Host cells and methods using a non-oxidative glycolytic pathway

Abstract

The present invention provides for a genetically modified bacterial cell capable of non-oxidative glycolysis while growing on glucose or sucrose without the need for acetate supplementation.

Description

Host cells and methods using a non-oxidative glycolytic pathway Inventors: Justin Panich, Robert Bertrand, Steven W. SingerCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application Ser. No. 63 / 650,091, filed May 21, 2024, which is incorporated by reference in its entirety.STATEMENT OF GOVERNMENTAL SUPPORT

[0002] The invention was made with government support under Contract Nos. DE-AC02- 05CH11231 and DE-AR0002387-1517 awarded by the U.S. Department of Energy. The government has certain rights in the invention.FIELD OF THE INVENTION

[0003] The present invention is in the field of growing a cell using non-oxidative glycolytic pathway.BACKGROUND OF THE INVENTION

[0004] Glycolysis is a nearly universal metabolic pathway that serves as the primary route for sugar catabolism across all domains of life, driving energy metabolism and biomass formationl. The classical Embden-Meyerhof-Parnas (EMP) pathway, the predominant glycolytic route, converts glucose into two molecules of acetyl-CoA, releasing CO2 as a byproduct. This carbon loss represents a fundamental constraint for biomanufacturing since acetyl-CoA is a critical precursor for numerous industrially relevant compounds — including isoprenoids, polyketides, alkanes, alcohols, and fatty acids. In microbial production platforms engineered for sustainable chemical synthesis, maximizing carbon conservation is paramount for improving yield, feedstock efficiency, and economic viability.

[0005] Alternative glycolytic strategies have evolved in nature to minimize carbon loss. Bifidobacteria employ the phosphoketolase (Xpk)-dependent "bifid shunt," which enhances acetyl-CoA yield by partially bypassing pyruvate formation2. However, these organisms still mostly rely on EMP glycolysis and the pentose phosphate pathway, limiting their ability to achieve complete carbon conservation. More recently, synthetic biology approaches have sought to rewire central metabolism to improve carbon retention. Building on prior work byBogorad et al., Lin et al. developed an A", coli strain engineered to rely on synthetic non- oxidative glycolysis (NOG), a pathway designed to achieve near-complete carbon conservation under fermentative conditions3,4. Their developed strain accumulated extensive genomic modifications through adaptive laboratory evolution, including 11 overexpressed genes, 10 deletions, and over 50 mutations. Despite its success in enabling carbon-efficient metabolism, the reliance on plasmid-based expression introduced genetic instability, complicating large-scale applications and efforts to further engineer the strain with additional modifications, such as the introduction of bioproduction pathways.

[0006] Liao et al. disclose a recombinant microorganism comprising a non-CCh evolving metabolic pathway for the synthesis of acetyl phosphate with improved carbon yield beyond 1 :2 molar ratio (fructose 6-phosphate: acetyl phosphate) from a carbon substrate using a pathway comprising an enzyme having (i) fructose-6-phosphoketolase (Fpk) activity and / or xylulose-5 phosphoketolase (Xpk) activity and (ii) a fructose 1.6 bisphosphatase or a Sedoheptuloase 1.6 bisphosphatase activity (U.S. Patent Application Publication No. 2016 / 0017339).SUMMARY OF THE INVENTION

[0007] The present invention provides for a genetically modified bacterial cell capable of non-oxidative glycolysis while growing on glucose or sucrose without the need for acetate supplementation.

[0008] The present invention provides for a genetically modified bacterial cell comprises one or more of the following: phosplhoketolase enzyme (Xpk), and Tkt2, Tkt, GlpX, Tal3, Glk, CscA, CscB, and / or CscK. In some embodiments, the genetically modified bacterial cell comprises the E. coli modC-ybhl region. In some embodiments, the genetically modified bacterial cell comprises YbhA, Pgl, and / or YbhD. In some embodiments, the genetically modified bacterial cell comprises heterologous enzymes for producing a compound of interest.

[0009] In some embodiments, the genetically modified bacterial cell comprises overexpression of YbhA. In some embodiments, the YbhA overexpression is least about 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold more expression, when compared to a corresponding bacterial cell not genetically modified to overexpression of YbhA. In some embodiments, the level of expression of YbhA in the not genetically modified bacterial cell is a wild-type levelof expression. In some embodiments, overexpression of YbhA is due to the addition of these genes on a mobile genetic element, such as a transposon, allowing for widespread multiplication of this region. In some embodiments, the genetically modified bacterial cell comprises a heterologous gene or additional or multiple copies of a native gene described herein in order to overexpress the gene in order to increase the enzymatic activity of the gene product of the gene by and / or within the host cell. In some embodiments, the genetically modified bacterial cell is further knocked out for a native gene described herein, expression of the native gene is reduced, in order to decrease or eliminate the enzymatic activity of the gene product of the gene by and / or within the host cell.

[0010] In some embodiments, the genetically modified bacterial cell comprises one or more nucleic acids encoding the enzymes and / or proteins operatively linked to one or more promoters capable of expressing the enzymes and / or proteins in the genetically modified bacterial cell. In some embodiments, the promoters are each independently their native promoters or constitutive promoters. In some embodiments, the one or more nucleic acids are stably integrated into the genome of the genetically modified bacterial cell.

[0011] The present invention provides for a method for producing a compound of interest comprising: (a) providing the genetically modified bacterial cell of the present invention, (b) culturing or growing the genetically modified bacterial cell in a suitable medium such that the compound of interest is produced, (c) optionally the compound of interest is separated or removed from the genetically modified bacterial cell and / or medium. In some embodiments, the one or more nucleic acids are stably integrated into the genome of the genetically modified bacterial cell, and the genetically modified bacterial cell are cultured or grown in a bioreactor.

[0012] In some embodiments, the genetically modified bacterial cell is an Escherichia cell, such as Escherichia coli.

[0013] In some embodiments, the genetically modified bacterial cell is an E. coli capable of non-oxidative glycolysis while growing on glucose or sucrose without the need for acetate supplementation. The genetically modified bacterial cell comprises the required genes and mutations, such as are present on the chromosome of the developed strain.

[0014] In some embodiments, the genetically modified bacterial cell comprises a phosplhoketolase enzyme (Xpk) as the key enzyme to drive conversion of fructose 6phosphate to acetyl phosphate, and subsequently acetyl-CoA, bypassing pyruvate dehydrogenase and avoiding CO2 evolution during glycolysis. In some embodiments, the genetically modified bacterial cell comprises three additional genes from E. coli strain W, which allows for the uptake and utilization of sucrose to power the non-oxidative glycolysis cycle. The initially constructed strain did not grow, but finally grew after 16 days of shaking. A major technical problem that was overcame during this process involves acetate. The original work (Lin et al, 2018) detailed a strain that also requires 5 mM acetate in the media. By genetic engineering and adaptive laboratory evolution, a strain was generated that was capable of non-oxidative glycolysis on sugars without supplementing the medium with acetate.

[0015] In some embodiments, the genetically modified bacterial cell is useful for reducing their feedstock costs when using this strain, particularly for modifying redox levels because this type of metabolism is depleted in reducing power.

[0016] The present invention has one or more of the following advantages: (1) The genetically modified bacterial cell does not require the addition of acetate. The addition of acetate may have deleterious outcomes for industrial scale fermentation and product end titers. (2) The genetically modified bacterial cell does not require plasmids, antibiotics, and / or any inducer chemicals. (3) The genetically modified bacterial cell has the ability to grow on sucrose, a widely available feedstock that may be cheaper than glucose in some cases.

[0017] The present invention provides for a genetically modified bacterial cell is an engineered E. coli with a novel non-oxidative glycolytic pathway that bypasses carbon loss to CO2 by utilizing a phosphoketolase enzyme (Xpk), and comprising YbhA, whose expression enables non-oxidative glycolysis, such as with mostly genes that are native to E. coli. The genetically modified bacterial cell is useful for increasing the theoretical yield of bioproduction and thus reducing the cost of feedstock needed for any particular sugar-based bioproduction platform. The maximum theoretical yield of bioproduction is 66.67%, whereas NOG enables 100.00%, which is a 50% jump in productivity, and a 33.33% drop in feedstock costs.

[0018] The genetically modified bacterial cell is useful for any sugar-based bioproduction platform, as it could decrease costs on feedstock by about 33%. The pathway described herehas not been previously theorized or rationally designed. In fact, the physiological relevance of the discovered enzyme in this pathway, YbhA, has not been substantially described in the literature. The genetically modified bacterial cell of the present invention, comprising the non-oxidative pathway described herein, is distinguished from the pathway developed by Lin et. al. (2018) The genetically modified bacterial cell of the present invention does not require acetate for growth, while the strain of Lin et al. (2018) required 5 mM acetate for growth. This is advantageous because it further decreases on feedstock costs and fermentation complexity.

[0019] In some embodiments, the genetically modified bacterial cell does not comprise two plasmids. In some embodiments, the genetically modified bacterial cell comprises E. coli cscBAK enable sucrose catabolism.

[0020] In some embodiments, the genetically modified bacterial cell is capable of growth using sucrose as the sole carbon source.

[0021] In some embodiments, the genetically modified bacterial cell comprises Xpk and / or Tkt2.

[0022] In some embodiments, the genetically modified bacterial cell is deleted or knocked out for one or more genes, or all genes, of any endogenous glycolytic pathway.

[0023] In some embodiments, the genetically modified bacterial cell comprises the E. coli modC-ybhl region. In some embodiments, the E. coli modC-ybhl region is amplified. In some embodiments, the genetically modified bacterial cell comprises the E. coli modC-ybhl region on a high copy plasmid. The E. coli modC-ybhl region the cloned fragment of DNA imparted confers the ability to grow on glucose and sucrose on the genetically modified bacterial cell.

[0024] In some embodiments, the genetically modified bacterial cell comprises YbhA, Pgl, and / or YbhD. In some embodiments, the genetically modified bacterial cell comprises the gene ybhA, pgl, and / or ybhD genes under their respective native promoter(s).BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The foregoing aspects and others will be readily appreciated by the skilled artisan from the following description of illustrative embodiments when read in conjunction with the accompanying drawings.

[0026] Figure 1. Delivery vector for NOG isozyme genes. Plasmid was partially derived from pPL274 and pTW371 from Lin et al. (2018). Genes for sucrose catabolism, cscBAK, were amplified from WT E. coli strain W. Plasmid also encodes Cre recombinase, which enabled recombination of the relevant genes into E. coli BW25113 flgAB locus. The resulting strain was then used to transfer the NOG sucrose cassette into the background strain for NOG metabolism.

[0027] Figure 2. Metabolic labeling experiment for integrated and evolved NOG strain. Cells were grown anaerobically at an OD600 = 25 in the presence of 1% glucose-3,4-13C for 24 hours. Supernatants were subjected to GC-MS analysis and the engineered NOG strain shows the expected shift in m / z for acetate, indicating double labeled acetate formed in the NOG strain, but not in the WT control.

[0028] Figure 3. Growth profile of NOG*S2 strain in glucose and sucrose MOPS minimal media with no other carbon sources present.

[0029] Figure 4. NOG cycle reactions proposed by Lin et al. (2018).

[0030] Figure 5 growth profile for chromosomally engineered NOG strains in minimal media with glucose or sucrose. NOG*S2 grows on glucose and sucrose as sole carbon sources.

[0031] Figure 6. Insertion cassette encoding the NOG isozymes was destroyed during the 16 day course of evolution. The sucrose uptake operon cscBAK was found to be intact, as well as a lacUV5 promoter driving expression of tkt2 from Methylmicrobium . Expression of xpk from a separate chromosomal location was also maintained.

[0032] Figure 7. Isotopic labeling confirms the NOG phenotype in NOG*S2, as a prominent peak occurs at m / z 62 for acetate, indicating that this strain generates double-labeled acetate when grown on 13C-3,4-glucose.

[0033] Figure 8. The modC-ybhl region is amplified roughly 8-fold relative to NOG*S1. Sequencing reads were mapped to the E. coli BW5113 reference genome in NOG*base and the evolved strain. Please note the difference in values on the y-axis. Complementation of YbhA on a plasmid restores aerobic growth in glucose minimal media in NOG22, indicating that only YbhA is relevant to the NOG*S2 phenotype. The YbhA culture is very cloudy, while the Pgl and YbhD cultures are relatively clear.

[0034] Figure 9. Expression of genes from modC-ybhl, and F16BPases ybhA and glpX allows for growth on glucose minimal media, while expression of pgl, ybhD, do not rescue growth of NOG22.

[0035] Figure 10. Proteomics characterization of NOG*S2 grown aerobically in 0.5% glucose minimal media. Panel A) Growth curve of wild-type and NOG*S2 strain. The arrow indicates the time point used for proteomic analysis shown in panels B, C, D. Panel B) Proteomic analysis of NOG-related enzymes. Tkt2 and Xpk are heterologous. Panel C) Proteomics confirms that genetic knockouts disabling the EMP and ED pathways are still present in NOG*S2. Panel D) Enzymes for the TCA cycle are significantly overexpressed in NOG*S2 relative to WT E. coli.

[0036] Figure 11. Metabolic profiling during aerobic growth in 0.5% glucose reveals elevated NOG intermediates F16BP and G3P, increased NAD(P)+, and xylonate production.

[0037] Figure 12. The Modified NOG cycle. Enzymes in green font indicate natively expressed enzymes, while red font indicates heterologous enzymes, and blue indicates overexpressed endogenous enzymes.

[0038] Figure 13. Alternative routes for acetyl-CoA synthesis.

[0039] Figure 14. No 6-PGL was detected in NOG*S2, indicating the absence of Zwf activity in this strain. A modified NOG*S2 strain defective for gnd was still competent for growth, indicating that growth is not dependent on flux through the ED pathway.

[0040] Figure 15. Verification of NOG phenotype in engineered strain. Panel A) schematic showing carbon loss in the form of CO2 in EMP glycolysis compared to carbon retention in acetate in Non-Oxidative Glycolysis.

[0041] Figure 16. Sequencing data reveals that the NOG insertion was disrupted during the 16 day lag period before growth was observed.

[0042] Figure 17. The duplicated fragment of DNA cloned onto a high copy plasmid allowed for growth of our non-growing base strain. We then cloned three of the most likely genes to allow for growth (ybhA, pgl, and ybhD) under their native promoter and placed each individual plasmid in the base strain. We found that expression of ybhA alone gave growth in sucrose.

[0043] Figure 18. Volcano plot: Welch’s T-test.DETAILED DESCRIPTION OF THE INVENTION

[0044] Before the invention is described in detail, it is to be understood that, unless otherwise indicated, this invention is not limited to particular sequences, expression vectors, enzymes, host microorganisms, or processes, as such may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting.

[0045] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

[0046] The terms "optional" or "optionally" as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.

[0047] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an "expression vector" includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to "cell" includes a single cell as well as a plurality of cells; and the like.

[0048] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

[0049] The terms "optional" or "optionally" as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.

[0050] Where a range of values is provided, it is understood that each intervening value, tothe tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0051] The term “about” refers to a value including 10% more than the stated value and 10% less than the stated value.

[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0053] The terms “host cell” and "host microorganism" are used interchangeably herein to refer to a living biological cell, such as a microbe, that can be transformed via insertion of an expression vector. Thus, a host organism or cell as described herein may be a prokaryotic organism (e.g., an organism of the kingdom Eubacteria) or a eukaryotic cell. As will be appreciated by one of ordinary skill in the art, a prokaryotic cell lacks a membrane-bound nucleus, while a eukaryotic cell has a membrane-bound nucleus.

[0054] The term "heterologous" as used herein refers to a material, or nucleotide or amino acid sequence, that is found in or is linked to another material, or nucleotide or amino acid sequence, wherein the materials, or nucleotide or amino acid sequences, are foreign to each other (i.e., not found or linked together in nature).

[0055] The terms "expression vector" or "vector" refer to a compound and / or composition that transduces, transforms, or infects a host cell, thereby causing the cell to express nucleic acids and / or proteins other than those native to the cell, or in a manner not native to the cell.An "expression vector" contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host cell. Optionally, the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host cell, such as a virus, liposome, protein coating, or the like. The expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector must be one that can be transferred into a host cell and replicated therein. Particular expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art.

[0056] The terms "polynucleotide" and "nucleic acid" are used interchangeably and refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs may be used that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); positive backbones; nonionic backbones, and non-ribose backbones. Thus, nucleic acids or polynucleotides may also include modified nucleotides that permit correct read-through by a polymerase. "Polynucleotide sequence" or "nucleic acid sequence" includes both the sense and antisense strands of a nucleic acid as either individual single strands or in a duplex. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand; thus, the sequences described herein also provide the complement of the sequence. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.

[0057] The term "promoter," as used herein, refers to a polynucleotide sequence capable of driving transcription of a DNA sequence in a cell. Thus, promoters used in the polynucleotideconstructs of the invention include cis- and trans- acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and / or rate of transcription of a gene. For example, a promoter can be a cis- acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on / off, regulate, modulate, etc. gene transcription. Promoters are located 5' to the transcribed gene, and as used herein, include the sequence 5' from the translation start codon (i.e., including the 5' untranslated region of the mRNA, typically comprising 100-200 bp). Most often the core promoter sequences lie within 1-2 kb of the translation start site, more often within 1 kbp and often within 500 bp of the translation start site. By convention, the promoter sequence is usually provided as the sequence on the coding strand of the gene it controls. In the context of this application, a promoter is typically referred to by the name of the gene for which it naturally regulates expression. A promoter used in an expression construct of the invention is referred to by the name of the gene. Reference to a promoter by name includes a wildtype, native promoter as well as variants of the promoter that retain the ability to induce expression. Reference to a promoter by name is not restricted to a particular species, but also encompasses a promoter from a corresponding gene in other species.

[0058] A polynucleotide is "heterologous" to a host cell or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a polynucleotide encoding a polypeptide sequence is said to be operably linked to a heterologous promoter, it means that the polynucleotide coding sequence encoding the polypeptide is derived from one species whereas the promoter sequence is derived from another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).

[0059] The term "operatively linked" refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter or enhancer sequence is operably linked to a DNA or RNA sequence if it stimulates ormodulates the transcription of the DNA or RNA sequence in an appropriate host cell or other expression system. Generally, promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.

[0060] The nucleic acid constructs of the present invention comprise nucleic acid sequences encoding one or more of the subject enzymes. The nucleic acid of the subject enzymes are operably linked to promoters and optionally control sequences such that the subject enzymes are expressed in a host cell cultured under suitable conditions. The promoters and control sequences are specific for each host cell species. In some embodiments, expression vectors comprise the nucleic acid constructs. Methods for designing and making nucleic acid constructs and expression vectors are well known to those skilled in the art.

[0061] Sequences of nucleic acids encoding the subject enzymes are prepared by any suitable method known to those of ordinary skill in the art, including, for example, direct chemical synthesis or cloning. For direct chemical synthesis, formation of a polymer of nucleic acids typically involves sequential addition of 3'-blocked and 5'-blocked nucleotide monomers to the terminal 5'-hydroxyl group of a growing nucleotide chain, wherein each addition is effected by nucleophilic attack of the terminal 5'-hydroxyl group of the growing chain on the 3'-position of the added monomer, which is typically a phosphorus derivative, such as a phosphotriester, phosphoramidite, or the like. Such methodology is known to those of ordinary skill in the art and is described in the pertinent texts and literature (e.g., in Matteuci et al. (1980) Let. Let. 521 :719; U.S. Pat. Nos. 4,500,707; 5,436,327; and 5,700,637). In addition, the desired sequences may be isolated from natural sources by splitting DNA using appropriate restriction enzymes, separating the fragments using gel electrophoresis, and thereafter, recovering the desired nucleic acid sequence from the gel via techniques known to those of ordinary skill in the art, such as utilization of polymerase chain reactions (PCR; e.g., U.S. Pat. No. 4,683,195).

[0062] Each nucleic acid sequence encoding the desired subject enzyme can be incorporated into an expression vector. Incorporation of the individual nucleic acid sequences may be accomplished through known methods that include, for example, the use of restriction enzymes (such as BamHI, EcoRI, Hhal, Xhol, Xmal, and so forth) to cleave specific sites inthe expression vector, e.g., plasmid. The restriction enzyme produces single stranded ends that may be annealed to a nucleic acid sequence having, or synthesized to have, a terminus with a sequence complementary to the ends of the cleaved expression vector. Annealing is performed using an appropriate enzyme, e.g., DNA ligase. As will be appreciated by those of ordinary skill in the art, both the expression vector and the desired nucleic acid sequence are often cleaved with the same restriction enzyme, thereby assuring that the ends of the expression vector and the ends of the nucleic acid sequence are complementary to each other. In addition, DNA linkers may be used to facilitate linking of nucleic acids sequences into an expression vector.

[0063] A series of individual nucleic acid sequences can also be combined by utilizing methods that are known to those having ordinary skill in the art (e.g., U.S. Pat. No. 4,683,195).

[0064] For example, each of the desired nucleic acid sequences can be initially generated in a separate PCR. Thereafter, specific primers are designed such that the ends of the PCR products contain complementary sequences. When the PCR products are mixed, denatured, and reannealed, the strands having the matching sequences at their 3' ends overlap and can act as primers for each other Extension of this overlap by DNA polymerase produces a molecule in which the original sequences are "spliced" together. In this way, a series of individual nucleic acid sequences may be "spliced" together and subsequently transduced into a host microorganism simultaneously. Thus, expression of each of the plurality of nucleic acid sequences is effected.

[0065] Individual nucleic acid sequences, or "spliced" nucleic acid sequences, are then incorporated into an expression vector. The invention is not limited with respect to the process by which the nucleic acid sequence is incorporated into the expression vector. Those of ordinary skill in the art are familiar with the necessary steps for incorporating a nucleic acid sequence into an expression vector. A typical expression vector contains the desired nucleic acid sequence preceded by one or more regulatory regions, along with a ribosome binding site, e.g., a nucleotide sequence that is 3-9 nucleotides in length and located 3-11 nucleotides upstream of the initiation codon in E. coli. See Shine et al. (1975) Nature 254:34 and Steitz, in Biological Regulation and Development: Gene Expression (ed. R. F.Goldberger), vol. 1, p. 349, 1979, Plenum Publishing, N.Y.

[0066] Regulatory regions include, for example, those regions that contain a promoter and an operator. A promoter is operably linked to the desired nucleic acid sequence, thereby initiating transcription of the nucleic acid sequence via an RNA polymerase enzyme. An operator is a sequence of nucleic acids adjacent to the promoter, which contains a proteinbinding domain where a repressor protein can bind. In the absence of a repressor protein, transcription initiates through the promoter. When present, the repressor protein specific to the protein-binding domain of the operator binds to the operator, thereby inhibiting transcription. In this way, control of transcription is accomplished, based upon the particular regulatory regions used and the presence or absence of the corresponding repressor protein. An example includes lactose promoters (LacI repressor protein changes conformation when contacted with lactose, thereby preventing the LacI repressor protein from binding to the operator). Another example is the tac promoter. (See deBoer et al. (1983) Proc. Natl. Acad. Set. USA, 80:21-25.) As will be appreciated by those of ordinary skill in the art, these and other expression vectors may be used in the present invention, and the invention is not limited in this respect.

[0067] Although any suitable expression vector may be used to incorporate the desired sequences, readily available expression vectors include, without limitation: plasmids, such as pSClOl, pBR322, pBBRlMCS-3, pUR, pEX, pMRIOO, pCR4, pBAD24, pUC19; bacteriophages, such as Ml 3 phage and X phage. Of course, such expression vectors may only be suitable for particular host cells. One of ordinary skill in the art, however, can readily determine through routine experimentation whether any particular expression vector is suited for any given host cell. For example, the expression vector can be introduced into the host cell, which is then monitored for viability and expression of the sequences contained in the vector. In addition, reference may be made to the relevant texts and literature, which describe expression vectors and their suitability to any particular host cell.

[0068] The expression vectors of the invention must be introduced or transferred into the host cell. Such methods for transferring the expression vectors into host cells are well known to those of ordinary skill in the art. For example, one method for transforming E. coli with an expression vector involves a calcium chloride treatment wherein the expression vector is introduced via a calcium precipitate. Other salts, e.g., calcium phosphate, may also be used following a similar procedure. In addition, electroporation (i.e., the application of current to increase the permeability of cells to nucleic acid sequences) may be used to transfect the hostmicroorganism. Also, microinjection of the nucleic acid sequencers) provides the ability to transfect host microorganisms. Other means, such as lipid complexes, liposomes, and dendrimers, may also be employed. Those of ordinary skill in the art can transfect a host cell with a desired sequence using these or other methods.

[0069] For identifying a transfected host cell, a variety of methods are available. For example, a culture of potentially transfected host cells may be separated, using a suitable dilution, into individual cells and thereafter individually grown and tested for expression of the desired nucleic acid sequence. In addition, when plasmids are used, an often-used practice involves the selection of cells based upon antimicrobial resistance that has been conferred by genes intentionally contained within the expression vector, such as the amp, gpt, neo, and hyg genes.

[0070] When the host cell is transformed with at least one expression vector. When only a single expression vector is used (without the addition of an intermediate), the vector will contain all of the nucleic acid sequences necessary. Once the host cell has been transformed with the expression vector, the host cell is capable of growing in the soil or substrate.

[0071] In some embodiments, the genetically modified bacterial cell comprises heterologous enzymes for producing a compound of interest. In some embodiments, the compound of interest is a compound naturally produced by the host cell. In some embodiments, the compound of interest is a compound not naturally produced by the host cell. In some embodiments, the compound of interest is a biofuel or bioproduct, or any other organic compound, and the corresponding biosynthetic enzyme(s) for producing the compound of interest thereof, are described and taught in U.S. Patent Nos. 7,985,567; 8,420,833;8,852,902; 9,109,175; 9,200,298; 9,334,514; 9,376,691; 9,382,553; 9,631,210; 9,951,345;10,167,488; 10,273,605; 10,814,724; and 11,660,961; and PCT International Patent Application Nos. PCT / US2014 / 48293, PCT / US2018 / 049609, PCT / US2017 / 036168, PCT / US2018 / 029668, PCT / US2008 / 068833, PCT / US2008 / 068756, PCT / US2008 / 068831, PCT / US2009 / 042132, PCT / US2010 / 033299, PCT / US2011 / 053787, PCT / US2011 / 058660, PCT / US2011 / 059784, PCT / US2011 / 061900, PCT / US2012 / 031025, and PCT / US2013 / 074214 (all of which are incorporated in their entireties by reference). In some embodiments, the compound of interest is a terpene, isoprenoid, carboxylic acid, lactone, irimethylpentanoic acid, 1 -deoxyxylulose 5-phosphate, 1-deoxy-D-xylulose 5-phosphate (DXP), fatty acid, or derivatives thereof, alkyl lactone, lactam, isoprenyl alkanoate, 3 -methyl-2-buten-l-ol, 3-methyl-3-buten-l-ol, and 3-methyl-butan-l-ol, fatty acid ester, alpha-olefin, diacid, diamine, sesquiterpene, bisabolene, or oxidized aromatic amino acid. In some embodiments, the compound of interest is any pro, duct or intermediate in the mevalonate (MV A) pathway, including any compound from acetyl-CoA to mevalonate. In some embodiments, the biosynthetic enzyme(s) are phosphomevalonate decarboxylase (PMD), phosphatase, AtoB, hydroxymethylglutaryl-CoA synthase (HMGS), hydroxymethylglutaryl- CoA reductase (HMGR), and / or mevalonate kinase (MK). In some embodiments, the biosynthetic enzyme(s) is a polyketide synthase, and the compound of interest is polyketide.Host cells

[0072] In some embodiments, the host cells are genetically modified in that heterologous nucleic acid have been introduced into the host cells, and as such the genetically modified host cells do not occur in nature. The suitable host cell is one capable of expressing a nucleic acid construct encoding one or more enzymes described herein. The gene(s) encoding the enzyme(s) may be heterologous to the host cell or the gene may be native to the host cell but is operatively linked to a heterologous promoter and one or more control regions which result in a higher expression of the gene in the host cell.

[0073] Each introduced enzyme can be native or heterologous to the host cell. Where the enzyme is native to the host cell, the host cell is genetically modified to modulate expression of the enzyme. This modification can involve the modification of the chromosomal gene encoding the enzyme in the host cell or a nucleic acid construct encoding the gene of the enzyme is introduced into the host cell. One of the effects of the modification is the expression of the enzyme is modulated in the host cell, such as the increased expression of the enzyme in the host cell as compared to the expression of the enzyme in an unmodified host cell.

[0074] In some embodiments, the host cell is a bacterial cell selected from the Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsielia, Proteus, Salmonella, Serratia, Shigella, Ralstonia, Rhizobia, or Vitreoscilla taxonomical class. Bacterial host cells suitable for the invention include, but are not limited to, Escherichia, Corynebacterium, Pseudomonas, Streptomyces, and Bacillus. In some embodiments, the Escherichia cell is an E. coli, E. albertii, E. fergusonii, E. hermanii, E. marmotae, or E. vulneris. In some embodiments, the Corynebacterium cell is Corynebacterium glutamicum, Corynebacteriumkroppenstedtii, Corynebacterium alimapuense, Corynebacterium amycolatum, Corynebacterium diphtherias, Corynebacterium efficiens, Corynebacterium jeikeium, Corynebacterium macginleyi, Corynebacterium matruchotii, Corynebacterium minutissimum, Corynebacterium renale, Corynebacterium striatum, Corynebacterium ulcerans, Corynebacterium urealyticum, or Corynebacterium uropygiale. In some embodiments, the Pseudomonas cell is a P. putida, P. aeruginosa, P. chlororaphis, P. fluor escens, P. pertucinogena, P. stutzeri, P. syringae, P. cremoricolorata, P. entomophila, P. fulva, P. monteilii, P. mosselii, P. oryzihabitans, P. parafluva, or P. plecoglossicida. In some embodiments, the Streptomyces cell is a S. coelicolor, S. lividans, S. venezuelae, S. ambofaciens, S. avermitilis, S. albus, or S. scabies. In some embodiments, the Bacillus cell is a B. subtilis, B. megaterium, B. licheniformis, B. anthracis, B. amyloliquefaciens, B. pumilus, B. brevis, B. aminovorans, or B. fusiformis. In some embodiments the bacterial cell is a Gram-positive bacterium, such as a Streptomyces species, such as any Streptomyces species or strain taught herein.

[0075] In some embodiments, the host cell comprises a nucleic acid encoding the one or more enzymes operatively linked to a promoter capable of expressing the one or more enzymes in the host cell. In some embodiments, the encoding of the one or more enzymes to the nucleic acid is codon optimized to the host cell. In some embodiments, the nucleic acid is vector or replicon that can stably reside in the host cell. In some embodiments, the nucleic acid is stably integrated into one or more chromosomes of the host cell.

[0076] In some embodiments, the providing step (a) comprises introducing a nucleic acid encoding the one or more enzymes operatively linked to a promoter capable of expressing the one or more enzymes in the host cell into the host cell.

[0077] The present invention provides for a method for constructing a genetically modified host cell of the present invention, comprising (a) introducing a nucleic acid encoding the one or more enzymes operatively linked to a promoter capable of expressing the one or more enzymes in the host cell into the host cell.

[0078] One can modify the expression of a gene encoding any of the enzymes taught herein by a variety of methods in accordance with the methods of the invention. Those skilled in the art would recognize that increasing gene copy number, ribosome binding site strength, promoter strength, and various transcriptional regulators can be employed to alter an enzymeexpression level.

[0079] References cited herein:1. Flamholz, A., Noor, E., Bar-Even, A., Liebermeister, W., and Milo, R. (2013). Glycolytic strategy as a tradeoff between energy yield and protein cost. Proc Natl Acad Sci USA 110, 10039-10044.2. Meile, L., Rohr, L.M., Geissmann, T.A., Herensperger, M., and Teuber, M. (2001).Characterization of the D-xylulose 5-phosphate / D-fructose 6-phosphate phosphoketolase gene (xfp) from Bifidobacterium lactis. J. Bacteriol. 183, 2929-2936.3. Bogorad, I.W., Lin, T.-S., and Liao, J.C. (2013). Synthetic non-oxi dative glycolysis enables complete carbon conservation. Nature 502, 693-697.4. Lin, P.P., Jaeger, A. J., Wu, T.-Y., Xu, S.C., Lee, A.S., Gao, F., Chen, P.-W., and Liao, J.C. (2018). Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism. Proc Natl Acad Sci USA 115, 3538-3546.5. Sabri, S., Nielsen, L.K., and Vickers, C.E. (2013). Molecular control of sucrose utilization in Escherichia coli Nl, an efficient sucrose-utilizing strain. Appl. Environ. Microbiol. 79, 478-487.6. Santos, C.N.S., Regitsky, D.D., and Yoshikuni, Y. (2013). Implementation of stable and complex biological systems through recombinase-assisted genome engineering. Nat.Commun. 4, 2503.7. Santos, C.N.S., and Yoshikuni, Y. (2014). Engineering complex biological systems in bacteria through recombinase-assisted genome engineering. Nat. Protoc. 9, 1320-1336.8. Kuznetsova, E., Proudfoot, M., Gonzalez, C.F., Brown, G., Omelchenko, M.V., Borozan,I., Carmel, L., Wolf, Y.I., Mori, H., Savchenko, A.V., et al. (2006). Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family.J. Biol. Chem. 281, 36149-36161.9. Bosl, M., and Kersten, H. (1991). A novel RNA product of the tyrT operon of Escherichia coli. Nucleic Acids Res. 19, 5863-5870.10. Noor, R., Murata, M., Nagamitsu, H., Klein, G., Raina, S., and Yamada, M. (2009). Dissection of sigma(E)-dependent cell lysis in Escherichia coi , roles of RpoE regulators RseA, RseB and periplasmic folding catalyst PpiD. Genes Cells 14, 885-899.

[0080] Other objects, features, and advantages of the present invention will be apparent to one of skill in the art from the following detailed description and figures.

[0081] It is to be understood that, while the invention has been described in conjunction with the preferred specific embodiments thereof, the foregoing description is intended to illustrate and not limit the scope of the invention. Other aspects, advantages, and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

[0082] All patents, patent applications, and publications mentioned herein are hereby incorporated by reference in their entireties.

[0083] The invention having been described, the following examples are offered to illustrate the subject invention by way of illustration, not by way of limitation.EXAMPLE 1Non-oxidative glycolysis strain of E. coli for growth on sucrose fructose-1,6- bisphosphatase is a key limiting step for synthetic non-oxidative glycolysis

[0084] Glycolysis is a fundamental metabolic pathway for energy generation and biosynthesis, but the standard Embden-Meyerhof-Pamas (EMP) pathway inherently loses carbon as CO2 during acetyl-CoA formation. Non-oxidative glycolysis provides a mechanism to limit loss by bypassing pyruvate decarboxylation in acetyl-CoA formation. Here, we engineered a chromosomally integrated version of a previously reported Escherichia coli strain reliant on non-oxidative glycolysis (NOG). Following an extended 16-day lag phase, our engineered strain successfully grew in minimal media with glucose as the sole carbon source. Whole-genome sequencing revealed that transposon insertions disrupted most of the heterologous NOG-related genes, leaving only xpk and tkt2 functionally expressed. Additionally, a genomic amplification of the modC-ydhl region was identified containingybhA encoding a fructose- 1,6-bisphosphtase (F16BPase), and overexpression of YbhA was sufficient to restore NOG metabolism in the NOG22 background strain. These findings provide key insights into the genetic and metabolic adaptations required for sustaining NOG, highlighting both bottlenecks and potential strategies for optimizing carbon-efficient metabolism in industrial bioproduction.

[0085] Here, we address these limitations by engineering a plasmid-free E. coli NOG strain, thereby enhancing genetic stability and reducing metabolic burden. We introduced the cscBAK operon from E. coli W to expand substrate versatility, enabling sucrose utilization as a carbon source to make our strain compatible with sucrose-secreting cyanobacteria in a consortium (cite DOI: 10. 1007 / 978- •1-0716-1791-5 16, DOI 10.1186 / sl3036-017-0048-5) 5. Remarkably, we found that this engineered NOG strain requires only a single additional overexpression of fructose- 1,6-bisphosphatase (YbhA) to restore growth in the NOG22 chassis. By eliminating plasmid dependence and demonstrating the minimal genetic requirements for sustaining NOG metabolism, we provide a more robust platform for studying and optimizing this strain. Our findings offer key insights into the metabolic constraints and adaptive mechanisms associated with non-oxidative glycolysis, paving the way for future efforts to improve pathway efficiency, balance cellular energy demands, and enhance strain robustness for industrial biomanufacturing applications.RESULTSBuilding and evolving plasmid-free NOG strain

[0086] We integrated the NOG isozymes present on pPL274 and pTW371 from NOG21 into the plasmid-free strain NOG22, which is incapable of growth on glucose as its sole carbon source, which James Liao kindly provided to us4. This strain lacks functional glycolytic pathways and harbors a genome-integrated xpk at the edd-zwf\ocv . Using Recombinase Assisted Genome Editing (RAGE) to integrate all isozymes required for NOG that were located on pPL274, encoding native E. coli genes gif and glk, along with tkt2 (WP_01841573 from Methylmicrobium buryatense 5 GB 1), and tai from Klebsiella pneumonia . Additionally, two tkt genes from pTW371 (WP_017841573 and WP_017840137) were cloned into RAGE delivery vector pW5Y along with the cscBAK operon from E. coli W5. The 10-gene cassette was introduced to the flgAB locus, selected due to its non-essentiality and minimal metabolic impact when deleted. The resultant strain was designated NOG*S1.

[0087] Despite successful chromosomal integration, NOG* SI initially failed to grow in minimal media containing 0.5% glucose. However, after a prolonged 16-day lag, we observed turbidity in the culture. The culture was isolated and verified, and upon reinoculation, the strain exhibited robust growth, reaching an OD >1.0 within 48 hours. This strain, designated NOG*S2, also grew in sucrose, demonstrating the functionality of the heterologous cscBAK operon (Fig. 6).Strain characterization reveals minimized NOG geneset

[0088] Genome sequencing revealed several mutations occurring in NOG*S2 (Table SI). One of the most striking findings was that the majority of the integrated NOG cassette was inactivated by transposon insertion, effectively disabling the expression of glfZM, glk, talKP, and glpX, which were introduced in this construct (Fig. 7). We were initially concerned that phage transduction re-introduced WT genes for EMP or ED glycolysis. However, the whole genome sequencing confirmed the integrity of the original knockouts in the NOG22 strain, and results were further validated with proteomic analysis (Fig. 11, panel C, for full proteomics data, see PRIDE database).

[0089] These results prompted us to question whether our strain truly performs non-oxidative glycolysis. One conceivable hypothesis is that another gene was recruited to complement the function of zwf which was knocked out in our strain. Such a function would enable the upper oxidative portion of the pentose phosphate pathway to function by the enzymatic action of Gnd, and the action of Xpk could modify the lower portion of the PPP. Therefore, we knocked out gnd in our strain and assessed growth. Indeed, NOG*S2 Agnd was unaffected for growth in glucose and sucrose (Figure 13).

[0090] To further rule out flux through the oxidative portion of the PPP, we performed an isotope labeling experiment. Oxidative glycolysis leads to the loss of carbon that originated in the 3 and 4 positions in glucose in the form of CO2 by the enzymatic action of pyruvate dehydrogenase. As such, the EMP pathway would produce labeled acetate when fed 13C-3,4- glucose. Flux through the PPP or EMP glycolysis in cells fed 13C-3,4-glucose, would yield single labeled acetate, even in the context of Xpk activity. However, cells that enable complete carbon conservation would produce double-labeled acetate as a portion of the acetate pool. In our labeling experiment, we observed double-labeled acetate with an m / z ratio of 62 (Fig. 8). The validation of the NOG phenotype in this strain suggests that theoverexpression of one or more of the genes, glfZM, glk, tkt2MB, talKP, or glpX, may be deleterious to fitness within the context of N0G*S2.Overexpression of YbhA is sufficient for NOG metabolism in NOG22.

[0091] Since the NOG isozymes encoded by pPL274and pTW appear to be dispensable for the NOG phenotype, we hypothesized that one or more native enzymes are involved in NOG metabolism in NOG*S2. Whole-genome sequencing of NOG*S2 revealed that the modC- ybhl region had a ~8-fold higher read coverage compared to NOG* SI, suggesting that one or more genes within this region play a critical role in supporting NOG metabolism (Fig. 8). Further analysis indicated that this region became flanked by IS4-like transposons and was likely duplicated via transposition. However, due to the relatively short average read lengths (-3000-6000 bp), the precise insertion sites in NOG*S2 could not be resolved. To assess the functional significance of this region, we cloned the modC-ybhl region onto a high-copy vector, introduced the construct into NOG22, and observed growth with glucose as the sole carbon source. We then cloned three plasmids expressing ybhA, pgl, and ybhD under an inducible promoter and found that overexpression oi ybhA alone was sufficient to support growth on glucose as a sole carbon source (Fig. 8).

[0092] YbhA is a dual-function enzyme. It has widely been studied regarding its haloacid dehalogenase activity with its substrate vitamin B6. YbhA also functions as a fructose- 1,6- bisphosphatase (F16BPase) with a relatively high KM (2.4 mM)8. Therefore, we hypothesized that the F16BPase activity plays a key role in NOG metabolism in NOG*S2. To test this, we tested the complementation of NOG22 on 0.5% glucose media using the more commonly known F16BPase enzymes, Fbp and GlpX (YbhA Km = 2.4 mM Kcat = 9.7; / 10.1074 / jbc.M605449200. GlpX Km = 0.07 mM, Kcat = 5.7; 10.1074 / jbc.M808186200. Fbp Km = 0.02 mM, Kcat = 14.6; Kelley-Loughnane et al., “Purification, kinetic studies, and homology model of Escherichia colt fructose-l,6-bisphosphatase,” Biochemics et Biophysica Acta 1594(1):6-16, 2002). We found that expression of both enzymes rescued the growth of NOG22 similar to YbhA (Fig. 9).

[0093] Lin et al. previously sought to alleviate metabolic bottlenecks by overexpressing heterologous transketolase and transaldolase enzymes based on metabolic modeling predictions that Escherichia colds native Tai and Tkt enzymes were limiting. However, our findings indicate that only an additional F16BPase is required in the NOG22 chassis to enableNOG metabolism, suggesting that native TalAB and Tkt enzymes are sufficient, implying that the primary bottleneck for the NOG pathway occurs at the F16BPase step. Supporting this, we observed only minor expression changes in these enzymes, with TalB showing a modest 0.74-fold (log?) upregulation compared to a ~6.08-fold increase in YbhA (Fig. 10, panel B).Metabolomic analysis reveals elevated NOG metabolites

[0094] To gain deeper insights into the metabolic rewiring of NOG*S2, we conducted comparative proteomic and metabolomic analyses against wild-type (WT) cells (Fig. 11). Our findings revealed substantial shifts in metabolite concentrations associated with NOG metabolism. One of the most striking differences was the accumulation of fructose- 1,6- bisphosphate (F16BP), a critical intermediate in the NOG cycle, which was elevated ~6.6- fold in NOGS2 compared to WT after 24 hours of growth. This significant accumulation suggests a bottleneck or an altered regulatory mechanism facilitating increased Fl 6BP retention in the engineered strain and gives a rationale for the selection for YbhA overexpression in NOG*S2. Similarly, glyceraldehyde-3 -phosphate (G3P), an essential glycolytic and NOG intermediate, was undetectable in WT cells at the 24- and 48-hour time points, whereas NOG*S2 exhibited consistent accumulation, reaching nearly 1 pM G3P / OD600 at 72 hours — approximately 7.2- fold higher than WT levels. This accumulation indicates a distinct redistribution of carbon flux favoring NOG metabolism.

[0095] Intriguingly, while intracellular xylulose-5-phosphate (X5P) levels remained comparable between the strains, substantial quantities of X5P were detected in the supernatant of NOG*S2, suggesting an overflow metabolism leading to extracellular secretion. The presence of xylonate in the culture medium further supports the hypothesis that excess X5P is converted into this organic acid, likely through an alternative oxidation pathway. The secretion of X5P and xylonate implies a previously uncharacterized metabolic overflow mechanism that may serve to alleviate intracellular metabolic stress caused by NOG operation.

[0096] Further analysis revealed a marked reduction in intracellular acetyl-CoA concentrations in NOG*S2, a finding consistent with increased carbon flux through the tricarboxylic acid (TCA) cycle. Supporting this hypothesis, we observed a substantial upregulation in the expression of TCA cycle enzymes, suggesting a metabolic shift towardoxidative phosphorylation to compensate for the ATP deficit inherent to NOG metabolism. In addition to these central carbon flux alterations, we identified significant perturbations in redox balance. Notably, intracellular levels of NAD+ and NADP+ were markedly elevated in N0G*S2, potentially reflecting increased expression of the NAD+ biosynthesis pathway.This upregulation likely represents an adaptive response to mitigate the inherent reductive power deficiency of the NOG pathway, allowing cells to optimize electron transfer and maintain metabolic homeostasis.

[0097] Collectively, these results provide new insights into the metabolic intricacies of NOG and the compensatory mechanisms employed by NOG*S2 to sustain energy metabolism. The observed changes in carbon flux, redox balance, and metabolite secretion highlight key challenges and opportunities for further optimization of non-oxidative glycolysis in biotechnological applications.Proteomics reveals shifts in expression compared to wild-type E. coli.

[0098] Proteomic analysis further elucidated the metabolic adaptations in NOG*S2, revealing both expected and unanticipated changes in protein expression relative to WT E. coli. Notably, endogenous enzymes from the pentose phosphate pathway (PPP) exhibited similar expression levels between WT and NOG*S2, with the exception of fructose-1,6- bisphosphatases (F16BPases). The F16BPases YbhA and Fbp displayed a ~6.7- and ~1.4-fold increase in expression, respectively, underscoring the critical role of this enzymatic step as a bottleneck in NOG metabolism. This finding reinforces the notion that non-oxidative glycolysis requires precise enzymatic tuning to sustain metabolic flow and suggests that further optimization of F16BPase activity could enhance NOG efficiency.

[0099] Interestingly, while the expression of other key NOG-associated enzymes remained unchanged, a significant upregulation of TCA cycle-associated genes was observed, mirroring results from Lin et al., suggesting a metabolic shift toward increased oxidative metabolism, possibly as a compensatory response to the inherent ATP limitation and redox imbalances imparted by NOG metabolism. The physiological significance of this upregulation remains unclear, but it raises intriguing questions regarding the energetic constraints imposed by the NOG cycle and potential mechanisms by which cells adjust to optimize energy homeostasis. Increased TCA cycle activity may serve as a mechanism to extract additional energy from metabolic intermediates, particularly in the absence ofglycolytic ATP generation.

[0100] Additionally, proteomic data confirmed the integrity of key knockouts in glycolytic pathways, ensuring that EMP and ED pathways remained inactive in NOG*S2. This verification further supports the conclusion that observed metabolic adaptations were a direct consequence of NOG functionality rather than unintended flux through native glycolytic routes. These findings provide a foundation for future studies aimed at refining NOG metabolism by identifying additional regulatory nodes and optimizing enzyme expression to enhance strain robustness and metabolic efficiency.Transposon-mediated regulatory rewiring of amino acid metabolism

[0101] The insertion of two transposases near leuO appears to have introduced a new regulatory element, potentially altering its expression. A promoter identified at the 3' end of one of these insertion sequences, with a -10 (GGTTACGCT) and -35 (CTCAAA) motif, seems to be constitutively active, which may be driving leuO transcription. Although we did not detect LeuO at the protein level in either strain, transcriptomic analysis revealed significant upregulation of leucine biosynthesis and transport genes, including leuC, leuB, leuD, leuA, and livK, suggesting that that leuO expression is indeed increased but below the limit of detection for proteomic analysis. LeuO is known to act as a global regulator that influences stress responses and metabolic adaptation, and its upregulation in this strain could serve as a compensatory mechanism to optimize leucine biosynthesis and uptake under nutrient-limited conditions. The presence of an unregulated promoter in this insertion event further underscores the role of transposon-mediated regulatory rewiring in adaptive evolution.

[0102] In addition to the changes associated with leuO, we identified the insertion of the small RNA rtT in an intergenic region. / 77'has been previously shown to mitigate the effects of glycine or isoleucine limitation^ suggesting that its increased expression in this strain may provide a selective advantage under nutrient-restricted conditions. Given the upregulation of leuO and its associated genes, the overexpression of rtT could further enhance metabolic flexibility by alleviating amino acid stress. This aligns with previous observations that small RNAs can play a critical role in modulating metabolism by finetuning gene expression in response to environmental cues. Together, the insertion-driven activation of leuO and rtT highlights how mobile genetic elements can introduce novelregulatory interactions, enabling the strain to reprogram its metabolic network to adapt to changing nutrient availability.Upregulation of CobB and possible role in Acetyl-CoA production in N0G*S2

[0103] The observed upregulation of CobB, a sirtuin-like NAD+-dependent deacetylase, suggests a potential shift in acetylation dynamics that could influence central carbon metabolism. CobB is known to deacetylate numerous metabolic enzymes, including those involved in glycolysis, the TCA cycle, and acetate metabolism, thereby modulating their activity in response to cellular energy and redox states. One of its key targets is Acs (acetyl-CoA synthetase), which catalyzes the conversion of acetate into acetyl-CoA, a central metabolite for energy production and biosynthetic pathways. Given that acetylation generally inhibits Acs activity, the increased expression of CobB may enhance Acs function by maintaining it in a deacetylated, active state, ultimately leading to an increase in intracellular acetyl-CoA levels.NOG*S2 produces xylonate

[0104] Interestingly, we observed the production of xylonate in NOG*S2, which E. coli does not naturally produce under any known conditions. Xylonate is a diacid that can be polymerized into bioplastics or used as a biodegradable chelator. In addition, there are applications in the food and beverage industry as a precursor to xylitol or other sugar acids. We propose that the xylonate is a product of excess xylulose-5-phosphate. This reaction is unlikely to occur spontaneously, as the reaction would require the (likely slow) tautomerization of X5P to the enediol form, and enediol oxidation requires highly basic pH conditions in the presence of a strong oxidant. The most probable enzymatic route to xylonate in E. coli is the oxidation of X5P by a sugar phosphate dehydrogenase to form a phosphorylated xylonate intermediate, followed by dephosphorylation. However, most of the sugar phosphate dehydrogenases are knocked out (Zwf, Edd) or downregulated (Gnd) in all NOG strains described here. It is possible that some less-characterized dehydrogenase enzymes, such as YqhD or YiaD, could be involved in this reaction, which are both upregulated in NOG*S2.DISCUSSIONFructose 1,6 bisphosphatase is a bottleneck for NOG metabolism

[0105] In this work, we integrated the genes for enzymes from Lin et al. into the chromosome of NOG22 and expressed them under two constitutive promoters (Ptoc and P / ac( ) in the flgAB locus. After a prolonged multi-day lag period, our cells grew in 0.5% glucose. We found two key mutations in the resultant strain. First, a transposon disrupted one of the integrated operons, disrupting the overexpressed genes glfZM, glk, tkt2MB, talKP, and glpX, suggesting that the overexpression of one or more of these genes is not tolerated for NOG metabolism. Further investigation revealed that a portion of the genome from modC to ybhl is overrepresented in the genome coverage by ~8-fold. Introducing additional copies of this segment of the genome on a plasmid with a (medium copy) origin rescued growth of NOG22 in 0.5% glucose minimal media, indicating that one or more of the genes in this section of the genome is sufficient to allow for the NOG phenotype. Next, we individually cloned each of the intact genes from this section of the genome, including ybhA, pgl, ybhD, and ybhH under an inducible promoter and found that overexpression cA ybhA alone is sufficient for NOG metabolism in NOG22, defining a ‘modified’ NOG cycle (Fig. 12).

[0106] This series of experiments shows that the overexpression of glfZM, glk, tkt2MB, and talKP is not necessary for the NOG phenotype, but the overexpression of an enzyme with F16BPase activity is necessary. Our analysis of metabolite levels in WT E. coli and NOG*S2 suggests that F16BP is sufficiently elevated in NOG*S2 to allow for the activity of YbhA in NOG*S2 given its relatively high KM for Fl 6BP, but it may be latent or inactive for F16BPase activity in wild-type E. coli. Lin et al. hypothesized that Tkt and Tai are possible bottlenecks in the NOG cycle. It appears that Tai is not a kinetic bottleneck for NOG, as the kinetic profile of E. coli ’s native Tai enzyme is sufficient. Elevated levels of G3P and elevated levels of secreted X5P indicate substantial Tai activity in NOG*S2 relative to WT. However, we observe a ~2-fold increase in wild-type TalB in our strain, suggesting that overexpression of TalB may be necessary. We did not identify any causative mutations for the overexpression of TalB, suggesting that it may have been achieved through one of the many mutations in uncharacterized regulators that we found in our genome sequencing. Though Lin et. al. show superior activity of TalKP relative to A. coliA native Tai, it seems that upregulation of E. coliA native Tai is sufficient for the NOG phenotype. We make similar conclusions with Tkt, as we see a slight overexpression of Tkt and low expression of Tkt2MB in NOG*S2, but it seems that the heterologous copy of Tkt2MB is not necessary because NOG22 is rescued by expression of any F16BPase. It has been noted that the activity of E. coliA native Tkt enzyme is similar to that of heterologous Tkt2MB.Upregulation of NAD+ biosynthesis

[0107] We observed a significant upregulation of nadA transcription in the NOG strain, accompanied by a marked increase in intracellular NAD+ levels. Most notably, NADP+ levels were substantially elevated relative to the wild-type strain, suggesting that these cells are actively adjusting their redox balance to compensate for metabolic constraints. The disproportionate accumulation of NADP+ strongly suggests that NADPH availability is severely limiting, likely creating a bottleneck for biosynthetic reactions that rely on NADPH as a reducing equivalent.

[0108] Given this apparent redox imbalance, we expected to see an upregulation of key enzymes involved in NADPH regeneration, such as the membrane-bound transhydrogenase complex (PntAB), which catalyzes the conversion of NADH to NADPH. However, proteomic analysis did not reveal increased expression of pntA or pntB, suggesting that alternative mechanisms may be compensating for the NADPH deficit. Additionally, we did not observe a significant increase in proteins involved in the electron transport chain, such as NuoA, NuoB, NuoE, NuoH, or Nuol, further indicating that respiratory metabolism is not a primary driver of redox balance adjustments in this strain.

[0109] Although NadA itself was not detected in our proteomics experiments, transcriptomic data indicate substantial upregulation, reinforcing the conclusion that NAD+ biosynthesis is being actively enhanced at the transcriptional level. This suggests that while increased NAD+ and NADP+ availability may help buffer the redox imbalance, additional compensatory pathways — potentially involving alternative NADPH-generating enzymes such as glucose-6-phosphate dehydrogenase (Zwf) or malic enzyme (MaeB) — may be at play. Further studies will be necessary to determine how the NOG strain resolves its apparent NADPH deficiency and whether metabolic flux through the pentose phosphate pathway or other alternative routes is being altered to meet cellular demands.Possible routes to performance improvement

[0110] Although this strain exhibits characteristics favorable for increased carbon conversion, its applicability in biotechnology is constrained by its osmosensitivity and potential mechanosensitivity. This limitation is most evident in its inability to withstand electroporation, as the cells lyse upon rapid changes in media osmolarity, such as during DI water washes. Several factors may contribute to this fragility, though their relevance withinthe context of NOG remains uncertain. One potential strategy to enhance strain robustness is the deletion of rseA, which encodes an anti-sigma factor that inhibits rpoE, a sigma factor involved in the response to cell envelope stress. Overexpression of rseA has been implicated in increased cell lysis during the stationary phaselO, and proteomic analysis indicates an 8.2- fold (log2) increase in RseA expression in this strain. Targeted downregulation or deletion of rseA may mitigate cell envelope instability and improve the strain’s suitability for biotechnological applications.Implementing external redox uptake to power biomanufacturing

[0111] The ability of NOG metabolism to operate with near-complete carbon conservation presents an exciting opportunity for expanding its bioenergetic potential. One promising avenue for further strain engineering is the expression of enzymes that allow for the utilization of external electron carriers such as H2 or formate, to mitigate the inherent redox imbalance imparted by NOG metabolism. The heterologous expression of a soluble hydrogenase from Cupriavidus necator could enable direct assimilation of molecular hydrogen, providing a renewable and efficient electron donor to fuel cellular metabolism. Likewise, introducing a formate dehydrogenase system could allow the strain to utilize formate as an alternative reducing equivalent, offering a versatile strategy to enhance NAD(P)H availability and improve metabolic resilience. By leveraging these electron sources, this strain could be further optimized for applications in bioelectrosynthesis, CO2 fixation, and sustainable chemical production. Integrating external redox inputs would strengthen the strain’s viability in diverse environments and unlock new possibilities for biomanufacturing platforms that capitalize on renewable feedstocks and electrochemical energy conversion.MATERIALS AND METHODS

[0112] Isotopic labeling of acetate. Isotopically labeled [3,4-13C] glucose was obtained from Cambridge Isotope Laboratories, Inc. (Tewksbury, MA). Metabolites were extracted from the supernatant of specified E. coli strains by acidifying 4 mL of the sample with 100 pL of concentrated H2SO4 (-98%; Sigma-Aldrich, St. Louis, MO) to achieve a pH <2. Next, 1.5 g of Na2SO4(>99%, granular; Sigma-Aldrich) was added and shaken until dissolved. Phase extraction was performed by adding 1 mL of Zc / V-butyl methyl ether (>99%; Sigma- Aldrich), followed by vigorous shaking and a five-minute settling period. The organic(top) layer was collected and transferred to a vial for GC / MS analysis. Samples were analyzed using an AutoSpec Premier mass spectrometer (Waters, Manchester, UK) coupled to an Agilent 7890A gas chromatograph with an electron impact ion source. Data acquisition and processing were conducted using MassLynx software.

[0113] Assembly of NOG-sucrose cassette. The NOG-sucrose cassette was cloned into pW5Y using yeast recombination assembly. Chemically competent Saccharomyces cerevisiae CEN.PK cells were prepared using the Frozen-EZ Yeast Transformation II Kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol. Recombinant plasmids were then extracted using the Zymoprep Yeast Plasmid Miniprep II Kit (Zymo Research). The purified plasmids were electroporated into electrocompetent E. coli SIG10 cells (Sigma- Aldrich, St. Louis, MO). Candidate plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen, Redwood City, CA) and verified by full-plasmid sequencing with Plasmidsaurus (Eugene, OR). The final construct is referred to as pW5Y::NOGsuc.

[0114] Genome engineering. All genomic modifications were initially performed in E. coli BW25113 and subsequently transferred to the NOG22 chassis via Pl phage transduction. A chloramphenicol resistance cassette flanked by directional lox sites was amplified from pSB54, a gift from Dr. Yasuo Yoshikuni (Lawrence Berkeley National Laboratory, Berkeley, CA), and integrated into the flgAB locus using the Red recombination system with pKD46 to create a landing pad for Recombinase- Assisted Genome Engineering (RAGE). The cassette was amplified using primers JP452 (5’ GCGTACATGCTGATGCGGTGAAACCATCTGGATTTGCGCCTGGTTATCATCCACT TTGAGGGAGATTTGC ACTTCACCTAAATggcaaagcctcgcaatc 3’) (SEQ ID NO:1) and JP453 (5’ CGCTGATCAGCGATATTGTTTCCGACGCGCAACAAGCTAATTTACTGATCCCTGT GGATGAAACACCGCC TGTCATCAAggccaacttttggcgaaaatg 3’) (SEQ ID NO:2). This insertion disrupted both flgA and flgB promoters and most of their coding sequences. The pKD46 plasmid was then cured by incubation at 37°C on LB agar, generating strain JP2347.

[0115] Plasmid pW5Y::NOGsuc was electroporated into JP2347 and selected using 50 pg / mL spectinomycin. Successful RAGE recombination was confirmed by screening for chloramphenicol sensitivity, yielding strain JP2441. The final integrated construct was then transferred to the NOG22 chassis via Pl phage transduction.

[0116] Genome sequencing. The original NOG* strain and the evolved NOG*S2 strain were sequenced using whole genome sequencing services from Azenta, Inc.(Burlington, MA).SUPPLEMENTARY INFORMATION

[0117] Upregulation of CobB deacetylase could provide additional Acetyl-CoA, which is also known to stimulate Acs. sRNA rtT is inserted in an intergenic region. RtT overexpression is known to minimize the effects of glycine or isoleucine limitation (Bosl et al. “A novel RNA product of the tyrT operon of Escherichia coll,” Nucleic Acids Res. 19(21):5863-70, 1991). IS4 transposase insertions were identical except 7-9 bp on 5’ end. LeuO: two transposases hopped in, there’s a promoter at the 3’ end of insertion sequence that seems unregulated, with sequence -GGTTACGCT (-10) and -CTCAAA (-35) (SEQ ID NO:3 and 4, respectively) which could be turning on LeuO. No proteomics signal for LeuO in either strain, but leucine-associated genes LeuC, LeuB, LeuD, LeuA, and LivK are upregulated, suggesting upregulation of LeuO. sRNA rtT is inserted in an intergenic region. RtT overexpression is known to minimize the effects of glycine or isoleucine limitation (Bosl et al., 1991). dhaR is disturbed with transposase, inhibiting formation of DHAP to use as carbon source, corresponds with downregulation of DhaM, Dhal, DhaK expression.Transposon insertions are of different size than those reported by Lin et al.

[0118] Section 1. Most of the accumulated mutations in NOG*S2 were caused by transposition of an IS4-like element (see Table 1).

[0119] Table 1. Accrued mutations in NOG*S2.

[0120] DNA sequence listed in Table 1 have the following sequence identifiers: TCAATAA (SEQ ID NO: 5), GAGTTAA (SEQ ID NO: 6), CGCCTGG (SEQ ID NO: 7), AAGGTAG (SEQ ID NO: 8), ACTTCC (SEQ ID NO: 9), CGCTCTG (SEQ ID NO: 10), GGCTGAG (SEQ ID NO: 11), GGCGTAG (SEQ ID NO: 12), CTGAGAG (SEQ ID NO: 13), GAGAGT (SEQ ID NO:14),TGTTAAA (SEQ ID NO:15), AGTATGA (SEQ ID NO: 16), AATTCATG (SEQ ID NO: 17), TACTCCGG (SEQ ID NO: 18), TTTAACTG (SEQ ID NO: 19), CCAACTTA (SEQ ID NO:20), TTATTAAT (SEQ ID NO:21), TGCTTTG (SEQ ID NO:22), GGTACTG (SEQ ID NO:23), AACTCTG (SEQ ID NO:24), AGCTTAA (SEQ ID NO:25), ACGAAAA (SEQ ID NO:26), CGCGCTG (SEQ ID NO:27), TGCGAAG (SEQ ID NO:28), GTACTTT (SEQ ID NO:29), ACCGCTGA (SEQ ID NO:30), TCTGGAA (SEQ ID NO:31), CACTTAA (SEQ ID NO:32), CGCTGTG (SEQ ID NO:33), GGACTTA (SEQ ID NO:34), CAAAATC (SEQ ID NO:35), GCTTGTA (SEQ ID NO:36), TACGGAG (SEQ ID NO: 37), GCTGGTG (SEQ ID NO: 38), TACTCCG (SEQ ID NO: 39), GCATAT (SEQ ID NO:40), AAAGCGG (SEQ ID NO:41), TATTCATA (SEQ ID NO:42), ACACGCCA (SEQ ID NO:43), TGCTTCG (SEQ ID NO:44), TACGCGG (SEQ ID NO:45), GTACGTG (SEQ ID NO:46), TTAGGGA (SEQ ID NO:47), AACACACa (SEQ ID NO:48), and TTTTT (SEQ ID NO:49).

[0121] Section 2. Investigating possible alternative routes for acetyl-CoA synthesis in NOG*S2. Proteomics suggested that in addition to the activity of Xpk, acetyl-CoA synthesis could be supplemented by at least two additional pathways. First, we observed an 11.8-fold increase in PabA, an enzyme that converts L-glutamate + 4-amino-4-deoxy chori smate to L- glutamine + chorismite — though the physiologically favored reaction favors glutamate formation. Additionally, UbiC, which converts chorismate to 4-hydroxybenzoic acid and pyruvate, was upregulated 6-fold. Given that aceEF remains intact in our strain, it is plausible that pyruvate dehydrogenase contributes to acetyl-CoA synthesis. However, this pathway is unlikely to serve as a major source of acetyl-CoA due to the relatively low concentrations ofchorismate in a typical bacterial cell and the observed >2-fold downregulation of AceEF in our strain. Further, this strain’s sole source of glutamate and glutamine is biosynthesis, disfavoring the formation of chorismate. For the chorismite pathway to function as a primary carbon flux route, glucose must be processed through NOG, with alpha-ketoglutarate subsequently diverted toward glutamate synthesis. Given glutamate’s critical role in osmotic homeostasis, significant depletion would likely compromise cell viability. A second potential route for acetyl-CoA supplementation involves ethanol oxidation. Proteomic data revealed a 6.6-fold upregulation to the oxygen-tolerant alcohol dehydrogenase AdhP, which catalyzes ethanol oxidation to acetaldehyde. Acetaldehyde could then be further converted to acetyl- CoA by the alcohol dehydrogenase activity of AdhE. However, this pathway is also unlikely to contribute substantially to acetyl-CoA production under the assessed growth conditions, as ethanol is not readily available.EXAMPLE 2Non-oxidative glycolysis strain of E. coli for growth on sucrose

[0122] We have engineered a strain of E. coli capable of non-oxidative glycolysis while growing on glucose or sucrose without the need for acetate supplementation. All required genes and mutations are present on the chromosome of the developed strain.

[0123] Two plasmids encoding the non-oxidative glycolysis pathway were obtained from James Liao Lab at UCLA (See U.S. Patent Application Publication No. 2016 / 0017339).

[0124] The engineered microorganism utilizes a phosplhoketolase enzyme (Xpk) as the key enzyme to drive conversion of fructose 6 phosphate to acetyl phosphate, and subsequently acetyl CoA, bypassing pyruvate dehydrogenase and avoiding CO2 evolution during glycolysis. The strain also has been engineered with three additional genes from E. coli strain W, which allows for the uptake and utilization of sucrose to power the non- oxidative glycolysis cycle. Strain did not grow initially, and finally grew after 16 days of shaking. A major technical problem that was overcame during this process involves acetate. The prior art (Lin et al., 2018) detailed a strain that also requires 5 mM acetate in the media. Here we simply omitted acetate and allowed for laboratory evolution to give us a strain that truly undergoes non oxidative glycolysis on glucose or sucrose alone. We have completed strain engineering and validation, along with metabolic tracing experiments to show thenature of the NOG metabolism at lab scales.

[0125] Figure 1 shows the delivery vector for NOG isozyme genes. Plasmid was partially derived from pPL274 and pTW371 from Lin et al. (2018). Genes for sucrose catabolism, cscBAK, were amplified from WT E. coli strain W. Plasmid also encodes Cre recombinase, which enabled recombination of the relevant genes into E. coli BW25113 flgAB locus. The resulting strain was then used to transfer the NOG sucrose cassette into the background strain for NOG metabolism.

[0126] Figure 2 shows the metabolic labeling experiment for integrated and evolved NOG strain. Cells were grown anaerobically at an ODeoo = 25 in the presence of 1% glucose- 3,4-13C for 24 hours. Supernatants were subjected to GC-MS analysis and the engineered NOG strain shows the expected shift in m / z for acetate, indicating double labeled acetate formed in the NOG strain, but not in the WT control.

[0127] Figure 3 shows the growth profile of NOG*S2 strain in glucose and sucrose MOPS minimal media with no other carbon sources present.EXAMPLE 3Novel pathway for carbon conservation

[0128] To engineer non-oxidative glycolysis in E. coli, we attempted to modify an existing strain developed by James Liao’s group at UCLA (Figure 4) (1). They have developed a strain of non-oxidative glycolysis that requires two plasmids. To stabilize this strain, we integrated genes from both plasmids into the chromosome of E. coli, along with cscBAK from E. coli to enable sucrose catabolism.

[0129] The engineered strain did not initially grow in glucose minimal media. After a 16-day lag period, growth was observed. After strain purification and verification, the isolate was inoculated into glucose minimal media and grew to an ODeoo >1 in less than 48 hours, and also grew in sucrose.

[0130] Figure 5 shows the growth profile for chromosomally engineered NOG strains in minimal media with glucose or sucrose. To confirm the NOG phenotype in this strain, we performed 13C metabolic labeling using 3,4-13C-glucose. The heavy labeled carbons in this glucose molecule are typically lost during oxidative glycolysis through the action of pyruvatedehydrogenase. Retention of these heavy carbons in fermentation products indicates carbon conservation through glycolysis.

[0131] Figure 15 shows the verification of NOG phenotype in engineered strain. Panel A shows a schematic showing carbon loss in the form of CO2 in EMP glycolysis compared to carbon retention in acetate in Non-Oxidative Glycolysis (NOG). However, upon genome sequencing, we found that a transposon disrupted the NOG cassette during the 16- day lag period, though two enzymes in the NOG cycle (Xpk, Tkt2) were intact and expressed, as evidenced by proteomic analysis and transcriptomic data.

[0132] Figure 16 shows the sequencing data reveals that the NOG insertion was disrupted during the 16 day lag period before growth was observed. Further analysis of the whole genome sequence confirmed that all native glycolytic routes were still deleted in this strain.

[0133] Every native glycolytic route is deleted in the strain. However, a fragment of DNA was amplified several-fold, as evidenced by 8x coverage within the modC-ybhl region. The modC-ybhl region has been duplicated and amplified in our developed NOG strain. To verify that our NOG phenotype was arising from this specific amplification event, we cloned the entire region in a high copy vector and placed it in the original nongrowing NOG* strain, and found that the cloned fragment of DNA imparted the ability of this strain to grow on glucose and sucrose.

[0134] Figure 17 shows the duplicated fragment of DNA cloned onto a high copy plasmid allowed for growth of our non-growing base strain. We then cloned three of the most likely genes to allow for growth (ybhA,pgl, and ybhD) under their native promoter and placed each individual plasmid in the base strain. We found that expression oiybhA alone gave growth in sucrose. YbhA is responsible for one or more enzymatic step in our NOG cycle.

[0135] Figure 12 shows the pathway used herein. Figure 18 shows proteomics data showing that YbhA is upregulated 6-fold, confirming the relevance of the chromosomal multiplication observed in the YbhA region in the evolved strain. YbhA blends with many other data points in the volcano plot.

[0136] In addition, an unrelated transposon was observed to have that disabled acassette for NOG isozymes that have been described by Lin et. al. (“Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism,” Proc Nat Acad Sci USA, 115(14) :3538-3546). Many of these overexpressed genes are not necessary for the phenotype because E. coli has homologs for these genes that appear adequate for the strain to grow through non-oxidative glycolysis.

[0137] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

Claims

What is claimed is:

1. A genetically modified bacterial cell comprising phosplhoketolase enzyme (Xpk), and one or more of the following: Tkt2, Tkt, GlpX, Tal3, Glk, CscA, CscB, and / or CscK.

2. The genetically modified bacterial cell of claim 1 comprising YbhA, Pgl, and / or YbhD.

3. The genetically modified bacterial cell of claim 1 comprising the E. coli modC-ybhl region.

4. The genetically modified bacterial cell of claim 1 comprising one or more heterologous enzymes for producing a compound of interest.

5. The genetically modified bacterial cell of claim 1 wherein the one or more nucleic acids encoding the enzymes are stably integrated into the genome of the genetically modified bacterial cell.

6. A method for producing a compound of interest comprising: (a) providing the genetically modified bacterial cell of claim 1, (b) culturing or growing the genetically modified bacterial cell in a suitable medium such that the compound of interest is produced, (c) optionally the compound of interest is separated or removed from the genetically modified bacterial cell and / or medium.

7. The method of claim 6, wherein the medium does not contain acetate.

8. The method of claim 6, wherein the one or more nucleic acids encoding the enzymes are stably integrated into the genome of the genetically modified bacterial cell, and the genetically modified bacterial cell are cultured or grown in a bioreactor.

Images