Personalized Anti-emetic treatment for chemotherapy-induced nausea and vomiting

Abstract

It relates to a novel method for personalizing a treatment for chemotherapy-induced nausea and vomiting (CINV) in a patient. SNP variations in genes HTR3A, HTR3B and TACR1 are utilized to predict the response to a particular anti-emetic regimen for a patient. Treatment regimens utilizing antagonists of 5-hydroxytryptamine type 3 (5-HT3R) receptor and neurokinin-1 (NK-1) receptor, with or without the addition of olanzapine are selected based on the patient genotype. In addition, a method has been generated to determine the genotypes of these genes and SNPs from VCF file output from high throughput sequencing.

Description

PERSONALIZED ANTI-EMETIC TREATMENT FOR CHEMOTHERAPY-INDUCED NAUSEA AND VOMITING

[0001] CROSS-REFERENCE TO RELATED APPLICATION

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 653,423, filed May 30, 2024, which is hereby incorporated by reference in its entirety including any tables, figures, or drawings.TECHNICAL FIELD

[0003] The present invention pertains to a novel method for personalizing a prophylactic anti-emetic treatment to control chemotherapy induced nausea and vomiting (CINV) using information from patients’ genotypes in genes HTR3A, HTR3B and TACR1.BACKGROUND ART

[0004] Chemotherapy is a main-stage treatment in many cancer patients. However, nausea and vomiting are experienced by most patients as common side effects, which may become so severe that chemotherapy needs to be stopped. Such chemotherapy-induced nausea and vomiting (CINV) are most distressing and prevalent (Aapro et al. 2021) . Prevention of CINV by prophylactic anti-emetic treatment is the primary goal. International associations, like the National Comprehensive Cancer Network (NCCN) , the American Society of Clinical Oncology (ASCO) , the European Society for Medical Oncology (ESMO) , and the Multinational Association of Supportive Care in Cancer (MASCC) have ranked the emetogenic risk for commonly used chemotherapy agents into four levels (Lei et al. 2018, Razvi et al. 2019, Olver et al. 2023) . For example, the commonly used anthracycline-cyclophosphamide (AC) regimen for adjuvant therapy in breast cancer patients is classified as highly emetogenic chemotherapy (HEC) which is associated with a more than 90%risk of emesis. Therefore, international guidelines have been developed for the use of prophylactic anti-emetic therapy for HEC. However, no guideline includes pharmacogenetics in the selection among various prophylactic anti-emetic regimens. As a result, personalized anti-emetic treatment is not practiced in CINV nowadays.

[0005] Prophylaxis use of a triple-drug regimen of antagonists against receptors of 5-hydroxytryptamine type 3 (5-HT3 receptor, type 3 serotonin receptor) and neurokinin-1 (NK-1) together with dexamethasone is recommended by guidelines of various medical associationincluding NCCN, MASCC, and ESMO, andis used in routine practice in oncology (Hesketh et al. 2017, Razvi et al. 2019, Rapoport et al. 2023) . The neurokinin 1 receptor, also known as the tachykinin receptor 1, is coded by the TACR1 gene. Various genes are coding for various types and subunits of receptors of 5-hydroxytryptamine (serotonin) .

[0006] Various regimens for prophylactic control of CINV associated with chemotherapy have been recommended. For example, the triple-drug regimen consists of antagonists against receptors of 5-hydroxytryptamine type 3 (5-HT3 receptor, type 3 serotonin receptor) and neurokinin-1 (NK-1) together with dexamethasone has been recommended in various guidelines (Rapoport et al. 2023) . Such guideline recommended a 3-drug regimen (referred to as Regimen A, the 3-drug regimen) . In addition, olanzapine has been added to this basic 3-drug for a 4-drug regimen (referred to as Regimen B, the 4-drug regimen) which is believed to achieve antiemetic control by targeting multiple pathways (Navariet al. 2016) . However, various studies on the comparison between the guideline-recommended 3-drug regimen and the 4-drug regimen (addition of olanzapine) yielded conflicting results (Kawazoe et al. 2018, Sutherland et al. 2018, Rapoport et al. 2023, Zhao et al. 2023) . Recently, these multi-drug anti-emetic therapies have been formulated into a combined oral or IV drug to facilitate prescription and delivery (referred to as Regimen C) . For example, NEPA is now available in oral and IV form and have been approved by regulatory bodies in many countries.

[0007] However, these regimens are prescribed on an empirical basis to all patients, and there is no indication of personalized anti-emetic treatment as there is no known biomarker that can predict the efficacy or effectiveness of prophylactic anti-emetic treatment in controlling CINV in a particular patient (Suginoet al. 2015, Singh et al. 2018, Gupta et al. 2021) . Previous genetic studies only focused on the genetic predisposition for CINV or postoperative nausea and vomiting (Eliasen et al. 2020, 2022, Tsuji et al. 2021) . On the other hand, few studies evaluated the genetic determinants for treatment efficacy or effectiveness in the control of nausea and vomiting by various anti-emetic regimens. Yet, it is an essential step in the practice of personalized anti-emetic treatment for CINV or related conditions (Gupta et al. 2021) . Therefore, there is a need for utilizing biomarkers that may predict the response to a particular anti-emetic regimen for each patient and enable choosing the most useful regimen for individual patients.SUMMARY OF THE INVENTION

[0008] The subject invention provides a novel method for personalizingan anti-emetic treatment for chemotherapy induced nausea and vomiting (CINV) comprising (a) obtaining a sample from a patient planned for receiving a chemotherapy treatment, (b) genotyping the sample for single nucleotide polymorphism (SNP) variations in genes HTR3A, HTR3B, and TACR1, (c) predicting response of the subject to a particular anti-emetic regimen based on a genotype or a combination of genotypes (also known as gene-gene interaction) of gene polymorphismsin genes HTR3A, HTR3B, and TACR1; (d) selecting a personalized anti-emetic treatment based on the genotype or a combination of genotypes, and (e) administering the personalized anti-emetic treatment to the patient accordingly.

[0009] In embodiments, HTR3A, HTR3B, and TACR1 genes are genotyped for SNPs rs1176722, rs1176744, and rs3821313, respectively.

[0010] Inembodiments, an anti-emetic treatment comprises a regimen administered to a patient including antagonists of 5-hydroxytryptamine receptor 3A, 5-hydroxytryptamine receptor 3B, and optionally neurokinin-1.

[0011] In preferred embodiments, ananti-emetic treatmentis selected from a Regimen B, which comprises aprepitant, ondansetron, and dexamethasone, with the addition of olanzapine, and a Regimen C, which comprises netupitant, palonosetron, and dexamethasone.

[0012] In one embodiment, the response to an anti-emetic treatment selected according to the genotyped profile of a patient for SNPs rs1176722, rs1176744, and rs3821313, significantly reduces CINV. In a preferred embodiment, the response to an anti-emetic treatment is less 25 mm on a visual analogue scale (VAS) . In a more preferred embodiment, the response to an anti-emetic treatment is less 5 mm on a VAS.

[0013] In a preferred embodiment, disclosed herein is a method for predicting or determining responses to a particular anti-emetic regimen based on a genotype or a combination of genotypes of SNPsin selected genes for the method of the subject invention, the method comprising: (a) retrieving a list of genome positions of a gene of interest from the human genome map of the same version that matches the gene used to generate the VCF file of a test sample, (b) searching each of the listed genome positions in the high throughput sequencing (HTS) results VCF file of the test sample or use other genotyping methods to obtain genotypes of selected SNPs, (c) confirming whether the genome position of SNPs of interest is listed in the VCF file of the test sample, and (d) assigning a homozygote genotype if a genome position is not listed in the results VCF file of the test sample, or (e) obtaining the genotype results of the SNPs from the VCF file if a genome position is listed in the results VCF file or by other rapid genotyping methods.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figures 1A-1Idescribe how the interaction between rs1176744 (HTR3B) and rs3821313 (TACR1) determines response to various prophylactic anti-emetic treatment regimens in chemotherapy patients. (Standard: Regimen A, olanzapine: Regimen B and NEPA: Regimen C) . The numbers of patients in each group (n= x) are shown above each bar together with numbers that had complete protection which is labelled as case (case= y) . The y-axis shows the percentage of patients who achieved complete protection for each regimen.

[0015] Figures 2A-2Ddescribe a recessive mode analysis of the interaction between rs1176744 (HTR3B) and rs3821313 (TACR1) and response to various prophylactic anti-emetic treatment regimens in chemotherapy patients. The y-axis shows the percentage of patients who achieved complete protection for each regimen. Assuming the gene-gene interaction occurs in the homozygotes of both major alleles in a recessive mode, the 3 x 3 combination of genotypes as shown in Figures 1A-1I (shown here as an inset in the left upper) are combined as shown into 4 groups of digenic genotypes as shown in the right lower larger graph. (Standard: Regimen A, olanzapine: Regimen B and NEPA: Regimen C) . The numbers of patients in each group (n= x) are shown above each bar together with numbers that had complete protection which is labelled as case (case= y) . Figure 2D shows the P value of statistical comparison between Standard Regimen A and olanzapineadded Regimen B.

[0016] Figures 3A-3D describe a recessive mode analysis of the interaction between rs1176722 (HTR3A) and rs3821313 (TACR1) and response to various prophylactic anti-emetic treatment regimens in chemotherapy patients. Assuming the gene-gene interaction occurs in the homozygotes of both major alleles in a recessive mode, the 3 x 3 combination of genotypes of these 2 SNPs are combined as shown into 4 groups of digenic genotypes. (Standard: Regimen A, olanzapine: Regimen B and NEPA: Regimen C) . The numbers of patients in each group (n= x ) are shown above each bar together with numbers that had complete protection which is labelled as case (case=y ) . Figure 3D, shows the P value of statistical comparison between Standard Regimen A and olanzapineadded Regimen B.

[0017] Figure 4describes amethod workflow to determine genotypes for SNPs in genes of interest from a VCF file of HTS results of a test sample.

[0018] BRIEF DESCRIPTION OF THE SEQUENCES

[0019] The alleles of nucleotide polymorphisms of the 3 SNPs are shown in SEQ ID NO: 1 to SEQ ID NO:3 with the alternative bases shown inside the bracket [] together with flanking 25 basepairs of both sides.

[0020] SEQ ID NO: 1

[0021] Rs1176744

[0022] SEQ ID NO: 2

[0023] Rs1176722

[0024] SEQ ID NO: 3

[0025] Rs3821313

[0026] SEQ ID NO: 4 rs1176722_forward primer TCCGACCTTCTTAGCCCTCA

[0027] SEQ ID NO: 5rs1176722_reverse primer CGCACACCCTTCCTGTAGTT

[0028] SEQ ID NO: 6 rs1176744_forward primer CTCTTGAAGGTCAGGCTGCA

[0029] SEQ ID NO: 7 rs1176744_reverse primer GCTCATCTTTGCCAGGGTGA

[0030] SEQ ID NO: 8 rs3821313_forward primer TTTGGGCAGTCTTTGGGGTT

[0031] SEQ ID NO: 9 rs3821313_reverse primer CTGATCTTCTGGGTGAGGCA

[0032] SEQ ID NO: 10 long 14-bp 5′GC sequence 5′-GCGGGCAGGGCGGC-3′)

[0033] DETAILED DISCLOSURE OF THE INVENTION

[0034] Selected Definitions

[0035] As used herein, the singular forms “a” , “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including” , “includes” , “having” , “has” , “with” , or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising” . The transitional terms / phrases (and any grammatical variations thereof) “comprising” , “comprises” , “comprise” , “consisting essentially of” , “consists essentially of” , “consisting” and “consists” can be used interchangeably.

[0036] The term “about” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured, i.e., the limitations of the measurement system. In the context of compositions containing amounts of ingredients where the term “about” is used, these compositions contain the stated amount of the ingredient with a variation (error range) of 0-10%around the value (X ±10%) . In other contexts, the term “about” is providing a variation (error range) of 0-10%around a given value (X ± 10%) . As is apparent, this variation represents a range that is up to 10%above or below a given value, for example, X ± 1%, X ± 2%, X ± 3%, X ± 4%, X ± 5%, X ± 6%, X ± 7%, X ± 8%, X ± 9%, or X ± 10%.

[0037] In the present disclosure, ranges are stated in shorthand to avoid having to set out at length and describe each and every value within the range. Any appropriate value within the range can be selected, where appropriate, as the upper value, lower value, or the terminus of the range. For example, a range of 0.1-1.0 represents the terminal values of 0.1 and 1.0, as well as the intermediate values of 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and all intermediate ranges encompassed within 0.1-1.0, such as 0.2-0.5, 0.2-0.8, 0.7-1.0, etc. Values having at least two significant digits within a range are envisioned, for example, a range of 5-10 indicates all the values between 5.0 and 10.0 as well as between 5.00 and 10.00 including the terminal values. When ranges are used herein, combinations and subcombinations of ranges (e.g., subranges within the disclosed range) and specific embodiments therein are explicitly included.

[0038] By “reduces” is meant a negative alteration of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.

[0039] By “increases” is meant as a positive alteration of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.

[0040] As used herein, the term “subject” refers to an animal, needing or desiring delivery of the benefits provided by a therapeutic compound. The animal may be for example, humans, pigs, horses, goats, cats, mice, rats, dogs, apes, fish, chimpanzees, orangutans, guinea pigs, hamsters, cows, sheep, birds, chickens, as well as any other vertebrate or invertebrate. These benefits can include, but are not limited to, the treatment of a health condition, disease or disorder; prevention of a health condition, disease or disorder; immune health; enhancement of the function of an organ, tissue, or system in the body. The preferred subject in the context of this invention is a human. The subject can be of any age or stage of development, including infant, toddler, adolescent, teenager, adult, or senior.

[0041] As used herein, the terms “therapeutically-effective amount, ” “therapeutically-effective dose, ” “effective amount, ” and “effective dose” are used to refer to an amount or dose of a compound or composition that, when administered to a subject, is capable of treating or improving a condition, disease, or disorder in a subject or that is capable of providing enhancement in health or function to an organ, tissue, or body system. In other words, when administered to a subject, the amount is “therapeutically effective. ” The actual amount will vary depending on a number of factors including, but not limited to, the particular condition, disease, or disorder being treated or improved; the severity of the condition; the particular organ, tissue, or body system of which enhancement in health or function is desired; the weight, height, age, and health of the patient; and the route of administration.

[0042] As used herein, the term “treatment” refers to inhibiting, eradicating, reducing, ameliorating, or reversing a sign or symptom of a health condition, disease or disorder to any extent, and includes, but does not require, a complete cure of the condition, disease, or disorder. Treating can be curing, improving, or partially ameliorating a disorder. “Treatment” can also include improving or enhancing a condition or characteristic, for example, bringing the function of a particular system in the body to a heightened state of health or homeostasis.

[0043] As used herein, “preventing” a health condition, disease, or disorder refers to inhibiting, avoiding, delaying, forestalling, or minimizing the onset of a particular sign or symptom of the condition, disease, or disorder. Prevention can, but is not required, to be absolute or complete; meaning, the sign or symptom may still develop at a later time. Prevention can include reducing the severity of the onset of such a condition, disease, or disorder, and / or inhibiting the progression of the condition, disease, or disorder to a more severe condition, disease, or disorder.

[0044] In some embodiments of the invention, the method comprises administration of multiple doses of the compounds of the subject invention. The method may comprise administration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, or more therapeutically effective doses of a composition comprising the compounds of the subject invention as described herein. In some embodiments, doses are administered over the course of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, 21 days, 30 days, or more than 30 days. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the invention can include a single treatment or can include a series of treatments. It will also be appreciated that the effective dosage of a compound used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays or imaging techniques for detecting tumor sizes known in the art. In some embodiments of the invention, the method comprises administration of the compounds at several time per day, including but not limiting to 2 times per day, 3 times per day, and 4 times per day.

[0045] As used herein, an “isolated” or “purified” compound is substantially free of other compounds. In certain embodiments, purified compounds are at least 60%by weight (dry weight) of the compound of interest. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight of the compound of interest. For example, a purified compound is one that is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w / w) of the desired compound by weight. Purity is measured by any appropriate standard method, for example, by column chromatography, thin layer chromatography, or high-performance liquid chromatography (HPLC) analysis.

[0046] As used herein, a “pharmaceutical” refers to a compound manufactured for use as a medicinal and / or therapeutic drug.

[0047] The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

[0048] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

[0049] The term “polymorphism” refers to the occurrence of two or more alternative genomic sequences or alleles between or among different genomes or individuals. The variation may comprise but is not limited to one or more base changes, the insertion of one or more nucleotides or the deletion of one or more nucleotides.

[0050] As used herein, the term “single nucleotide polymorphism” also referred to by the abbreviation “SNP” means a polymorphism at a single site wherein the polymorphism constitutes a single base pair change. SNP is a common form of genetic polymorphisms. SNPs typically have two and up to four alternative alleles, and each corresponds to a nucleotide that may exist in the chromosome. Thus, a SNP is characterized by two or more nucleotides out of four (A, C, G, T) . An example would be that a SNP has either allele C or allele T at a given position on each chromosome. This is shown as [C / T] , The more commonly occurring allele is shown first (in this case, it is C) and called the major, common, or wild-type allele. The alternative allele that occurs less commonly instead of the common allele (in this case, it is T) is called minor, rare, or variant allele. Since humans are diploid organisms meaning that each chromosome occurs in two copies, each individual has two alleles at a SNP. These alleles may be two copies of the same allele (CC or TT) or they may be different ones (CT) . The CC, CT and TT are called genotypes. Among these CC and TT are characterized by having two copies of the same allele and are called homozygote genotypes. The genotype CT has different alleles on each chromosome and is a heterozygote genotype. Individuals bearing homozygote or heterozygote genotypes are called homozygote and heterozygote, respectively.

[0051] The term “genotype” refers to a description of the alleles of a gene contained in an individual or sample. As used herein, “genotyping” a subject (or DNA or other biological sample) for a polymorphic allele of a gene (s) means detecting which allelic or polymorphic form (s) of the gene (s) or gene expression products (e.g., heterogeneous nuclear (hn) RNA, messenger RNA or protein) are present or absent in a subject (or a sample) . As it is well known in the art, an individual may be heterozygous or homozygous for a particular allele. More than two allelic forms may exist, thus there may be more than three possible genotypes. As used herein, an allele may be “detected” or “determined” when its identity (e.g., sequence) is known. Sequence variations may be detected directly (by, e.g., sequencing) or indirectly (e.g., by restriction fragment lengthpolymorphismanalysis, or detection of the hybridization of a probe of known sequence, or reference strand conformationpolymorphism) , or by using other known methods.

[0052] The term “sample” refers to any composition containing or presumed to contain nucleic acid (e.g., DNA) from an individual. In the context of the present disclosure, any type of body sample may be used, including without limitation, skin, buccal swab, tissue biopsy, plasma, serum, whole blood and blood components, saliva, urine, tears, seminal fluid, vaginal fluids and other fluids and tissues, including paraffin embedded tissues or tissues collected and preserved in the course of a forensic investigation. Samples also may include constituents and components of in vitro cultures of cells obtained from an individual. DNA can be extracted from various samples for genotyping.

[0053] The term “nucleotide” as used herein refers to a sub-unit of a nucleic acid, and it includes not only natural purine and pyrimidine bases, e.g., adenine (A) , thymine (T) , cytosine (C) , guanine (G) , or uracil (U) , but also modified or analog bases.

[0054] The term “oligonucleotide” as used herein refers to a chain of linked nucleotide residues. Oligonucleotides may be chemically synthesized and may be used as primers or probes. The terms “oligonucleotide” and “polynucleotide” as used herein may also refer to modified or unmodified RNA or DNA.

[0055] The term “primer” as used herein refers to an oligonucleotide complementary to a DNA segment to be amplified or replicated. A primer hybridizes or anneals to the template DNA and is used by a polymerase to start the replication / amplification process. By “complementary” is meant that the primer sequence can form a stable hydrogen bond complex with the template.

[0056] The term “Polymerase Chain Reaction” or “PCR” as used herein refers to a thermocyclic, polymerase-mediated, DNA amplification reaction employing template molecules, oligonucleotide primers complementary to the template molecules, a thermostable DNA polymerase, and deoxyribonucleotides, and it involves three repeated processes (denaturation, hybridization, and primer extension) that are performed at distinct temperatures and steps.

[0057] Method for a personalized anti-emetic treatment for CINV.

[0058] Disclosedherein is a novel method for personalizing a highly responsive prophylactic anti-emetic regimen to control CINV using information on patients’ genotypes in 3 genes, HTR3A, HTR3B and TACR1. In one embodiment, genotyping for variations in genes HTR3A, HTR3B, and TACR1 in patients receiving chemotherapy with the potential of inducing nausea and vomiting, provides information useful for determining the best treatment for each subject. Genotypes in one or more of these genes affect the efficacy of prophylactic anti-emetic treatment. Some genotypes and / or combination of genotypes (also known as genetic interaction, digenic interaction or gene-gene interaction) are more responsive to certain anti-emetic regimens. Accordingly, genotype information of an individual patient enables the choice of preferred regimen with a high probability of good anti-emetic efficacy and reduces or inhibits chemotherapy-induced nausea and vomiting.

[0059] In some embodiments, Genotypes in the HTR3B and TACR1 genes interact in such a way that homozygotes of the prevalent alleles in SNPs of these 2 genes benefits from the best response to the CINV regimen with the addition of Olanzapine (Regimen B) . This is a new phenomenon of digenic interaction that was not known before.

[0060] In some embodiments, a method is provided to reduce or ameliorate one or more symptoms of CINV in a subject. The severity of CINV is categorized into 2 phases or periods in a treatment cycle. Acute CINV occurs within the first 24 hours (0-24 hr) after chemotherapy treatment, with a peak occurrence at around hours 5 to 6. Delayed CINV (24 to 120 hr) refers to symptoms’ onset between 1 and 5 days post-chemotherapy. Treatment efficacy is also assessed over the entire period of 5 days after chemotherapy (0 to 120 hr) and is referred to as the overall period. These are the principal features and time periods used to assess the efficacy of anti-emetic treatment. Usually, the degree of anti-emetic control is similar across treatment cycles, so the response in the first cycle is commonly used as the endpoint of treatment response or outcome (Navari et al. 2023) . Patients take anti-emetic treatment 1-2 hours before the start of chemotherapy on day 1 of a treatment cycle. Depending on the anti-emetic regimen, it may last for 3 or 5 days. Symptoms of nausea are rated by the patient on a visual analogue scale (VAS) for the previous 24 hours every day during the 5 days. The VAS scale ranges from 0 mm, “no nausea” to 100 mm, “the worst” (Meek et al. 2015, Yeo et al. 2020) . History of vomiting or use of rescue therapy for control of CINV was recorded. A good treatment outcome or efficacy of the antiemetic prophylaxis is defined as no vomiting, no need to use rescue therapy and no significant nausea (VAS scale < 25mm) . This definition is also commonly known as complete protection in CINV therapy (Escobar et al. 2015) .

[0061] In some embodiments, the method of the subject invention typically involves administering to the subject one or more anti-emetics comprising antagonists of 5-hydroxytryptamine type 3 receptors (5-HT3 receptor, type 3 serotonin receptor) , and optionally neurokinin-1 (NK-1) receptor.

[0062] In some embodiments, one or more antagonist of 5-HT3 receptor administered to a subject to ameliorate, reduce, and / or inhibit the severity of one or more symptoms of CINV, include, but are not limited to, ondansetron, granisetron, palonosetron, tropisetron, and dolasetron.

[0063] In some embodiments, one or more antagonist of NK-1 receptor administered to a subject to ameliorate, reduce, and / or inhibit the severity of one or more symptoms of CINV, include, but are not limited to, aprepitant, rolapitant, casopitant, netupitant, maropitant, vofopitant, orvepitant, befetupitant, vapreotide, spantide I, MEN 10207, nolpitantium, fosnetupitant, SDZ NKT 343, CS-003, CP 122721, Substance P, imnopitant, spantide II, L-760735, and fosaprepitant.

[0064] In a most preferred embodiment, olanzapine is administered in addition to the basic 3-drugs, e.g., aprepitant, ondansetron, and dexamethasone, for a 4-drug regimen (Regimen B) .

[0065] It is well known in the art that a combination of an antagonist of the 5-HT3 receptors and NK-1 receptor with dexamethasone or another corticosteroid increases the anti-emetic efficacy of these drugs. In a preferred embodiment, a corticosteroidis administered together with antagonists of 5-HT3 and NK-1 receptors. In a more preferred embodiment, methylprednisolone is administered together with antagonists of 5-HT3 and NK-1 receptors. In a most preferred embodiment, dexamethasone is administered together with antagonists of 5-HT3 and NK-1 receptors.

[0066] In some embodiments, treatment regimens are selected based on the genotype information for SNPs for HTR3A, HTR3B and TACR1 genes foreach patient. The SNPs utilized for genotyping are rs1176722 for gene HTR3A, rs1176744 for gene HTR3B, and rs3821313 for gene TACR1.

[0067] In some embodiments, a sample is obtained from a subject scheduled for chemotherapy, then the sample is genotyped for SNPs variations in genes HTR3A, HTR3B and TACR1 and, based on the genotype of the subject, the expected response to a particular anti-emetic regimen is predicted and a personalized anti-emetic treatment is selected and administered to the subject.

[0068] In some embodiments, the subject is a mammal. In preferred embodiments, the mammal is a human.

[0069] In preferred embodiments, Regimen B includingolanzapine is administered to a subject with genotype TT homozygote for SNP rs1176744 in HTR3B gene; Regimen B including olanzapine is administered to a subject with genotype GG homozygote for SNP rs3821313 in TACR1 gene; Regimen B including olanzapine is administered to a subject with genotype TT homozygous for SNP rs1176744 in TACR1 gene and homozygote GG for SNP rs3821313 in TACR1 gene; Regimen B including olanzapine is administered to a subject with genotype GG for SNP rs1176722 in HTR3A gene and GG for SNP rs3821313 in TACR1 gene; Regimen C is administered to a subject with genotype GG or GT for SNP rs1176744 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene; and Regimen C is administered to a subject with genotype AA or GA for SNP rs1176722 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene.

[0070] In preferred embodiments, the anti-emetic treatment selected for the patient significantly reduces or substantially inhibits CINV symptoms. In more preferred embodiments, the response to the anti-emetic treatment is less than 25 mm on a VAS. In most preferred embodiments, the response to the anti-emetic treatment is less than 5 mm on a VAS.

[0071] In some embodiments, the anti-emetic treatment is administered to a patient for about three to about five days.

[0072] In one embodiment, the anti-emetic treatment is administered to a subject undergoing chemotherapy for the duration of the chemotherapeutical treatment. A chemotherapy treatment may be administered for a period ranging from about a week to several years. Anti-emetic drugscan be administered via, for example, injection, which includes intravenously, intraperitoneally, intramuscularly, intrathecally, or subcutaneously.

[0073] In another embodiment, the anti-emetics can be administered via the skin through a patch or directly onto the skin for local or systemic effects. The anti-emetics can be administered sublingually, buccally, rectally, or vaginally. Furthermore, the anti-emetics can be sprayed into the nose for absorption through the nasal membrane, nebulized, inhaled via the mouth or nose, or administered in the eye or ear.

[0074] In other embodiments, the anti-emetics can be administered in a variety of unit dosage forms depending upon the method of administration. Suitable unit dosage forms, include, but are not limited to powders, tablets, pills, capsules, lozenges, suppositories, patches, nasal sprays, injectables, implantable sustained-release formulations, or lipid complexes.

[0075] In one embodiment, the anti-emetics can be combined with a pharmaceutically acceptable carrier (excipient) to form a pharmacological composition. In certain embodiments, pharmaceutically acceptable carriers include those approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in / on animals, and more particularly in / on humans. A “carrier” refers to, for example, a diluent, adjuvant, excipient, auxiliary agent or vehicle with which an active agent of the present invention is administered.

[0076] Pharmaceutically acceptable carriers can contain one or more physiologically acceptable compound (s) that act, for example, to stabilize the composition or to increase or decrease the absorption of the active agent (s) . Physiologically acceptable compounds can include, for example, carbohydrates, such as glucose, sucrose, or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, protection and uptake enhancers such as lipids, compositions that reduce the clearance or hydrolysis of the active agents, or excipients or other stabilizers and / or buffers.

[0077] Other physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives that are particularly useful for preventing the growth or action of microorganisms. Various preservatives are well known and include, for example, phenol and ascorbic acid. One skilled in the art would appreciate that the choice of pharmaceutically acceptable carrier (s) , including a physiologically acceptable compound depends, for example, on the route of administration of the active agent (s) and on the particular physio-chemical characteristics of the active agent (s) .

[0078] In one embodiment, the excipients are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. For various oral dosage form excipients such as tablets and capsules sterility is not required.

[0079] In certain therapeutic applications, the anti-emetics are administered therapeutically to a subject planned for receiving a chemotherapy treatment in an amount sufficient to reduce, and / or inhibit the symptoms of CINV. An amount adequate to accomplish this is defined as a “therapeutically effective dose. ” Amounts effective for therapeutic use will depend upon the expected response of the subject to the active agents. Single or multiple administrations of the active agents may be utilized depending on the dosage and frequency as required and tolerated by the subject. In any event, the treatment should provide a sufficient amount of the anti-emetics to effectively reduce, inhibit, or ameliorate one or more symptoms of CINV.

[0080] The concentration / amount of anti-emetics can vary widely, and are selected primarily based on activity of the active ingredient (s) , body weight and the like in accordance with the particular mode of administration selected and the patient's needs. Concentrations, however, will typically be selected to provide dosages ranging from about 0.01 mg / kg / day to about 50 mg / kg / day and sometimes higher. Typical dosages range from about 0.1 mg / kg / day to about 25 mg / kg / day, preferably from about 0.1 mg / kg / day to about 10 mg / kg / day, more preferably from about 0.1 mg / kg / day to about 5 mg / kg / day, and most preferably from about 0.1 mg / kg / day to about 3.75 mg / kg / day. It will be appreciated that such dosages may be varied to optimize a therapeutic and / or prophylactic regimen in a particular subject.

[0081] MATERIALS AND METHODS

[0082] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

[0083] Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

[0084] EXAMPLE 1-

[0085] We performed a series of clinical trials to compare the efficacy of various antiemetic regimens for control of CINV (for example, clinical trial registry: NCT03079219) . We compared the effect of adding olanzapine (amulti-target CNS drug) to a guidelinerecommended triple-drug regimen of antagonists against receptors of 5-hydroxytryptamine type 3 (5-HT3 receptor, type 3 serotonin receptor) , and neurokinin-1 (NK-1) together with dexamethasone and found that olanzapine led to a better overall complete protection rate with no nausea and vomiting after AC treatment cycles (Yeo et al. 2020) . Similarly, we compared NEPA and the standard regimen, NCT03386617 (Yeo et al. 2022) . In addition, a comparison between NEPA and the addition of olanzapine to the guideline-recommended regimen was performed (Yip et al. 2023) .

[0086] A subgroup of patients in these trials also joined a pharmacogenetic study to analyze the genetic biomarkers that could predict good treatment outcomes for each of the 3 different regimens (Table 1) .

[0087] The inclusion criteria of study subjects were (standardized for the 3 regimens) :

[0088] · Female breast cancer patients of Chinese ethnicity;

[0089] · Aged 18 to 75 years;

[0090] · Completed primary treatment with surgery;

[0091] · Planned for adjuvant chemotherapy with 4 cycles AC [each cycle consists of doxorubicin 60 mg / m2 and cyclophosphamide 600 mg / m2 on day 1 of a 3-weekly cycle;

[0092] · Patients were mentally competent and provided informed consent.

[0093] Assessment of anti-emetic efficacy:

[0094] · No nausea is defined as a response of VAS < 5mm on a visual analogue scale for nausea during the periods of assessment;

[0095] · No significant nausea is defined as a response of VAS < 25mm on a visual analogue scale for nausea during the periods of assessment;

[0096] · Complete protection is defined as no vomiting, no use of rescue therapy and no significant nausea during the periods of assessment.

[0097] Period of assessment is defined as:

[0098] · Acute phase: 0-24 hours after initiation of AC;

[0099] · Delayed phase: 24-120 hours;

[0100] · The overall phase refers to the period of both acute and delay phases.

[0101] As the first cycle is representative of the response in subsequent cycles, these endpoints were assessed in the first cycle of AC, which is also a common practice in CINV studies (Navari et al. 2016) .

[0102] Table 1: Details of anti-emetic treatments used in 3 groups of Chinese breast cancer patients undergoing doxorubicin-cyclophosphamide chemotherapy.

[0103] EXAMPLE 2-LABORATORY METHODS

[0104] Genomic DNA was extracted from peripheral blood using commercial kits. PCR was carried out under standard conditions in 96-or 384-well format. Genotyping (Tang et al. 2019, Ma et al 2019) for SNPs in the candidate genes was carried out followinglab established protocols, PCR-melting curve analysis and / or PCR-Sanger sequencing. The primers utilized for the PCR for each of the corresponding SNPs were:

[0105] SEQ ID NO: 4 rs1176722_forward primer TCCGACCTTCTTAGCCCTCA;

[0106] SEQ ID NO: 5 rs1176722_reverse primer CGCACACCCTTCCTGTAGTT;

[0107] SEQ ID NO: 6 rs1176744_forward primer CTCTTGAAGGTCAGGCTGCA;

[0108] SEQ ID NO: 7 rs1176744_reverse primer GCTCATCTTTGCCAGGGTGA;

[0109] SEQ ID NO: 8 rs3821313_forward primer TTTGGGCAGTCTTTGGGGTT

[0110] SEQ ID NO: 9 rs3821313_reverse primer CTGATCTTCTGGGTGAGGCA.

[0111] The genotyping method utilizes a set of 3 sets of PCR primers to amplify a region encompassing a SNP and the PCR products are then sequenced to obtain the genotype for an individual.

[0112] Both positive and negative control samples were included together with replicated samples representing at least 5%of the original sample set. Any genotype data showing departure from Hardy-Weinberg equilibrium was re-genotyped by a different protocol.

[0113] As an alternative genotyping method to rapidly obtain genotype results, wealso utilized a published PCR-melting genotyping method (Tang et al. 2019, Ma et al 2019) . Briefly, 2 allele-specific primers and a common reverse primer were designed for each SNP. The 2 allele-specific primers with the 3’ end nucleotide matching to one of the polymorphic alleles, in addition, they also include additional sequence of different length at 5′end which will produce a different melting temperature due to differences in GC composition in additional 5′sequence. For example, a long 14-bp 5′GC sequence (5′-GCGGGCAGGGCGGC-3′) (SEQ ID NO: 10) was added to one of the allele-specific primer, while a short 5′8-bp GC tail (5′-GATTACCG-3′) was attached to the other allele-specific primer. By attaching 5′GC tails of different lengths onto the 5′end of each pairs of allele-specific primers, genotypes at the SNP can be inferred from the melting profile of the polymerase chain reaction (PCR) products, as the different GC 5′tail will generate a 3℃ to 4℃ difference in Tm between the allele-specific PCR products. PCR reactions were carried out in a total volume of 15 μl containing 10 ng of DNA, 10 mM Tris–HCl buffer (pH 8.3) , 1.5 mM MgCl2, 200 mM of each deoxynucleotide triphosphate, 50 ng of primers with different 5’ tails in the presence of Taq DNA polymerase (Roche Molecular Biochemicals) . After PCR, the genotypes of samples are revealed by their melting temperature in the presence of a fluorescent DNA binding dye such as SYBR Green. DNA samples of known genotypes were included as a positive control in each batch of 96-well plates. Results were also confirmed by Sanger sequencing of PCR products.

[0114] Genetic association analysis

[0115] For each treatment regimen, patients’ response (e.g., complete protection or not) was used to classify patients into 2 categorical groups. Then, the genotypes of their genetic polymorphisms were compared between these 2 groups in a 2 x 3 table. A statistically significant result indicates that the genotype of that gene polymorphism determines the response or efficacy of that anti-emetic regimen.

[0116] Besides, the complete protection rate (proportion of patients’ archived complete protection) can be compared across various regimens for patients with given genotypes. Therefore, the most effective treatment regimen can be identified for patients with those genotypes.

[0117] EXAMPLE 3-

[0118] Number of patients who participated in each treatment regimen and their overall response rate are shown in Table 2. Higher complete protection rates were found in Regimen B (with the addition of olanzapine) and Regimen C (NEPA) with a complete protection rate of 57%and 55%, respectively. However, the differences were not statistically significant when compared to the basic 3-drug regimen (Regimen A) .

[0119] Table 2: Patients received various prophylactic anti-emetic regimens and their complete protection rate.

[0120] EXAMPLE 4-GENETIC ASSOCIATION STUDY OF THE ANTI-EMETIC EFFICACY IN REGIMEN B, WITH THE ADDITION OF OLANZAPINE

[0121] In each regimen group, patients were divided into those who achieved complete protection and those who did not. The two groups wereanalyzed for their association with genotypes of single nucleotidepolymorphisms (SNPs) located on genes. Three genes are the primary targets, includingHTR3A, HTR3B and TACR1 (Table 3) . More associations were found with Regimen B.

[0122] Table 3: List of Genes and SNPs studies for association with anti-emetic efficacy

[0123] A significant genetic association with treatment efficacy was found in Regimen B (4-drug regimen with the addition of olanzapine) . Table 4 shows the genetic association analysis between a SNP in the HTR3B gene (rs1176744) and treatment response in patients who received Regimen B. The T allele (encoding for Tyrosine at codon 129 of HTR3B) is the common allele of rs1176744, which is also referred as the A allele (on the complementary strand which also is the sense strand sequence of the gene) in dbSNP. This SNP is a nonsynonymous mutation and is also known as Tyr129Ser (p. Y129S) , where the tyrosine of codon 129 is substituted by serine by this T to G nucleotide change. Results showed that homozygote patients with tyrosine of codon 129 (p. 129Tyr / Tyr or TT in Table 4) were more likely to get complete protection against CINV when prophylactically given the 4-drug regimen with olanzapine. Among the 29 homozygote p. 129Tyr (p. 129Tyr / Tyr) patients, 69%achieved complete protection after treatment with Regimen B, while only 31% (4 out of 13) of the heterozygote GT patients (p. 129Ser / Tyr) achieved complete protection.

[0124] When the treatment cycle was subdivided into acute (0-24 hours) and delay period (24-120 hr) after chemotherapy, a similar association was found for rs1176744 (Table 5) . Again, patients homozygote of Tyr at codon 129 (p. 129Tyr / Tyr) of the HTR3B gene were more likely to achieve complete protection during the delay phase (76%, 22 out of 29 homozygotes Tyr vs 38%, 5 out of 13 heterozygotes) .

[0125] For the acute phase (0-24 hours) , an association was found between rs3821313 in the TACR1 gene and treatment efficacy (Table 6) . Homozygote G patients (GG genotype) were more likely to achieve complete protection during the acute phase (0-24 hours) .

[0126] Table 4. Association between rs1176744 genotypes in HTR3B and treatment efficacy of the 4-drug regimen with the addition of olanzapine (Regimen B) . The complementary base is used in the genotype call. Therefore, the alleles of SNP is called T / G representing A / C as mentioned in dbSNP (see worldwide website: ncbi. nlm. nih. gov / snp / rs1176744) .

[0127] P value < 0.05 by chi-square with Yates’ correction

[0128] Table 5. Association between rs1176744 genotypes in HTR3B and treatment efficacy of the 4-drug regimen with the addition of olanzapine (Regimen B) .

[0129] P value < 0.05 by chi-square with Yates’ correction

[0130] Table 6. Association between rs3821313 genotypes in TACR1 and treatment efficacy of the 4-drug regimen with the addition of olanzapine (Regimen B) .

[0131] P value < 0.05 by chi-square

[0132] EXAMPLE 5-GENETIC ASSOCIATION STUDY OF THE ANTI-EMETIC EFFICACY IN REGIMEN A (THE 3-DRUG REGIMEN)

[0133] One significant association was found in patients who received Regimen A (Table 7) . Patients homozygotes of the G allele of rs1176722 in the HTR3A gene were more likely to have nausea during the 5 days after chemotherapy (79%of GG homozygotes got nausea, 19 out of 23) after given the Regimen A prophylaxis, suggesting that this genotype was less responsive to Regimen A.

[0134] Therefore, patients with GG genotype in rs1176722 of the HTR3A gene should receive other prophylactic anti-emetic regimens but not the standard 3-drug regimen.

[0135] Table 7. Association between rs1176722 genotypes in HTR3A and treatment efficacy of the 3-drug regimen (Regimen A) .

[0136] P value < 0.05 by chi-square in a 2 x 2 table without the genotype AA column.

[0137] EXAMPLE 6-DIGENIC GENOTYPE EFFECTS OR GENE-GENE INTERACTION IN THE PROPHYLACTIC TREATMENT OF CINV: HTR3B AND TACR1

[0138] Phenotypes may also be determined by the effect of 2 genes, asit is well known in the field of animal breeding. It is called epistasis (Lee et al. 2020, Okazaki et al. 2022) . Therefore, the effects of a combination of genotypes in 2 SNPs were analyzed as well. Specifically, only those SNPs with a significant association with treatment efficacy were analyzed. Complete protection of the whole period was used as the treatment outcome. Interaction between rs1176744 (HTR3B) and rs3821313 (TACR1) affects the treatment efficacy of prophylactic anti-emetic regimens. Figures 1A-1I show the percentage of patients who achieved complete protection after being given various prophylactic anti-emetic regimens. The G allele of rs1176744 and A allele of rs3821313 are minor alleles of low allelic frequencies in the population, so no patients homozygote for both of these alleles are studied (Figure 1A) . On the other hand, many patients were both homozygote T of rs1176744 and homozygote G of rs3821313 and their treatment efficacy toward the 3 regimens is shown in Figure 1I. There was a striking difference among various regimens in terms of percentages of patients achieving complete protection in this combination of genotypes in the HTR3B and TACR1 genes. In Figure 1I, there were patients who were homozygotes for both prevalent alleles in these 2 SNP. As shown in Figure 1I, this group of patients were best treated by Regimen B with the addition of Olanzapine (crosshatch bar in Figure 1I) , and 9 out of 11 (88%) patients achieved complete protection during the 5 days. On the other hand, only 29% (7 out of 24) of patients given the standard 3-drug regimen (Regimen A, stripe bar in Figure 1I) experienced complete protection.

[0139] As the minor alleles of both SNPs are uncommon in the population, the digenic interaction was analyzed by reducing the 3x3 genotype combinations into 2x2 genotype combinations by combining the homozygotes of minor alleles with heterozygotes into one class as shown in Figure 2A. The biology significance of such results is that the major alleles act in a recessive manner (Lee et al. 2020) .

[0140] The results after rearrangement confirmed that patients who were homozygotes of the common alleles in both SNPs (rs1176744 and rs3821313) were best treated with Regimen B by adding olanzapine to the standard regimen (Figure 2D) . The complete protection rate was higher in the Regimen B group (crosshatch bar in Figure 2D) than the Regimen A group (stripe bar in Figure 2D) and it was statistically significant by Fisher exact test, p<0.05. On the other hand, patients with combinations of genotypes shown in Figure 2A would have Regimen C: NEPA (dotted bar in Figure 2A) as the preferred treatment. Specifically, this combination of genotypes are rs1176744 (GG or GT) and rs3821313 (AA or GA) .

[0141] EXAMPLE 7-DIGENIC GENOTYPE EFFECTS OR GENE-GENE INTERACTION IN PROPHYLACTIC TREATMENT OF CINV: HTR3A AND TACR1

[0142] Interaction between rs1176722 (HTR3A) and rs3821313 (TACR1) also affects the treatment efficacy of prophylactic anti-emetic regimens. A similar approach is used to combine genotypes of these 2 SNPs into a 2x2 genotype combination figure (Figures 3A-3D) . Figure 3D shows the treatment efficacy interms of complete protection for 5 days after various anti-emetic prophylactic regimens. Patientswho were homozygote for G alleles in both rs1176722 and rs3821313 showed poor response toRegimen A (stripe bar in Figure 3D) . They should be treated with Regimen B with the addition ofolanzapine or Regimen C.

[0143] On the other hand, patients with combinations of genotypes shown in Figure 3A would haveRegimen C: NEPA (dotted bar in Figure 3A) as the preferred treatment. Specifically, this combinationof genotypes are rs1176722 (AA or GA) and rs3821313 (AA or GA) .

[0144] EXAMPLE 8-SELECTION OF PROPHYLACTIC ANTI-EMETIC REGIMEN FOR CINV BASED ON PATIENTS’ GENOTYPES

[0145] Patients should be genotyped for these 3 genes, HTR3A, HTR3B, and TACR1. Based on their genotype combined, the best response anti-emetic regimen can be determined on an individual basis.

[0146] Table 8. Recommended use of prophylactic anti-emetic regimen for CINV based on patients’ genotypes.

[0147] Regimen B represents a standard guideline-recommended anti-emetic prophylactic regimen with addition of olanzapine. People skilled in the art are aware that there are variations in the 4-drug regimen with addition of olanzapine as the common essential component. Therefore, regimen B could be a 4-drug regimen, as shown in Examples, or its variation as a 3-drug regimen including an antagonist against serotonin receptors of 5-hydroxytryptamine type 3 (5-HT3 receptor, type 3 serotonin receptor) , dexamethasone and olanzapine but omitting the NK-1 receptor antagonist (also known as aprepitant sparing regimen) (Gyawali et al. 2016) .

[0148] EXAMPLE 9-DETERMINATION OF PHARMACOGENETICS ALLELE STATUS FROM HIGH THROUGHPUT SEQUENCING RESULTS

[0149] Organizations like the Food and Drug Administration (FDA) of the United States of America collected information on genes that influence the effects of drugs. The Clinical Pharmacogenetics Implementation Consortium (CPIC) is a consortium for the implementation of these data into clinical applications (Relling et al. 2020) . Presently, genotyping of individuals is commonly performed by high throughput sequencing (HTS) . For example, exons of all protein-coding genes can be captured for sequencing which also known as exome sequencing (Please also see information in worldwide website: en. wikipedia. org / wiki / Exome_sequencing) . To make use of such HTS seq sequencing results for pharmacogenetics applications, various software applications have been developed, based on the list of genes that are recommended by these organizations, to determine the genotypes of individuals using the common exome sequencing results file format VCF as input (Tippenhauer et al. 2023) . VCF is also called the variant call format (see worldwide website: en. wikipedia. org / wiki / Variant_Call_Format) . However, these softwareapplications have many limitations. Some require phased genotype data in VCF files which is not commonly available (Calendo et al. 2024) . Others ignore a genome position or nucleotide base if the allele of the individual is the same as the reference sequence (that is the individual is homozygous for the reference allele) (Li et al. 2023) . A typical VCF file will not list a genome position or nucleotide base if the nucleotide base (allele) of the test sample is the same as the reference allele. The genotype results will be considered missing by software (Tippenhauer et al. 2023) . The genes HTR3A, HTR3B, and TACR1used in the subject invention are not mentioned or covered by both FDA guidelines (see worldwide website: fda. gov / drugs / science-and-research-drugs / tablepharmacogenomic-biomarkers-drug-labeling) and CPIC consortium (see worldwide website: cpicpgx. org / genes-drugs / ) . Therefore, the alleles of these three and many other genes are not considered in many pharmacogenetic software, for example, PharmCat (Li et al. 2023) . Therefore, a new method is required to determine the genotypes of these 3 and other genes related to future pharmacogenetics applications from the commonly used VCF file format. As shown in Figure 4, the list of genome positions (chromosome number and nucleotide position along that chromosome) of genes of interest (e.g., HTR3B, TACR1) is first obtained from the human genome map of the version that matches that used to generate the VCF file of the test sample. (Labelled as step 401 in Figure 4) . Then, each of these specific genome positions is searched in the HTS results VCF file of the test sample. If the genome position is not listed in the results VCF file, it indicates that the test sample individual is homozygote for the reference allele (Table 9 and Table 10) . If the genome position is listed in the results VCF file, the genotype of the individual is indicated in the VCF file.

[0150] Table 9. Examples of genome positions of genes of interestand the genotype results of test samples when such positions are not listed in the VCF file and the VCF file is based on Genome Reference Consortium Human Build 38 (GRCh38) .

[0151] Table 10. Examples of genome positions of genes of interest and the genotype results of test samples when such positions are not listed in the VCF file and the VCF file is based on Genome Reference Consortium Human Build 37 (GRCh37) .

[0152] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims. In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and / or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.

[0153] EXEMPLARY EMBODIMENTS

[0154] Embodiment 1. A method for personalizing an anti-emetic treatment for chemotherapy induced nausea and vomiting (CINV) , the method comprising:

[0155] (a) obtaining a sample from a subject planned for receiving a chemotherapy treatment;

[0156] (b) genotyping the sample for single nucleotide polymorphism (SNP) variations in genes HTR3A, HTR3B, and TACR1;

[0157] (c) selecting a personalized anti-emetic treatment based on the genotype; and

[0158] (d) administering the personalized anti-emetic treatment to the subject.

[0159] Embodiment 2. The method of embodiment 1, wherein the subject is a mammal.

[0160] Embodiment 3. The method of embodiment 2, wherein the mammal is a human.

[0161] Embodiment 4. The method of any preceding embodiment, wherein the anti-emetic treatment is Regimen B with optionally aprepitant, or Regimen C.

[0162] Embodiment 5. The method of any preceding embodiment, wherein the SNP analyzed for HTR3A gene is rs1176722.

[0163] Embodiment 6. The method of any preceding embodiment, wherein the SNP analyzed for HTR3B gene is rs1176744.

[0164] Embodiment 7. The method of any preceding embodiment, wherein the SNP analyzed for TACR1 gene is rs3821313.

[0165] Embodiment 8. The method of any preceding embodiment, wherein Regimen B comprises ondansetron, dexamethasone, and olanzapine.

[0166] Embodiment 9. The method of any preceding embodiment, wherein Regimen B comprises aprepitant, ondansetron, dexamethasone, and olanzapine.

[0167] Embodiment 10. The method of any preceding embodiment, wherein Regimen C comprises netupitant, palonosetron, and dexamethasone.

[0168] Embodiment 11. The method of any preceding embodiment, wherein Regimen B plus olanzapine is administered to a subject with genotype TT homozygote for SNP rs1176744 in HTR3B gene,

[0169] wherein Regimen B plus olanzapine is administered to a subject with genotype GG homozygote for SNP rs3821313 in TACR1 gene,

[0170] wherein Regimen B plus olanzapine is administered to a subject with genotype TT homozygote for SNP rs1176744 in HTR3B gene and GG homozygote for SNP rs3821313 in TACR1 gene,

[0171] wherein Regimen B plus olanzapine is administered to a subject with genotype GG for SNP rs1176722 in HTR3A gene and GG homozygote for SNP rs3821313 in TACR1 gene,

[0172] wherein Regimen C is administered to a subject with genotype GG or GT for SNP rs1176744 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene, and

[0173] wherein Regimen C is administered to a subject with genotype AA or GA for SNP rs1176722 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene.

[0174] Embodiment 12. The method of any preceding embodiment, wherein the anti-emetic treatment is administered to the subject for about 3 to about 5 days.

[0175] Embodiment 13. The method of any preceding embodiment, wherein a response to the anti-emetic treatment is less than 25 mm on a visual analogue scale (VAS) .

[0176] Embodiment 14. The method of any preceding embodiment, wherein the response to the anti-emetic treatment is less than 5 mm on a visual analogue scale (VAS) .

[0177] Embodiment 15. The method of any preceding embodiment, wherein the treatment comprises administering to the subject one or more antagonist of 5-hydroxytryptamine receptor 3A, 5-hydroxytryptamine receptor 3B, and neurokinin-1.

[0178] Embodiment 16. The method of any preceding embodiment, wherein the treatment comprises administering to the subject antagonists of 5-hydroxytryptamine receptor 3A, 5-hydroxytryptamine receptor 3B, and optionally neurokinin-1.

[0179] Embodiment 17. The method of any preceding embodiment, wherein the one or more antagonist is selected from ondansetron, granisetron, palonosetron, tropisetron, and dolasetron, aprepitant, rolapitant, casopitant, netupitant, maropitant, vofopitant, orvepitant, befetupitant, vapreotide, spantide I, MEN 10207, nolpitantium, fosnetupitant, SDZ NKT 343, CS-003, CP 122721, Substance P, imnopitant, spantide II, L-760735, fosaprepitant, and olanzapine.

[0180] Embodiment 18. The method of any preceding embodiment, wherein the anti-emetic treatment is administered to a subject undergoing chemotherapy for the duration of the chemotherapy.

[0181] Embodiment 19. A method for personalizing an anti-emetic treatment for chemotherapy induced nausea and vomiting (CINV) , the method comprising:

[0182] (a) obtaining a sample from a subject planned for receiving the chemotherapy treatment;

[0183] (b) genotyping the sample for single nucleotide polymorphism (SNP) variations in genes HTR3A, HTR3B, and TACR1;

[0184] (c) retrieving a list of SNPs in genes of interest and their genome positions obtained from ahuman genome map of the version that matches genome positions used to generate a variant call format (VCF) file of a test sample;

[0185] (d) searching each of the listed genome positions in the high through sequencing (HTS) results VCF file of the test sample;

[0186] (e) confirming whether the genome position of the SNP in a gene of interest is listed in the VCF file of the test sample;

[0187] (f) assigning a homozygote genotype if the genome position is not listed in the results VCF file of the test sample;

[0188] (g) obtaining the genotype results of the SNP from the VCF file if the genome position is listed in the results VCF file;

[0189] (h) selecting a personalized anti-emetic treatment based on the genotype; and

[0190] (i) administering the personalized anti-emetic treatment to the subject.

[0191] REFERENCES

[0192] Aapro M, Scotté F, Escobar Y, Celio L, Berman R, Franceschetti A, Bell D, Jordan K. Practice patterns for prevention of chemotherapy-induced nausea and vomiting and antiemetic guideline adherence based on real-world prescribing data. The Oncologist. 2021; 26 (6) : e1073–82.

[0193] Calendo G, Kusic D, Madzo J, Gharani N, Scheinfeldt L. ursaPGx: a new R package to annotate pharmacogenetic star alleles using phased whole-genome sequencing data. Front Bioinform. 2024; 4: 1351620.

[0194] Eliasen A, Dalhoff K, Mathiasen R, Schmiegelow K, Rechnitzer C, Schelde AB, Perwitasari DA, Tsuji D, Brok J. Pharmacogenetics of antiemetics for chemotherapy-induced nausea and vomiting: A systematic review and meta-analysis. Crit Rev Oncol Hematol. 2020; 149: 102939.

[0195] Eliasen A, Kornholt J, Mathiasen R, Wadt K, Stoltze U, Brok J, Rechnitzer C, Schmiegelow K, Dalhoff K. Background sensitivity to chemotherapy-induced nausea and vomiting and response to antiemetics in paediatric patients: a genetic association study. Pharmacogenet Genomics. 2022; 32 (2) : 72–8.

[0196] Escobar Y, Cajaraville G, Virizuela JA,  A, Olariaga O, Tamés MJ, Muros B, Lecumberri MJ, Feliu J, Martínez P, Adansa JC, Martínez MJ, López R, Blasco A, Gascón P, Calvo V, Luna P, Montalar J, Del Barrio P, Tornamira MV. Incidence of chemotherapy-induced nausea and vomiting with moderately emetogenic chemotherapy: ADVICE (Actual Data of Vomiting Incidence by Chemotherapy Evaluation) study. Support Care Cancer Off J Multinatl Assoc Support Care Cancer. 2015; 23 (9) : 2833–40.

[0197] Gupta K, Walton R, Kataria SP. Chemotherapy-Induced Nausea and Vomiting: Pathogenesis, Recommendations, and New Trends. Cancer Treat Res Commun. 2021; 26: 100278.

[0198] Gyawali B, Poudyal BS, Iddawela M. Cheaper Options in the Prevention of Chemotherapy-Induced Nausea and Vomiting. J Glob Oncol. 2016; 2 (3) : 145–53.

[0199] Hesketh PJ, Kris MG, Basch E, Bohlke K, Barbour SY, Clark-Snow RA, Danso MA, Dennis K, Dupuis LL, Dusetzina SB, Eng C, Feyer PC, Jordan K, Noonan K, Sparacio D, Somerfield MR, Lyman GH. Antiemetics: American Society of Clinical Oncology Clinical Practice Guideline Update. J ClinOncol Off J Am Soc Clin Oncol. 2017; 35 (28) : 3240–61.

[0200] Kawazoe H, Uozumi R, Murakami A, Yamashita M, Kobayashi-Taguchi K, Kusakabe E, Yamasawa H, Yakushijin Y, Nakamura T, Kamei Y. Olanzapine plus aprepitant, palonosetron, and dexamethasone for nausea and vomiting in patients with breast cancer receiving anthracycline: A retrospective study. Sci Rep. Nature Publishing Group; 2018; 8 (1) : 16232.

[0201] Lee K-Y, Leung K-S, Ma SL, So HC, Huang D, Tang NL-S, Wong M-H. Genome-Wide Search for SNP Interactions in GWAS Data: Algorithm, Feasibility, Replication Using Schizophrenia Datasets. Front Genet. 2020; 11: 1003.

[0202] Lei Y-Y, Ho SC, Cheng A, Kwok C, Lee C-KI, Cheung KL, Lee R, Loong HHF, He Y-Q, Yeo W. Adherence to the World Cancer Research Fund / American Institute for Cancer Research Guideline Is Associated With Better Health-Related Quality of Life Among Chinese Patients With Breast Cancer. J Natl Compr Cancer Netw JNCCN. 2018; 16 (3) : 275–85.

[0203] Li B, Sangkuhl K, Keat K, Whaley RM, Woon M, Verma S, Dudek S, Tuteja S, Verma A, Whirl-Carrillo M, Ritchie MD, Klein TE. How to Run the Pharmacogenomics Clinical Annotation Tool (PharmCAT) . Clin Pharmacol Ther. 2023; 113 (5) : 1036–47.

[0204] Ma SL, Tang NLS, Wat KHY, et al. Effect of CYP2D6 and CYP3A4 Genotypes on the Efficacy of Cholinesterase Inhibitors in Southern Chinese Patients With Alzheimer's Disease. Am J Alzheimers Dis Other Demen. 2019; 34 (5) : 302-307. doi: 10.1177 / 1533317519848237

[0205] Meek R, Egerton-Warburton D, Mee MJ, Braitberg G. Measurement and monitoring of nausea severity in emergency department patients: a comparison of scales and exploration of treatment efficacy outcome measures. Acad Emerg Med Off J Soc Acad Emerg Med. 2015; 22 (6) : 685–93.

[0206] Navari R, Binder G, Molasiotis A, Herrstedt J, Roeland EJ, Ruddy KJ, LeBlanc TW, Kloth DD, Klute KA, Papademetriou E, Schmerold L, Schwartzberg L. Duration of Chemotherapy-Induced Nausea and Vomiting (CINV) as a Predictor of Recurrent CINV in Later Cycles. The Oncologist. 2023; 28 (3) : 208–13.

[0207] Navari RM, Aapro M. Antiemetic Prophylaxis for Chemotherapy-Induced Nausea and Vomiting. N Engl J Med. Massachusetts Medical Society; 2016; 374 (14) : 1356–67.

[0208] Okazaki A, Ott J. Machine learning approaches to explore digenic inheritance. Trends Genet TIG. 2022; 38 (10) : 1013–8.

[0209] Olver I, Clark-Snow R, Ruhlmann CH, Garcia-Del-Barrio M-A, Schwartzberg L, Rapoport BL, Jahn F. 2023 updated MASCC / ESMO consensus recommendations: controlling nausea and vomiting with chemotherapy of low or minimal emetic potential. Support Care Cancer Off J Multinatl Assoc Support Care Cancer. 2023; 32 (1) : 37.

[0210] Rapoport BL, Herrstedt J, Snow RC, Radhakrishnan V, Saito M, Navari RM, Smit T. 2023 updated MASCC / ESMO consensus recommendations: prevention of nausea and vomiting following multiple-day chemotherapy, high-dose chemotherapy, and breakthrough nausea and vomiting. Support Care Cancer Off J Multinatl Assoc Support Care Cancer. 2023; 32 (1) : 36.

[0211] Razvi Y, Chan S, McFarlane T, McKenzie E, Zaki P, DeAngelis C, Pidduck W, Bushehri A, Chow E, Jerzak KJ. ASCO, NCCN, MASCC / ESMO: a comparison of antiemetic guidelines for the treatment of chemotherapy-induced nausea and vomiting in adult patients. Support Care Cancer Off J Multinatl Assoc Support Care Cancer. 2019; 27 (1) : 87–95.

[0212] Relling MV, Klein TE, Gammal RS, Whirl-Carrillo M, Hoffman JM, Caudle KE. The Clinical Pharmacogenetics Implementation Consortium: 10 Years Later. Clin Pharmacol Ther. 2020; 107 (1) : 171–5.

[0213] Singh KP, Dhruva AA, Flowers E, Kober KM, Miaskowski C. A review of the literature on the relationships between genetic polymorphisms and chemotherapy-induced nausea and vomiting. Crit Rev Oncol Hematol. 2018; 121: 51–61.

[0214] Sugino S, Janicki PK. Pharmacogenetics of chemotherapy-induced nausea and vomiting. Pharmacogenomics. 2015; 16 (2) : 149–60.

[0215] Sutherland A, Naessens K, Plugge E, Ware L, Head K, Burton MJ, Wee B. Olanzapine for the prevention and treatment of cancer-related nausea and vomiting in adults. Cochrane Database Syst Rev. John Wiley & Sons, Ltd; 2018; (9) .

[0216] Tang NL, Wang X, Chang KC, et al. Genetic susceptibility to Tuberculosis: Interaction between HLA-DQA1 and age of onset. Infect Genet Evol. 2019; 68: 98-104. doi: 10.1016 / j. meegid. 2018.12.014

[0217] Tippenhauer K, Philips M, Largiadèr C, Sariyar M. Using the PharmCAT tool for Pharmacogenetic clinical decision support. Brief Bioinform. 2023; 25 (1) : bbad452.

[0218] Tsuji D, Matsumoto M, Kawasaki Y, Kim Y-IL, Yamamoto K, Nakamichi H, Sahara Y, Makuta R, Yokoi M, Miyagi T, Itoh K. Analysis of pharmacogenomic factors for chemotherapy-induced nausea and vomiting in patients with breast cancer receiving doxorubicin and cyclophosphamide chemotherapy. Cancer Chemother Pharmacol. 2021; 87 (1) : 73–83.

[0219] Yeo W, Lau TK, Kwok CC, Lai KT, Chan VT, Li L, Chan V, Wong A, Soo WM, Yeung EW, Wong KH, Tang NL, Suen JJ, Mo FK. NEPA efficacy and tolerability during (neo) adjuvant breast cancer chemotherapy with cyclophosphamide and doxorubicin. BMJ Support Palliat Care. 2022; bmjspcare-2019-002037.

[0220] Yeo W, Lau TK, Li L, Lai KT, Pang E, Cheung M, Chan VT, Wong A, Soo WM, Yeung VT, Tse T, Lam DC, Yeung EW, Ng KP, Tang NL, Tong M, Suen JJ, Mo FK. A randomized study of olanzapinecontaining versus standard antiemetic regimens for the prevention of chemotherapyinduced nausea and vomiting in Chinese breast cancer patients. The Breast. Elsevier BV; 2020; 50: 30–8.

[0221] Yip CC, Li L, Lau TKH, Chan VTC, Kwok CCH, Suen JJS, Mo FKF, Yeo W. Evaluation of contemporary olanzapine-and netupitant / palonosetron-containing antiemetic regimens for chemotherapy-induced nausea and vomiting. Hong Kong Med J Xianggang Yi Xue Za Zhi. 2023; 29 (1) : 49–56.

[0222] Zhao Y, Yang Y, Gao F, Hu C, Zhong D, Lu M, Yuan Z, Zhao J, Miao J, Li Y, Zhu J, Wang C, Han J, Zhao Y, Huang Y, Zhang L. A multicenter, randomized, double-blind, placebo-controlled, phase 3 trial of olanzapine plus triple antiemetic regimen for the prevention of multiday highly emetogenic chemotherapy-induced nausea and vomiting (OFFER study) . eClinicalMedicine. Elsevier; 2023; 55.

Claims

1.A method for personalizing an anti-emetic treatment for chemotherapyinduced nausea and vomiting (CINV) , the method comprising:(a) obtaining a sample from a subject planned for receiving a chemotherapy treatment;(b) genotyping the sample for single nucleotide polymorphism (SNP) variations in genes HTR3A, HTR3B, and TACR1;(c) selecting a personalized anti-emetic treatment based on the genotype; and(d) administering the personalized anti-emetic treatment to the subject.2.The method of claim 1, wherein the subject is a mammal.3.The method of claim 2, wherein the mammal is a human.4.The method of claim 1, wherein the anti-emetic treatment is Regimen B with optionallyaprepitant, orRegimen C.5.The method of claim 1, wherein the SNP analyzed for HTR3A gene is rs1176722.6.The method of claim 1, wherein the SNP analyzed for HTR3B gene is rs1176744.7.The method of claim 1, wherein the SNP analyzed for TACR1 gene is rs3821313.8.The method of claim 4, wherein Regimen B comprises ondansetron, dexamethasone, and olanzapine.9.The method of claim 4, wherein Regimen B comprises aprepitant, ondansetron,dexamethasone, and olanzapine.10.The method of claim 4, wherein Regimen C comprises netupitant, palonosetron, and dexamethasone.11.The method of claim 1, wherein Regimen B plus olanzapine is administered to a subject with genotype TT homozygote for SNP rs1176744 in HTR3B gene,wherein Regimen B plus olanzapine is administered to a subject with genotype GG homozygote for SNP rs3821313 in TACR1 gene,wherein Regimen B plus olanzapine is administered to a subject with genotype TT homozygote for SNP rs1176744 in HTR3B gene and GG homozygote for SNP rs3821313 in TACR1 gene,wherein Regimen B plus olanzapine is administered to a subject with genotype GG for SNP rs1176722 in HTR3A gene and GG homozygote for SNP rs3821313 in TACR1 gene,wherein Regimen C is administered to a subject with genotype GG or GT for SNP rs1176744 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene, andwherein Regimen C is administered to a subject with genotype AA or GA for SNP rs1176722 in HTR3A gene and AA or GA for SNP rs3821313 in TACR1 gene.12.The method of claim 1, wherein the anti-emetic treatment is administered to the subject for about 3 to about 5 days.13.The method of claim 1, wherein a response to the anti-emetic treatment is less than 25 mm on a visual analogue scale (VAS) .14.The method of claim 13, wherein the response to the anti-emetic treatment is less than 5 mm on a visual analogue scale (VAS) .15.The method of claim 1, wherein the treatment comprises administering to the subject one or more antagonist of 5-hydroxytryptamine receptor 3A, 5-hydroxytryptamine receptor 3B, andneurokinin-1.16.The method of claim 15, wherein the treatment comprises administering to the subject antagonists of 5-hydroxytryptamine receptor 3A, 5-hydroxytryptamine receptor 3B, and optionally neurokinin-1.17.The method of claim 15, wherein the one or more antagonist is selected from ondansetron, granisetron, palonosetron, tropisetron, and dolasetron, aprepitant, rolapitant, casopitant, netupitant, maropitant, vofopitant, orvepitant, befetupitant, vapreotide, spantide I, MEN 10207, nolpitantium, fosnetupitant, SDZ NKT 343, CS-003, CP 122721, Substance P, imnopitant, spantide II, L-760735, fosaprepitant, and olanzapine.18.The method of claim 1, whereinthe anti-emetic treatment is administered to a subject undergoing chemotherapy for the duration of the chemotherapy.19.A method for personalizing an anti-emetic treatment for chemotherapy induced nausea and vomiting (CINV) , the method comprising:(a) obtaining a sample from a subject planned for receiving the chemotherapy treatment;(b) genotyping the sample for single nucleotide polymorphism (SNP) variations in genes HTR3A, HTR3B, and TACR1;(c) retrieving a list of SNPs in genes of interest and their genome positions obtained froma human genome map of the version that matches genome positions used to generate a variant call format (VCF) file of a test sample;(d) searching each of the listed genome positions in the high through sequencing (HTS) results VCF file of the test sample;(e) confirming whether the genome position of the SNP in a gene of interest is listed in the VCF file of the test sample;(f) assigning a homozygote genotype if the genome position is not listed in the results VCF file of the test sample;(g) obtaining the genotype results of the SNP from the VCF file if the genome position is listed in the results VCF file;(h) selecting a personalized anti-emetic treatment based on the genotype; and(i) administering the personalized anti-emetic treatment to the subject.

Images