although all siRNAs tested were antisense matches to the GNAQQ209LmRNA, it was unexpectedly observed that approximately half of the GNAQQ209L- specific siRNAs resulted in significant increases in both colony formation and alamarBlue™ fluorescence compared to the NTC siRNA (FIGS.13A-13C). An NCBI BLAST®search of all nineteen siRNAs against known transcript sequences in the human and mouse genomes suggest they have no other exact sequence matches, but several of the duplexed siRNAs contained at least some sequence complementarity to other mRNAs that may affect off-target transcript regulation of cell metabolism and / or proliferation.60,72-76Although this variability is interesting, these mechanisms are not fully understood and are beyond the scope of the current study.

[0198] A second important aspect of this work is the demonstration that preferential depletion of a single-nucleotide mutant transcript can be achieved while preserving wild-type transcript expression. FIGS. 9A-9B and 14 demonstrate that 24-hours post-transfection of P5 GNAQQ209L-targeting siRNA, a ~60% reduction in total GNAQ transcripts which results in a 3:1 GNAQQ209L-selective bias in transcript depletion is observed in conjunction with aAttorney Docket No.5470.972.WO significant reduction in the YAP-induced transactivation of CTGF and CYR61 genes. It has previously been shown that GNAQwtexpression remains necessary for normal cell signaling and function: defects in platelet activation and mouse development / cognition have been observed in GNAQ- / -knockout models, and systemic treatment of mice with Gαq / 11small molecule inhibitors results in acute toxicity.16,30,31,35,36,77,78Taken together, the data in FIGS. 8A-8C and 9A-9B demonstrate that the P5 GNAQQ209L-targeting siRNA sequence preferentially discriminated between wild-type and mutant GNAQ transcripts while functionally reducing aberrant downstream signaling associated with UVM survival / progression. This suggests that a genetic-based approach which preferentially targets GNAQQ209Ltranscripts may provide an alternative therapeutic strategy for UVM with fewer off-target side effects.

[0199] To confirm that the P5 GNAQQ209L-targeting siRNA preferentially targeted GNAQQ209Ltranscripts, a GNAQwtUVM cell line, Mel285, was assayed to determine whether the P5 GNAQQ209L-targeting siRNA could also deplete GNAQwttranscripts. As expected, Mel285 cells exhibited neither a significant reduction in cell survival nor in total GNAQ transcripts measured when treated with the P5 GNAQQ209L-targeting siRNA (FIGS.10B, 15A). Although a small increase in alamarBlue™ fluorescence was observed following P5 GNAQQ209L-targeting siRNA transfection in Mel285s, neither an increase in clonogenic survival nor an increase in total GNAQ transcripts were observed, suggesting the increased metabolic activity was not the result of upregulation of total GNAQ expression and / or oversaturation of the endogenous RNAi pathway (FIG.10B).79,80To confirm that the decrease in UVM cell viability and significant GNAQQ209Ltranscript depletion observed in the Mel202 cell line were due to its GNAQQ209Lmutation status, identical experiments were performed in an additional GNAQQ209LUVM cell line, 92.1.81Indeed, similar to the Mel202 cell line, transfection with P5 GNAQQ209L-targeting siRNA significantly reduced cell survival in 92.1 cells (FIG. 10A), and total GNAQ mRNA abundance was depleted by roughly 33%. (FIG. 15B). Taken together, these data suggest that the P5 GNAQQ209L-targeting siRNA sequence consistently depletes GNAQQ209Ltranscripts in multiple GNAQQ209LUVM cell lines resulting in cell death.

[0200] Upon demonstrating that an siRNA based delivery approach using the P5 GNAQQ209L- targeting sequence induced cell death in GNAQQ209LUVM cells by preferentially depleting GNAQQ209Ltranscripts, a second delivery method utilizing a favored gene therapy vector, rAAV, was also explored to determine whether an increase in the durability of the P5 GNAQQ209L-targeting sequence would enhance its toxicity in GNAQQ209LUVM cells43,76,82-85.Attorney Docket No.5470.972.WO This hypothesis was tested by vectorizing the P5 GNAQQ209L-targeting siRNA sequence into a shRNA cassette for continuous expression and delivered via a rAAV2 viral vector. rAAV was chosen as the vector because the U.S. Food and Drug Administration (FDA) has approved multiple AAV-based therapies for clinical use, highlighting their excellent safety profile and capacity for long term transgene expression.76,86-95An AAV serotype transduction survey of the Mel285, Mel202, and 92.1 UVM cell lines demonstrated that AAV serotype 2 transduced all three UVM cell lines with high efficiency in vitro (FIGS.11A-11B). These results were not surprising as previous reports have shown that human melanoma cell lines exhibit upregulated heparan sulfate proteoglycan and human fibroblast growth factor receptor 1, two identified membrane surface proteins that aid in the intracellular uptake of AAV2.96-98A serotype survey comparing AAV transduction between primary human melanocytes and human cutaneous melanoma cell lines demonstrated that AAV6 transduced primary cutaneous melanocytes with the highest efficiency, but AAV2 exhibited the highest transduction efficiency in melanoma cell lines.99Thus, for future pre-clinical applications, multiple serotypes will need to be to be examined to empirically determine which capsid exhibits the highest transduction efficiencies for UVM cells in vivo.

[0201] Successful AAV-mediated delivery of shRNA cassettes has previously been shown to selectively induce cancer cell death through transcript depletion in several other types of cancer in vivo.55,100However, to our knowledge, this report is the first to describe a rAAV- shRNA based approach targeting a single base pair driver mutation on one allele in UVM. The rAAV2-shGNAQQ209Lvector was generated to deliver the GNAQQ209L-targeting shRNA cassette while simultaneously expressing GFP to monitor transduction (FIG.12A). Although significant reductions in alamarBlue™ fluorescence were observed with rAAV2- shGNAQQ209Ltransduction in Mel202 and 92.1 UVM cells, it was also slightly decreased in Mel285 cells (FIG. 12B). Unexpectedly, the control vector (rAAV2-shNTC) also exhibited some toxicity in the GNAQQ209LUVM cell lines, although to a lesser extent than rAAV2- shGNAQQ209L. These data suggest that a property of the rAAV and / or the transgene cassette induces cell death in GNAQQ209LUVM. This phenomenon has previously been observed with wild-type AAV and rAAV in certain types of cancer cells and stem cells and has been attributed, at least in part, to the AAV ITR sequence (FIGS. 12B).101-108Although not well understood, the mechanism(s) of ITR-induced cell death in a subset of cancer cells is an area of active investigation in the laboratory, and we hope to shed some light on this area in future publications.Attorney Docket No.5470.972.WO

[0202] Although the Mel285 cell line exhibited decreased alamarBlue™ fluorescence upon transduction with both the control rAAV2-shNTC and rAAV2-shGNAQQ209Lcompared to the PBS control, the difference between the NTC and GNAQQ209L-specific virus was not significant (FIG.12C). Furthermore, there was no change in Mel285 cell morphology upon transduction with either the control or GNAQQ209L-specific virus, nor was the release of melanin and / or melanosomes observed in these cultures, suggesting that the Mel285 UVM cell line likely experienced slower cell growth and / or metabolism upon rAAV transduction. In FIG. 12C, microscopic analysis also confirms the abundance and similarity of adherent Mel285 cells in PBS and rAAV-transduced cells. In contrast, Mel202 and 92.1 cells exhibit both decreased adherent cell number and increased levels of dark colored and circular debris throughout the culture media across rAAV-transduced wells, similar to melanin-like particles which are often released upon melanocyte cell death.61,62Although Mel202 and 92.1 cell death was incomplete following rAAV2-shGNAQQ209Ltransduction, the amount of cell death observed correlated with the transduction efficiency measurements for each cell line. This implies that rAAV2- shGNAQQ209Leffectively eliminated transduced GNAQQ209Lcells but was unable to transduce all UVM cells in vitro (FIGS. 11A-11B and 12B). This is further exemplified by the lack of GFP fluorescence in rAAV transduced 92.1 cells noted in the right panels of FIG. 12C, suggesting that most, if not all, GFP+92.1 cells died prior to analysis. Taken together, these data suggest that rAAV2-shGNAQQ209Lresults in cell death in GNAQQ209LUVM cells, similar to the effects observed with P5 GNAQQ209L-targeting siRNA sequences, providing a path forward for the optimization of an AAV-based therapeutic strategy.101-103

[0203] In summary, this example provides proof-of-concept that the P5 GNAQQ209L-targeting siRNA significantly reduced GNAQQ209Ltranscripts at least three-fold over GNAQwt, resulting in effective discrimination between GNAQwtand GNAQQ209Ltranscripts and GNAQQ209L- specific cell death. Although both rAAV2-shGNAQQ209Land rAAV2-shNTC reduced alamarBlue™ fluorescence measurements of metabolic activity, rAAV2-shGNAQQ209Lresulted in a significantly higher amount of toxicity in GNAQQ209LUVM cell lines, suggesting that the GNAQQ209L-targeting shRNA cassette induces cell death similar to that observed with the P5 GNAQQ209L-targeting siRNA. Follow-up studies will examine a similar approach to GNA11Q209Lmutant UVM and assess the in vivo efficacy of rAAV2-shGNAQQ209Ldelivery in a previously characterized mouse model of metastatic GNAQQ209LUVM.109METHODS AND MATERIALS Cell cultureAttorney Docket No.5470.972.WO

[0204] Mel202 (CVCL_C301) and 92.1 (CVCL_8607) human UVM cell lines were purchased from Sigma-Aldrich Inc (Saint Louis, MO, USA). The Mel285 (CVCL_C303) human UVM cell line was a kind gift from Dr. Martine Jaeger (Leiden University, Leiden, Netherlands). GNAQ / 11 mutation status was confirmed via Sanger sequencing (Azenta / Genewiz, South Plainfield, NJ, USA) for all three UVM cell lines (DNS). Each cell line’s STR profile was also confirmed, and periodic mycoplasma testing remained negative throughout the study (DNS). Cell lines were cultured with RPMI Medium 1x (Gibco, Grand Island, NY, USA), 10% Fetal Bovine Serum (Omega Scientific Inc., Tarzana, CA, USA), 2mM L-Glutamine (Gibco, Grand Island, NY, USA), and 1% antibiotic-antimycotic solution (Gibco, Grand Island, NY, USA) at 5% CO2and 37 °C. UVM culture media was replaced every 2-3 days and sub-cultured at approximately 60-80% confluency. siRNA transfections

[0205] All siRNA sequences targeting GNAQQ209Ltranscripts were designed as previously described by Schwarz et. al.42The non-targeting control siRNA (NTC) was purchased from MilliporeSigma (Burlington, MA, USA) and does not target any known sequence in the human or mouse genome. Transfections of UVM cells were completed with 800 pmol of each siRNA in an 80% confluent 15-cm cell culture dish using a Lipofectamine RNAiMAX kit (Invitrogen / ThermoFisher Scientific Inc., Waltham, MA, USA) following the manufacturer’s instructions. siRNA sequences were custom ordered from MilliporeSigma (Burlington, MA, USA), conjugated to a 6-FAM fluorophore, and are listed in FIG. 2. Each siRNA sequence also contained a deoxythymidine dinucleotide (dTdT) overhang to enhance intracellular stability (FIG.2). Flow cytometry cell enrichment

[0206] Transfected UVM cell populations were enriched for 6-FAM+ cells 24-hours following transfection of siRNA using the Becton Dickinson FACSAria II (BD Biosciences, Franklin Lakes, NJ, USA) system operated by the UNC Flow Cytometry Core Facility (UNC- Chapel Hill, Chapel Hill, NC, USA). Propidium iodide was used as a live / dead discrimination dye (Invitrogen / ThermoFischer Scientific Inc, Waltham, MA, USA).100,0006-FAM-positive live UVM cells were collected for each sample and subsequently divided for clonogenic survival, alamarBlue™ assays, and reverse-transcription reactions for RT-qPCR and NGS. Clonogenic survival assay

[0207] 1,000 single live 6-FAM+ cells were seeded onto 10-cm tissue culture dishes in replicates of at least four for each experimental group. Cultures were fed with fresh media every 2-3 days for 18-20 days until colonies containing ≥50 cells became visible. Media wasAttorney Docket No.5470.972.WO removed from each plate, stained with a 0.05% crystal violet / 40% methanol solution, washed with phosphate-buffered saline (PBS) solution, and dried overnight. Plates were imaged using the Amersham ImageQuant™ 800 system (Cytiva, Marlborough, MA, USA) and analyzed for colony numbers with a hand count on the ImageQuant™ TL analysis software (Cytiva, Marlborough, MA, USA). The data shown are compiled from at least three independent experiments with at least four technical replicates each. siRNA-based alamarBlue™ assay

[0208] 2,000 live 6FAM+ cells were seeded in each well of a 96-well plate in replicates of four. Six days following plating, alamarBlue™ HS Cell Viability Reagent (Life Technologies Corporation, Eugene, OR, USA) was added to each well and incubated / monitored for up to 24 hours at a final concentration of 10% of the medium volume. Cellular metabolism of the alamarBlue™ dye was verified through visual color changes in the solution, and fluorescence readings were taken two-, four-, and six-hours post-addition of the dye. Fluorescence (Excitation: 540 / 20 nm; Emission: 585 / 20 nm) of each well was quantified on the BioTek Cytation 5 Imaging Reader system (Lineberger Comprehensive Cancer Center, UNC-Chapel Hill, NC, USA; Agilent, Santa Clara, CA, USA). The data shown are compiled from at least three independent experiments with at least four technical replicates each. RT-qPCR

[0209] To quantify total GNAQ, CTGF, CYR61, and GAPDH transcript levels, RT-qPCR was performed in triplicate for each sample. RNA was isolated from flow cytometry enriched 6- FAM+ cell pellets with a RNeasy kit (Qiagen, Hilden, Germany) and treated with a DNA-free DNA removal kit (Invitrogen / Thermo Fisher Scientific Inc., Waltham, MA, USA). First-strand cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems / Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. For qPCR analysis, a 2x TaqMan Universal PCR Master Mix (Applied Biosystems / Thermo Fisher Scientific Inc., Waltham, MA, USA) was used in conjunction with pre-designed TaqMan 20x gene expression assay primer / probe mixes for each target analyzed in a total reaction volume of 20 uL / well. Reactions were run on the StepOnePlus Real-Time PCR System (Applied Biosystems / Thermo Fisher Scientific Inc., Waltham, MA, USA) under relative quantification with the following thermal cycling parameters: 50°C for two minutes and 95°C for ten minutes followed by 40 cycles of 95°C for fifteen seconds and 60°C for one minute. TaqMan assay numbers are listed in Table 1. Relative quantification of gene expression to Human GAPDH was calculated as previously described.110Attorney Docket No.5470.972.WO RNA samples not subjected to reverse transcription were also analyzed through RT-qPCR to ensure the absence of contaminating residual DNA. Table 1Next-generation sequencing (NGS)

[0210] Next-generation sequencing was used to differentiate the relative number of GNAQQ209Land GNAQwtcDNA copies in each sample. Following cDNA synthesis, the region of interest, a 263 base-pair amplicon containing GNAQ209, was subject to PCR amplification using the Phusion High Fidelity PCR kit (New England Biolabs, Ipswich, MA, USA). Amplified cDNA of NTC and P5 GNAQQ209L-targeting siRNA transfected samples were briefly purified using a QIAquick PCR Purification kit following the manufacturer’s instructions (Giagen, Hilden, Germany). PCR amplification was confirmed based on the presence of 263 base pair amplicons on a 2% agarose gel. Samples were then shipped to Azenta / Genewiz (Azenta Life Sciences, South Plainfield, NJ, USA) for Amplicon-EZ sequencing. The Partek™Flow™Software (Partek Incorporated, Chesterfield, MO, USA) was used for analysis of returned sequences. Sequences were aligned with a Burrows-Wheeler Alignment, and variants between transcripts were identified (“called”) using FreeBayes. The total sequence number of wild-type (A) and GNAQQ209L(T) at position 626 was quantified using the “chromosome” view for each sample. The data shown are compiled from five independent experiments. rAAV serotype assayAttorney Docket No.5470.972.WO

[0211] The self-complementary (sc) format of rAAV-CMV-GFP serotypes 1, 2, 3, 4, 5, 6, 8, and 9 were purchased from the UNC Vector Core (UNC-Chapel Hill, Chapel Hill, NC, USA) and are previously characterized.587.5×104cells for each UVM cell line were seeded in quadruplicate in 24-well plates, treated with 1.0×104vg / cell the following day, and monitored for GFP expression. Three days post-transduction, cells were treated with 0.05% trypsin-EDTA (Gibco / Life Technologies, Grand Island, NY, USA), resuspended in cell culture media, and fixed with 37% formaldehyde. GFP fluorescence was measured on the Thermo Fisher Attune NxT flow cytometer (Waltham, MA, USA) maintained by the UNC Flow Cytometry Core (UNC-Chapel Hill, Chapel Hill, NC, USA). Analysis was performed using the FlowJo Software (Version 10 for Windows 10, Ashland, Oregon, USA). AAV production and characterization

[0212] rAAV-shGNAQQ209Land rAAV-shNTC were designed as described previously and displayed in FIG. 12A. rAAV plasmid sequences were submitted to VectorBuilder Inc. (Chicago, IL, USA) for the manufacture of in vitro-grade preparations of rAAV. rAAV preparations were independently characterized via alkaline gel electrophoresis and SYBR Gold staining to confirm vector genome size and quantitative PCR (FIGS.17A-17B) with a custom TaqMan primer / probe set targeting the CMV promoter to confirm viral genome titer (FIG.16; Table 1). rAAV-based alamarBlue™ assay

[0213] 1.0×104cells were seeded in 24-well plates, and the following day, 1.0×104vg / cell of ssAAV2-shGNAQQ209Lor ssAAV2-shNTC were added to wells in replicates of six. An equivalent volume of PBS was used as a vehicle control. Plates were monitored for cell growth, and seven days later, alamarBlue™ Viability Reagent was added to a final concentration of 10%. Plates were analyzed in the manner described above for siRNA-based alamarBlue™ assay. Data shown is a compilation of at least three independent experiments with at least four replicates. Figure generation and data analysis

[0214] Data was compiled and analyzed in Microsoft Excel for Windows 10 (Redmond, WA, USA) and / or GraphPad Prism version 10 for Windows (GraphPad Software, Boston, MA, USA), unless otherwise noted. Visualizations of data were created using GraphPad Prism 10 and Adobe Illustrator 2024 (Adobe, San Jose, CA, USA). FIG. 12A was created using Biorender.com. An unpaired t-test was used to determine statistical significance between the means of experimental groups, and differences were considered significant if the p-value < 0.05. Averages are represented as the mean of the data-set, and statistical error is displayed asAttorney Docket No.5470.972.WO ± the standard deviation. Data was normalized to either NTC siRNA or PBS data for accurate comparisons of data among cell lines.

[0215] The following references pertain to Example 2: 1. Singh, A.D., Turell, M.E., and Topham, A.K. (2011). Uveal melanoma: trends in incidence, treatment, and survival. Ophthalmology 118, 1881-1885. 10.1016 / j.ophtha.2011.01.040. 2. Chang, A.E., Karnell, L.H., and Menck, H.R. (1998). The National Cancer Data Base report on cutaneous and noncutaneous melanoma: a summary of 84,836 cases from the past decade. The American College of Surgeons Commission on Cancer and the American Cancer Society. Cancer 83, 1664-1678. 10.1002 / (sici)1097- 0142(19981015)83:8<1664::aid-cncr23>3.0.co;2-g. 3. McLaughlin, C.C., Wu, X.C., Jemal, A., Martin, H.J., Roche, L.M., and Chen, V.W. (2005). Incidence of noncutaneous melanomas in the U.S. Cancer 103, 1000-1007. 10.1002 / cncr.20866. 4. Damato, E.M., and Damato, B.E. (2012). Detection and time to treatment of uveal melanoma in the United Kingdom: an evaluation of 2,384 patients. Ophthalmology 119, 1582-1589.10.1016 / j.ophtha.2012.01.048. 5. Finger, P.T. (2024). Yttrium-90 Episcleral Plaque Brachytherapy for Choroidal Melanoma. J Vitreoretin Dis 8, 210-214.10.1177 / 24741264241227684. 6. Collaborative Ocular Melanoma Study, G. (2006). The COMS randomized trial of iodine 125 brachytherapy for choroidal melanoma: V. Twelve-year mortality rates and prognostic factors: COMS report No. 28. Arch Ophthalmol 124, 1684-1693. 10.1001 / archopht.124.12.1684. 7. Bechrakis, N.E., Bornfeld, N., Zoller, I., and Foerster, M.H. (2002). Iodine 125 plaque brachytherapy versus transscleral tumor resection in the treatment of large uveal melanomas. Ophthalmology 109, 1855-1861.10.1016 / s0161-6420(02)01273-3. 8. Kujala, E., Makitie, T., and Kivela, T. (2003). Very long-term prognosis of patients with malignant uveal melanoma. Invest Ophthalmol Vis Sci 44, 4651-4659. 10.1167 / iovs.03-0538. 9. Rietschel, P., Panageas, K.S., Hanlon, C., Patel, A., Abramson, D.H., and Chapman, P.B. (2005). Variates of survival in metastatic uveal melanoma. J Clin Oncol 23, 8076- 8080.10.1200 / JCO.2005.02.6534. 10. Augsburger, J.J., Correa, Z.M., and Shaikh, A.H. (2009). Effectiveness of treatments for metastatic uveal melanoma. Am J Ophthalmol 148, 119-127. 10.1016 / j.ajo.2009.01.023. 11. Kuk, D., Shoushtari, A.N., Barker, C.A., Panageas, K.S., Munhoz, R.R., Momtaz, P., Ariyan, C.E., Brady, M.S., Coit, D.G., Bogatch, K., Callahan, M.K., et al. (2016). Prognosis of Mucosal, Uveal, Acral, Nonacral Cutaneous, and Unknown Primary Melanoma From the Time of First Metastasis. Oncologist 21, 848-854. 10.1634 / theoncologist.2015-0522. 12. Jensen, O.A. (1982). Malignant melanomas of the human uvea: 25-year follow-up of cases in Denmark, 1943--1952. Acta Ophthalmol (Copenh) 60, 161-182. 10.1111 / j.1755-3768.1982.tb08371.x.Attorney Docket No.5470.972.WO 13. Consortium, I.T.P.-C.A.o.W.G. (2020). Pan-cancer analysis of whole genomes. Nature 578, 82-93.10.1038 / s41586-020-1969-6. 14. Van Raamsdonk, C.D., Bezrookove, V., Green, G., Bauer, J., Gaugler, L., O'Brien, J.M., Simpson, E.M., Barsh, G.S., and Bastian, B.C. (2009). Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature 457, 599-602. 10.1038 / nature07586. 15. Van Raamsdonk, C.D., Griewank, K.G., Crosby, M.B., Garrido, M.C., Vemula, S., Wiesner, T., Obenauf, A.C., Wackernagel, W., Green, G., Bouvier, N., Sozen, M.M., et al. (2010). Mutations in GNA11 in uveal melanoma. N Engl J Med 363, 2191-2199. 10.1056 / NEJMoa1000584. 16. Onken, M.D., Makepeace, C.M., Kaltenbronn, K.M., Kanai, S.M., Todd, T.D., Wang, S., Broekelmann, T.J., Rao, P.K., Cooper, J.A., and Blumer, K.J. (2018). Targeting nucleotide exchange to inhibit constitutively active G protein alpha subunits in cancer cells. Sci Signal 11.10.1126 / scisignal.aao6852. 17. Neves, S.R., Ram, P.T., and Iyengar, R. (2002). G protein pathways. Science 296, 1636- 1639.10.1126 / science.1071550. 18. Dorsam, R.T., and Gutkind, J.S. (2007). G-protein-coupled receptors and cancer. Nat Rev Cancer 7, 79-94.10.1038 / nrc2069. 19. Oldham, W.M., and Hamm, H.E. (2008). Heterotrimeric G protein activation by G- protein-coupled receptors. Nat Rev Mol Cell Biol 9, 60-71.10.1038 / nrm2299. 20. Kalinec, G., Nazarali, A.J., Hermouet, S., Xu, N., and Gutkind, J.S. (1992). Mutated alpha subunit of the Gq protein induces malignant transformation in NIH 3T3 cells. Mol Cell Biol 12, 4687-4693.10.1128 / mcb.12.10.4687-4693.1992. 21. Landis, C.A., Masters, S.B., Spada, A., Pace, A.M., Bourne, H.R., and Vallar, L. (1989). GTPase inhibiting mutations activate the alpha chain of Gs and stimulate adenylyl cyclase in human pituitary tumours. Nature 340, 692-696.10.1038 / 340692a0. 22. Feng, X., Degese, M.S., Iglesias-Bartolome, R., Vaque, J.P., Molinolo, A.A., Rodrigues, M., Zaidi, M.R., Ksander, B.R., Merlino, G., Sodhi, A., Chen, Q., et al. (2014). Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a trio-regulated rho GTPase signaling circuitry. Cancer Cell 25, 831-845. 10.1016 / j.ccr.2014.04.016. 23. Yu, F.X., Luo, J., Mo, J.S., Liu, G., Kim, Y.C., Meng, Z., Zhao, L., Peyman, G., Ouyang, H., Jiang, W., Zhao, J., et al. (2014). Mutant Gq / 11 promote uveal melanoma tumorigenesis by activating YAP. Cancer Cell 25, 822-830.10.1016 / j.ccr.2014.04.017. 24. Sudol, M., Bork, P., Einbond, A., Kastury, K., Druck, T., Negrini, M., Huebner, K., and Lehman, D. (1995). Characterization of the mammalian YAP (Yes-associated protein) gene and its role in defining a novel protein module, the WW domain. J Biol Chem 270, 14733-14741.10.1074 / jbc.270.24.14733. 25. Zhao, B., Li, L., Lei, Q., and Guan, K.L. (2010). The Hippo-YAP pathway in organ size control and tumorigenesis: an updated version. Genes Dev 24, 862-874. 10.1101 / gad.1909210. 26. Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., Comerford, S.A., Gayyed, M.F., Anders, R.A., Maitra, A., and Pan, D. (2007). Elucidation of a universal size-controlAttorney Docket No.5470.972.WO mechanism in Drosophila and mammals. Cell 130, 1120-1133. 10.1016 / j.cell.2007.07.019. 27. Li, H., Li, Q., Dang, K., Ma, S., Cotton, J.L., Yang, S., Zhu, L.J., Deng, A.C., Ip, Y.T., Johnson, R.L., Wu, X., et al. (2019). YAP / TAZ Activation Drives Uveal Melanoma Initiation and Progression. Cell Rep 29, 3200-3211 e3204. 10.1016 / j.celrep.2019.03.021. 28. Yu, F.X., Zhao, B., Panupinthu, N., Jewell, J.L., Lian, I., Wang, L.H., Zhao, J., Yuan, H., Tumaneng, K., Li, H., Fu, X.D., et al. (2012). Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150, 780-791. 10.1016 / j.cell.2012.06.037. 29. Zhao, B., Ye, X., Yu, J., Li, L., Li, W., Li, S., Yu, J., Lin, J.D., Wang, C.Y., Chinnaiyan, A.M., Lai, Z.C., et al. (2008). TEAD mediates YAP-dependent gene induction and growth control. Genes Dev 22, 1962-1971.10.1101 / gad.1664408. 30. Mamoru Fujioka, S.K., Yukiyoshi Morimoto, and Klaus Biemann (1988). Structure of FR900359, a cyclic depsipeptide from Ardisia crenata sims. The Journal of Organic Chemistry 53, 2820-2825. 31. Lapadula, D., Farias, E., Randolph, C.E., Purwin, T.J., McGrath, D., Charpentier, T.H., Zhang, L., Wu, S., Terai, M., Sato, T., Tall, G.G., et al. (2019). Effects of Oncogenic Galpha(q) and Galpha(11) Inhibition by FR900359 in Uveal Melanoma. Mol Cancer Res 17, 963-973.10.1158 / 1541-7786.MCR-18-0574. 32. Kawasaki, T., Taniguchi, M., Moritani, Y., Uemura, T., Shigenaga, T., Takamatsu, H., Hayashi, K., Takasaki, J., Saito, T., and Nagai, K. (2005). Pharmacological properties of YM-254890, a specific G(alpha)q / 11 inhibitor, on thrombosis and neointima formation in mice. Thromb Haemost 94, 184-192.10.1160 / TH04-09-0635. 33. Takasaki, J., Saito, T., Taniguchi, M., Kawasaki, T., Moritani, Y., Hayashi, K., and Kobori, M. (2004). A novel Galphaq / 11-selective inhibitor. J Biol Chem 279, 47438- 47445.10.1074 / jbc.M408846200. 34. Hitchman, T.D., Bayshtok, G., Ceraudo, E., Moore, A.R., Lee, C., Jia, R., Wang, N., Pachai, M.R., Shoushtari, A.N., Francis, J.H., Guan, Y., et al. (2021). Combined Inhibition of Galpha(q) and MEK Enhances Therapeutic Efficacy in Uveal Melanoma. Clin Cancer Res 27, 1476-1490.10.1158 / 1078-0432.CCR-20-2860. 35. Offermanns, S., Zhao, L.P., Gohla, A., Sarosi, I., Simon, M.I., and Wilkie, T.M. (1998). Embryonic cardiomyocyte hypoplasia and craniofacial defects in G alpha q / G alpha 11- mutant mice. EMBO J 17, 4304-4312.10.1093 / emboj / 17.15.4304. 36. Onken, M.D., Makepeace, C.M., Kaltenbronn, K.M., Choi, J., Hernandez-Aya, L., Weilbaecher, K.N., Piggott, K.D., Rao, P.K., Yuede, C.M., Dixon, A.J., Osei-Owusu, P., et al. (2021). Targeting primary and metastatic uveal melanoma with a G protein inhibitor. J Biol Chem 296, 100403.10.1016 / j.jbc.2021.100403. 37. Schlegel, J.G., Tahoun, M., Seidinger, A., Voss, J.H., Kuschak, M., Kehraus, S., Schneider, M., Matthey, M., Fleischmann, B.K., Konig, G.M., Wenzel, D., et al. (2021). Macrocyclic Gq Protein Inhibitors FR900359 and / or YM-254890-Fit for Translation? ACS Pharmacol Transl Sci 4, 888-897.10.1021 / acsptsci.1c00021. 38. Hassel, J.C., Berking, C., Forschner, A., Gebhardt, C., Heinzerling, L., Meier, F., Ochsenreither, S., Siveke, J., Hauschild, A., and Schadendorf, D. (2023). PracticalAttorney Docket No.5470.972.WO guidelines for the management of adverse events of the T cell engager bispecific tebentafusp. Eur J Cancer 191, 112986.10.1016 / j.ejca.2023.112986. 39. Hassel, J.C., Piperno-Neumann, S., Rutkowski, P., Baurain, J.F., Schlaak, M., Butler, M.O., Sullivan, R.J., Dummer, R., Kirkwood, J.M., Orloff, M., Sacco, J.J., et al. (2023). Three-Year Overall Survival with Tebentafusp in Metastatic Uveal Melanoma. N Engl J Med 389, 2256-2266.10.1056 / NEJMoa2304753. 40. Nathan, P., Hassel, J.C., Rutkowski, P., Baurain, J.F., Butler, M.O., Schlaak, M., Sullivan, R.J., Ochsenreither, S., Dummer, R., Kirkwood, J.M., Joshua, A.M., et al. (2021). Overall Survival Benefit with Tebentafusp in Metastatic Uveal Melanoma. N Engl J Med 385, 1196-1206.10.1056 / NEJMoa2103485. 41. Gelmi, M.C., and Jager, M.J. (2024). Uveal melanoma: Current evidence on prognosis, treatment and potential developments. Asia Pac J Ophthalmol (Phila) 13, 100060. 10.1016 / j.apjo.2024.100060. 42. Schwarz, D.S., Ding, H., Kennington, L., Moore, J.T., Schelter, J., Burchard, J., Linsley, P.S., Aronin, N., Xu, Z., and Zamore, P.D. (2006). Designing siRNA that distinguish between genes that differ by a single nucleotide. PLoS Genet 2, e140. 10.1371 / journal.pgen.0020140. 43. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494-498.10.1038 / 35078107. 44. Paddison, P.J., Caudy, A.A., and Hannon, G.J. (2002). Stable suppression of gene expression by RNAi in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America 99, 1443-1448.10.1073 / pnas.032652399. 45. Izquierdo, M. (2005). Short interfering RNAs as a tool for cancer gene therapy. Cancer Gene Ther 12, 217-227.10.1038 / sj.cgt.7700791. 46. Ambrosini, G., Musi, E., Ho, A.L., de Stanchina, E., and Schwartz, G.K. (2013). Inhibition of mutant GNAQ signaling in uveal melanoma induces AMPK-dependent autophagic cell death. Mol Cancer Ther 12, 768-776. 10.1158 / 1535-7163.MCT-12- 1020. 47. Ksander, B.R., Rubsamen, P.E., Olsen, K.R., Cousins, S.W., and Streilein, J.W. (1991). Studies of tumor-infiltrating lymphocytes from a human choroidal melanoma. Invest Ophthalmol Vis Sci 32, 3198-3208. 48. Griewank, K.G., Yu, X., Khalili, J., Sozen, M.M., Stempke-Hale, K., Bernatchez, C., Wardell, S., Bastian, B.C., and Woodman, S.E. (2012). Genetic and molecular characterization of uveal melanoma cell lines. Pigment Cell Melanoma Res 25, 182- 187.10.1111 / j.1755-148X.2012.00971.x. 49. Krampe, B., and Al-Rubeai, M. (2010). Cell death in mammalian cell culture: molecular mechanisms and cell line engineering strategies. Cytotechnology 62, 175- 188.10.1007 / s10616-010-9274-0. 50. Verbik, D.J., Murray, T.G., Tran, J.M., and Ksander, B.R. (1997). Melanomas that develop within the eye inhibit lymphocyte proliferation. Int J Cancer 73, 470-478. 10.1002 / (sici)1097-0215(19971114)73:4<470::aid-ijc3>3.0.co;2-x. 51. De Waard-Siebinga, I., Blom, D.J., Griffioen, M., Schrier, P.I., Hoogendoorn, E., Beverstock, G., Danen, E.H., and Jager, M.J. (1995). Establishment andAttorney Docket No.5470.972.WO characterization of an uveal-melanoma cell line. Int J Cancer 62, 155-161. 10.1002 / ijc.2910620208. 52. Hickerson, R.P., Vlassov, A.V., Wang, Q., Leake, D., Ilves, H., Gonzalez-Gonzalez, E., Contag, C.H., Johnston, B.H., and Kaspar, R.L. (2008). Stability study of unmodified siRNA and relevance to clinical use. Oligonucleotides 18, 345-354. 10.1089 / oli.2008.0149. 53. Czauderna, F., Fechtner, M., Dames, S., Aygun, H., Klippel, A., Pronk, G.J., Giese, K., and Kaufmann, J. (2003). Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res 31, 2705-2716. 10.1093 / nar / gkg393. 54. Holen, T., Amarzguioui, M., Wiiger, M.T., Babaie, E., and Prydz, H. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger Tissue Factor. Nucleic Acids Res 30, 1757-1766.10.1093 / nar / 30.8.1757. 55. Sato, N., Saga, Y., Uchibori, R., Tsukahara, T., Urabe, M., Kume, A., Fujiwara, H., Suzuki, M., Ozawa, K., and Mizukami, H. (2018). Eradication of cervical cancer in vivo by an AAV vector that encodes shRNA targeting human papillomavirus type 16 E6 / E7. Int J Oncol 52, 687-696.10.3892 / ijo.2018.4245. 56. Bower, J.J., Song, L., Bastola, P., and Hirsch, M.L. (2021). Harnessing the Natural Biology of Adeno-Associated Virus to Enhance the Efficacy of Cancer Gene Therapy. Viruses 13.10.3390 / v13071205. 57. Issa, S.S., Shaimardanova, A.A., Solovyeva, V.V., and Rizvanov, A.A. (2023). Various AAV Serotypes and Their Applications in Gene Therapy: An Overview. Cells 12. 10.3390 / cells12050785. 58. McCarty, D.M., Monahan, P.E., and Samulski, R.J. (2001). Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8, 1248-1254.10.1038 / sj.gt.3301514. 59. Ma, H., Wu, Y., Dang, Y., Choi, J.G., Zhang, J., and Wu, H. (2014). Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation. Mol Ther Nucleic Acids 3, e161.10.1038 / mtna.2014.12. 60. Sayers, E.W., Bolton, E.E., Brister, J.R., Canese, K., Chan, J., Comeau, D.C., Connor, R., Funk, K., Kelly, C., Kim, S., Madej, T., et al. (2022). Database resources of the national center for biotechnology information. Nucleic Acids Res 50, D20-d26. 10.1093 / nar / gkab1112. 61. Ando, H., Niki, Y., Yoshida, M., Ito, M., Akiyama, K., Kim, J.H., Yoon, T.J., Matsui, M.S., Yarosh, D.B., and Ichihashi, M. (2011). Involvement of pigment globules containing multiple melanosomes in the transfer of melanosomes from melanocytes to keratinocytes. Cell Logist 1, 12-20.10.4161 / cl.1.1.13638. 62. Lu, F., Yan, D., Zhou, X., Hu, D.N., and Qu, J. (2007). Expression of melanin-related genes in cultured adult human retinal pigment epithelium and uveal melanoma cells. Mol Vis 13, 2066-2072. 63. Diener-West, M., Reynolds, S.M., Agugliaro, D.J., Caldwell, R., Cumming, K., Earle, J.D., Green, D.L., Hawkins, B.S., Hayman, J., Jaiyesimi, I., Kirkwood, J.M., et al. (2004). Screening for metastasis from choroidal melanoma: the Collaborative OcularAttorney Docket No.5470.972.WO Melanoma Study Group Report 23. J Clin Oncol 22, 2438-2444. 10.1200 / JCO.2004.08.194. 64. Collaborative Ocular Melanoma Study, G. (2001). Assessment of metastatic disease status at death in 435 patients with large choroidal melanoma in the Collaborative Ocular Melanoma Study (COMS): COMS report no. 15. Arch Ophthalmol 119, 670- 676.10.1001 / archopht.119.5.670. 65. Carvajal, R.D., Schwartz, G.K., Tezel, T., Marr, B., Francis, J.H., and Nathan, P.D. (2017). Metastatic disease from uveal melanoma: treatment options and future prospects. Br J Ophthalmol 101, 38-44.10.1136 / bjophthalmol-2016-309034. 66. Croce, M., Ferrini, S., Pfeffer, U., and Gangemi, R. (2019). Targeted Therapy of Uveal Melanoma: Recent Failures and New Perspectives. Cancers (Basel) 11. 10.3390 / cancers11060846. 67. Bongianino, R., Denegri, M., Mazzanti, A., Lodola, F., Vollero, A., Boncompagni, S., Fasciano, S., Rizzo, G., Mangione, D., Barbaro, S., Di Fonso, A., et al. (2017). Allele- Specific Silencing of Mutant mRNA Rescues Ultrastructural and Arrhythmic Phenotype in Mice Carriers of the R4496C Mutation in the Ryanodine Receptor Gene (RYR2). Circ Res 121, 525-536.10.1161 / CIRCRESAHA.117.310882. 68. Miller, V.M., Xia, H., Marrs, G.L., Gouvion, C.M., Lee, G., Davidson, B.L., and Paulson, H.L. (2003). Allele-specific silencing of dominant disease genes. Proc Natl Acad Sci U S A 100, 7195-7200.10.1073 / pnas.1231012100. 69. Noguchi, S., Ogawa, M., Kawahara, G., Malicdan, M.C., and Nishino, I. (2014). Allele- specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts. Mol Ther Nucleic Acids 3, e171. 10.1038 / mtna.2014.22. 70. Romano, R., De Luca, M., Del Fiore, V.S., Pecoraro, M., Lattante, S., Sabatelli, M., La Bella, V., and Bucci, C. (2022). Allele-specific silencing as therapy for familial amyotrophic lateral sclerosis caused by the p.G376D TARDBP mutation. Brain Commun 4, fcac315.10.1093 / braincomms / fcac315. 71. Hickerson, R.P., Smith, F.J., Reeves, R.E., Contag, C.H., Leake, D., Leachman, S.A., Milstone, L.M., McLean, W.H., and Kaspar, R.L. (2008). Single-nucleotide-specific siRNA targeting in a dominant-negative skin model. J Invest Dermatol 128, 594-605. 10.1038 / sj.jid.5701060. 72. Kobayashi, Y., Fukuhara, D., Akase, D., Aida, M., and Ui-Tei, K. (2022). siRNA Seed Region Is Divided into Two Functionally Different Domains in RNA Interference in Response to 2'-OMe Modifications. ACS Omega 7, 2398-2410. 10.1021 / acsomega.1c06455. 73. Kobayashi, Y., Tian, S., and Ui-Tei, K. (2022). The siRNA Off-Target Effect Is Determined by Base-Pairing Stabilities of Two Different Regions with Opposite Effects. Genes (Basel) 13.10.3390 / genes13020319. 74. Anderson, E.M., Birmingham, A., Baskerville, S., Reynolds, A., Maksimova, E., Leake, D., Fedorov, Y., Karpilow, J., and Khvorova, A. (2008). Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 14, 853-861.10.1261 / rna.704708.Attorney Docket No.5470.972.WO 75. Jackson, A.L., Burchard, J., Schelter, J., Chau, B.N., Cleary, M., Lim, L., and Linsley, P.S. (2006). Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. RNA 12, 1179-1187.10.1261 / rna.25706. 76. Dana, H., Chalbatani, G.M., Mahmoodzadeh, H., Karimloo, R., Rezaiean, O., Moradzadeh, A., Mehmandoost, N., Moazzen, F., Mazraeh, A., Marmari, V., Ebrahimi, M., et al. (2017). Molecular Mechanisms and Biological Functions of siRNA. Int J Biomed Sci 13, 48-57. 77. Offermanns, S., Hashimoto, K., Watanabe, M., Sun, W., Kurihara, H., Thompson, R.F., Inoue, Y., Kano, M., and Simon, M.I. (1997). Impaired motor coordination and persistent multiple climbing fiber innervation of cerebellar Purkinje cells in mice lacking Galphaq. Proc Natl Acad Sci U S A 94, 14089-14094. 10.1073 / pnas.94.25.14089. 78. Offermanns, S., Toombs, C.F., Hu, Y.H., and Simon, M.I. (1997). Defective platelet activation in G alpha(q)-deficient mice. Nature 389, 183-186.10.1038 / 38284. 79. Khan, A.A., Betel, D., Miller, M.L., Sander, C., Leslie, C.S., and Marks, D.S. (2009). Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs. Nat Biotechnol 27, 549-555.10.1038 / nbt.1543. 80. Onken, M.D., Noda, S.E., Kaltenbronn, K.M., Frankfater, C., Makepeace, C.M., Fettig, N., Piggott, K.D., Custer, P.L., Ippolito, J.E., and Blumer, K.J. (2022). Oncogenic Gq / 11 signaling acutely drives and chronically sustains metabolic reprogramming in uveal melanoma. J Biol Chem 298, 101495.10.1016 / j.jbc.2021.101495. 81. Jager, M.J., Magner, J.A., Ksander, B.R., and Dubovy, S.R. (2016). Uveal Melanoma Cell Lines: Where do they come from? (An American Ophthalmological Society Thesis). Trans Am Ophthalmol Soc 114, T5. 82. Palliser, D., Chowdhury, D., Wang, Q.Y., Lee, S.J., Bronson, R.T., Knipe, D.M., and Lieberman, J. (2006). An siRNA-based microbicide protects mice from lethal herpes simplex virus 2 infection. Nature 439, 89-94.10.1038 / nature04263. 83. Zimmermann, T.S., Lee, A.C., Akinc, A., Bramlage, B., Bumcrot, D., Fedoruk, M.N., Harborth, J., Heyes, J.A., Jeffs, L.B., John, M., Judge, A.D., et al. (2006). RNAi- mediated gene silencing in non-human primates. Nature 441, 111-114. 10.1038 / nature04688. 84. Mantei, A., Rutz, S., Janke, M., Kirchhoff, D., Jung, U., Patzel, V., Vogel, U., Rudel, T., Andreou, I., Weber, M., and Scheffold, A. (2008). siRNA stabilization prolongs gene knockdown in primary T lymphocytes. Eur J Immunol 38, 2616-2625. 10.1002 / eji.200738075. 85. Bartlett, D.W., and Davis, M.E. (2006). Insights into the kinetics of siRNA-mediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res 34, 322-333.10.1093 / nar / gkj439. 86. Traber, G.M., and Yu, A.-M. (2024). <strong>The Growing Class of Novel RNAi Therapeutics< / strong>. Molecular Pharmacology, MOLPHARM-MR-2024-000895. 10.1124 / molpharm.124.000895. 87. Administration, U.S.F.a.D. (2024). Approved Cellular and Gene Therapy Products. fda.gov / vaccines-blood-biologics / cellular-gene-therapy-products / approved-cellular- and-gene-therapy-products.Attorney Docket No.5470.972.WO 88. Chancellor, D., Barrett, D., Nguyen-Jatkoe, L., Millington, S., and Eckhardt, F. (2023). The state of cell and gene therapy in 2023. Mol Ther 31, 3376-3388. 10.1016 / j.ymthe.2023.11.001. 89. Li, C., and Samulski, R.J. (2020). Engineering adeno-associated virus vectors for gene therapy. Nat Rev Genet 21, 255-272.10.1038 / s41576-019-0205-4. 90. Wu, Z., Asokan, A., and Samulski, R.J. (2006). Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol Ther 14, 316-327. 10.1016 / j.ymthe.2006.05.009. 91. Brummelkamp, T.R., Bernards, R., and Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553. 10.1126 / science.1068999. 92. Tomar, R.S., Matta, H., and Chaudhary, P.M. (2003). Use of adeno-associated viral vector for delivery of small interfering RNA. Oncogene 22, 5712-5715. 10.1038 / sj.onc.1206733. 93. Nguyen, G.N., Everett, J.K., Kafle, S., Roche, A.M., Raymond, H.E., Leiby, J., Wood, C., Assenmacher, C.A., Merricks, E.P., Long, C.T., Kazazian, H.H., et al. (2021). A long-term study of AAV gene therapy in dogs with hemophilia A identifies clonal expansions of transduced liver cells. Nat Biotechnol 39, 47-55. 10.1038 / s41587-020- 0741-7. 94. Nathwani, A.C., Rosales, C., McIntosh, J., Rastegarlari, G., Nathwani, D., Raj, D., Nawathe, S., Waddington, S.N., Bronson, R., Jackson, S., Donahue, R.E., et al. (2011). Long-term safety and efficacy following systemic administration of a self- complementary AAV vector encoding human FIX pseudotyped with serotype 5 and 8 capsid proteins. Mol Ther 19, 876-885.10.1038 / mt.2010.274. 95. Dorsett, Y., and Tuschl, T. (2004). siRNAs: applications in functional genomics and potential as therapeutics. Nat Rev Drug Discov 3, 318-329.10.1038 / nrd1345. 96. Hoek, K., Rimm, D.L., Williams, K.R., Zhao, H., Ariyan, S., Lin, A., Kluger, H.M., Berger, A.J., Cheng, E., Trombetta, E.S., Wu, T., et al. (2004). Expression profiling reveals novel pathways in the transformation of melanocytes to melanomas. Cancer Res 64, 5270-5282.10.1158 / 0008-5472.CAN-04-0731. 97. Summerford, C., and Samulski, R.J. (1998). Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions. J Virol 72, 1438- 1445.10.1128 / JVI.72.2.1438-1445.1998. 98. Qing, K., Mah, C., Hansen, J., Zhou, S., Dwarki, V., and Srivastava, A. (1999). Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2. Nat Med 5, 71-77.10.1038 / 4758. 99. Sheppard, H.M., Ussher, J.E., Verdon, D., Chen, J., Taylor, J.A., and Dunbar, P.R. (2013). Recombinant adeno-associated virus serotype 6 efficiently transduces primary human melanocytes. PLoS One 8, e62753.10.1371 / journal.pone.0062753. 100. Pinto, C., Silva, G., Ribeiro, A.S., Oliveira, M., Garrido, M., Bandeira, V.S., Nascimento, A., Coroadinha, A.S., Peixoto, C., Barbas, A., Paredes, J., et al. (2019). Evaluation of AAV-mediated delivery of shRNA to target basal-like breast cancer genetic vulnerabilities. J Biotechnol 300, 70-77.10.1016 / j.jbiotec.2019.05.016.Attorney Docket No.5470.972.WO 101. Raj, K., Ogston, P., and Beard, P. (2001). Virus-mediated killing of cells that lack p53 activity. Nature 412, 914-917.10.1038 / 35091082. 102. Fragkos, M., and Beard, P. (2011). Mitotic catastrophe occurs in the absence of apoptosis in p53-null cells with a defective G1 checkpoint. PLoS One 6, e22946. 10.1371 / journal.pone.0022946. 103. Alam, S., Bowser, B.S., Conway, M.J., Israr, M., Tandon, A., and Meyers, C. (2011). Adeno-associated virus type 2 infection activates caspase dependent and independent apoptosis in multiple breast cancer lines but not in normal mammary epithelial cells. Mol Cancer 10, 97.10.1186 / 1476-4598-10-97. 104. de la Maza, L.M., and Carter, B.J. (1981). Inhibition of adenovirus oncogenicity in hamsters by adeno-associated virus DNA. J Natl Cancer Inst 67, 1323-1326. 105. Hirsch, M.L., Fagan, B.M., Dumitru, R., Bower, J.J., Yadav, S., Porteus, M.H., Pevny, L.H., and Samulski, R.J. (2011). Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells. PLoS One 6, e27520. 10.1371 / journal.pone.0027520. 106. Bockstael, O., Melas, C., Pythoud, C., Levivier, M., McCarty, D., Samulski, R.J., De Witte, O., and Tenenbaum, L. (2012). Rapid transgene expression in multiple precursor cell types of adult rat subventricular zone mediated by adeno-associated type 1 vectors. Hum Gene Ther 23, 742-753.10.1089 / hum.2011.216. 107. Hordeaux, J., Buza, E.L., Dyer, C., Goode, T., Mitchell, T.W., Richman, L., Denton, N., Hinderer, C., Katz, N., Schmid, R., Miller, R., et al. (2020). Adeno-Associated Virus-Induced Dorsal Root Ganglion Pathology. Hum Gene Ther 31, 808-818. 10.1089 / hum.2020.167. 108. Johnston, S., Parylak, S.L., Kim, S., Mac, N., Lim, C., Gallina, I., Bloyd, C., Newberry, A., Saavedra, C.D., Novak, O., Goncalves, J.T., et al. (2021). AAV ablates neurogenesis in the adult murine hippocampus. Elife 10.10.7554 / eLife.59291. 109. Huang, J.L., Urtatiz, O., and Van Raamsdonk, C.D. (2015). Oncogenic G Protein GNAQ Induces Uveal Melanoma and Intravasation in Mice. Cancer Res 75, 3384- 3397.10.1158 / 0008-5472.CAN-14-3229. 110. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.10.1006 / meth.2001.1262. Example 3. Allele-specific gene editing to downregulate mutant GNAQ / GNA11 transcripts

[0216] The previous examples focused on using an siRNA / shRNA depletion approach to downregulate the mutant GNAQ / GNA11 transcripts. siRNAs that preferentially deplete the Q209L mutation in both GNAQ and GNA11 were identified. Although this approach has been successful in vitro, it would be advantageous to simultaneously develop an orthogonal strategy that could be used to permanently modify uveal melanoma cells to increase the effectiveness of the approach. Previous studies have demonstrated that allele-specific geneAttorney Docket No.5470.972.WO editing of a single base pair mutation can be achieved by designing the sgRNA to encompass the mutant base pair inside the adjacent PAM sequence

[0012] . Furthermore, multiple variants of the SaCas9 nuclease have been identified that recognize additional PAM sequences, broadening the number of potentially editable sites in the human genome [7]. Based on these studies, multiple potential sgRNA / SaCas9 variant combinations have been identified that are likely to exhibit GNAQ / GNA11 mutant allele-specific gene editing activity. Example designed sgRNAs for GNAQ Q209L include: sgRNA A: TAAGGTCAGAGAGAAGAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:81) SgRNA B: TGGTCGATGTAGGGGGCCTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG CTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:82)

[0217] In order to test each combination’s editing specificity towards the mutant allele, a panel of nine human uveal melanoma cell lines will be employed: three containing the GNAQQ209Lmutation, three containing the GNA11Q209Lmutation, and three containing wild- type GNAQ and wild-type GNA11. Cell lines will be transfected with purified SaCas9 variants labeled with GFP and the appropriate mutant allele targeting sgRNA. 24 hours post- transfection cells will be enriched for GFP via flow cytometry sorting, genomic DNA will be isolated, and PCR will be used to amplify a 500 bp region flanking the Q209 amino acid. Amplicon EZ next generation sequencing (NGS) will be used to determine the percentage of the mutant and wild-type sequences in each group. Controls will include transfection with SaCas9 only (no sgRNA, negative control) and an sgRNA that has previously demonstrated high efficiency editing (positive control). Three independent experiments will be performed for all nine cell lines and all sgRNA / SaCas9 variants that exhibit >90% mutant allele specificity will be selected for further study.

[0218] To determine whether allele-specific gene editing induces UVM cell killing, clonogenic survival and alamarBlue assays will be performed. 24 hours post-transfection with sgRNA / SaCas9 variant combinations that exhibit >90% mutant allele editing specificity, cells will be enriched via flow cytometry and single cells will be seeded at a low density on a 10 cm dish for colony formation. Medium will be replaced every 3-4 days for three weeks, and upon the formation of visible colonies, plates will be fixed and stained with crystal violet. For alamarBlue assays, 2000 sorted cells per well will be seeded in a 96 well plate in triplicate. Controls will include an SaCas9 only negative control and a positive killing control, the smallAttorney Docket No.5470.972.WO molecule Gαq / 11 inhibitor FR-900359

[0013] . Three independent experiments will be performed and the sgRNA / Cas9 variant combination that demonstrates the highest level of UVM cell killing for each mutation (GNAQQ209Land GNA11Q209L) will be selected for AAV vectorization studies.

[0219] AAV plasmids will be designed, and then cloned by VectorBuilder. Recombinant AAV (rAAV) preparations packaged into a serotype 2 capsid will be generated for in vitro functional testing. Mutant allele editing specificity and UVM cell killing by the vectorized rAAV-sgRNA / SaCas9 variant will be performed as described for the transfection experiments in vitro to confirm biological functionality of the final AAV products. Finally, to determine the extent to which off-target editing effects are observed, rAAV-sgRNA / SaCas9 edited cell lines will be subjected to whole genome short read deep sequencing. It is anticipated approximately 4-5 rAAV-sgRNA / SaCas9 will exhibit high editing efficiency and mutant allele specificity; therefore, five unedited negative control samples (rAAV-SaCas9 only) and five experimental samples will be submitted for whole genome sequencing.

[0220] It is anticipated that these studies will identify approximately 4-5 sgRNA / SaCas9 variants with high editing efficiency and an estimated 2-3 of those are likely to exhibit mutant allele specificity based on previous work. Combinations that exhibit >90% specificity for the mutant allele will be vectorized and subsequently tested to determine the extent to which they confer off target effects via whole genome sequencing. The lead candidate will be defined as the rAAV-sgRNA / SaCas9 variant that exhibits >90% allele specific editing and <0.1% off target editing sites, which is comparable to current clinical trial applications for gene editing approaches

[0014] .

[0221] In vivo testing of the lead AAV product(s) will be conducted. A genetically engineered mouse model (GEMM) that expresses the human GNAQ209L allele specifically in melanocytes when crossed with a MITF-Cre mouse and develops uveal melanoma in 100% of animals can be utilized for testing. Initial studies would include testing the AAV / sgRNA / SaCas9 variant that exhibits the highest editing efficiency and specificity for the GNAQ209L mutation via ocular and intravenous injection routes to assess the lead candidate’s effects on primary tumor volume and the formation of lung metastases in our GEMM model. Proposed studies monitoring the primary uveal melanoma tumor would include optical coherence tomography, ultrasound, and fluorescein angiography. Studies monitoring lung metastases would include lung CT scanning and histological analysis upon sacrifice. Efficacy studies will include monitoring survival extension, primary tumor volume, weight and body condition scoring, and the number of detectable metastases.Attorney Docket No.5470.972.WO

[0222] An alternative approach to mitigate the incomplete gene silencing observed in mutant specific shRNA vectors will be the inclusion of a thymidine kinase suicide gene (HSV1-TK) under the control of a melanoma specific promoter which is predicted to result in cell death only in replicating melanoma cells. HSV1-TK toxicity relies on a different mechanism of cell death, alleviating the concerns of the development of UVM cells that are resistant to incomplete shRNA depletion.

[0223] The following references pertain to Example 3: 1. Carvajal, R.D., et al., Selumetinib in Combination With Dacarbazine in Patients With Metastatic Uveal Melanoma: A Phase III, Multicenter, Randomized Trial (SUMIT). J Clin Oncol, 2018.36(12): p.1232-1239. 2. Yang, J., et al., Treatment of uveal melanoma: where are we now? Ther Adv Med Oncol, 2018.10: p.1758834018757175. 3. Edmunds, S.C., et al., Absence of BRAF gene mutations in uveal melanomas in contrast to cutaneous melanomas. Br J Cancer, 2003.88(9): p.1403-5. 4. Cruz, F., 3rd, et al., Absence of BRAF and NRAS mutations in uveal melanoma. Cancer Res, 2003.63(18): p.5761-6. 5. Van Raamsdonk, C.D., et al., Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature, 2009.457(7229): p.599-602. 6. Van Raamsdonk, C.D., et al., Mutations in GNA11 in uveal melanoma. N Engl J Med, 2010.363(23): p.2191-9. 7. Kleinstiver, B.P., et al., Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol, 2015.33(12): p.1293- 1298. 8. Offermanns, S., et al., Impaired motor coordination and persistent multiple climbing fiber innervation of cerebellar Purkinje cells in mice lacking Galphaq. Proc Natl Acad Sci U S A, 1997.94(25): p.14089-94. 9. Offermanns, S., et al., Defective platelet activation in G alpha(q)-deficient mice. Nature, 1997.389(6647): p.183-6. 10. Offermanns, S., et al., Embryonic cardiomyocyte hypoplasia and craniofacial defects in G alpha q / G alpha 11-mutant mice. Embo j, 1998.17(15): p.4304-12. 11. Ambrosini, G., et al., Inhibition of mutant GNAQ signaling in uveal melanoma induces AMPK-dependent autophagic cell death. Mol Cancer Ther, 2013.12(5): p.768-76. 12. György, B., et al., Allele-specific gene editing prevents deafness in a model of dominant progressive hearing loss. Nat Med, 2019.25(7): p.1123-1130. 13. Onken, M.D., et al., Targeting primary and metastatic uveal melanoma with a G protein inhibitor. J Biol Chem, 2021.296: p.100403. 14. Lu, Y., et al., Safety and feasibility of CRISPR-edited T cells in patients with refractory non-small-cell lung cancer. Nat Med, 2020.26(5): p.732-740

[0224] All publications, patents, and patent applications are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0225] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious thatAttorney Docket No.5470.972.WO certain changes and modifications may be practiced within the scope of the list of the foregoing embodiments and the appended claims.

Claims

Attorney Docket No.5470.972.WO WHAT IS CLAIMED IS:

1. An siRNA molecule targeted to mRNA of a G protein subunit alpha q (GNAQ) or a G protein subunit alpha 11 (GNA11) gene, the GNAQ or GNA11 mRNA encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11(Gα11), respectively.

2. The siRNA molecule of claim 1, wherein the mRNA comprises a single point mutation at a nucleotide position that encodes a mutation at position Q209 of mutated Gαqor Gα11.

3. The siRNA molecule of claim 2, wherein the mutation at position Q209 is Q209P of mutated Gαq, or Q209L of mutated Gαq or Gα11.

4. The siRNA molecule of any one of the previous claims, wherein an antisense and sense strand of the siRNA each comprise between 18 and 24 nucleotides.

5. The siRNA molecule of any one of the previous claims wherein the antisense strand is specific for GNAQ mutated mRNA encoding a Q209L mutant Gαq.

6. The siRNA molecule of claim 5, wherein the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 2 or position 5 of the antisense strand.

7. The siRNA molecule of claim 5, wherein the antisense strand comprises one of SEQ ID NOs:17 (P5), 18 (P5v2), or 21 (P2).

8. The siRNA molecule of any one of claims 1-4, wherein the antisense strand is specific for GNA11 mutated mRNA encoding a Q209L mutant Gα11.Attorney Docket No.5470.972.WO 9. The siRNA molecule of claim 8, wherein the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 4 of the antisense strand.

10. The siRNA molecule of claim 9, wherein the antisense strand comprises SEQ ID NO:

40.

11. The siRNA molecule of any one of claims 1-4, wherein the antisense strand is specific for GNAQ mutated mRNA encoding a Q209P mutant of Gαq.

12. The siRNA molecule of claim 8, wherein the antisense strand of the siRNA is complementary to the point mutation of the mRNA at position 5 of the antisense strand or is complementary to the point mutation of the mRNA at position 2 of the antisense strand.

13. The siRNA molecule of claim 11, wherein the antisense strand comprises SEQ ID NO:59 (P5) or SEQ ID NO:60 (P5v2) or comprises SEQ ID NO:63 (P2).

14. An shRNA comprising the siRNA molecule of any one of claims 1-13.

15. A gene editing system comprising a CRISPR-Cas system, the CRISPR-Cas system comprising a Cas polypeptide and an sgRNA having complementarity to a target nucleotide sequence comprising GNAQQ209Lor GNA11Q209L.

16. The gene editing system of claim 15, wherein the Cas polypeptide is an SaCas9.

17. The gene editing system of claim 15 or 16, wherein the sgRNA exhibits 80% or more mutant allele editing specificity.

18. An expression cassette comprising the shRNA of claim 14 or the gene editing system of any one of claims 15-17.Attorney Docket No.5470.972.WO 19. The expression cassette of claim 18, according to SEQ ID NOs:65, 66, 69, 70, 73, 74, or 75.

20. The expression cassette of claim 18 or 19, further comprising a melanoma specific promoter.

21. The expression cassette of any one of claims 19-20, further comprising a Herpes Simplex Virus-Thymidine Kinase (HSV-TK).

22. The expression cassette of claim 18, 20, or 21, comprising a MITF-M, DCT, MCR1, or TYRL1 promoter.

23. The expression cassette of any one of claims 18-22, further comprising an miRNA- 122 target sequence.

24. A composition comprising the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17 or the expression cassette of any one of claims 18-23.

25. The composition of claim 24, further comprising a nanoparticle.

26. One or more vectors comprising the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17 or the expression cassette of any one of claims 18-23.

27. One or more viral vectors comprising the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17 or the expression cassette of any one of claims 18-23.Attorney Docket No.5470.972.WO 28. The one or more viral vectors of claim 27, wherein the one or more viral vectors is an AAV vector.

29. The one or more viral vectors of claim 28, wherein the AAV vector is an AAV2, AAV8, or AAV9 vector.

30. The one or more viral vectors of claims 28 or 29, wherein the AAV vector is a recombinant AAV vector.

31. A method of treating uveal melanoma in a subject in need thereof, the method comprising administering to the subject the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17, the expression cassette of any one of claims 18-23, the composition of claim 24 or 25, the vector of claim 26, or the one or more viral vectors of any one of claims 27-30, thereby treating the uveal melanoma.

32. A method of reducing mutant Gαqand / or Gα11transcript in a target cell, comprising contacting the cell with the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17, the expression cassette of any one of claims 18-23, the composition of claim 24 or 25, the vector of claim 26, or the one or more viral vectors of any one of claims 27-30 to thereby reduce the mutant Gαqand / or Gα11 transcript in the cell.

33. A method of modulating expression of G protein subunit alpha q (GNAQ) or G protein subunit alpha 11 (GNA11) encoding a mutated alpha subunit of G protein Gq (Gαq) or of G protein G11(Gα11), respectively in a target cell, comprising contacting the target cell with the siRNA of any one of claims 1-13, the shRNA of claim 14, the gene editing system of any one of claims 15-17, the expression cassette of any one of claims 18-23, the composition of claim 24 or 25, the vector of claim 26, or the one or more viral vectors of any one of claims 27-30 to thereby reduce the mutant Gαqand / or Gα11transcript in the cell.Attorney Docket No.5470.972.WO 34. The method of claim 32 or 33, wherein the contacting occurs in vivo.

35. The method of claim 34, wherein the contacting comprises intravenous or intraocular administration.

Images