Fine-tuning of car expression

Abstract

The present disclosure relates to a method and system for fine-tuning of chimeric antigen receptor (CAR) expression comprising an isolated nucleic acid comprising a sequence encoding a CAR and at least one target site for an endogenously expressed microRNA (miRNA) positioned downstream of said sequence encoding a CAR. Also described are vectors, host cells, pharmaceutical compositions, kits comprising said isolated nucleic acids, and methods of treating a subject using said isolated nucleic acid.

Description

FINE-TUNING OF CAR EXPRESSIONFIELD

[0001] The present disclosure relates generally to fine tuning of Chimeric Antigen Receptor expression.BACKGROUND

[0002] Chimeric Antigen Receptor (CAR) T cell therapy is emerging as a powerful strategy for treating haematological malignancies. CARs are engineered fusion proteins delivered to patient T cells by viral transduction. They comprise an extracellular binding domain which mediates cancer recognition, and intracellular domains that promote T cell activation and cancer killing. In clinical trials of relapsed and / or refractory B cell leukemia and lymphomas, over 50% of patients achieved a complete response to CAR T therapy and many have remained disease-free for years. Owing to their striking efficacy, numerous CAR T products have been approved for clinical use.

[0003] Despite their tremendous potential, existing CAR T products are greatly limited by the fact that the CAR is expressed at excessively high levels on the surface of virally transduced T cells. High CAR expression contributes to a phenomenon called T cell dysfunction which reduces treatment efficacy and durability, and is associated with relapse. Systemic delivery of immune checkpoint inhibitors in combination with CAR T therapy has shown signals of modest benefit in early trials, however these expensive drugs cause system-wide autoimmunity. Consequently, better approaches for mitigating CAR T cell dysfunction are required.

[0004] High CAR expression also contributes to excessive inflammation and cytokine release syndrome, a side effect that occurs in -60% of CAR T recipients and can be life threatening. Cytokine release syndrome is currently managed with IL-6 and IL-1 blockade and necessitates extensive hospital resources, adding to the overall cost of CAR T therapy.SUMMARY

[0005] In one or more embodiments of the present disclosure, there is provided:

[0006] 1. An isolated nucleic acid, comprising:

[0007] a sequence encoding a chimeric antigen receptor (CAR), and

[0008] at least one target site for an endogenously expressed microRNA (miRNA) positioned downstream of said sequence encoding a CAR.

[0009] 2. The isolated nucleic acid of embodiment 1 , wherein the target site for an endogenously expressed miRNA comprises one or more nucleotide mismatches.

[0010] 3. The isolated nucleic acid of embodiment 1 or 2, wherein the target site for an endogenously expressed miRNA is a miR-17 target site variant.

[0011] 4. The isolated nucleic acid of any one of embodiments 1 to 3, wherein the isolated nucleic acid comprises two or three or more of said target site.

[0012] 5. The isolated nucleic acid of any one of embodiments 1 to 4, wherein theCAR comprises an extracellular antibody variable domain specific for an antigen associated with the disease or disorder and an intracellular signaling domain.

[0013] 6. The isolated nucleic acid of embodiment 5, wherein the antigen associated with the disease or disorder is a tumour associated cell surface antigen.

[0014] 7. The isolated nucleic acid of embodiment 6, wherein the tumour associated cell surface antigen is CD19.

[0015] 8. The isolated nucleic acid of any one of embodiments 1 to 7, wherein theCAR comprises a transmembrane domain, preferably CD3 zeta chains, a CD28 and / or 4- 1BB costimulatory domain, and a CD3 zeta signaling domain.

[0016] 9. The isolated nucleic acid of any one of embodiments 1 to 8, wherein the one or more target site comprises or consists of SEQ ID NO: 1 [Scramble], SEQ ID NO: 2 (17-A.18-G), SEQ ID NO: 3 (2-A.17-T), SEQ ID NO: 4 (18G), SEQ ID NO: 5 (1x Perfect), SEQ ID NO: 6 (2x Perfect), or SEQ ID NO: 7 (3x Perfect), or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof.

[0017] 10. The isolated nucleic acid of any one of embodiments 1 to 8, wherein the isolated nucleic acid comprises or consists of SEQ ID NO: 8 (Bidirectional hPGK-CAR- miSFIT-Scramble sequence), SEQ ID NO: 9 (Bidirectional hPGK-CAR-miSFIT-2A-17T sequence) or SEQ ID NO: 10 (Bidirectional hPGK-CAR-miSFIT-1x-Perfect sequence), or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof.

[0018] 11. The isolated nucleic acid of any one of embodiments 1 to 9, further comprising a vector sequence.

[0019] 12. The isolated nucleic acid of embodiment 11 , wherein the vector sequence comprises a viral vector derived from a virus selected from a lentivirus, an adenovirus type 2 and an adenovirus type 5, a retrovirus, an adeno-associated virus (AAV), a simian virus 40(SV-40), vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), or herpes simplex virus (HSV).

[0020] 13. The isolated nucleic acid of embodiment 11 , wherein the vector sequence comprises a viral vector derived from a lentivirus.

[0021] 14. A vector comprising the isolated nucleic acid of any one of embodiments1 to 9.

[0022] 15. The vector of embodiment 14, further comprising a promoter.

[0023] 16. The vector of embodiment 15, wherein the promoter is a modified MLV long terminal repeat (MNDLI3) promoter or a bidirectional promoter, preferably a human phosphoglycerate kinase promoter.

[0024] 17. The vector of any one of embodiments 14 to 16, wherein the vector is a lentiviral vector.

[0025] 18. A host cell comprising the isolated nucleic acid of any one of embodiments 1 to 13 or the vector of any one of embodiments 14 to 17.

[0026] 19. The host cell of embodiment 18, wherein the host cell is a T-cell.

[0027] 20. The host cell of embodiment 18 or 19, wherein host cell is a human cell.

[0028] 21. An engineered immune cell comprising the isolated nucleic acid of chimeric antigen receptor (CAR) of any one of embodiments 1 to 13 or the vector of any one of embodiments 14 to 17, wherein the engineered immune cell is a NK cell, an NKT cell, or a T cell.

[0029] 22. A pharmaceutical composition comprising the host cell of any one of embodiments 18 to 20, or the engineered immune cell of embodiment 21, and a pharmaceutically acceptable carrier.

[0030] 23. A method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a cancer, comprising: administering a therapeutically effective amount of the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21, or the pharmaceutical composition of embodiment 22 to a subject.

[0031] 24. The method of embodiment 23, wherein said cancer is CD19-positive 13- cell leukemia or CD19-positive lymphoma;

[0032] 25. The method of embodiment 23, wherein the cancer is acute lymphocytic leukemia.

[0033] 26. A method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathicinflammatory myositis, systemic sclerosis or asthma, comprising: administering a therapeutically effective amount of the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 or the pharmaceutical composition of embodiment 22 to a subject,

[0034] 27. The method of any one of embodiments 23 to 26, wherein the subject is a human.

[0035] 28. Use of a therapeutically effective amount of the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 , or the pharmaceutical composition of embodiment 22 for treating a subject having cancer, or suspected to having cancer, or at risk of developing cancer, or in the manufacture of a medicament for treating a subject having cancer, or suspected to having cancer, or at risk of developing cancer .

[0036] 29. The use of embodiment 28, wherein said cancer is CD19-positive B-cell leukemia or CD19-positive lymphoma;

[0037] 30. The use of embodiment 28, wherein the cancer is acute lymphocytic leukemia.

[0038] 31. Use of a therapeutically effective amount of the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 or the pharmaceutical composition of embodiment 22 for treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, or in the manufacture of a medicament for treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, or in the manufacture of a medicament.

[0039] 32. The use of any one of embodiments 28 to 29, wherein the subject is a human.

[0040] 33. An isolated nucleic acid of any one of embodiments 1 to 13, the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 or the pharmaceutical composition of embodiment 22 for use in treating a subject having cancer.

[0041] 34. The isolated nucleic acid of any one of embodiments 1 to 13, the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 or the pharmaceutical composition of embodiment 22 for use in reducing T-cell exhaustion and / or cytokine release storm in a subject.

[0042] 35. The isolated nucleic acid of any one of embodiments 1 to 13, the host cell of any one of embodiments 18 to 20, the engineered immune cell of embodiment 21 or the pharmaceutical composition of embodiment 22 for use according to embodiment 27, wherein the cytokine release storm comprises at least TNF-a or IL-2.

[0043] 36. A kit comprising the isolated nucleic acid of any one of embodiments 1 to13, and a container, and optionally instructions for the use thereof.

[0044] 37. A kit comprising the engineered immune cell of embodiment 21 , and a container, and optionally instructions for the use thereof.

[0045] 38. A kit comprising the pharmaceutical composition of embodiment 22, and a container, and optionally instructions for the use thereof.BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.

[0047] Fig. 1 depicts reducing anti-CD19 CAR expression mitigates unwanted inflammatory cytokine production without compromising tumour killing, a.) Ten different plasmid vectors encoding an anti-CD19 chimeric antigen receptor coupled to a distinct microRNA target site variant were transfected into HEK 293 T cells and CAR expression was quantified by flow cytometry, b.) HEK 293T cells were transduced with lentiviral particles comprising a subset of the constructs from (a), c.) Primary human T cells were transduced with the indicated anti-CD19 CAR vectors and co-cultured with tumour cells expressing CD19. Interferon gamma (IFNy) and TNF alpha (TNFa) production were quantified by intracellular flow cytometry. (d,e) Tumour cell killing were quantified by flow cytometry after 24 hour co-culture with the indicated anti-CD19 CAR T vectors.

[0048] Fig. 2 depicts a.) lentiviral vector controlled by a bidirectional human phosphoglycerate kinase (hPGK) promoter. On the right-hand side, the CD19-CAR sequence is transcribed with a corresponding miRNA silencing-mediated fine-tuner (miSFIT). On the left-hand side, the truncated nerve growth factor receptor (tNGFR) is transcribed as a transduction marker. Dashed boxes represent the seed region for miR-17. Bolded nucleotide refers to the mismatch substitution with respect to the fully complementary sequence to miR- 17 (1x Perfect), b.) CAR expression levels quantified as median fluorescence intensity (MFI) on primary T cells after transduction with one of seven CAR-miSFIT lentiviral vectors, c.) MNDU3-CD19.CAR lentiviral vector controlled by a MNDLI3 promoter, which transcribes theCD19 CAR, porcine teschovirus-1 2A peptide (P2A) and tNGFR in one continuous mRNA. During translation, P2A causes a ribosomal skipping event that allows for cleavage and separation of CD19 CAR protein and tNGFR protein to be expressed independently. CAR expression levels were quantified as median fluorescence intensity (MFI) on primary T cells after transduction with MNDU3-CD19.CAR lentiviral vector versus one of seven hPGK- CD19.CAR-miSFIT lentiviral vectors.

[0049] Fig. 3 depicts a.) co-culture of CD19.CAR-miSFIT-T cells and NALM-6 B-cell acute lymphocytic leukemia (B-ALL) tumour cells. All co-cultures were performed at a 1 :5 ratio of T cells to NALM-6 cells, b.) NALM-6 B-cell acute lymphocytic leukemia (B-ALL) cell lysis following co-culture with CAR T cells, c.) quantification of PD-1 (left) and LAG-3 (right) expression as a function of CAR expression levels. Quantification of exhaustion markers PD- 1 and LAG-3 on each CAR T cell variant following co-cultures with NALM-6 tumour cells.

[0050] Fig. 4 depicts a.) preclinical B-cell acute lymphocytic leukemia (B-ALL) xenograft mouse model, b.) bioluminescent imaging quantification of tumour growth over time. Dotted lines correspond to biological replicates, solid lines indicate group average, c.) a Kaplan-Meier survival curves of mice.

[0051] Fig. 5 depicts a.) tripartite co-culture of CD19.CAR-miSFIT-T cells, NALM-6 B- cell acute lymphocytic leukemia (B-ALL) tumour cells and human primary monocytes. All cocultures were performed at a 1 :5:1 ratio of T cells to NALM-6 cells to monocytes, b.) quantification of primary wave pro-inflammatory cytokines TNFa (top-left), IL-2 (top-right), and GM-CSF (bottom) secreted by each CD19.CAR-miSFIT T cell variant co-cultured with B- ALL tumour cells and human primary monocytes after 48 hours. All co-cultures were performed at a 1 :5:1 ratio of T cells to tumour cells to monocytes. Dashed lines indicate the 95% confidence interval for the regression line (solid line). All data are means ± s.d. R2refers to the goodness of model fit.DETAILED DESCRIPTION

[0052] Generally, the present disclosure provides a method and system for fine- tuning of CAR expression.

[0053] Rather than attempting to manage T cell dysfunction and excessive cytokine release once they have already begun, there is described herein fine-tune of CARexpression to an optimal level to prevent these critical issues while maintain efficient killing of cancer cells.

[0054] In one embodiment, there is provided an isolated nucleic acid, comprising:

[0055] a sequence encoding a chimeric antigen receptor (CAR), and

[0056] a target site for an endogenously expressed microRNA (miRNA) positioned downstream of said sequence encoding a CAR.

[0057] The terms “chimeric antigen receptor” or “CAR” as used herein refers to a recombinant polypeptide comprising at least an antigen-binding domain that is linked, via hinge and transmembrane domains, to an intracellular signalling domain.

[0058] An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. The term includes nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogues or analogues biologically synthesized by heterologous systems. A substantially pure molecule may include isolated forms of the molecule. Specifically, an “isolated” nucleic acid molecule encoding a CAR as described herein is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the environment in which it was produced.

[0059] The terms “nucleic acid”, “nucleic acid molecule”, polynucleotide”, refer to a single- or double-stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues or natural nucleotides, or mixtures thereof, and can include molecules comprising coding and non-coding sequences of a gene, sense and antisense sequences and complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments.

[0060] The term “target site”, as used herein, refers to a target base sequence that binds a microRNA.

[0061] The term “microRNA” (miRNA) refers to a RNA, and functions to induce RNA interference that suppresses gene expression in the post-transcriptional stage of the target gene. The microRNA recognizes hundreds of target mRNAs through the base sequence of the seed region located mainly at the 5-end, followed by base arrangement, and suppressing their expression to regulate biological functions.

[0062] The term “variant" refers to any sequence having one or more alterations in comparison to a reference sequence.

[0063] The term “vector” refers to a substance that is used to carry or include a nucleic acid sequence, including for example, a nucleic acid sequence encoding a CAR, in order to introduce a nucleic acid sequence into a host cell.

[0064] As used herein, the terms “encode”, “encoding” and the like refer to the capacity of a nucleic acid molecule to provide for another nucleic acid or a polypeptide.

[0065] In some examples, the vector may comprises a viral vector derived from a virus selected from a lentivirus, an adenovirus type 2 and an adenovirus type 5, a retrovirus, an adeno-associated virus (AAV), a simian virus 40 (SV-40), vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), or herpes simplex virus (HSV). In a specific example, the vector is derived from a lentivirus.

[0066] The term “host” as used herein refers to an animal, such as a mammal (e.g., a human).

[0067] An “antigen” refers to any molecule that provokes an immune response or is capable of being bound by an antibody or an antigen binding molecule. The immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.

[0068] In one example, wherein the CAR comprises a transmembrane domain, preferably CD3 zeta chains, a CD28 and / or 4-1 BB costimulatory domain, and a CD3 zeta signaling domain.

[0069] In certain embodiments, an antigen is associated with a cell, for example, is present on or in a cell.

[0070] In certain embodiments, an engineered immune cell provided herein is an NK cell, an NKT cell, or a T cell.

[0071] In one example, the T cells are obtained from a donor subject. In other embodiment, the donor subject is human patient afflicted with a cancer or a tumor. Inadditional embodiment, the donor subject is a human patient not afflicted with a cancer or a tumour.

[0072] As used herein, the term “in vitro cell” refers to any cell which is cultured ex vivo. In one embodiment, an in vitro cell includes a T cell.

[0073] The term "cell" as used herein refers to an individual cell, cell line, cell culture or population of cells that comprise the nucleic acid molecule or vectors described herein, or that is capable of expressing the fusion protein described herein.

[0074] The term "population of cells" may refer to homogenous cell populations comprising cells that each comprise the nucleic acid molecule or vectors described herein, or that is capable of expressing the fusion protein described herein, or heterogeneous cell populations that may comprise progeny of a single parental cell.

[0075] In certain embodiments, the CARs provided herein can enhance the killing activities of the engineered immune cells.

[0076] The terms “binds” or “binding” refer to an interaction between molecules including, for example, to form a complex. Interactions can be, for example, non-covalent interactions including hydrogen bonds, ionic bonds, hydrophobic interactions, and / or van der Waals interactions

[0077] The term “pharmaceutically acceptable” when used in reference to a carrier, is intended to mean that the carrier, diluent or excipient is not toxic or otherwise undesirable, (i.e., the material may be administered to a subject without causing any undesirable biological effects), and it is compatible with the other ingredients of the formulation. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as saline solutions. A saline solution can be a carrier when the pharmaceutical composition is administered intravenously. Saline solutions

[0078] 78tugand aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

[0079] Excipients may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is an exemplary excipient when a composition (e.g., a pharmaceutical composition) is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid excipients, particularly forinjectable solutions. An excipient can also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. Compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations, and the like. Oral compositions, including formulations, can include standard excipients such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.

[0080] In one example, the pharmaceutical composition may further comprises one or more immune adjuvants.

[0081] In one aspect, there is provided a method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a cancer, comprising: administering a therapeutically effective amount immune cell of embodiment 10 or a therapeutically effective amount of a pharmaceutical composition of embodiment 11.

[0082] The term “therapeutically effective” or “pharmaceutically effective” amount or number of a subject construct, nucleic acid, cell, or composition generally refers to an amount or number sufficient for a construct, nucleic acid, cell, or composition to accomplish a stated purpose relative to the absence of the composition. For example, to provide a therapeutic benefit in the treatment or management of the cancer, or to delay or minimize one or more symptoms associated with the cancer. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapeutic agents, which provides a therapeutic benefit in the treatment or management of the cancer.

[0083] The terms “subject” and “patient” may be used interchangeably.

[0084] As used herein, a subject is a mammal, such as a non-primate or a primate (e.g. , human).

[0085] In specific embodiments, the subject is a human.

[0086] In one example, the subject is a human, diagnosed with a disease or disorder.

[0087] In another example, the subject is a human, at risk of developing a disease or disorder.

[0088] In one example, the subject is a human, suspected of having a disease or disorder.

[0089] In one example, the disease or disorder is a cancer.

[0090] The term “cancer” refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. A “cancer” or “cancer tissue” may include a tumor at various stages.

[0091] In oner example, the cancer is CD19-positive B-cell leukemia or CD19- positive lymphoma

[0092] In one aspect, there is provided a method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, comprising: administering a therapeutically effective amount of an immune cell of embodiment 10 or a therapeutically effective amount of a pharmaceutical composition of embodiment 11, preferably the subject is a human.

[0093] The term “immune cell” includes, and is not limited to, macrophages (e.g., tumor associated macrophages) neutrophils, basophils, eosinophils, granulocytes, natural killer cells (NK cells), B cells, T cells, NK-T cells, mast cells, tumor infiltrating lymphocytes (TILs), myeloid derived suppressor cells (MDSCs), and dendritic cells. The term also includes precursors of these immune cells.

[0094] The term “engineered” refers to a method of modifying the genome of a cell, including, but not being limited to, deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof. In one embodiment, the cell that is modified is a lymphocyte, e.g., a T cell, which may either be obtained from a patient or a donor. The cell may be modified to express an exogenous construct, such as, e.g., a chimeric antigen receptor (CAR), which is incorporated into the cell's genome.

[0095] The term “chimeric antigen receptor” (CAR) refers to genetically engineered receptor(s), which may be expressed by immune cells, including T cells. With a CAR, a single receptor may be programmed to both recognize a specific antigen and, when bound to that antigen, activate the immune cell to attack and destroy the cell bearing or expressing that antigen. When these antigens exist on tumor cells, an immune cell that expresses the CAR may target and kill the tumor cell.

[0096] In one example, the cell that is prepared according to the present application is a cell having a chimeric antigen receptor (CAR), comprising an antigen binding molecule, acostimulatory domain, and an activating domain. The costimulatory domain may comprise an extracellular domain, a transmembrane domain, and an intracellular domain. In one embodiment, the extracellular domain comprises a hinge or a truncated hinge domain.

[0097] In one example, the antigen binding molecule is an antigen associated with the disease or disorder.

[0098] In a specific example, the antigen associated with the disease or disorder is a tumour associated cell surface antigen.

[0099] In one example, the tumour associated cell surface antigen is CD- 19.

[0100] Patients with B-cell malignancies bearing high levels of circulating CD19- expressing tumor cells represent a population with unmet need. In some examples, CD-19 is associated with CD19-positive B-cell leukemia or CD19-positive lymphoma.

[0101] An anti-CD19 CAR T-cell therapy or product used in CD19 CAR-T may be manufactured from the patient's own T cells, via leukapheresis suitable for B-cell malignancies with circulating tumor cell burden to minimize the CD19-expressing tumor cells in the final product

[0102] The term “administering” or “administration” refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other method of physical delivery described herein or known in the art.

[0103] As used herein, the terms “treat,” “treatment” and “treating” refer to the reduction or amelioration of the progression, severity, and / or duration of a disease or condition resulting from the administration of one or more therapies. Treating may be determined by assessing whether there has been a decrease, alleviation and / or mitigation of one or more symptoms associated with the underlying disorder such that an improvement is observed with the patient, despite that the patient may still be afflicted with the underlying disorder. The term “treating” includes both managing and ameliorating the disease. The terms “manage,” “managing,” and “management” refer to the beneficial effects that a subject derives from a therapy which does not necessarily result in a cure of the disease.

[0104] The terms “prevent,” “preventing,” and “prevention” refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptom(s) (e.g., a cancer).

[0105] The term “T cell exhaustion” refers to a state of hypo-responsiveness induced in effector T cell populations after chronic exposure to antigen.

[0106] The terms “CRISPR” (clustered regularly interspaced short palindromic repeats), “Cas” (CRISPR-associated protein) “CRISPR-Cas” and “CRISPR system” refer to the genome editing tool derived from prokaryotic organisms and comprising a nucleic acid guide molecule and a sequence-specific nucleic acid-guided endonuclease capable of cleaving a target nucleic acid strand at a site complementary to a sequence in the nucleic acid guide.

[0107] The term “optionally” is used herein to mean that the subsequent described feature may or may not be present or that the subsequently described event or circumstance may or may not occur.

[0108] EXAMPLES

[0109] Example

[0110] Chimeric Antigen Receptor (CAR) T therapy has revolutionized the immunotherapy landscape, especially for leukemia and lymphoma. CARs are engineered fusion proteins comprised of an extracellular ligand binding domain that recognize cancer antigens, linked to an intracellular activation domain that licenses the T cell for cancer-killing. The majority of patients treated with CAR T achieved complete remission and have been living disease-free for years. To date, it is believed six CAR T products have been FDA- approved. Despite its clinical success, suboptimal durability and safety continue to delimit the advancement of CAR T as first-line treatment for cancers. Such limitations lie in the overly high levels of CAR expression on the transduced T cells, resulting in two major challenges: T cell exhaustion rendering them dysfunctional, and excessive inflammation resulting in immunopathology such as cytokine release syndrome.

[0111] Methods: Utilizing the microRNA silencing-mediated fine-tuners (miSFIT) technology, a library of lentiviruses was created that enabled precise, stepwise control of CD19 CAR transgene expression in human T cells. miSFITs are engineered target sites that recruit endogenous microRNA, thereby controlling the expression of a gene of interest. We tested the functionality of these CAR T cells in vitro against NALM-6 cells, a CD19-positive B-cell acute lymphocytic leukemia cell line. After 48-72 hours of co-culture, we quantified tumour cell killing, and performed immunophenotyping for T cell activation, cytokine production, memory subtypes, and exhaustion markers by flow cytometry.

[0112] Results: In vitro co-culture assays show that reducing the expression of CD19 CAR does not hamper tumour-killing capacity. However, after successive rounds of re- challenging- by replenishing the NALM-6 target cells- we observe notable differentialdynamics of T cell activation, inflammatory cytokine production, and exhaustion phenotypes when we modulated expression levels of the CD19 CAR in T cells.

[0113] Conclusion: We demonstrate that it is feasible to precisely control CD19 CAR expression levels in human T cells using miSFIT technology. These CD19 CAR-miSFIT T cells display effective anti-tumour properties but differing T-cell fate specifications.

[0114] Example 2

[0115] Chimeric Antigen Receptor (CAR) T cell therapy has transformed the cellular immunotherapy landscape, especially for leukemia and lymphoma1. CARs are engineered fusion proteins comprised of an extracellular single chain variable fragment (scFv) that recognizes cancer antigens linked to an intracellular T cell activation domain, CD3 , that licenses the T cell for cancer-killing1 2. Second-generation CARs additionally contain a costimulatory domain, e.g., CD28 or 4-1 BB, that is proven to augment T cell activation and cytotoxic activity in vitro and, more importantly, persistence and tumour clearance in vivo1 2. The CAR bypasses the need for epitope processing and presentation on the major histocompatibility complex (MHC) as it can directly bind to surface antigens in their native state, resulting in a more rapid and efficient T cell response3. Over 50% of patients administered with CAR T cell therapy achieved complete remission; many have been living disease-free for years4. Due to their promising efficacy, the FDA has now authorized seven CAR T cell products. Despite its revolutionary success, suboptimal durability and safety profiles continue to delimit the advancement of CAR T cell therapies as a first-line cancer treatment1’4 5. The limitations lie in the overly high levels of surface CAR expression on the transduced T cells, directly giving rise to two major challenges: T cell exhaustion4 6and cytokine release syndrome (CRS)4’5’1. T cell exhaustion is defined by the loss of effector function8 9and is characterized by upregulated co-expression of inhibitory receptors10. This results in a global dysfunctional T cell state10. Studies show that the excessively high expression of CAR causes tonic signalling resulting in chronic activation, thus, accelerating exhaustion11-13. Concomitantly, patients classified as non-responders to CAR T cell therapy were shown to have exhausted T cells14 15. Similarly, supraphysiological CAR expression results in rapid activation and cytokine production of CAR T cells13’16’18. Upon encounter with these cytokines, bystander immune cells such as monocytes respond and secrete their own pro-inflammatory factors, e.g., IL-1 and IL-6, ultimately resulting in an acute and dramatic cytokine storm, clinically diagnosed as CRS7’18’19. It is now known that virtually all patientstreated with CAR T cell therapy experienced some degree of CRS, thus increasing the length of hospitalization for in-patient care which further burdens the healthcare system, at large20’21. Moreover, despite advancements in CRS management such as the use of tocilizumab (an IL-6 receptor inhibitor)20, the need for additional medications and in-patient care further contributes to the inaccessibility of CAR T cell therapies.

[0116] Described herein is the use of levels of CAR expression using a gene regulation technology called microRNA silencing-mediated fine-tuners (miSFIT) technology22. miSFITs are engineered target sites that recruit endogenous microRNA, thereby controlling the expression of a gene of interest. Such technology allows for a high-resolution control on gene expression by ~1 % of any desired level, instead of conventional all-or-nothing genetic modification strategies22.

[0117] Tuning CAR expression is feasible using the miSFIT technology

[0118] Described is a panel of seven lentiviral vectors, each encoding a different miR-17 target site variant downstream of the CAR (Fig. 2a). miR-17 was chosen due to its verified broad expression in mammalian cells, including T cells22 23. When compared to the control, scrambled miR-17 target site (Scramble), placing 3 copies of the miR-17 target site (3x Perfect) confers a 5.1-fold reduction in CD19 CAR expression, as achieved in 3 different T cell donors (Fig. 2b). Moreover, when compared to a clinically relevant CAR expression vector, which uses a MNDLI3 promoter24, switching the promoter to hPGK imparts at least a 60-fold reduction in CD19 CAR expression (Fig. 2c). Intermediate CD19 CAR expression levels are achieved by placing 1 and 2 copies of the miR-17 target site (1x Perfect and 2x Perfect, respectively), and target sites with mono- (e.g., 18-G) or di-nucleotide (e.g., 2-A.17-T and 17-A.18-G) base substitutions. We achieved a high-resolution, stepwise post- transcriptional control of CAR expression in human primary T cells, demonstrating that it is feasible to control CAR expression using the miSFIT technology.

[0119] Tuning CAR expression mitigates T cell exhaustion during anti-tumour response in vitro

[0120] To test the impact of tuned CAR expression levels on the degree of activation, we utilized in vitro tumour co-culture assays with serial re-challenging, where NALM-6 cells are replenished every 48 hours for a total of 3 challenges (Fig. 3a). Potent T cell cytotoxicity against tumour cells was preserved across the CD19.CAR-miSFIT T cell variants after the first challenge. However, after successive encounters, only the CD19.CAR-miSFIT T cell variants with the intermediate CAR expression levels were able to maintain durable (>80%)tumour killing (Fig. 3b). To examine T cell dysfunction after repeated encounters with NALM- 6 tumours, canonical T cell exhaustion markers, programmed cell death protein 1 (PD-1) and lymphocyte activation gene protein 3 (LAG-3), were quantified using the same co-culture assay via flow cytometry. CAR expression is correlated with T cell exhaustion in a dosedependent manner (Fig. 3c). Indeed, this demonstrated that there is a window of CAR expression level where anti-tumour T cell function is most optimal and underscores that the highest and lowest CAR expressions are inferior to the CAR T cell products with intermediate CAR expression levels. These preliminary results suggest that tuning CAR expression levels effectively delays T-cell dysfunction while maintaining effective tumour control in vitro.

[0121] Tuned CAR expression is superior at controlling B-ALL in vivo

[0122] We employed an established B-ALL xenograft model using NOD / SCID / IL- 2Rynul1(NSG) immunodeficient mice. We intravenously (i.v.) injected luciferase-tagged, green fluorescent protein (GFP)+NALM-6 tumours. After 4 days of engraftment, CAR-miSFIT T cells were then i.v. injected. Uniform tumour burdens across all mice were confirmed by non- invasive bioluminescence imaging (BLI) using an Ami HT optical imaging system (Spectral Instruments) before treatment (Fig. 4a). Tumour clearance was tracked weekly by BLI. We showed that the intermediate CAR T cell product, CD19.CAR-miSFIT-2A-17T, outperformed the low and high CAR T cell products, resulting in effective remission of B-ALL in tumourbearing mice (Fig. 4b-c).

[0123] Tuned CAR expression dampens cytokine production in vitro

[0124] In CRS, I L-1+1 L-6+monocytes respond to cytokines secreted by CAR T cells during their anti-tumour response16’18’19. Upon encounter with cognate antigen, CAR T cells elicit the primary wave of pro-inflammatory cytokines, including interleukin (I L)-2, interferon (IFN)-y, tumour necrosis factor (TNF)-a and granulocyte-macrophage colony-stimulating factor (GM-CSF)25. In response, bystander immune cells like monocytes and macrophages respond and induce a secondary wave of cytokines, including IL-1 and IL-618’19’26. To assess the influence of CAR expression levels on both primary and secondary inflammation, we used a tripartite co-culture assay with NALM-6 cells, CD19. CAR-miSFIT T cells and monocytes, thus, more accurately modelling CRS in vitro (Fig. 5a). This analysis showed that the amount of primary inflammatory cytokines secreted is directly correlated with CAR expression in a dose-dependent manner (Fig. 5b).

[0125]

[0126] Materials and Methods:MiRNA silencing-mediated fine-tuner (miSFIT) sequences miSFIT SequenceScramble CGCGCTTCCGCGGCCCGTTCAAG (SEQ ID NO: 1)17-A,18-G CTACCTGCACTGTAAGAGCTTTG (SEQ ID NO: 2)2-A,17-T CAACCTGCACTGTAAGTACTTTG (SEQ ID NO: 3)18G CTACCTGCACTGTAAGCGCTTTG (SEQ ID NO: 4) lx Perfect CTACCTGCACTGTAAGCACTTTG (SEQ ID NO: 5)2x Perfect CTACCTGCACTGTAAGCACTTTGTATCTACCTGCACTGTAAGCACTTTG (SEQ ID NO: 6) 3x Perfect CTACCTGCACTGTAAGCACTTTGTATCTACCTGCACTGTAAGCACTTTGTAT CTACCTGCACTGTAAGCACTTTG (SEQ ID NO: 7)

[0127] Promoter-CAR-miSFIT sequencesLegend:Bidirectional hPGK promoter (undelided)CD19-CAR (italics underline) miSFIT (bold)Bidirectional hPGK-CAR-miSFIT-Scramble sequence (SEP ID NO: 8)CTGGGGAGAGAGGTCGGTGATTCGGTCAACGAGGGAGCCGACTGCCGACGTGCGCTCCGGAGGCTTGCAGAATGCGGAACACCGCGCGGGCAGGAACAGGGCCCACACTACCGCCCCACACCCCGCCTCCCGCACCGCCCCTTCCCGGCCGCTGCTCTCGGCGCGCCCTGCTGAGCAGCCGCTATTGGCCACAGCCCATCGCGGTCGGCGCGCTGCCATTGCTCCCTGGCGCTGTCCGTCTGCGAGGGTACTAGTGAGACGTGCGGCTTCCGTTTGTCACGTCCGGCACGCCGCGAACCGCAAGGAACCTTCCCGACTTAGGGGCGGAGCAGGAAGCGTCGCCGGGGGGCCCACAAGGGTAGCGGCGAAGATCCGGGTGACGCTGCGAACGGACGTGAAGAATGTGCGAGACCCAGGGTCGGCGCCGCTGCGTTTCCCGGAACCACGCCCAGAGCAGCCGCGTCCCTGCGCAAACCCAGGGCTGCCTTGGAAAAGGCGCAACCCCAACCCCGTGGAATTCGATATCAAGCTTCTCGAGGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGG AGCTCCTGC AGGTGCC ACCA TGCTTCTCCTGGTGA CAA GCCTTCTGCTCTGTGA GTTACCACACCCAGCATTCCTCCTGATCCCAGACATCCAGATGACACAGACTACATCCTCCCTG TCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAA A TA TTTAAA TTGGTA TCA GCA GAAA CCA GA TGGAA CTG TTAAA CTCCTGA TCTA CCA TA CA TCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTAT TCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGT AA TA CGCTTCCGTA CA CGTTCGGA GGGGGGA CTAAGTTGGAAA TAA CA GGCTCCA CCTC TGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCAG GAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTC AGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTC TGGA GTGGCTGGGAGTAA TA TGGGGTA GTGAAA CCA CA TA CT A TAA TTCA GCTCTCAAA T CCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTC TGCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTA TGCTA TGGA CT A CTGGGGTCAA GGAA CCTCA GTCA CCGTCTCCTCA GCGGCCGCAA TTG AAGTTA TGTA TCCTCCTCCTTA CCTA GA CGCCA GCAA TGA GAA GA GCAA TGGAA CCA TTA TCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTT TTGGGTGCTGGTGGTGGTTGGGGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGG CCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGA ACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCA CGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGC GTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGT ACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAG GAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCT ACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTA CCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGC CCCCTCGCTAAGGGGTAGCACGTGAGTGCTAGCCGCGCTTCCGCGGCCCGTTCAAGA CCGGT

[0128] Bidirectional hPGK-CAR-miSFIT-2A-17T sequence (SEP ID NO: 9)CTGGGGAGAGAGGTCGGTGATTCGGTCAACGAGGGAGCCGACTGCCGACGTGC GCTCCGGAGGCTTGCAGAATGCGGAACACCGCGCGGGCAGGAACAGGGCCCACACTAC CGCCCCACACCCCGCCTCCCGCACCGCCCCTTCCCGGCCGCTGCTCTCGGCGCGCCCTG CTGAGCAGCCGCTATTGGCCACAGCCCATCGCGGTCGGCGCGCTGCCATTGCTCCCTGG CGCTGTCCGTCTGCGAGGGTACTAGTGAGACGTGCGGCTTCCGTTTGTCACGTCCGGCA CGCCGCGAACCGCAAGGAACCTTCCCGACTTAGGGGCGGAGCAGGAAGCGTCGCCGGG GGGCCCACAAGGGTAGCGGCGAAGATCCGGGTGACGCTGCGAACGGACGTGAAGAATGTGCGAGACCCAGGGTCGGCGCCGCTGCGTTTCCCGGAACCACGCCCAGAGCAGCCGCG TCCCTGCGCAAACCCAGGGCTGCCTTGGAAAAGGCGCAACCCCAACCCCGTGGAATTCG ATATCAAGCTTCTCGAGGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGT TTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGA CACCGGAGCTCCTGCAGGTGCCACCATGC7TCTCCTGGTGACAAGCC7TCTGCTCTGTGA GTTACCACACCCAGCATTCCTCCTGATCCCAGACATCCAGATGACACAGACTACATCCTC CCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTA GTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAG A TTA TTCTCTCACCA TTAGCAACCTGGAGCAAGAAGA TA TTGCCACTTACTTTTGCCAACA GGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCA CCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACT GCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTG TCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAG GGTCTGGA GTGGCTGGGA GTAA TA TGGGGTA GTGAAA CCA CA TA CT A TAA TTCA GCTCTC AAA TCCA GA CTGA CCA TCA TCAA GGA CAA CTCCAA GA GCCAA GTTTTCTTAAAAA TGAA C A GTCTGCAAA CTGA TGA CA CA GCCA TTTA CT A CTGTGCCAAA CA TTA TTA CT A CGGTGGTA GCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCGGCCGCA A TTGAAGTTA TGTA TCCTCCTCCTTA CCTA GA CGCCA GCAA TGA GAA GA GCAA TGGAA CC A TTA TCCA TGTGAAA GGGAAA CA CCTTTGTCCAAGTCCCCTA TTTCCCGGA CCTTCTAA GC CCTTTTGGGTGCTGGTGGTGGTTGGGGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACA GTGGCCTTTA TTA TTTTCTGGGTGA GGA GTAA GA GGA GCA GGCTCCTGCA CAGTGA CT A CA TGAA CA TGA CTCCCCGCCGCCCCGGGCCCA CCCGCAA GCA TTA CCA GCCCTA TGCCC CACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCC CCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGA GGAGTA CGA TGTTTTGGA CAA GA GA CGTGGCCGGGA CCCTGA GA TGGGGGGAAA GCCG A GAA GGAA GAA CCCTCA GGAA GGCCTGTA CAA TGAA CTGCA GAAA GA TAA GA TGGCGGA GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGG CCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGG CCCTGCCCCCTCGCTAAGGGGTAGCACGTGAGTGCTAGCCAACCTGCACTGTAAGTAC TTTGACCGGT

[0129] Bidirectional hPGK-CAR-miSFIT-1x-Perfect sequence (SEP ID NO: 10)CTGGGGAGAGAGGTCGGTGATTCGGTCAACGAGGGAGCCGACTGCCGACGTGC GCTCCGGAGGCTTGCAGAATGCGGAACACCGCGCGGGCAGGAACAGGGCCCACACTACCGCCCCACACCCCGCCTCCCGCACCGCCCCTTCCCGGCCGCTGCTCTCGGCGCGCCCTG CTGAGCAGCCGCTATTGGCCACAGCCCATCGCGGTCGGCGCGCTGCCATTGCTCCCTGG CGCTGTCCGTCTGCGAGGGTACTAGTGAGACGTGCGGCTTCCGTTTGTCACGTCCGGCA CGCCGCGAACCGCAAGGAACCTTCCCGACTTAGGGGCGGAGCAGGAAGCGTCGCCGGG GGGCCCACAAGGGTAGCGGCGAAGATCCGGGTGACGCTGCGAACGGACGTGAAGAATG TGCGAGACCCAGGGTCGGCGCCGCTGCGTTTCCCGGAACCACGCCCAGAGCAGCCGCG TCCCTGCGCAAACCCAGGGCTGCCTTGGAAAAGGCGCAACCCCAACCCCGTGGAATTCG ATATCAAGCTTCTCGAGGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGT TTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGA CACCGGAGCTCCTGCAGGTGCCACCATGC7TCTCCTGGTGACAAGCC7TCTGCTCTGTGA GTTACCACACCCAGCATTCCTCCTGATCCCAGACATCCAGATGACACAGACTACATCCTC CCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTA GTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCA TACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAG A TTA TTCTCTCACCA TTAGCAACCTGGAGCAAGAAGA TA TTGCCACTTACTTTTGCCAACA GGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCA CCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTG TCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAG GGTCTGGA GTGGCTGGGA GTAA TA TGGGGTA GTGAAA CCA CA TA CT A TAA TTCA GCTCTC AAA TCCA GA CTGA CCA TCA TCAA GGA CAA CTCCAA GA GCCAA GTTTTCTTAAAAA TGAA C A GTCTGCAAA CTGA TGA CA CA GCCA TTTA CT A CTGTGCCAAA CA TTA TTA CT A CGGTGGTA GCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCGGCCGCA A TTGAAGTTA TGTA TCCTCCTCCTTA CCTA GA CGCCA GCAA TGA GAA GA GCAA TGGAA CC A TTA TCCA TGTGAAA GGGAAA CA CCTTTGTCCAAGTCCCCTA TTTCCCGGA CCTTCTAA GC CCTTTTGGGTGCTGGTGGTGGTTGGGGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACA GTGGCCTTTA TTA TTTTCTGGGTGA GGA GTAA GA GGA GCA GGCTCCTGCA CAGTGA CT A CA TGAA CA TGA CTCCCCGCCGCCCCGGGCCCA CCCGCAA GCA TTA CCA GCCCTA TGCCC CACCACGCGACTTCGCAGCCTATCGCTCCAGAGTGAAGTTCAGCAGGAGCGCAGACGCC CCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGA GGAGTA CGA TGTTTTGGA CAA GA GA CGTGGCCGGGA CCCTGA GA TGGGGGGAAA GCCG A GAA GGAA GAA CCCTCA GGAA GGCCTGTA CAA TGAA CTGCA GAAA GA TAA GA TGGCGGA GGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGGGGTAGCACGTGAGTGCTAGCCTACCTGCACTGTAAGCAC TTTGACCGGT

[0130] CAR T cell production'. T cells were isolated from PBMC (STEMCELL Technologies, British Columbia, Canada) using the human Pan T Cell Isolation kit (Miltenyi Biotec, North Rhine-Westphalia, Germany), and activated using Dynabeads™ Human T- Activator CD3 / CD28 beads (Gibco; Thermo Fisher Scientific, Inc., Massachusetts, USA) or human T cell TransAct™ (Miltenyi Biotec, North Rhine-Westphalia, Germany) in Roswell Park Memorial Institute 1640 Medium (RPMI; Gibco; Thermo Fisher Scientific, Inc., Massachusetts, USA) modified with L-glutamine and supplemented with 10% FBS, 25 mM HEPES, 100 U / ml penicillin and 100 pg / ml streptomycin (hereinafter, referred to as TCM). TCM was supplemented with fresh 50 pM 2-mercaptoethanol and 50 U / ml IL-2 upon use. After 48 hours, CD19 CAR lentivirus was added. After another 48 hours, media was refreshed with TCM supplemented with 50 pM 2-ME and 50 U / ml IL-2, and cells were maintained at a density of 1 x 106cells / ml. After 5 days post-transduction, lentivirus and activation reagent were removed, then transduction was quantified by flow cytometry using a monoclonal antibody specific for human CD271 BV421 (clone C40-1457; catalog 560834, Biolegend, California, USA) or PerCP-Cy5.5 (clone HIB19; catalog 306740, Biolegend). CD19 CAR expression levels were quantified using an idiotype monoclonal antibody for the CAR’s single-chain variable fragment (scFv) clone FMC63 PE (clone REA1297; catalog 130127342, Miltenyi Biotec) or Vio Bright B515 (clone REA1297; catalog 130127344, Miltenyi Biotec).

[0131] In vitro cytotoxicity assay. The cytotoxicity of CAR T cells was determined by flow cytometry. In brief, NALM-6 cells, permanently labelled using CellTrace™ Violet (Invitrogen; Thermo Fisher Scientific, Inc., Massachusetts, USA), served as target cells. The effector (E) and target (T) cells were co-cultured in triplicates at a 1 :5 (E:T) ratio in roundbottom 96-well plates. Co-cultures were performed in RPMI modified with L-glutamine and supplemented with 10% FBS, 100 U / ml penicillin and 100 pg / ml streptomycin. After 48 hours, wells were sampled for flow cytometry quantification of remaining live target cells and immunophenotyping of effector cells. To re-challenge the effector cells, wells were replenished with the same amount of labelled target cells and co-cultured for another 48 hours; this was repeated for a total of 3 challenges. After every 48 hours, flow cytometry readouts of surviving target cells and immunophenotyping of effector cells were performed. The percentage of specific lysis of target cells were calculated as follows:> / surviving target cells in experimental wells \ Specific lysis (%)= ( 1- - — - - — : - : - — ) x 100%\ mean surviving target cells in target only wells /

[0132] Multiparametric flow cytometry: Samples obtained for immunophenotyping were stained with Zombie Aqua™ (catalog 423101, Biolegend) and monoclonal antibodies specific for human CD4 BB515 (clone SK3; catalog 566912, BD, New Jersey, USA), CD8a PE (clone SK1; catalog 344706, Biolegend), CD279 (PD-1) FITC (clone EH12.2H7; catalog 329904, Biolegend), and CD223 (LAG-3) APC-Fire 810 (clone 11C3C65; catalog 369350, Biolegend). Samples were analyzed using a Cytek® Aurora.

[0133] In vitro cytokine release syndrome assay: The crosstalk of CAR T cells and monocytes was determined by flow cytometry. In brief, monocytes were isolated from PBMC (STEMCELL Technologies, British Columbia, Canada) using the human Pan Monocyte Isolation kit (Miltenyi Biotec, North Rhine-Westphalia, Germany). Similar to the in vitro cytotoxicity assay, effector and target cells were co-cultured in triplicates at a 1:5 (E:T) ratio in round-bottom 96-well plates. Tripartite co-cultures were performed in RPMI modified with L-glutamine and supplemented with 10% FBS, 100 U / ml penicillin and 100 pg / ml streptomycin. Each co-culture was supplemented with monocytes to a final ratio of 1:5:1 (E:T:monocytes). After 48 hours, the supernatant was harvested from each well and assayed using LEGENDplex™ (Biolegend, California, USA) to quantify TNFa, IL-2, and GM-CSF.

[0134] Mouse xenograft model: We used 8- to 12-week-old N OD / SC I D / IL-2 Ry- null (NSG) female mice under a protocol approved by the University of Manitoba Animal Care Committee. Mice were inoculated with 0.5 x 106FFLuc+GFP+ NALM-6 cells by tail vein injection, followed by 1 x 106(untransduced or CAR) T cells injected four days later. NALM-6 produced even tumour burdens across all mice. Tumour burden was assessed by bioluminescence imaging using the Ami HT imaging system (Spectral Instruments Imaging, Arizona, USA). In brief, 10 minutes prior to imaging, mice were intraperitoneally injected with 150 mg / kg D-luciferin (Xenogen, California, USA) in PBS. Subsequently, the mice were induced using 2% isoflurane and positioned within the imaging chamber under anesthesia.

[0135] In the preceding description, for purposes of explanation, numerous details are set forth in order to provide a thorough understanding of the embodiments. However, it will be apparent to one skilled in the art that these specific details are not required. In other instances, well-known electrical structures and circuits are shown in block diagram form inorder not to obscure the understanding. For example, specific details are not provided as to whether the embodiments described herein are implemented as a software routine, hardware circuit, firmware, or a combination thereof.

[0136] Embodiments of the disclosure can be represented as a computer program product stored in a machine-readable medium (also referred to as a computer-readable medium, a processor-readable medium, or a computer usable medium having a computer- readable program code embodied therein). The machine-readable medium can be any suitable tangible, non-transitory medium, including magnetic, optical, or electrical storage medium including a diskette, compact disk read only memory (CD-ROM), memory device (volatile or non-volatile), or similar storage mechanism. The machine-readable medium can contain various sets of instructions, code sequences, configuration information, or other data, which, when executed, cause a processor to perform steps in a method according to an embodiment of the disclosure. Those of ordinary skill in the art will appreciate that other instructions and operations necessary to implement the described implementations can also be stored on the machine-readable medium. The instructions stored on the machine- readable medium can be executed by a processor or other suitable processing device, and can interface with circuitry to perform the described tasks.

[0137] The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.

[0138] References:(1) June, C. H.; Sadelain, M. Chimeric Antigen Receptor Therapy. / V Engl J Med 2018, 379(1), 64-73. DOI: 10.1056 / NEJMra1706169 From NLM Medline.(2) June, C. H.; O'Connor, R. S.; Kawalekar, O. II.; Ghassemi, S.; Milone, M. C. CAR T cell immunotherapy for human cancer. Science 2018, 359 (6382), 1361-1365. DOI: 10.1126 / science.aar6711 From NLM Medline.(3) Sadelain, M.; Riviere, I.; Riddell, S. Therapeutic T cell engineering. Nature 2017, 545 (7655), 423-431. DOI: 10.1038 / nature22395 From NLM Medline.(4) Cappell, K. M.; Kochenderfer, J. N. Long-term outcomes following CAR T cell therapy: what we know so far. Nat Rev Clin Oncol 2023, 20 (6), 359-371. DOI: 10.1038 / s41571-023- 00754-1 From NLM Medline.(5) Sterner, R. C.; Sterner, R. M. CAR-T cell therapy: current limitations and potential strategies. Blood Cancer J 2021 , 11 (4), 69. DOI: 10.1038 / s41408-021-00459-7 From NLM Medline.(6) Poorebrahim, M.; Melief, J.; Pico de Coana, Y.; S, L. W.; Cid-Arregui, A.; Kiessling, R. Counteracting CAR T cell dysfunction. Oncogene 2021, 40 (2), 421-435. DOI: 10.1038 / S41388-020-01501 -x From NLM Medline.(7) Shimabukuro-Vornhagen, A.; Godel, P.; Subklewe, M.; Stemmier, H. J.; Schlosser, H. A.; Schlaak, M.; Kochanek, M.; Boll, B.; von Bergwelt-Baildon, M. S. Cytokine release syndrome. J Immunother Cancer 2018, 6 (1), 56. DOI: 10.1186 / s40425-018-0343-9 From NLM Medline.(8) Gallimore, A.; Glithero, A.; Godkin, A.; Tissot, A. C.; Pluckthun, A.; Elliott, T.; Hengartner, H.; Zinkernagel, R. Induction and Exhaustion of Lymphocytic Choriomeningitis Virus-specific Cytotoxic T Lymphocytes Visualized Using Soluble Tetrameric Major Histocompatibility Complex Class l-Peptide Complexes. The Journal of Experimental Medicine 1998, 187 (9), 1383-1393. DOI: 10.1084 / jem.187.9.1383.(9) Zajac, A. J.; Blattman, J. N.; Murali-Krishna, K.; Sourdive, D. J. D.; Suresh, M.; Altman, J. D.; Ahmed, R. Viral Immune Evasion Due to Persistence of Activated T Cells Without Effector Function. The Journal of Experimental Medicine 1998, 188 (12), 2205-2213. DOI: 10.1084 / jem.188.12.2205.(10) Yi, J. S.; Cox, M. A.; Zajac, A. J. T-cell exhaustion: characteristics, causes and conversion. Immunology 2010, 729 (4), 474-481. DOI: 10.1111 / j.1365-2567.2010.03255.x From NLM Medline.(11) Calderon, H.; Mamonkin, M.; Guedan, S. Analysis of CAR-Mediated Tonic Signaling. Methods Mol Biol 2020, 2086, 223-236. DOI: 10.1007 / 978-1-0716-0146-4_17 From NLM Medline.(12) Gomes-Silva, D.; Mukherjee, M.; Srinivasan, M.; Krenciute, G.; Dakhova, O.; Zheng, Y.; Cabral, J. M. S.; Rooney, C. M.; Orange, J. S.; Brenner, M. K.; et al. Tonic 4-1 BB Costimulation in Chimeric Antigen Receptors Impedes T Cell Survival and Is Vector- Dependent. Cell Rep 2017, 21 (1), 17-26. DOI: 10.1016 / j.celrep.2017.09.015 From NLM Medline.(13) Long, A. H.; Haso, W. M.; Shern, J. F.; Wanhainen, K. M.; Murgai, M.; Ingaramo, M.; Smith, J. P.; Walker, A. J.; Kohler, M. E.; Venkateshwara, V. R.; et al. 4-1 BB costimulationameliorates T cell exhaustion induced by tonic signaling of chimeric antigen receptors. Nat Med 2015, 21 (6), 581-590. DOI: 10.1038 / nm.3838 From NLM Medline.(14) Fraietta, J. A.; Lacey, S. F.; Orlando, E. J.; Pruteanu-Malinici, I.; Gohil, M.; Lundh, S.; Boesteanu, A. C.; Wang, Y.; O'Connor, R. S.; Hwang, W. T.; et al. Determinants of response and resistance to CD19 chimeric antigen receptor (CAR) T cell therapy of chronic lymphocytic leukemia. Nat Med 2018, 24 (5), 563-571. DOI: 10.1038 / s41591-018-0010-1 From NLM Medline.(15) Garcia-Calderon, C. B.; Sierro-Martinez, B.; Garcia-Guerrero, E.; Sanoja-Flores, L.; Munoz-Garcia, R.; Ruiz-Maldonado, V.; Jimenez-Leon, M. R.; Delgado-Serrano, J.; Molinos- Quintana, A.; Guijarro-Albaladejo, B.; et al. Monitoring of kinetics and exhaustion markers of circulating CAR-T cells as early predictive factors in patients with B-cell malignancies. Front Immunol 2023, 14, 1152498. DOI: 10.3389 / fimmu.2023.1152498 From NLM Medline.(16) Arcangeli, S.; Bove, C.; Mezzanotte, C.; Camisa, B.; Falcone, L.; Manfredi, F.; Bezzecchi, E.; El Khoury, R.; Norata, R.; Sanvito, F.; et al. CAR T cell manufacturing from naive / stem memory T lymphocytes enhances antitumor responses while curtailing cytokine release syndrome. J Clin In vest 2022, 732 (12). DOI: 10.1172 / JC1150807 From NLM Medline.(17) Eyquem, J.; Mansilla-Soto, J.; Giavridis, T.; Van Der Stegen, S. J. C.; Hamieh, M.; Cunanan, K. M.; Odak, A.; Gdnen, M.; Sadelain, M. Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection. Nature 2017, 543 (7643), 113-117. DOI: 10.1038 / nature21405.(18) Giavridis, T.; van der Stegen, S. J. C.; Eyquem, J.; Hamieh, M.; Piersigilli, A.; Sadelain, M. CAR T cell-induced cytokine release syndrome is mediated by macrophages and abated by IL-1 blockade. Nat Med 2018, 24 (6), 731-738. DOI: 10.1038 / s41591-018-0041-7 From NLM Medline.(19) Norelli, M.; Camisa, B.; Barbiera, G.; Falcone, L.; Purevdorj, A.; Genua, M.; Sanvito, F.; Ponzoni, M.; Doglioni, C.; Cristofori, P.; et al. Monocyte-derived IL-1 and IL-6 are differentially required for cytokine-release syndrome and neurotoxicity due to CAR T cells. Nat Med 2018, 24 (6), 739-748. DOI: 10.1038 / s41591-018-0036-4 From NLM Medline.(20) Messmer, A. S.; Que, Y. A.; Schankin, C.; Banz, Y.; Bacher, U.; Novak, U.; Pabst, T. CAR T-cell therapy and critical care : A survival guide for medical emergency teams. Wien Klin Wochenschr 2021 , 733 (23-24), 1318-1325. DOI: 10.1007 / s00508-021-01948-2 From NLM Medline.(21) Morris, E. C.; Neelapu, S. S.; Giavridis, T.; Sadelain, M. Cytokine release syndrome and associated neurotoxicity in cancer immunotherapy. Nat Rev Immunol 2022, 22 (2), 85-96. DOI: 10.1038 / S41577-021-00547-6 From NLM Medline.(22) Michaels, Y. S.; Barnkob, M. B.; Barbosa, H.; Baeumler, T. A.; Thompson, M. K.; Andre, V.; Colin-York, H.; Fritzsche, M.; Gileadi, II.; Sheppard, H. M.; et al. Precise tuning of gene expression levels in mammalian cells. Nat Commun 2019, 10 (1). DOI: 10.1038 / s41467-019- 08777-y.(23) Panwar, B.; Omenn, G. S.; Guan, Y. miRmine: a database of human miRNA expression profiles. Bioinformatics 2017, 33 (10), 1554-1560. DOI: 10.1093 / bioinformatics / btx019 From NLM Medline.(24) Ho, J. Y.; Wang, L.; Liu, Y.; Ba, M.; Yang, J.; Zhang, X.; Chen, D.; Lu, P.; Li, J. Promoter usage regulating the surface density of CAR molecules may modulate the kinetics of CAR-T cells in vivo. Mol Ther Methods Clin Dev 2021 , 21, 237-246. DOI:10.1016 / j.omtm.2021.03.007 From NLM PubMed-not-MEDLINE.(25) Yi, Y.; Chai, X.; Zheng, L.; Zhang, Y.; Shen, J.; Hu, B.; Tao, G. CRISPR-edited CART with GM-CSF knockout and auto secretion of IL6 and IL1 blockers in patients with hematologic malignancy. Cell Discov 2021, 7 (1), 27. DOI: 10.1038 / s41421-021-00255-4 From NLM PubMed-not-MEDLINE.(26) Lin, M. Y.; Nam, E.; Shih, R. M.; Shafer, A.; Bouren, A.; Ayala Ceja, M.; Harris, C.; Khericha, M.; Vo, K. H.; Kim, M.; et al. Self-regulating CAR-T cells modulate cytokine release syndrome in adoptive T-cell therapy. J Exp Med 2024, 221 (6). DOI: 10.1084 / jem.20221988 From NLM Medline.

Claims

WHAT IS CLAIMED IS:

1. An isolated nucleic acid, comprising: a sequence encoding a chimeric antigen receptor (CAR), and at least one target site for an endogenously expressed microRNA (miRNA) positioned downstream of said sequence encoding a CAR.

2. The isolated nucleic acid of claim 1, wherein the target site for an endogenously expressed miRNA comprises one or more nucleotide mismatches.

3. The isolated nucleic acid of claim 1 or 2, wherein the target site for an endogenously expressed miRNA is a miR-17 target site variant.

4. The isolated nucleic acid of any one of claims 1 to 3, wherein the isolated nucleic acid comprises two or three or more of said target site.

5. The isolated nucleic acid of any one of claims 1 to 4, wherein the CAR comprises an extracellular antibody variable domain specific for an antigen associated with the disease or disorder and an intracellular signaling domain.

6. The isolated nucleic acid of claim 5, wherein the antigen associated with the disease or disorder is a tumour associated cell surface antigen.

7. The isolated nucleic acid of claim 6, wherein the tumour associated cell surface antigen is CD19.

8. The isolated nucleic acid of any one of claims 1 to 7, wherein the CAR comprises a transmembrane domain, preferably CD3 zeta chains, a CD28 and / or 4-1 BB costimulatory domain, and a CD3 zeta signaling domain.

9. The isolated nucleic acid of any one of claims 1 to 8, wherein the one or more target site comprises or consists of SEQ ID NO: 1 [Scramble], SEQ ID NO: 2 (17-A.18-G), SEQ ID NO:3 (2-A.17-T), SEQ ID NO: 4 (18G), SEQ ID NO: 5 (1x Perfect), SEQ ID NO: 6 (2x Perfect), or SEQ ID NO: 7 (3x Perfect), or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof.

10. The isolated nucleic acid of any one of claims 1 to 8, wherein the isolated nucleic acid comprises or consists of SEQ ID NO: 8 (Bidirectional hPGK-CAR-miSFIT-Scramble sequence), SEQ ID NO: 9 (Bidirectional hPGK-CAR-miSFIT-2A-17T sequence) or SEQ ID NO: 10 (Bidirectional hPGK-CAR-miSFIT-1x-Perfect sequence), or a sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereof.11 . The isolated nucleic acid of any one of claims 1 to 9, further comprising a vector sequence.

12. The isolated nucleic acid of claim 11 , wherein the vector sequence comprises a viral vector derived from a virus selected from a lentivirus, an adenovirus type 2 and an adenovirus type 5, a retrovirus, an adeno-associated virus (AAV), a simian virus 40 (SV-40), vaccinia virus, Sendai virus, Epstein-Barr virus (EBV), or herpes simplex virus (HSV).

13. The isolated nucleic acid of claim 11 , wherein the vector sequence comprises a viral vector derived from a lentivirus.

14. A vector comprising the isolated nucleic acid of any one of claims 1 to 9.

15. The vector of claim 14, further comprising a promoter.

16. The vector of claim 15, wherein the promoter is a modified MLV long terminal repeat (MNDLI3) promoter or a bidirectional promoter, preferably a human phosphoglycerate kinase promoter.

17. The vector of any one of claims 14 to 16, wherein the vector is a lentiviral vector.

18. A host cell comprising the isolated nucleic acid of any one of claims 1 to 13 or the vector of any one of claims 14 to 17.

19. The host cell of claim 18, wherein the host cell is a T-cell.

20. The host cell of claim 18 or 19, wherein host cell is a human cell.

21. An engineered immune cell comprising the isolated nucleic acid of chimeric antigen receptor (CAR) of any one of claims 1 to 13 or the vector of any one of claims 14 to 17, wherein the engineered immune cell is a NK cell, an NKT cell, or a T cell.

22. A pharmaceutical composition comprising the host cell of any one of claims 18 to 20, or the engineered immune cell of claim 21 , and a pharmaceutically acceptable carrier.

23. A method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a cancer, comprising: administering a therapeutically effective amount of the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 , or the pharmaceutical composition of claim 22 to a subject.

24. The method of claim 23, wherein said cancer is CD19-positive B-cell leukemia or CD19- positive lymphoma;25. The method of claim 23, wherein the cancer is acute lymphocytic leukemia.

26. A method of treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, comprising: administering a therapeutically effective amount of the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 or the pharmaceutical composition of claim 22 to a subject,27. The method of any one of claims 23 to 26, wherein the subject is a human.

28. Use of a therapeutically effective amount of the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 , or the pharmaceutical composition of claim 22 for treating a subject having cancer, or suspected to having cancer, or at risk of developing cancer, or inthe manufacture of a medicament for treating a subject having cancer, or suspected to having cancer, or at risk of developing cancer .

29. The use of claim 28, wherein said cancer is CD19-positive B-cell leukemia or CD19- positive lymphoma;30. The use of claim 28, wherein the cancer is acute lymphocytic leukemia.31 . Use of a therapeutically effective amount of the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 or the pharmaceutical composition of claim 22 for treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, or in the manufacture of a medicament for treating a subject having a cancer, or suspected of having a cancer, or at risk of developing a systemic lupus erythematosus (SLE), idiopathic inflammatory myositis, systemic sclerosis or asthma, or in the manufacture of a medicament.

32. The use of any one of claims 28 to 29, wherein the subject is a human.

33. An isolated nucleic acid of any one of claims 1 to 13, the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 or the pharmaceutical composition of claim 22 for use in treating a subject having cancer.

34. The isolated nucleic acid of any one of claims 1 to 13, the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 or the pharmaceutical composition of claim 22 for use in reducing T-cell exhaustion and / or cytokine release storm in a subject.

35. The isolated nucleic acid of any one of claims 1 to 13, the host cell of any one of claims 18 to 20, the engineered immune cell of claim 21 or the pharmaceutical composition of claim 22 for use according to claim 27, wherein the cytokine release storm comprises at least TNF-a or IL-2.

36. A kit comprising the isolated nucleic acid of any one of claims 1 to 13, and a container, and optionally instructions for the use thereof.

37. A kit comprising the engineered immune cell of claim 21, and a container, and optionally instructions for the use thereof.

38. A kit comprising the pharmaceutical composition of claim 22, and a container, and optionally instructions for the use thereof.

Images