Compositions and methods for solid forms of ulixertinib
A solid dispersion form of ulixertinib, incorporating polymers and surfactants, addresses stability and solubility issues, enhancing drug delivery and shelf life by maintaining amorphous stability and improving bioavailability.
Patent Information
- Application Number
- PCT/US2025/029880
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-28
- Filing Date
- 2025-05-16
- Publication Date
- 2025-12-04
AI Technical Summary
Existing pharmaceutical compositions of ulixertinib, a MAPK pathway inhibitor, face challenges with instability, solubility, and bioavailability due to the specific crystalline form of the active pharmaceutical ingredient, limiting effective drug delivery and shelf life.
Development of a solid dispersion form of ulixertinib, characterized by amorphous content and inclusion of polymers like hydroxypropyl methylcellulose acetate succinate, with optional surfactants and release controlling agents, formulated into microgranules or pharmaceutical compositions to enhance solubility and stability.
The solid dispersion form of ulixertinib exhibits improved stability and solubility, maintaining amorphous state under stress conditions and enhancing bioavailability, facilitating effective drug delivery and prolonged shelf life.
Smart Images

Figure US2025029880_04122025_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS FOR SOLID FORMS OF ULIXERTINIB CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims benefit of U.S. Provisional Patent Application SerialNo. 63 / 652,520, filed on May 28, 2024, the entire content of which is hereby incorporated by reference. BACKGROUND
[0002] Mitogen-activated protein kinase (MAPK) pathways mediate signals which controldiverse cellular processes including growth, differentiation, migration, proliferation, and apoptosis. One MAPK pathway, the extracellular signal-regulated kinase (ERK) signaling pathway, is often found to be up-regulated in tumors. Pathway members, therefore, represent attractive blockade targets in the development of cancer therapies. For example, U.S. Patent No. 7,354,939 B2 discloses, inter alia, compounds effective as inhibitors of ERK protein kinase. One of these compounds, 4-(5-Chloro-2-isopropylaminopyridin- 4-yl)-1 H-pyrrole-2-carboxylic acid (S)-[1 -(3-chlorophenyl)-2-hydroxyethyl]amide (BVD-523 or ulixertinib), is a compound according to formula (I):
[0003] Pharmaceutical compositions are often formulated with a crystalline solid of theactive pharmaceutical ingredient (API). The specific crystalline form of the API can have significant effects on properties such as stability, manufacturability, hygroscopicity, solubility, dissolution rate, and bioavailability. Instability and solubility characteristics can limit the ability to formulate a composition with an adequate shelf life or to effectively deliver a desired amount of a drug over a given time frame.
[0004] There exists an unmet need for compositions comprising BVD-523 which exhibitimproved properties for formulation of pharmaceutical compositions. The present application is directed at meeting this and other needs. SUMMARY OF THE DISCLOSURE
[0005] According to some aspects, the present disclosure provides a solid dispersion formof ulixertinib. In some embodiments, from about 25% to about 100% by weight of the ulixertinib is amorphous according to Differential Scanning Calorimetry (DSC) or powder X-ray diffraction (XRPD). In some embodiments, the solid dispersion form of ulixertinib is characterized by an XRPD substantially similar to one or more of the XRPDs of Figures 2-7, 20-24, 28, 33, 35, 39, 46-52, 55-58, 60, 62-63, 66-69, 72-73, and 81-83. In some embodiments, the solid dispersion form of ulixertinib is characterized by a Thermogram substantially similar to Figures 8-19, 29, 34, 40, 53, 59, 61, 71, 74-75, and 88. In some embodiments, the form has the appearance of a single glass transition temperature (Tg). In some embodiments, a Tg of a form increases with an increased ulixertinib concentration. In some embodiments, the form when stressed at 40°C / 75% RH for at least 1 week, at least 4 weeks, or at least 6 weeks, is x-ray amorphous according to XRPD. In some embodiments, the form when stressed at 40°C / 75% RH for 3 months is x-ray amorphous according 2to XRPD. In some embodiments, the form when stressed at 40°C / 75% RH for 6 months is x-ray amorphous according to XRPD. In some embodiments, the form when stressed at 40°C / 75% RH for greater than 6 months is x-ray amorphous according to XRPD.
[0006] According to some aspects, the present disclosure provides a microgranulecomprising the solid dispersion form of ulixertinib as described herein. In some embodiments, the microgranule further comprises a polymer. In some embodiments, the polymer comprises one or more of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcellulose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Poly(methacrylic acid-co-methyl methacrylate) (1:1), Soluplus (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer) and combinations thereof. In some embodiments, the microgranule comprises 15-75 wt% of at least one polymer. In some embodiments, the microgranule comprises 40-60 wt% of at least one polymer. In some embodiments, the microgranule comprises 19-30 wt% of at least one polymer. In some embodiments, the microgranule comprises 42-44 wt% of at least one polymer. In some embodiments, the microgranule comprises equal amounts of ulixertinib and polymer. In some embodiments, the microgranule further comprises an intragranular release controlling agent. In some embodiments, the intragranular release controlling agent comprises between about 1 wt% to 3about 40 wt% of the microgranule. In some embodiments, the intragranular release controlling agent comprises between about 2 wt% to about 30 wt% of the microgranule. In some embodiments, the intragranular release controlling agent comprises about 4 wt% to about 22 wt% of the microgranule. In some embodiments, the intragranular release controlling agent comprises one or more pharmaceutically acceptable excipients. In some embodiments, one or more of a pharmaceutically acceptable excipient is selected from the group consisting of disintegrants, crospovidone, sodium starch glycolate, corn starch, microcrystalline cellulose, cellulosic derivatives, sodium bicarbonate, and sodium alginate and combinations thereof. In some embodiments, the microgranule further comprises a surfactant. In some embodiments, the surfactant is a non-ionic or anionic surfactant. In some embodiments, the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 10 wt% of the microgranule. In some embodiments, the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 1.5 wt% of the microgranule. In some embodiments, the non-ionic or anionic surfactant comprises about 1.0 wt% of the microgranule. In some embodiments, the non-ionic surfactant comprises a poloxamer. In some embodiments, the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS). In some embodiments, the microgranule further comprises an antioxidant. In some embodiments, the antioxidant is selected from the group consisting of butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT) and propyl gallate (PG). In some embodiments, the antioxidant comprises between about 0.1 wt% 4to about 3 wt% of the microgranule. In some embodiments, the antioxidant comprises between about 0.5 wt% to about 1 wt% of the microgranule.
[0007] According to some aspects the present disclosure provides a pharmaceuticalcomposition comprising the microgranule as disclosed herein. In some embodiments, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients. In some embodiments, the composition comprises a tablet, capsule, caplet, gelcap, geltab, or sachet. In some embodiments, the pharmaceutical composition comprises a disintegrant.
[0008] According to some aspects, the present disclosure provides a pharmaceuticalcomposition comprising solid dispersion (SD) ulixertinib, a polymer, a surfactant, and a release controlling agent. In some embodiments, the pharmaceutical composition comprises SD ulixertinib, HPMC-AS, SLS, and croscarmellose Na (CS). In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, caplet, gelcap, geltab, or sachet. In some embodiments, the pharmaceutical composition further comprises fillers, glidants and / or lubricants. In some embodiments, the composition comprises the formulation: Ingredients Solid Dispersion TabletsIntragranular Components % Formula mg / tabletMagnesium Stearate 0.30 1.5Total 100 500.0
[0009] According to some aspects, the present disclosure provides a process for producinga solid dispersion of ulixertinib comprising: a. obtaining a slurry or a solution of a solvent, ulixertinib, a polymer and a surfactant, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water; and b. spray drying the slurry or solution. In some embodiments, the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol.
[0010] According to some aspects, the present disclosure provides a process for producinga solid dispersion of ulixertinib comprising spray drying a slurry or a solution of a solvent, ulixertinib, HPMC-AS and poloxamer 407, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water. In some embodiments, the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol.
[0011] According to some aspects, the present disclosure provides a process for producinga solid dispersion form of ulixertinib comprising the steps listed in Figures 76 and 77.
[0012] According to some aspects, the present disclosure provides a solubility-enhancedcomposition comprising: an active agent which is 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H- pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) and pharmaceutically acceptable salts thereof, and a water soluble, biologically compatible polymer, wherein the solubility-enhanced composition is resistant to an undesirable form change. In some embodiments, the composition further comprises a surfactant. In some embodiments, the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a 6polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof. In some embodiments, the surfactant is SLS. In some embodiments, the water soluble, biologically compatible polymer is selected from the group consisting of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcellulose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Soluplus (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer), , Poly(methacrylic acid-co-methyl methacrylate) (1:1) and combinations thereof. In some embodiments, the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate. In some embodiments, the composition is selected from the group consisting of a solid amorphous dispersion, a lipid vehicle comprising said ulixertinib, a solid adsorbate comprising ulixertinib adsorbed onto a substrate, nanoparticles, adsorbates of ulixertinib in a crosslinked polymer, a nanosuspension, a supercooled form, an ulixertinib / cyclodextrin drug form, a soft gel form, a self-emulsifying form, a three-phase ulixertinib form, a crystalline highly soluble form, a high-energy crystalline form, a hydrate or 7solvate crystalline form, an amorphous form, a mixture of ulixertinib and a solubilizing agent, and a solution of said ulixertinib dissolved in a liquid. In some embodiments, the composition is a spray-dried dispersion. In some embodiments, the composition is an amorphous solid dispersion and the active agent is 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide and pharmaceutically acceptable salts thereof. In some embodiments, the undesirable form change is a conversion to Form A. In some embodiments, the composition comprises about 60% to about 90% by weight of the free base of ulixertinib. In some embodiments, the composition comprises about 70% to about 80% by weight of the free base of ulixertinib. In some embodiments, the composition comprises about 70% by weight of the free base of ulixertinib. In some embodiments, the composition comprises about 10% to about 40% by weight hydroxypropyl methylcellulose acetate succinate. In some embodiments, the composition comprises about 17.5% to about 22.5% by weight hydroxypropyl methylcellulose acetate succinate. In some embodiments, the composition comprises about 19% by weight hydroxypropyl methylcellulose acetate succinate. In some embodiments, the composition comprises about 29% by weight hydroxypropyl methylcellulose acetate succinate. In some embodiments, the composition comprises about 0.1% to about 5% by weight SLS. In some embodiments, the composition comprises about 0.5% to about 2% by weight SLS. In some embodiments, the composition comprises about 1% by weight SLS.
[0013] According to some aspects, the present disclosure provides a solid dispersioncomposition comprising: (a) from about 50% to about 90% by weight of 4-(5-chloro-2- isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2- hydroxyethyl]amide (ulixertinib) free base; (b) a water soluble, biologically compatible polymer; and a (c) surfactant, wherein from about 25% to about 100% by weight of the 8ulixertinib free base is non-crystalline, and wherein the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate.
[0014] According to some aspect, the present disclosure provides, a solid dispersioncomposition comprising: (a) about 70%-80% by weight of 4-(5-chloro-2-isopropylaminopyridin- 4-y1)-1H-pyrrole-2-carboxylic acid (S)- [1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base; (b) about 19%-29% by weight of hydroxypropyl methylcellulose acetate succinate; and (c) about 1% by weight of a surfactant.
[0015] In some embodiments, the surfactant is selected from the group consisting ofsodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof. In some embodiments, the surfactant is SLS. In some embodiments, the composition is an amorphous solid dispersion. In some embodiments, the composition is a spray dried dispersion.
[0016] According to some embodiments, the present disclosure provides a method offorming a solubility-enhanced pharmaceutical dosage form comprising the steps of: (a) providing a spray-dried amorphous dispersion comprising particles, the particles comprising 4-(5-chloro-2- isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2- hydroxyethyl]amide (ulixertinib) free base, a water soluble, biologically compatible polymer, and a surfactant, the dispersion having an average particle diameter of less than 100 µm; (b) performing one or more of blending, milling, de-lumping, and roller compacting of the particles; and (c) 9forming the pharmaceutical dosage form by compressing the product of step (b) to form a tablet or encapsulating the product of step (b) to form a capsule.
[0017] According to some aspects, the present disclosure provides a method ofmanufacturing a solubility-enhanced pharmaceutical dosage form, the method comprising the steps of: (a) providing a mixture of 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2- carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base, hydroxypropyl methylcellulose acetate succinate, and sodium lauryl sulfate (SLS), in a solvent or mixture of solvents; (b) spraying the mixture of step (a) to form a dispersion of droplets; (c) drying the solvent from the dispersion to form an amorphous solid dispersion, which substantially does not convert to Form A when in contact with an environment with a low pH and an elevated chloride concentration; and (d) forming the pharmaceutical dosage form by compressing the amorphous solid dispersion of step (c) to form a tablet or encapsulating the product of step (c) to form a capsule. As used herein, “substantially does not convert” means less than 1% of amorphous solid form converts to a crystalline form (e.g., Form A). In some embodiments, the solvent is an organic solvent. In some embodiments, the solvent is about 75% (vol) to about 100% (vol) acetone. In some embodiments, the solvent is about 90% (vol) acetone. In some embodiments, the solvent is about a 90:10 mixture of acetone and water (vol:vol).
[0018] According to some aspects, the present disclosure provides a pharmaceuticalcomposition comprising the composition as disclosed herein and optionally an agent selected from the group consisting of a binding agent, a diluent, a glidant, a disintegrant, a lubricant and combinations thereof. In some embodiments, the pharmaceutical composition disclosed herein is formulated as a tablet, capsule, caplet, gelcap, geltab, or sachet. 10
[0019] According to aspects, the present disclosure provides a method of treating a cancerin a subject in need thereof comprising administering to the subject an effective amount of a form as disclosed herein, a microgranule as disclosed herein, a pharmaceutical composition as disclosed herein, or a composition as disclosed herein. In some embodiments, the subject is a mammal. In some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals. In some embodiments, the mammal is a human. In some embodiments, the method further comprises administering to the subject at least one additional anti-cancer agent. In some embodiments, the at least one additional anti-cancer agent is selected from the group consisting of cabozantinib, lenvatinib, nivolumab, atezolizumab, venetoclax, alectinib, cobimetinib, daratumumab, elotuzumab, panobinostat, palbociclib, talimogene laherparepvec, pembrolizumab, lenvatinib, trifluridine, tipiracil, ixazomib, sonidegib, irinotecan, nivolumab, necitumumab, osimertinib, dinutuximab, rolapitant, uridine triacetate, trabectedin, netupitant, palonosetron, belinostat, blinatumomab, ramucirumab, ibrutinib, pembrolizumab, olaparib, idelalisib, ceritinib, obinutuzumab, afatinib, ibrutinib, ado-trastuzumab emtansine, trametinib, pomalidomide, lenalidomide, regorafenib, dabrafenib, mechlorethamine, denosumab, radium Ra 223 dichloride, paclitaxel, everolimus, everolimus, bosutinib, cabozantinib, vismodegib, ponatinib, axitinib, carfilzomib, vincristine sulfate, tbo-filgrastim, ingenol mebutate, regorafenib, fentanyl, omacetaxine mepesuccinate, pertuzumab, pazopanib, enzalutamide, ziv- aflibercept, brentuximab vedotin, everolimus, asparaginase Erwinia chrysanthemi, sunitinib, peginterferon alfa-2b, vandetanib, crizotinib, ipilimumab, vemurafenib, abiraterone, eribulin, trastuzumab, cabazitaxel, sipuleucel-T, denosumab, ondansetron, everolimus, ofatumumab, bevacizumab, Human Papillomavirus Bivalent (Types 16 and 18) Vaccine, rasburicase, pralatrexate, romidepsin, pazopanib, degarelix, levoleucovorin, plerixa, granisetron, 11bendamustine, raloxifene, topotecan, ixabepilone, nilotinib, temsirolimus, lapatinib, quadrivalent human papillomavirus (types 6, 11, 16, 18) vaccine, dasatinib, sunitinib, panitumumab, nelarabine, sorafenib, pemetrexed, bevacizumab, clofarabine, cetuximab, cinacalcet, erlotinib, OSI 774, palonosetron, bexxar, aprepitant, gefitinib, abarelix, conjugated estrogen, alfuzosin, bortezomib, oxaliplatin, leuprolide, 5- fluorouracil, leucovorin, fulvestrant, imatinib, neulasta, secretin, ibritumomab tiuxetan, zoledronic acid, campath, letrozole, imatinib, granisetron, triptorelin pamoate, xeloda, gemtuzumab ozogamicin, triptorelin pamoate, arsenic trioxide, leuprolide, aromasin, busulflex, doxorubicin, ellence, temodar, uvadex, zofran, amifostine, actiq, anzemet, camptosar, gemcitabine, herceptin, neupogen, nolvadex, photofrin, proleukin, sclerosol, valstar, xeloda, bromfenac, letrozole, polifeprosan 20, carmustine, interferon alfa-2b, granisetron, leuprolide, neumega, samarium Sm 153 lexidronam, rituxan, taxol, anexsia, pamidronate, anastrozole, campostar, flutamide, gemcitabine, topotecan, sargramostim, leuprolide, docetaxel, goserelin, amifostine, sargramostim, chloroquine, hydroxychloroquine, encorafenib, ruxolitinib, lonsurf, sotorasib, adagrasib, pharmaceutically acceptable salts thereof and combinations thereof. In some embodiments, the at least one additional anti-cancer agent is a BRAF inhibitor. In some embodiments, the BRAF inhibitor is selected from the group consisting of compound 7 2,,N ,, ,compound ,16,17, ,, , ,( ovarts); - ( m t oscences), Q- ( rQue), RQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 19(Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. In some embodiments, the BRAF inhibitor is vemurafenib or encorafenib. In some embodiments, the BRAF inhibitor is provided as a solid dispersion.
[0020] According to some aspects, the present disclosure provides a process for producinga solid dispersion form of ulixertinib comprising the steps of: (a) providing a spray solution preparation comprising ulixertinib, HPMCAS-M polymer, and SLS surfactant; and (b) spray drying the solution of step (a). In some embodiments, the spray solution preparation further comprises one or more of acetone and water. In some embodiments, the spray drying of step (b) comprises one or more of: a spray solution flow rate of 28 (±5) mL / minute or 25 (±5) g / minute; a spray solution atomization pressure of 28 (±5) psi; an inlet drying gas temperature of 103 (±20) ºC; an outlet drying gas temperature of 47 (±5) ºC; a drying gas flow rate of about 35 kg / h; and a condenser outlet temperature of -20 (±5) ºC. In some embodiments, the process further comprises the step of: (c) performing a secondary drying. In some embodiments, the secondary drying comprises a drying temperature set point of 40 ºC. 20
[0021] According to some aspects, the present disclosure provides a process for producinga solid dispersion form of ulixertinib comprising the steps of: (a) blending a composition of 70:29:1 ulixertinib:HPMCAS-M:SLS (SDI) with one or more of Avicel PH 102 (MCC), Partek M100 (Mannitol), Cab-o-sil M-5P (Colloidal silica), and Ac-Di-Sol (CCS). In some embodiments, the process further comprises the step of (b) milling the blend of step (a) effective to deagglomerate the blended composition. In some embodiments, the process further comprises the step of (c) blending the product of step (b). In some embodiments, the process further comprises the step of (d) blending the product of step (c) to lubricate the product of step (c). In some embodiments, the process further comprises the step of (e) compressing the blended product of step (d) to produce a tablet. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1A shows XRPD Diffractogram of BVD-523 Free Base; Figure 1B showsXRPD Diffractogram of BVD-523 HCl salt Form A; Figure 1C shows XRPD Diffractogram of BVD-523 HCl salt Form C.
[0023] Figure 2 shows XRPD patterns of BVD-523 / Eudragit L100 dispersions by flashevaporation under vacuum.
[0024] Figure 3 shows XRPD patterns of BVD-523 / HPMC-AS MG dispersions by flashevaporation under vacuum.
[0025] Figure 4 shows XRPD patterns of BVD-523 / HPMC-P dispersions by flashevaporation under vacuum. 21
[0026] Figure 5 shows XRPD patterns of BVD-523 / PVP K-90 dispersions by flashevaporation under vacuum.
[0027] Figure 6 shows XRPD patterns of BVD-523 / PVP-co-VA dispersions by flashevaporation under vacuum.
[0028] Figure 7 shows XRPD patterns of BVD-523 / Soluplus dispersions by flashevaporation under vacuum.
[0029] Figure 8 shows mDSC thermogram of 50:50 (w / w) BVD-523 / Eudragit L100dispersion.
[0030] Figure 9 shows mDSC thermogram of 90:10 (w / w) BVD-523 / Eudragit L100dispersion.
[0031] Figure 10 shows mDSC thermogram of 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion.
[0032] Figure 11 shows mDSC thermogram of 90:10 (w / w) BVD-523 / HPMC-AS MGdispersion.
[0033] Figure 12 shows mDSC thermogram of 50:50 (w / w) BVD-523 / HPMC-Pdispersion.
[0034] Figure 13 shows mDSC thermogram of 90:10 (w / w) BVD-523 / HPMC-Pdispersion.
[0035] Figure 14 shows mDSC thermogram of 50:50 (w / w) BVD-523 / PVP K-90dispersion.
[0036] Figure 15 shows mDSC thermogram of 90:10 (w / w) BVD-523 / PVP K-90dispersion. 22
[0037] Figure 16 shows mDSC thermogram of 50:50 (w / w) BVD-523 / PVP-co-VAdispersion.
[0038] Figure 17 shows mDSC thermogram of 90:10 (w / w) BVD-523 / PVP-co-VAdispersions.
[0039] Figure 18 shows mDSC thermogram of 50:50 (w / w) BVD-523 / Soluplus dispersion.
[0040] Figure 19 shows mDSC thermogram of 90:10 (w / w) BVD-523 / Soluplus dispersion.
[0041] Figure 20 shows an overlay of XRPD patterns of BVD-523 / Eudragit L100dispersions pre- and post-stress.
[0042] Figure 21 shows an overlay of XRPD patterns of BVD-523 / HPMC-AS MGdispersions pre- and post-stress.
[0043] Figure 22 shows an overlay of XRPD patterns of BVD-523 / HPMC-P dispersionspre- and post-stress.
[0044] Figure 23 shows an overlay of XRPD patterns of BVD-523 / PVP K-90 dispersionspre- and post-stress.
[0045] Figure 24 shows an overlay of XRPD patterns of BVD-523 / PVP-co-VAdispersions pre- and post-stress.
[0046] Figure 25 shows microscopy images for BVD-523 dispersions stressed in pH 2medium at 37 ºC.
[0047] Figure 26 shows microscopy images for BVD-523 dispersions stressed in pH 6.5FaSSIF at 37 ºC.
[0048] Figure 27 shows microscopy images for BVD-523 dispersions stressed in dosingvehicle at ambient temperature. 23
[0049] Figure 28 shows XRPD pattern of 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion by spray drying.
[0050] Figure 29 shows mDSC thermogram of 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion by spray drying.
[0051] Figure 30 shows a TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion by spray drying.
[0052] Figure 31 shows TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion by spray drying.
[0053] Figure 32 shows TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-AS MGdispersion by spray drying.
[0054] Figure 33 shows the XRPD pattern of 50:50 (w / w) BVD-523 / HPMC-P dispersionby spray drying.
[0055] Figure 34 shows mDSC thermogram of 50:50 (w / w) BVD-523 / HPMC-P dispersionby spray drying.
[0056] Figure 35 shows XRPD pattern of 50:50 (w / w) BVD-523 / HPMC-P dispersion post-stress in pH 2.0 medium at 37 °C for 6 h.
[0057] Figure 36 shows TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-P dispersion byspray drying.
[0058] Figure 37 shows TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-P dispersion byspray drying.
[0059] Figure 38 shows TG-IR analysis for 50:50 (w / w) BVD-523 / HPMC-P dispersion byspray drying. 24
[0060] Figure 39 shows XRPD pattern of 50:50 (w / w) BVD-523 / PVP K-90 dispersion byspray drying.
[0061] Figure 40 shows mDSC thermogram of 50:50 (w / w) BVD-523 / PVP K-90dispersion by spray drying.
[0062] Figure 41 shows TG-IR analysis for 50:50 (w / w) BVD-523 / PVP K-90 dispersionby spray drying.
[0063] Figure 42 shows TG-IR analysis for 50:50 (w / w) BVD-523 / PVP K-90 dispersionby spray drying.
[0064] Figure 43 shows TG-IR analysis for 50:50 (w / w) BVD-523 / PVP K-90 dispersionby spray drying.
[0065] Figure 44 shows dissolution profiles of BVD-523 dispersions and salts in pH 1.6FaSSGF – 30 min.
[0066] Figure 45 shows dissolution profiles of BVD-523 dispersions and salts in pH 6.5FaSSIF –5 h.
[0067] Figure 46 shows XRPD patterns of post-dissolution solids of BVD-523 dispersionsfrom FaSSGF.
[0068] Figure 47 shows XRPD patterns of post-dissolution solids BVD-523 dispersionsfrom FaSSIF.
[0069] Figure 48 shows XRPD patterns of post-dissolution solids of BVD-523 malonatesalt.
[0070] Figure 49 shows XRPD patterns of post-dissolution solids of BVD-523 HCl salt.
[0071] Figure 50 shows XRPD patterns of post-dissolution solids of BVD-523 HCl saltafter exposed to ambient RH. 25
[0072] Figure 51 shows microscopy images for BVD-523 dispersions stressed in dosingvehicle at ambient temperature.
[0073] Figure 52 shows XRPD Patterns of BVD-523:HPMC-AS Binary Dispersions.
[0074] Figure 53 shows mDSC Thermograms for BVD-523:HPMC-AS BinaryDispersions.
[0075] Figure 54 shows TGA Thermograms of BVD-523:HPMC-AS Binary Dispersions.
[0076] Figure 55 shows XRPD Patterns of BVD-523:HPMC-AS Binary Dispersions, 24-Hour pH 2 HCl Slurry.
[0077] Figure 56 shows XRPD Patterns of 80:20 BVD-523:HPMC-AS Dispersion, 2-HourpH 2 HCl Slurry.
[0078] Figure 57 shows XRPD Patterns of 60:40 BVD-523:HPMC-AS Dispersion, 2-HourpH 2 HCl Slurry.
[0079] Figure 58 shows XRPD Patterns of 80:20 BVD-523:HPMC-AS TernaryDispersions with Poloxamer 407.
[0080] Figure 59 shows mDSC Thermograms of 80:20 BVD-523:HPMC-AS TernaryDispersions with Poloxamer 407.
[0081] Figure 60 shows XRPD Patterns of 80:20 BVD-523:HPMC-AS TernaryDispersions with SLS.
[0082] Figure 61 shows mDSC Thermograms of 80:20 BVD-523:HPMC-AS TernaryDispersions with SLS.
[0083] Figure 62 shows XRPD Patterns of BVD-523 Ternary Dispersions with Poloxamer407, 2-Hour pH 2 HCl Slurry. 26
[0084] Figure 63 shows XRPD Patterns of BVD-523 Ternary Dispersions with SLS, 2-Hour pH 2 HCl Slurry.
[0085] Figure 64 shows Dissolution Profiles in pH 1.6 FaSSGF (non-cGMP).
[0086] Figure 65 shows Dissolution Profiles in pH 6.5 FaSSIF.
[0087] Figure 66 shows XRPD Pattern of BVD-523 with 1% SLS, 30-min FaSSGF Slurry.
[0088] Figure 67 shows XRPD Pattern of BVD-523 HCl, 30-Minute FaSSGF Slurry.
[0089] Figure 68 shows XRPD Pattern of BVD-523 with 1% SLS, 6-Hour FaSSIF Slurry.
[0090] Figure 69 shows XRPD Pattern of BVD-523 HCl, 6-Hour FaSSIF Slurry.
[0091] Figure 70 shows Dissolution profiles of Crystalline BVD-523 and BVD-523 SolidDispersions.
[0092] Figure 71 shows Thermal analysis (mDSC) of BVD-523 Ternary Dispersions.
[0093] Figure 72 shows PXRD Difractrograms of the BVD-523 Ternary Dispersions.
[0094] Figure 73 shows XRD Analysis of BVD-523 Ternary Dispersion Stability Samples.
[0095] Figure 74 shows Thermal analysis (mDSC) of 70:29:1 BVD-523:HPMCAS-M:SLS Stability Samples Stored at Accelerated Conditions (40 °C / 75% RH).
[0096] Figure 75 shows Thermal Analysis (mDSC) of 80:19:1 BVD-523:HPMCAS-M:SLS Stability Samples Stored at Accelerated Conditions (40 °C / 75% RH).
[0097] Figure 76 shows the manufacture of the BVD-523 solid dispersion microgranules.
[0098] Figure 77 shows the manufacturing process for BVD-523 solid dispersion tablets.
[0099] Figure 78 shows Dissolution of BVD-523 Solid Dispersion Tablet in 0.01N HClwith 0.5% SLS.
[0100] Figure 79 shows Kinetic Solubility of BVD-523 in FaSSIF Media ContainingPolymer (20:80 BVD-523:Polymer). 27
[0101] Figure 80 shows Kinetic Solubility of BVD-523 in FaSSIF Media (0.5 mg / mL)Containing Polymer (50:50 BVD-523:Polymer).
[0102] Figure 81 shows XRPD Diffractograms of BVD-523 Solid Dispersions (25:75BVD-523:Polymer).
[0103] Figure 82 shows XRPD Diffractograms of BVD-523 Solid Dispersions (50:50BVD-523:Polymer).
[0104] Figure 83 shows XRPD Diffractogram of BVD-523 Solid Dispersion with HPMCPHP-55 (75:25 BVD-523:Polymer).
[0105] Figure 84 shows Fasted State Non-Sink Dissolution Test for BVD-523 AmorphousSolid Dispersions.
[0106] Figure 85 shows Fed State Non-Sink Dissolution Test for BVD-523 AmorphousSolid Dispersions.
[0107] Figure 86 shows Fasted State Non-Sink Dissolution of BVD-523 Amorphous SolidDispersions and Crystalline BVD-523 Free Base.
[0108] Figure 87 shows Fed State Non-Sink Dissolution of BVD-523 Amorphous SolidDispersions and Crystalline BVD-523 Free Base.
[0109] Figure 88 shows mDSC Scans of BVD-523 Amorphous Solid Dispersions (50:50BVD-523:Polymer).
[0110] Figure 89 shows SEM Images of BVD-523 Amorphous Solid Dispersions (50:50BVD-523:Polymer).
[0111] Figure 90 shows water adsorption profile of the 50:50 BVD-523:Polymer soliddispersions analyzed by DVS to measure the percent weight gain in response to changes in humidity. 28DETAILED DESCRIPTION
[0112] According to some aspects, the present disclosure provides a solid dispersion ofamorphous BVD-523 having the properties of improved solubility and absorption, and pharmaceutical compositions containing the solid dispersion.
[0113] As disclosed herein, BVD-523 is an ERK1 / 2 inhibitor having a structure accordingto formula (I):
[0114] and pharmaceutic. y be synthesized according tothe methods disclosed in, e.g., U.S. Pat. No.7,354,939. The mechanism of action of BVD-523 is believed to be, inter alia, unique and distinct from certain other ERK1 / 2 inhibitors, such as SCH772984. For example, SCH772984 inhibits autophosphorylation of ERK, whereas BVD-523 allows for the autophosphorylation of ERK while still inhibiting ERK. This is important, inter alia, because it is believed that the properties of BVD-523 allows for dissociation of multiple signaling pathways, for example, by controlling cell proliferation without substantially affecting cell death.
[0115] In some embodiments, the present disclosure provides (1) a pharmaceuticalcomposition which improves solubility and absorption of BVD-523, (2) a pharmaceutical composition which has rapid disintegrating property and dispersibility of BVD-523 when said 29pharmaceutical composition (tablet and the like) is used, and (3) a process of manufacturing the pharmaceutical compositions having these characteristics.
[0116] In some embodiments, the compositions and / or dosage forms disclosed hereinprovide unusually large enhancements in aqueous concentration in an environment of use. In some embodiments, these compositions also provide the opportunity to dose the entire daily therapeutic dose of BVD-523 in a single dosage unit, by improving the oral bioavailability of the drug. Amorphous BVD-523
[0117] In some embodiments, BVD-523 is amorphous (i.e., in a non-crystallinestate). Amorphous BVD-523 dissolves more quickly and to a greater extent than crystalline BVD- 523 in an aqueous use environment, such as an aqueous dissolution medium of an in vitro dissolution test (e.g., phosphate buffered saline, or model fasted intestinal fluid or simulated gastric fluid) or the in vivo environment of the stomach or small intestine. This enhanced dissolution results in higher BVD-523 oral bioavailability, compared to crystalline drug. Examples of a crystalline form of BVD-523, which can be characterized by the powder x-ray diffraction pattern, include a free base form (Figure 1A), Form A (Figure 1B), and Form C (Figure 1C.)
[0118] In some embodiments, BVD-523 is greater than 80% amorphous (i.e., containingless than 20% crystalline BVD-523). In some embodiments, BVD-523 is greater than 90% amorphous (i.e., containing less than 10% crystalline BVD-523). In some embodiments, BVD-523 is greater than 95% amorphous (i.e., containing less than 5% crystalline BVD-523). In some embodiments, BVD-523 exhibits no crystalline character when measured by powder x-ray diffraction, by low angle x-ray scattering, or by13C-NMR.
[0119] Amorphous BVD-523 may be prepared by any known means, including spray-drying, hot melt extrusion, and precipitation from solution on addition of an anti-solvent. 30Pharmaceutical Compositions
[0120] The exact amount (effective dose) of BVD-523 will vary from subject to subject,depending on, for example, the species, age, weight and general or clinical condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, the method and scheduling of administration, and the like.
[0121] The particular mode of administration and the dosage regimen will be selected bythe attending clinician, taking into account the particulars of the case (e.g., the subject, the disease, the disease state involved, and whether the treatment is prophylactic). Treatment may involve daily or multi-daily doses of compound(s) over a period of a few days to months, or even years.
[0122] In general, a suitable, non-limiting example of a dosage of BVD-523 disclosedherein is from about 1 mg / kg to about 24 mg / kg body weight per day, such as from about 1 mg / kg to about 12.5 mg / kg per day. Other representative dosages include about 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, or 20 mg / kg body weight per day. In some embodiments, a suitable dose of BVD-523 is from about 1 mg BID to about 1000 mg BID, such as from about 1 mg BID to about 1200 mg BID, 75 mg BID to about 300 mg BID, including from about 1 mg BID to about 100 mg BID. Other representative dosages include about 1 mg BID, 5 mg BID, 10 mg BID, 15 mg BID, 20 mg BID, 25 mg BID, 30 mg BID, 35 mg BID, 40 mg BID, 45 mg BID, 50 mg BID, 60 mg BID, 70 mg BID, 75 mg BID, 80 mg BID, 90 mg BID, 100 mg BID, 125 mg BID, 150 mg BID, 175 mg BID, 200 mg BID, 250 mg BID, 300 mg BID, 400 mg BID, 500 mg BID, 600 mg BID, 700 mg BID, 800 mg BID, 900 mg BID, and 1000 mg BID. 31
[0123] BVD-523 conveniently administered in unit dosage form; for example, containing1 mg to about 1000 mg, such as from about 3 mg to about 800 mg, 5 mg to about 700 mg, including from about 10 mg to about 600 mg. Other representative examples include about 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 75 mg, 80 mg, 90 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 250 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, and 1000 mg per unit dosage form.
[0124] BVD-523 may conveniently be presented in a single dose or as divided dosesadministered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations.
[0125] In some embodiments, compositions comprise amorphous BVD-523 and aconcentration-enhancing polymer. In some embodiments, compositions comprise amorphous BVD-523 and more than one concentration-enhancing polymer.
[0126] Amorphous BVD-523 and a concentration-enhancing polymer may be physicallymixed, that is the two materials, as separate powders, may be blended by methods known in the pharmaceutical arts, including dry-blending, dry-granulation, and wet granulation.
[0127] In some embodiments, compositions comprise solid amorphous dispersions ofBVD-523 and a polymer that is effective to increase the concentration of BVD-523 in in vivo or in vitro systems (i.e. “concentration-enhancing polymer”). In some embodiments, at least a major portion of the BVD-523 in the composition is amorphous. As used herein, the term “a major portion” of the BVD-523 means that at least 60% of the BVD-523 in the composition is in the amorphous form, rather than the crystalline form. In some embodiments, the BVD-523 in the dispersion is substantially amorphous. As used herein, “substantially amorphous” means that 32the amount of the BVD-523 in crystalline form does not exceed about 20%. In some embodiments, the BVD-523 in the dispersion is “almost completely amorphous,” meaning that the amount of BVD-523 in the crystalline form does not exceed about 10%. Amounts of crystalline BVD-523 may be measured by powder X-ray diffraction, low angle x-ray scattering, differential scanning calorimetry (DSC), solid state 13C-NMR, or any other standard quantitative measurement.
[0128] Compositions may contain from about 1 to about 90 wt % BVD-523, depending onthe dose of the drug and the effectiveness of the concentration-enhancing polymer. Enhancement of aqueous BVD-523 concentrations and relative bioavailability are typically best when BVD-523 levels in the dispersion are less than about 85 wt %. In some embodiments, dispersions comprise greater than 20 wt % and less than 85 wt % BVD-523. In some embodiments, dispersions comprise greater than 25 wt % and less than 85 wt % BVD-523. In some embodiments, dispersions comprise greater than 50 wt % and less than 80 wt % BVD-523.
[0129] Amorphous BVD-523 can exist within the solid amorphous dispersion as a purephase, as a solid solution of BVD-523 homogeneously distributed throughout the polymer, or any combination of these states or states that lie intermediate between them.
[0130] In some embodiments, the dispersion is substantially homogeneous so thatthe amorphous BVD-523 is dispersed as homogeneously as possible throughout the polymer. “Substantially homogeneous” means that the fraction of BVD-523 that is present in relatively pure amorphous domains within the solid dispersion is relatively small, on the order of less than 20%, and in some embodiments, less than 10% of the total amount of BVD-523.
[0131] In some embodiments, the solid amorphous dispersion may have some BVD-523-rich domains. In some embodiments, the dispersion itself has a single glass transition temperature (Tg) which demonstrates that the dispersion is substantially homogeneous. This contrasts with a 33simple physical mixture of pure amorphous BVD-523 particles and pure amorphous polymer particles which generally displays two distinct glass transition temperatures, one that of BVD-523 and one that of the polymer. Tg as used herein is the characteristic temperature where a glassy material, upon gradual heating, undergoes a relatively rapid (e.g., 10 to 100 seconds) physical change from a glass state to a rubber state. The Tg of an amorphous material such as a polymer, drug or dispersion can be measured by several techniques, including by a dynamic mechanical analyzer (DMA), a dilatometer, dielectric analyzer, and by a differential scanning calorimeter (DSC). The exact values measured by each technique can vary somewhat but usually fall within 10° to 30° C. of each other. Regardless of the technique used, when an amorphous dispersion exhibits a single Tg, this indicates that the dispersion is substantially homogenous.
[0132] Dispersions that are substantially homogeneous generally are more physicallystable and have improved concentration-enhancing properties and, in turn, improved bioavailability, relative to nonhomogeneous dispersions.
[0133] Compositions comprising BVD-523 and a concentration-enhancing polymerprovide increased concentration of the dissolved BVD-523 in in vitro dissolution tests. It has been determined that enhanced drug concentration in in vitro dissolution tests in fasted-state simulated intestinal fluid (FaSSIF), simulated gastric fluid (SGF), or Phosphate Buffered Saline (PBS) is a good indicator of in vivo performance and bioavailability. In some embodiments, an appropriate PBS solution is an aqueous solution comprising 20 mM sodium phosphate (Na2HPO4), 47 mM potassium phosphate (KH2PO4), 87 mM NaCl,0.2 mM KCl, and adjusted to pH 6.5 with NaOH. An appropriate FaSSIF solution is an aqueous solution comprising 3.0 mM sodium taurocholate, 0.2 mM lecithin, 68.6 mM sodium chloride (NaCl), 19.1 mM maleic acid, 34.8 mM sodium 34hydroxide (NaOH) and adjusted to pH 5.8 with aqueous HCl or NaOH. An appropriate FaSSGF solution consists of 0.08 mM sodium taurocholate, 0.02 mM lecithin, 34.2 mM sodium chloride (NaCl), 25.1 mM hydrochloric acid (HCl), 0.1 mg / mL (1.35 units / mg) pepsin, and adjusted to pH 1.6 with aqueous HCl or NaOH. A composition can be dissolution-tested by adding it to FaSSIF, FaSSGF, or PBS solution and agitating to promote dissolution. Generally, the amount of composition added to the solution in such a test is an amount that, if all the drug in the composition dissolved, would produce a BVD-523 concentration that is at least about 2-fold and, in some embodiments, at least 5-fold the equilibrium solubility of the crystalline BVD-523 alone in the test solution. It some embodiments, fed-state simulated intestinal fluid (FeSSIF) and fed-state simulated gastric fluid (FeSSGF) were also tested due to positive food effects with BVD-523. In some embodiments, an appropriate FeSSGF composition comprises 237.0 mM NaCl, 17.1 mM acetic acid (AcOH), 29.8 mM sodium acetate (NaOAc), 1:1 Ensure Plus:Buffer and adjusted to pH 6.3 with HCl or NaOH. In some embodiments, an appropriate FeSSIF comprises 10.0 mM sodium taurocholate, 2.0 mM lecithin, 125.5 mM NaCl, 55.0 mM maleic acid, 81.7 mM NaOH, 5.0 mM glycerol monooleate, 0.8 mM sodium oleate and adjusted to pH 6.8 with HCl or NaOH.
[0134] In some embodiments, compositions provide a Maximum Drug Concentration(MDC) that is at least about 2-fold the maximum concentration of a control composition comprising an equivalent quantity of crystalline BVD-523 but free from the concentration- enhancing polymer, during the first 210 minutes after dosing the dispersion into the in vitro medium. In some embodiments, the MDC of BVD-523 achieved with the compositions is at least about 5-fold the maximum concentration of the control composition. In some embodiments, the MDC of BVD-523 achieved with the compositions is at least about 10-fold the maximum concentration of the control composition. 35
[0135] In some embodiments, compositions disclosed herein provide a BVD-523concentration versus time Area Under the Curve (AUC) that is greater than crystalline BVD-523 control. In some embodiments, the compositions disclosed herein provide an AUC of BVD-523that is at least 1.5-fold, 2-fold, 2.5-fold, or 3-fold the AUC of a control composition comprising anequivalent quantity of undispersed crystalline BVD-523. Such large enhancements in aqueousconcentration versus time AUC values are surprising given the extremely low aqueous solubilityand hydrophobicity of BVD-523.
[0136] The concentration of dissolved BVD-523 is typically measured as a function oftime by sampling the test medium and plotting BVD-523 concentration in the test medium vs. time so that the MDC can be ascertained. The MDC is taken to be the maximum value of dissolved BVD-523 measured over the duration of the test. The aqueous concentration of the BVD-523versus time AUC is calculated by integrating the concentration versus time curve over any timeperiod staring at the time of introduction of the composition into the aqueous use environment (time equals zero).
[0137] In some embodiments, when dosed orally to a human or other mammal,compositions provide an area under the plasma BVD-523 concentration versus time curve (AUC) that is at least about 1.25-fold that observed when a control composition comprising an equivalent quantity of crystalline drug is dosed. It is noted that such compositions can also be said to have a relative bioavailability of at least about 1.25. In some embodiments, compositions dosed orally to a human or other animal provide a plasma BVD-523 AUC that is at least about 2-fold that observed when a control composition comprising an equivalent quantity of crystalline drug is dosed. In some embodiments, the in vivo AUC is as described below. The compositions can be evaluated in either in vitro or in vivo tests, or both. 36
[0138] Relative bioavailability of BVD-523 in the dispersions can be tested in vivo inanimals or humans using conventional methods for making such a determination. In some embodiments, the relative bioavailability is measured as the area under the plasma drug concentration versus time curve (AUC) determined for the test group divided by the plasma AUC provided by the control composition. In some embodiments, this test / control ratio is determined for each subject, and then the ratios are averaged over all subjects in the study. In some embodiments, in vivo determinations of AUC can be made by plotting the plasma concentration of drug along the ordinate (y-axis) against time along the abscissa (x-axis), and using the trapezoidal rule method.
[0139] In some embodiments, the relative bioavailability of the test composition is at leastabout 1.25 relative to a control composition comprised of crystalline BVD-523 but with no concentration-enhancing polymer as described above. (That is, the in vivo AUC provided by the test composition is at least about 1.25-fold the in vivo AUC provided by the control composition.) In some embodiments, the relative bioavailability of the test composition is at least about 2, relative to a control composition composed of crystalline BVD-523 but with no concentration-enhancing polymer present, as described above. The determination of AUCs is a well-known procedure and is described, for example, in Welling, “Pharmacokinetics Processes and Mathematics,” ACS Monograph 185 (1986), which is incorporated by reference as if recited in full herein.
[0140] Inspection of the plasma BVD-523 concentration versus time curves for the dosedsubjects will give the maximum BVD-523 concentration Cmax achieved during the post-dose period. A mean Cmaxcan be calculated for the cohort of subjects. In some embodiments, this disclosure provides a pharmaceutical composition comprising a solid amorphous dispersion of BVD-523 and a concentration-enhancing polymer effective to provide a Cmaxgreater than 700 37ng / mL, when a dose of 5 mg / kg is given to a subject. In some embodiments, the average Cmaxfor an amorphous spray dried composition comprising 70:29:1 BVD-523:HPMCAS-M:SLS is greater than 700 ng / mL. In some embodiments, the average Cmaxfor an amorphous spray dried composition comprising 50:50 API:HPMC-AS MG is greater than 500 ng / mL. In some embodiments, the average Cmax for an amorphous spray dried composition comprising 50:50 API:HPMCP is greater than 400 ng / mL. Concentration-Enhancing Polymers
[0141] Concentration-enhancing polymers suitable for use in the compositions are inert, inthat they do not chemically react with BVD-523, are pharmaceutically acceptable (i.e. are non- toxic), and have at least some solubility in aqueous solution at physiologically relevant pHs (e.g. 1-8). The concentration-enhancing polymer can be neutral or ionizable, and should have an aqueous-solubility of at least 0.1 mg / mL over at least a portion of the pH range of 1-8.
[0142] A polymer is a “concentration-enhancing polymer” if it meets at least one, or, insome embodiments, both, of the following conditions. The first condition is that the concentration- enhancing polymer increases the in vitro MDC of BVD-523 in the environment of use relative to a control composition consisting of an equivalent amount of crystalline BVD-523 but no polymer. That is, once the composition is introduced into an environment of use, the polymer increases the aqueous concentration of BVD-523 relative to the control composition. In some embodiments, the polymer increases the MDC of BVD-523 in aqueous solution by at least 2-fold relative to a control composition; in some embodiments, by at least 5-fold; in some embodiments, by at least 10-fold.The second condition is that the concentration-enhancing polymer increases the AUC of the BVD-523 in the in vitro or in vivo environment of use relative to a control composition consisting of BVD-523 but no polymer as described above. That is, in the environment of use, the composition 38comprising the BVD-523 and the concentration-enhancing polymer provides an area under the concentration versus time curve (AUC) for any period that is at least 1.5-fold that of a control composition comprising an equivalent quantity of BVD-523 but no polymer. In some embodiments, the AUC provided by the composition is at least 3-fold; in some embodiments, at least 3-fold that of the control composition.
[0143] In some embodiments, concentration-enhancing polymers may be cellulosic ornon-cellulosic. In some embodiments, the polymers may be neutral or ionizable in aqueous solution. In some embodiments, polymers are ionizable and cellulosic. In some embodiments, polymers are ionizable cellulosic polymers.
[0144] In some embodiments, polymers are “amphiphilic” in nature, meaning that thepolymer has hydrophobic and hydrophilic portions. The hydrophobic portion may comprise groups such as aliphatic or aromatic hydrocarbon groups. The hydrophilic portion may comprise either ionizable or non-ionizable groups that are capable of hydrogen bonding such as hydroxyls, carboxylic acids, esters, amines or amides. The relative contents of hydrophobic, ionizable hydrophilic, and non-ionizable hydrophilic groups in the polymer can be optimized to provide improved functionality as a concentration-enhancing polymer.
[0145] In some embodiments, amphiphilic polymers may have relatively stronginteractions with BVD-523 and may promote the formation of various types of polymer / drug assemblies in the use environment. In addition, the repulsion of the like charges of ionized groups of such polymers may serve to limit the size of the polymer / drug assemblies to the nanometer or submicron scale. For example, while not wishing to be bound by a particular theory, such polymer / drug assemblies may comprise hydrophobic BVD-523 clusters surrounded by the polymer with the polymer's hydrophobic regions turned inward towards BVD-523 and the 39hydrophilic regions of the polymer turned outward toward the aqueous environment. Alternatively, the polar functional groups of the polymer may associate, for example, via hydrogen bonds, with polar groups of the BVD-523. In the case of ionizable polymers, the hydrophilic regions of the polymer would include the ionized functional groups. Such polymer / drug assemblies in solution may well resemble charged polymeric micellar-like structures. In any case, regardless of the mechanism of action, in some embodiments the amphiphilic polymers, such as ionizable cellulosicpolymers, improve the MDC and / or AUC of BVD-523 in aqueous solution in vitro or in vivorelative to crystalline control compositions free from such polymers.
[0146] Surprisingly, one or more of the polymers disclosed herein can greatly enhance themaximum concentration of BVD-523 obtained when BVD-523 is dosed to a use environment. In addition, such polymers interact with BVD-523 to prevent the precipitation or crystallization of the BVD-523 from solution despite its concentration being substantially above its equilibrium concentration. In some embodiments, when the compositions are solid amorphous dispersions of BVD-523 and the concentration-enhancing polymer, the compositions provide a greatly enhanced drug concentration, particularly when the dispersions are substantially homogeneous. In some embodiments, the maximum drug concentration may be 2-fold and often more than 5-fold the equilibrium concentration of the crystalline BVD-523. Such enhanced BVD-523 concentrations in turn lead to substantially enhanced relative bioavailability for BVD-523.
[0147] In some embodiments, polymers comprise neutral non-cellulosic polymers,including, but not limited to, vinyl polymers and copolymers having substituents of hydroxyl, alkylacyloxy, and cyclicamido polyvinyl alcohols that have at least a portion of their repeat units in the unhydrolyzed (vinyl acetate) form; polyvinyl alcohol polyvinyl acetate copolymers; 40polyvinyl pyrrolidone; polyvinylpyrrolidone vinyl acetate; and polyethylene polyvinyl alcohol copolymers.
[0148] In some embodiments, polymers comprise ionizable non-cellulosic polymers,including, but not limited to, carboxylic acid-functionalized vinyl polymers, such as the carboxylic acid functionalized polymethacrylates and carboxylic acid functionalized polyacrylates such as the EUDRAGITS® manufactured by Rohm Tech Inc., of Malden, Mass.; amine-functionalized polyacrylates and polymethacrylates; proteins; and carboxylic acid functionalized starches such as starch glycolate.
[0149] In some embodiments, non-cellulosic polymers that are amphiphilic arecopolymers of a relatively hydrophilic and a relatively hydrophobic monomer. Examples include acrylate and methacrylate copolymers. Commercial grades of such copolymers include the EUDRAGITS®, which are copolymers of methacrylates and acrylates; and graft copolymers of polyethyleneglycol, polyvinylcaprolactam, and polyvinylacetate, one commercially available version of a graft copolymer known as SOLUPLUS®.
[0150] In some embodiments, polymers comprise ionizable and neutral cellulosicpolymers with at least one ester- and / or ether-linked substituent, in which the polymer has a degree of substitution of at least 0.1 for each substituent. In the polymer nomenclature used herein, ether- linked substituents are recited prior to “cellulose” as the moiety attached to the ether group; for example, “ethylbenzoic acid cellulose” has ethoxybenzoic acid substituents. Analogously, ester- linked substituents are recited after “cellulose” as the carboxylate; for example, “cellulose phthalate” has one carboxylic acid of each phthalate moiety ester-linked to the polymer and the other carboxylic acid unreacted. 41
[0151] As used herein, a polymer name such as “cellulose acetate phthalate” (CAP) refersto any of the family of cellulosic polymers that have acetate and phthalate groups attached via ester linkages to a significant fraction of the cellulosic polymer's hydroxyl groups. Generally, the degree of substitution of each substituent group can range from 0.1 to 2.9 as long as the other criteria of the polymer are met. “Degree of substitution” refers to the average number of the three hydroxyls per saccharide repeat unit on the cellulose chain that have been substituted. For example, if all of the hydroxyls on the cellulose chain have been phthalate substituted, the phthalate degree of substitution is 3. Also included within each polymer family type are cellulosic polymers that have additional substituents added in relatively small amounts that do not substantially alter the performance of the polymer.
[0152] In some embodiments, amphiphilic cellulosics may be prepared by substituting thecellulose at any or all of the 3 hydroxyl substituents present on each saccharide repeat unit with at least one relatively hydrophobic substituent. Hydrophobic substituents may be essentially any substituent that, if substituted to a high enough level or degree of substitution, can render the cellulosic polymer essentially aqueous insoluble. Hydrophilic regions of the polymer can be either those portions that are relatively unsubstituted, since the unsubstituted hydroxyls are themselves relatively hydrophilic, or those regions that are substituted with hydrophilic substituents. Examples of hydrophobic substituents include ether-linked alkyl groups such as methyl, ethyl, propyl, butyl, etc.; or ester-linked alkyl groups such as acetate, propionate, butyrate, etc.; and ether- and / or ester- linked aryl groups such as phenyl, benzoate, or phenylate. Hydrophilic groups include ether- or ester-linked non-ionizable groups such as the hydroxy alkyl substituents hydroxyethyl, hydroxypropyl, and the alkyl ether groups such as ethoxyethoxy or methoxyethoxy. In some embodiments, hydrophilic substituents are those that are ether- or ester-linked ionizable groups 42such as carboxylic acids, thiocarboxylic acids, substituted phenoxy groups, amines, phosphates or sulfonates.
[0153] One class of cellulosic polymers comprises neutral polymers, meaning that thepolymers are substantially non-ionizable in aqueous solution. Such polymers contain non- ionizable substituents, which may be either ether-linked or ester-linked. Exemplary ether-linked non-ionizable substituents include: alkyl groups, such as methyl, ethyl, propyl, butyl, etc.; hydroxy alkyl groups such as hydroxymethyl, hydroxyethyl, hydroxypropyl, etc.; and aryl groups such as phenyl. Exemplary ester-linked non-ionizable groups include: alkyl groups, such as acetate, propionate, butyrate, etc.; and aryl groups such as phenylate. However, when aryl groups are included, the polymer may need to include a sufficient amount of a hydrophilic substituent so that the polymer has at least some water solubility at any physiologically relevant pH from 1 to 8.
[0154] Exemplary non-ionizable polymers that may be used as the polymer include:hydroxypropyl methyl cellulose acetate, hydroxypropyl methyl cellulose, hydroxypropyl cellulose, methyl cellulose, hydroxyethyl methyl cellulose, hydroxyethyl cellulose acetate, and hydroxyethyl ethyl cellulose.
[0155] In some embodiments, neutral cellulosic polymers are those that are amphiphilic.Exemplary polymers include hydroxypropyl methyl cellulose and hydroxypropyl cellulose acetate, where cellulosic repeat units that have relatively high numbers of methyl or acetate substituents relative to the unsubstituted hydroxyl or hydroxypropyl substituents constitute hydrophobic regions relative to other repeat units on the polymer.
[0156] In some embodiments, cellulosic polymers comprise polymers that are at leastpartially ionizable at physiologically relevant pH and include at least one ionizable substituent, which may be either ether-linked or ester-linked. Exemplary ether-linked ionizable substituents 43include: carboxylic acids, such as acetic acid, propionic acid, benzoic acid, salicylic acid, alkoxybenzoic acids such as ethoxybenzoic acid or propoxybenzoic acid, the various isomers of alkoxyphthalic acid such as ethoxyphthalic acid and ethoxyisophthalic acid, the various isomers of alkoxynicotinic acid such as ethoxynicotinic acid, and the various isomers of picolinic acid such as ethoxypicolinic acid, etc.; thiocarboxylic acids, such as thioacetic acid; substituted phenoxy groups, such as hydroxyphenoxy, etc.; amines, such as aminoethoxy, diethylaminoethoxy, trimethylaminoethoxy, etc.; phosphates, such as phosphate ethoxy; and sulfonates, such as sulphonate ethoxy. Exemplary ester linked ionizable substituents include: carboxylic acids, such as succinate, citrate, phthalate, terephthalate, isophthalate, trimellitate, and the various isomers of pyridinedicarboxylic acid, etc.; thiocarboxylic acids, such as thiosuccinate; substituted phenoxy groups, such as amino salicylic acid; amines, such as natural or synthetic amino acids, such as alanine or phenylalanine; phosphates, such as acetyl phosphate; and sulfonates, such as acetyl sulfonate. For aromatic-substituted polymers to also have the requisite aqueous solubility, it is also desirable that sufficient hydrophilic groups such as hydroxypropyl or carboxylic acid functional groups be attached to the polymer to render the polymer aqueous soluble at least at pH values where any ionizable groups are ionized. In some cases, the aromatic group may itself be ionizable, such as phthalate or trimellitate substituents.
[0157] Exemplary cellulosic polymers that are at least partially ionized at physiologicallyrelevant pHs include: hydroxypropyl methyl cellulose acetate succinate, hydroxypropyl methyl cellulose succinate, hydroxypropyl cellulose acetate succinate, hydroxyethyl methyl cellulose succinate, hydroxyethyl cellulose acetate succinate, hydroxypropyl methyl cellulose phthalate, hydroxyethyl methyl cellulose acetate succinate, hydroxyethyl methyl cellulose acetate phthalate, carboxyethyl cellulose, carboxymethyl cellulose, cellulose acetate phthalate, methyl cellulose 44acetate phthalate, ethyl cellulose acetate phthalate, hydroxypropyl cellulose acetate phthalate, hydroxypropyl methyl cellulose acetate phthalate, hydroxypropyl cellulose acetate phthalate succinate, hydroxypropyl methyl cellulose acetate succinate phthalate, hydroxypropyl methyl cellulose succinate phthalate, cellulose propionate phthalate, hydroxypropyl cellulose butyrate phthalate, cellulose acetate trimellitate, methyl cellulose acetate trimellitate, ethyl cellulose acetate trimellitate, hydroxypropyl cellulose acetate trimellitate, hydroxypropyl methyl cellulose acetate trimellitate, hydroxypropyl cellulose acetate trimellitate succinate, cellulose propionate trimellitate, cellulose butyrate trimellitate, cellulose acetate terephthalate, cellulose acetate isophthalate, cellulose acetate pyridinedicarboxylate, salicylic acid cellulose acetate, hydroxypropyl salicylic acid cellulose acetate, ethylbenzoic acid cellulose acetate, hydroxypropyl ethylbenzoic acid cellulose acetate, ethyl phthalic acid cellulose acetate, ethyl nicotinic acid cellulose acetate, and ethyl picolinic acid cellulose acetate.
[0158] In some embodiments, cellulosic ionizable polymers are those that possess both acarboxylic acid functional aromatic substituent and an alkylate substituent and thus are amphiphilic. Exemplary polymers include cellulose acetate phthalate (CAP), methyl cellulose acetate phthalate, ethyl cellulose acetate phthalate, hydroxypropyl cellulose acetate phthalate, hydroxylpropyl methyl cellulose phthalate (HPMCP), hydroxypropyl methyl cellulose acetate phthalate (HPMCAP), hydroxypropyl cellulose acetate phthalate succinate, cellulose propionate phthalate, hydroxypropyl cellulose butyrate phthalate, cellulose acetate trimellitate, methyl cellulose acetate trimellitate, ethyl cellulose acetate trimellitate, hydroxypropyl cellulose acetate trimellitate, hydroxypropyl methyl cellulose acetate trimellitate, hydroxypropyl cellulose acetate trimellitate succinate, cellulose propionate trimellitate, cellulose butyrate trimellitate, cellulose acetate terephthalate, cellulose acetate isophthalate, cellulose acetate pyridinedicarboxylate, 45salicylic acid cellulose acetate, hydroxypropyl salicylic acid cellulose acetate, ethylbenzoic acid cellulose acetate, hydroxypropyl ethylbenzoic acid cellulose acetate, ethyl phthalic acid cellulose acetate, ethyl nicotinic acid cellulose acetate, and ethyl picolinic acid cellulose acetate.
[0159] In some embodiments, cellulosic ionizable polymers are those that possess a non-aromatic carboxylate substituent. Exemplary polymers include hydroxypropyl methyl cellulose acetate succinate, hydroxypropyl methyl cellulose succinate, hydroxypropyl cellulose acetate succinate, hydroxyethyl methyl cellulose acetate succinate, hydroxyethyl methyl cellulose succinate, and hydroxyethyl cellulose acetate succinate.
[0160] While a wide range of polymers may be used to form dispersions of BVD-523, ithas been surprisingly discovered that relatively hydrophobic polymers have shown the bestperformance as demonstrated by high MDC and AUC in vitro and in vivo. In particular, cellulosicpolymers that are aqueous insoluble in their non-ionized state but are aqueous soluble in their ionized state perform particularly well. A particular subclass of such polymers are the so-called “enteric” polymers which include, for example, hydroxypropylmethylcellulose acetate succinate (HPMCAS) and certain grades of hydroxypropyl methyl cellulose acetate phthalate (HPMCAP). Dispersions formed from such polymers generally show very large enhancements in the maximum drug concentration achieved in dissolution tests relative to that for a crystalline drug control.
[0161] In some embodiments, concentration-enhancing polymers for use in dispersionswith BVD-523 are hydroxypropylmethylcellulose acetate succinate (HPMCAS), hydroxypropylmethylcellulose (HPMC), hydroxypropylmethylcellulosephthalate (HPMCP), polyvinylpyrrolidonevinylacetate (PVP-VA), copolymers of methacrylic acid and methylmethacrylate (approximate 1:1 ratio) available as EUDRAGIT L-100®, and graft 46copolymers of polyethyleneglycol, polyvinylcaprolactam, and polyvinylacetate, one commercially available version of a graft copolymer is known as SOLUPLUS®.
[0162] In some embodiments, the compositions disclosed herein comprise one or morepolymers selected from hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropylmethyl ellulose, hydroxypropylmethyl ellulose acetate succinate, hydroxypropylmethyl cellulose phthalate, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethyene glycol, polyethyene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Hypromellose Acetate Succinate, Hypromellose Acetate Succinate, Poly(methacylic acid-co-methyl methacrylate) (1:1), SOLUPLUS® (polyvinyl caprolactam-polyvinyl acetate- polyethylene glycol graft copolymer) and combinations thereof.
[0163] To obtain the best performance, particularly upon storage for long times prior touse, it is preferred that the BVD-523 remain, to the extent possible, in the amorphous state. It has been surprisingly discovered that the polymers disclosed herein are effective to maintain BVD- 523 in an amorphous state. In some embodiments, when the compositions disclosed herein are stressed at 40°C / 75% RH for at least 1 week, at least 4 weeks, or at least 6 weeks, it remains x-ray amorphous according to XRPD. In some embodiments, when the compositions disclosed herein are stressed at 40°C / 75% RH for 3 months it remains x-ray amorphous according to XRPD. In some embodiments, when the compositions disclosed herein are stressed at 40°C / 75% RH for 6 47months it remains x-ray amorphous according to XRPD. In some embodiments, when the compositions disclosed herein are stressed at 40°C / 75% RH for greater than 6 months it remains x-ray amorphous according to XRPD.
[0164] The polymer is not particularly limited, so long as BVD-523 can be carried asthe solid dispersion. In some embodiments, the polymer is not particularly limited, so long as BVD-523 can be an amorphous state. Examples of the polymer include polyvinyl pyrrolidone (PVP), polyethyleneoxide (PEO), 5 poly(vinyl pyrrolidone-co-vinyl acetate), polymethacrylates, polyoxyethylene alkyl ethers, polyoxyethylene castor oils, polycaprolactam, polylactic acid, polyglycolic acid, poly(lactic-glycolic)acid, lipids, cellulose, pullulan, dextran, maltodextrin, hyaluronic acid, polysialic acid, chondroitin sulfate, heparin, fucoidan, pentosan polysulfate, spirulan, hydroxypropyl methyl cellulose (HPMC), hydroxypropyl cellulose (HPC), carboxymethyl ethylcellulose (CMEC), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate phthalate (CAP), cellulose acetate trimellitate (CAT), ethyl cellulose, cellulose acetate, cellulose butyrate, cellulose acetate butyrate, dextran polymer derivatives, and pharmaceutically acceptable forms, derivatives. In some embodiments, the polymer is hydroxypropyl methylcellulose acetate succinate (HPMCAS). Preparation of Compositions
[0165] Dispersions of BVD-523 and concentration-enhancing polymer may be madeaccording to any known process which results in at least a major portion (at least 60%) of the BVD-523 being in the amorphous state. Exemplary mechanical processes include milling and hot- melt extrusion; melt processes include high temperature fusion, solvent modified fusion and melt- congeal processes; and solvent processes including anti-solvent precipitation, spray coating and spray-drying. Although the dispersions may be made by any of these processes, the dispersions 48generally have their maximum bioavailability and stability when the BVD-523 is dispersed in the polymer such that it is substantially amorphous and substantially homogeneously distributed throughout the polymer.
[0166] Given the lower aqueous solubility and bioavailability of crystalline BVD-523, itis beneficial for the dispersions to be as homogeneous as possible. Thus, in some embodiments disclosed herein, a dispersion has a single glass transition temperature, which indicates a high degree of homogeneity.
[0167] In some embodiments, substantially amorphous and substantially homogeneousdispersions are made by any of the methods described above. In some embodiments, dispersions are formed by “solvent processing,” in which BVD-523 and a polymer are dissolved in a common solvent. “Common” here means that the solvent, which can be a mixture of compounds, will simultaneously dissolve the drug and the polymer(s). After both the BVD-523 and the polymer have been dissolved, the solvent is rapidly removed by evaporation or by mixing with an anti- solvent. Exemplary processes are spray-drying, spray-coating (pan-coating, fluidized bed coating, etc.), and precipitation by rapid mixing of the polymer and drug solution with CO2, water, or some other non-solvent. In some embodiments, removal of the solvent results in a solid dispersion which is substantially homogeneous. In such substantially homogeneous dispersions, the BVD-523 is dispersed as homogeneously as possible throughout the polymer and can be thought of as a solid solution of BVD-523 in the polymer(s). When the resulting dispersion constitutes a solid solution of BVD-523 in polymer, the dispersion may be thermodynamically stable, meaning that the concentration of BVD-523 in the polymer is at or below its equilibrium constant. In some embodiments, the dispersion is thermodynamically stable and will thus not crystallize from its amorphous state as long as the API concentration in the polymer does not exceed its 49solubility limit in the polymer matrix. Alternatively, the composition may be a supersaturated solid solution where the BVD-523 concentration in the dispersion polymer(s) is above its equilibrium constant.
[0168] In some embodiments, the solvent may be removed through the process of spray-drying. The term spray-drying is used conventionally and broadly refers to processes involving atomization of liquid mixtures into small droplets (atomization) and rapidly removing solvent from the mixture in a container (spray-drying apparatus) where there is a strong driving force for evaporation of solvent from the droplets. The strong driving force for solvent evaporation is generally provided by maintaining the partial pressure of solvent in the spray-drying apparatus well below the vapor pressure of the solvent at the temperature of the drying droplets. This is accomplished by either (1) maintaining the pressure in the spray-drying apparatus at a partial vacuum (e.g., 0.01 to 0.50 atm); (2) mixing the liquid droplets with a warm drying gas; or (3) both. In addition, at least a portion of the heat required for evaporation of solvent may be provided by heating the spray solution.
[0169] Solvents suitable for spray-drying can be any organic compound in which BVD-523 and polymer are mutually soluble. In some embodiments, the solvent is also volatile with a boiling point of 150°C or less. In addition, the solvent should have relatively low toxicity and be removed from the dispersion to a level that is acceptable according to The International Committee on Harmonization (ICH) guidelines. Removal of solvent to this level may require a processing step such as tray-drying subsequent to the spray-drying or spray-coating process. Solvents include alcohols such as methanol, ethanol, n-propanol, isopropanol, and butanol; ketones such as acetone, methyl ethyl ketone and methyl iso-butyl ketone; esters such as ethyl acetate and propylacetate; and various other solvents such as acetonitrile, methylene chloride, toluene, and 1,1,1- 50trichloroethane. Lower volatility solvents such as dimethyl acetamide or dimethylsulfoxide can also be used. Mixtures of solvents, such as 50% methanol and 50% acetone, can also be used, as can mixtures with water as long as the polymer and BVD-523 are sufficiently soluble to make the spray-drying process practicable. Generally, due to the hydrophobic nature of BVD-523, non- aqueous solvents are used. Non-aqueous solvents comprise less than about 10 wt % water; in some embodiments, less than 1 wt % water.
[0170] In some embodiments, solvents for spray drying BVD-523 / polymer solutions areacetone, ethanol, methanol, mixtures thereof, and mixtures with water.
[0171] In some embodiments, the temperature and flow rate of the drying gas is chosen sothat the polymer / drug-solution droplets are dry enough by the time they reach the wall of the apparatus that they are essentially solid, and so that they form a fine powder and do not stick to the apparatus wall. The actual length of time to achieve this level of dryness depends on the size of the droplets. Droplet sizes generally range from 1 μm to 500 μm in diameter, with 5 to 100 μm being more typical. The large surface-to-volume ratio of the droplets and the large driving force for evaporation of solvent leads to actual drying times of a few seconds or less, and more typically less than 0.1 second. This rapid drying is often critical to the particles maintaining a uniform, homogeneous dispersion instead of separating into drug-rich and polymer-rich phases. As above, to achieve large enhancements in concentration and bioavailability it is often necessary to obtain as homogeneous a dispersion as possible. Solidification times should be less than 100 seconds. In some embodiments, solidification time is less than a few seconds. In some embodiments, solidification time is less than 1 second. In general, to achieve this rapid solidification of the BVD- 523 / polymer solution, the size of droplets formed during the spray-drying process is less than 51about 100 μm in diameter. The resultant solid particles thus formed are generally less than about 100 μm in diameter.
[0172] Following solidification, the solid powder typically stays in the spray-dryingchamber for about 5 to 60 seconds, further evaporating solvent from the solid powder. The final solvent content of the solid dispersion as it exits the dryer should be low, since this reduces the mobility of BVD-523 molecules in the dispersion, thereby improving its stability. Generally, the solvent content of the dispersion as it leaves the spray-drying chamber should be less than 10 wt %. In some embodiments, the solvent content of the dispersion as it leaves the spray-drying chamber is less than 2 wt %. In some cases, it may be preferable to spray a solvent or a solution of a polymer or other excipient into the spray-drying chamber to form granules, so long as the dispersion is not adversely affected.
[0173] Spray-drying processes and spray-drying equipment are described generally inPerry's Chemical Engineers' Handbook, Sixth Edition (R. H. Perry, D. W. Green, J.0. Maloney, eds.) McGraw-Hill Book Co.1984, pages 2054 to 2057. More details on spray-drying processes and equipment are reviewed by Marshall “Atomization and Spray-Drying,” 50 Chem. Eng. Prog. Monogr. Series 2 (1954).
[0174] In some embodiments, the amount of concentration-enhancing polymer relative tothe amount of BVD-523 present in the dispersions may be expressed as a ratio, for example, as 70:29:1 BVD-523:HPMCAS-M:SLS, where the dispersion contains 70 parts (by weight) BVD- 523, 29 parts (by weight) hydroxypropylmethlycellulose acetate succinate medium grade (M- grade), and 1 part (by weight) sodium lauryl sulfate (SLS). For a specific concentration-enhancing polymer, the BVD-523 / polymer ratio that yields optimum results is best determined in in vitro dissolution tests and / or in vivo bioavailability tests. 52
[0175] In some embodiments, the ratio of the polymer to BVD-523 is not particularlylimited, so long as BVD-523 can be formed as a solid dispersion. In some embodiments, the ratio of the polymer to BVD-523 is not particularly limited, so long as BVD-523 can be an amorphous state. In some embodiments, the ratio of the polymer is about 0.5 to 3 parts by weight, with respect to 1 part by weight of BVD-523.
[0176] In addition, the amount of concentration-enhancing polymer that can be used in adosage form is often limited by the total mass requirements of the dosage form. For example, when oral dosing to a human is desired, at low BVD-523-to-polymer ratios the total mass of drug and polymer may be unacceptably large for delivery of the desired dose in a single tablet or capsule. Thus, in some embodiments it is necessary to use BVD-523-to-polymer ratios that are less than optimum in specific dosage forms to provide a sufficient BVD-523 dose in a dosage form that is small enough to be easily swallowed by a human.
[0177] In some embodiments, high-shear mixing of the solid amorphous dispersion and aglidant can increase the uniformity of the mixed particles, such as producing an ordered mixture and / or an interactive mixture. As used herein, the term “glidant” means a substance that, when added to a powder, improves the flowability of the powder, such as by reducing inter-particle friction. Exemplary glidants include but are not limited to colloidal silicas, colloidal silicon dioxide, fumed silica, CAB-O-SIL® M-5P, AEROSIL®, talc, starch, and magnesium aluminum silicates. A blend of the solid amorphous dispersion and the glidant using high-shear mixing can have improved flowability, as measured by Carr's Index, compared to the flowability of the solid amorphous dispersion alone. In general, the lower the Carr's Index, the better the flowability of the substance. As used herein, the term “Carr's Index” means a dimensionless parameter “C” used to characterize the flowability of a substance, such as a powder, where 53C=1−(B / T), B is the bulk density of the substance and T is the tapped density of the substance. The Carr's Index can be expressed as a percentage, e.g., if C=0.5, the Carr's Index can be expressed as 50%. The bulk density is equal to mass per volume (g / cc) of a sample before being tapped and the tapped density is equal to the mass of a sample divided by the volume of the sample after the sample is tapped for 2000 cycles in a Vankel Tap density instrument. In some embodiments, glidant (Cab-o-sil M-5P / Colloidal silica) is blended with a solid dispersion intermediate at 2 w / w%. In some embodiments, this excipient is added to the intragranular materials prior to roller compaction / dry granulation of the intragranular blend en route to compressing tablets. In some embodiments, glidant is not included in the spray dried intermediate containing active, but it is included as one of the excipients in the tablet formulation.
[0178] A powder having a lower Carr's Index can also be easier to compress into a tablet.In some exemplary methods, a mixture having a Carr's Index greater than 40%, for example, can be difficult to compress into a tablet. For example, a tablet formed from a mixture having a high Carr's Index can be more likely to crack, fracture, or otherwise fail to stick together or maintain a tablet form after compression. Also, powder blends having a high Carr Index may lead to inaccurate filling of the tablet die on the press which can cause inconsistent tablet weights (API dose in tablet may be too high or too low). In some embodiments, adding a glidant to the solid amorphous dispersion with high-shear mixing can produce a mixture having a low Carr's Index, such as below 40% and / or 35%, that is suitable for direct compression. This allows direct compression of the solid amorphous dispersion without the need to include an intermediate granulation process to decrease the Carr's Index of the mixture to a suitable level.
[0179] An exemplary method for forming a pharmaceutical dosage form comprises:providing a solid amorphous dispersion comprising particles wherein the particles comprise BVD- 54523 and a polymer, the solid amorphous dispersion having an average particle diameter of less than 50 μm; forming an ordered mixture by high-shear mixing a blend comprising the solid amorphous dispersion and a powdered glidant, the glidant having an average particle diameter of less than or equal to one-fifth the average particle diameter of the solid amorphous dispersion after high-shear mixing; and forming the pharmaceutical dosage form by at least one of directly compressing the ordered mixture to form a tablet and encapsulating the ordered mixture to form a capsule. In some embodiments, in addition to glidant the spray dried intermediate is blended with binders / diluents (e.g., MCC and Mannitol), disintegrant (e.g., NaCMC) and lubricant (e.g., MgSt),
[0180] Another exemplary method of preparing a pharmaceutical dosage form comprises:providing a solid amorphous dispersion comprising particles wherein the particles comprise BVD- 523 and a polymer, the solid amorphous dispersion having an average particle diameter of less than 50 μm; forming an ordered mixture comprising the solid amorphous dispersion and a glidant using high-shear mixing, the ordered mixture having a Carr's Index of less than 40%; and forming the pharmaceutical dosage form by directly compressing the ordered mixture to form a tablet or encapsulating the ordered mixture to form a capsule.
[0181] Another exemplary method for forming a pharmaceutical dosage form comprises:providing a solid amorphous dispersion comprising particles, the particles comprising BVD-523 and a polymer, the solid amorphous dispersion having an average particle diameter of less than 50 μm; forming a blend comprising the solid amorphous dispersion and a powdered glidant using high-shear mixing, the high-shear mixing having a Froude Number greater than 0.2; and forming the pharmaceutical dosage form by at least one of directly compressing the blend to form a tablet and encapsulating the blend to form a capsule. 55
[0182] As used herein, the term “Froude Number” means a dimensionless parameter “Fr”used to characterize a mixing process, such that Fr=V2 / gDc, where V is the characteristic velocity of the particles in a mixing chamber, Dc, is the characteristic diameter of the chamber, and g is the acceleration due to Earth's gravity. For a rotating agitator, such as an impeller, the characteristic velocity may be defined as V=πDaN, where Da is the diameter of the agitator and N is the agitator rotation rate in revolutions per unit time.
[0183] As used herein, the term “high-shear mixing” means a powder mixing processcharacterized by a Froude Number within a specified range, such as greater than 0.01, greater than 0.1, greater than 0.2, greater than 0.5, greater than 1, greater than 10, and / or greater than 20, for example. Where the Froude Number is not specified, the term “high-shear mixing” means a powder mixing process characterized by a Froude Number of at least 1. The term “high-shear mixing” does not include high-shear granulation using a liquid, or dissolving or dispersing a solid in a liquid.
[0184] As used herein, the term “low-shear mixing” means a conventional mixing processthat is not high-shear mixing.
[0185] As used herein, the term “ordered mixture” means a mixture of powders having alevel of uniformity that is greater than a level achievable by random mixing.
[0186] As used herein, the term “interactive mixture” means a mixture of a first powderhaving a first average particle size and a second powder having a second average particle size that is larger than the first average particle size, wherein all, substantially all or at least 90% of the particles of the first powder interact with and adhere to at least one of the plurality of the particles of the second powder. In some embodiments, an ordered mixture is also an interactive mixture. 56
[0187] As used herein, the term “average particle size” means the D50. The term D50 meansthat 50 vol % of the particles have a diameter that is smaller than the stated size, and 50 vol % of the particles have a diameter that is larger than the stated size. The average particle size may be measured using standard laser diffraction particle sizing techniques known in the art. One example of an instrument to measure the particle size of the dry powders is the Masteresizer 2000, manufactured by Malvern Instruments Ltd (Worcestershire, UK). In some embodiments, particle size can be determined by scanning-electron microscopy analysis. Excipients and Dosage Forms
[0188] Although the key ingredients present in the compositions are simply the BVD-523to be delivered and the concentration-enhancing polymer(s), the inclusion of other excipients in the composition may be useful. In some embodiments, these excipients may be utilized with the BVD-523 and polymer composition in order to formulate the composition into tablets, capsules, suspensions, powders for suspension, creams, transdermal patches, depots, and the like. The composition of BVD-523 and polymer can be added to other dosage form ingredients in essentially any manner that does not substantially alter the physical state and / or chemical stability of the BVD- 523. The excipients may be either physically mixed with the dispersion and / or included within the dispersion.
[0189] The solid dispersion comprising BVD-523 and the polymer is further mixed withone or more pharmaceutically acceptable additives to prepare a pharmaceutical composition. The additives are not particularly limited, so long as they are pharmaceutically acceptable. Examples of the additives include a filler, a binder, a disintegrant, an acidulant, an effervescent agent, an artificial sweetener, a flavor, a lubricant, a coloring agent, a stabilizing agent, a buffer, an antioxidant, a glidant, and the like. 57
[0190] The filler may be selected from, for example, mannitol, lactose, starch, corn starch,calcium hydrogen phosphate hydrate, magnesium carbonate, calcium carbonate, purified sucrose, glucose, and the like.
[0191] The binder may be selected from, for example, hydroxypropylmethyl cellulose,hydroxypropyl cellulose, polyvinyl alcohol, methyl cellulose, gum arabic, and the like.
[0192] The disintegrant may be selected from, for example, corn starch, starches,crystalline cellulose, carmellose calcium, carmellose sodium, croscarmellose sodium, light anhydrous silicic acid, calcium silicate, low-substituted hydroxypropyl cellulose, partially pregelatinized starch, sodium carboxymethyl starch, agar powder, crospovidone, synthetic aluminum silicate, sucrose fatty acid esters, lactose hydrate, D-mannitol, anhydrous citric acid, and the like.
[0193] The acidulant may be selected from, for example, citric acid, tartaric acid, malicacid, and the like.
[0194] The effervescent agent may be selected from, for example, sodium bicarbonate andthe like.
[0195] The artificial sweetener may be selected from, for example, saccharin sodium,dipotassium glycyrrhizinate, aspartame, stevia, thaumatin, and the like.
[0196] The flavor may be selected from, for example, lemon, lemon-lime, orange, menthol,and the like.
[0197] The lubricant may be selected from, for example, magnesium stearate, calciumstearate, sucrose fatty acid esters, sodium stearyl fumarate, polyethylene glycol, talc, stearic acid, and the like. 58
[0198] The coloring agent may be selected from, for example, yellow ferric oxide, redferric oxide, food yellow No.4, food yellow No. 5, food red No.3, food red No.102, food blue No.3, and the like.
[0199] The buffer may be selected from, for example, citric acid, succinic acid, fumaricacid, tartaric acid, ascorbic acid, or salts thereof; glutamic acid, glutamine, glycine, aspartic acid, alanine, arginine, or salts thereof; magnesium oxide, zinc oxide, magnesium hydroxide, phosphoric acid, boric acid, or their salts; and the like.
[0200] The antioxidant may be selected from, for example, ascorbic acid, dibutylhydroxytoluene, propyl gallate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT) and the like.
[0201] The glidant may be selected from, for example, light anhydrous silicic acid,titanium oxide, stearic acid, colloidal silica, colloidal 20 silicon dioxide, fumed silica, CAB-O- SIL® M-5P, AEROSIL®, talc, starch, and magnesium aluminum silicates and the like.
[0202] These additives may be added alone in an appropriate amount, or as a combinationof two or more thereof in appropriate amounts.
[0203] In some embodiments, excipients to be added to the formulation after formation ofthe BVD-523 / polymer dispersion include surfactants and surface-active agents. In some embodiments, suitable surfactants and surface-active agents are sulfonated hydrocarbons and their salts, such as dioctylsodiumsulfocuccinate and sodium laurylsulfate; polyoxyethylene sorbitan fatty acid esters, such as polysorbate-80 and polysorbate-20; polyoxyethylene alkyl ethers; polyoxyethylene castor oil; polyoxyethylene (−40 or −60) hydrogenated castor oil; tocopheryl polyethyleneglycol 1000 succinate; glyceryl polyethyleneglycol-8 caprylate / caprate; polyoxyethylene-32 glyceryl laurate; polyoxyethylene fatty acid esters; polyoxyethylene- 59polyoxypropylene block copolymers; polyglycolized glycerides; long-chain fatty acids such as palmitic and stearic and oleic and ricinoleic acids; medium-chain and long-chain saturated and unsaturated mono-, di- and tri-glycerides and mixtures thereof; fractionated coconut oils; mono- and di-glycerides of capric and caprylic acids; bile salts such as sodium taurocholate; and phospholipids such as egg lecithin, soy lecithin, 1,2-diacyl-sn-glycerophosphorylcholines such as 1-palmitoyl-2-oleyl-sn-glycerophosphorylcholine, dipalmitoyl-sn-glycerophosphorylcholine, distearoyl-sn-glycerophosphorylcholine, and 1-palmitoyl-2-stearoyl-sn- glycerophosphorylcholine. Such materials can be advantageously employed to increase the rate of dissolution by facilitating wetting, thereby increasing the maximum dissolved concentration, and also to inhibit crystallization or precipitation of drug by interacting with the dissolved drug through mechanisms such as complexation, formation of inclusion complexes, formation of micelles or adsorbing to the surface of solid drug, crystalline or amorphous. In some embodiments, these surfactants may comprise up to 5 wt % of the composition.
[0204] In some embodiments, the surfactant is selected from the group consisting ofsodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS).
[0205] In some embodiments, the addition of pH modifiers such as acids, bases, or buffersmay also be beneficial, retarding the dissolution of the composition (e.g., acids such as citric acid or succinic acid when the concentration-enhancing polymer is anionic) or, alternatively, enhancing the rate of dissolution of the composition (e.g., bases such as sodium acetate or amines when the polymer is anionic). 60
[0206] In some embodiments, conventional matrix materials, complexing agents,solubilizers, fillers, disintegrating agents (disintegrants), or binders may also be added as part of the composition itself or added by granulation via wet or mechanical or other means. These materials may comprise up to 90 wt % of the composition. Examples of matrix materials, fillers, or diluents include lactose, mannitol, xylitol, microcrystalline cellulose, calcium diphosphate, and starch. Examples of disintegrants include sodium starch glycolate, sodium alginate, carboxy methyl cellulose sodium, methyl cellulose, and croscarmellose sodium. Examples of binders include methyl cellulose, microcrystalline cellulose, starch, and gums such as guar gum, and tragacanth. Examples of lubricants include magnesium stearate and calcium stearate.
[0207] In some embodiments, other conventional excipients may be employed, includingthose excipients well-known in the art. In some embodiments, excipients such as pigments, lubricants, flavorants, and so forth may be used for customary purposes and in typical amounts without adversely affecting the properties of the compositions. These excipients may be utilized in order to formulate the composition into tablets, capsules, suspensions, powders for suspension, creams, transdermal patches, and the like.
[0208] The compositions may be delivered by a wide variety of routes, including, but notlimited to, oral, nasal, rectal, and pulmonary. In some embodiments, compositions are delivered by the oral route.
[0209] The pharmaceutical compositions comprising the solid dispersion, can beformulated into various dosage forms, including tablets, powders, fine granules, granules, dry syrups, capsules and the like as well as the solid dispersion itself. In some embodiments, the solid pharmaceutical composition is in tablet form. 61
[0210] Compositions disclosed herein may also be used in a wide variety of dosage formsfor administration of BVD-523. Exemplary dosage forms are powders or granules that may be taken orally either dry or reconstituted by addition of water or other liquids to form a paste, slurry, suspension, or solution; tablets; capsules; multiparticulates; and pills. Various additives may be mixed, ground, or granulated with the compositions disclosed herein to form a material suitable for the above dosage forms.
[0211] The compositions may be formulated in various forms such that they are deliveredas a suspension of particles in a liquid vehicle. Such suspensions may be formulated as a liquid or paste at the time of manufacture, or they may be formulated as a dry powder with a liquid, typically water, added later but prior to oral administration. Such powders that are constituted into a suspension are often termed sachets or oral powder for constitution (OPC) formulations. Such dosage forms can be formulated and reconstituted via any known procedure. The simplest approach is to formulate the dosage form as a dry powder that is reconstituted by simply adding water and agitating.
[0212] In some embodiments, dispersions of BVD-523 are formulated for long-termstorage in the dry state as this preserves the chemical and physical stability of the BVD-523. Various excipients and additives may be combined with the compositions to form the dosage form. For example, it may be desirable to add some or all of the following: preservatives such as sulfites (an antioxidant), benzalkonium chloride, methyl paraben, propyl paraben, benzyl alcohol or sodium benzoate; suspending agents or thickeners such as xanthan gum, starch, guar gum, sodium alginate, carboxymethyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, polyacrylic acid, silica gel, aluminum silicate, magnesium silicate, or titanium dioxide; anticaking agents or fillers such as silicon oxide, or lactose; flavorants 62such as natural or artificial flavors; sugars such as sucrose, lactose, or sorbitol as well as artificial sweeteners such as aspartame or saccharin; wetting agents or surfactants such as various grades of polysorbate, docusate sodium, or sodium lauryl sulfate; solubilizers such as ethanol propylene glycol or polyethylene glycol; coloring agents such as FD and C Red No.3 or FD and C Blue No. 1; and pH modifiers or buffers such as carboxylic acids (including citric acid, ascorbic acid, lactic acid, and succinic acid), various salts of carboxylic acids, amino acids such as glycine or alanine, various phosphate, sulfate and carbonate salts such as trisodium phosphate, sodium bicarbonate or potassium bisulfate, and bases such as amino glucose or triethanol amine.
[0213] In some embodiments, an additional concentration-enhancing polymer may beadded. An additional concentration-enhancing polymer may act as a thickener or suspending agent in formulations which are constituted with a liquid before dosing, and which may provide additional precipitation inhibition for all dosage forms after dosing to an aqueous use environment.
[0214] In some cases, the overall dosage form or particles, granules or beads that make upthe dosage form may have superior performance if coated with an enteric polymer to prevent or suppress dissolution until the dosage form exits the stomach. Exemplary enteric coating materials include hydroxypropyl methyl cellulose acetate succinate, hydroxypropyl methyl cellulose phthalate, cellulose acetate phthalate, cellulose acetate trimellitate, carboxylic acid-functionalized polymethacrylates, and carboxylic acid-functionalized polyacrylate.
[0215] Compositions may be administered in a controlled release dosage form. In one suchdosage form, the composition of the BVD-523 and polymer is incorporated into an erodible polymeric matrix device. By an erodible matrix is meant aqueous-erodible or water-swellable or aqueous-soluble in the sense of being either erodible or swellable or dissolvable in pure water or requiring the presence of an acid or base to ionize the polymeric matrix sufficiently to cause 63erosion or dissolution. When contacted with the aqueous environment of use, the erodible polymeric matrix imbibes water and forms an aqueous-swollen gel or “matrix” that entraps the dispersion of BVD-523 and polymer. The aqueous-swollen matrix gradually erodes, swells, disintegrates or dissolves in the environment of use, thereby controlling the release of the dispersion to the environment of use.
[0216] In some embodiments, compositions may be administered as multiparticulates.Multiparticulates generally refer to dosage forms that comprise a multiplicity of particles that may range in size from about 10 μm to about 2 mm, more typically about 100 μm to 1 mm in diameter. Such multiparticulates may be packaged, for example, in a capsule such as a gelatin capsule or a capsule formed from an aqueous-soluble polymer such as HPMCAS, HPMC or starch or they may be dosed as a suspension or slurry in a liquid.
[0217] Such multiparticulates may be made by any known process, such as wet- and dry-granulation processes, extrusion / spheronization, roller-compaction, or by spray-coating seed cores. For example, in wet- and dry-granulation processes, the composition of BVD-523 and concentration-enhancing polymer is prepared as described above. This composition is then granulated to form multiparticulates of the desired size. Other excipients, such as a binder (e.g., microcrystalline cellulose), may be blended with the composition to aid in processing and forming the multiparticulates. In the case of wet granulation, a binder such as microcryscalline cellulose may be included in the granulation fluid to aid in forming a suitable multiparticulate.
[0218] In any case, the resulting particles may themselves constitute the multiparticulatedosage form or they may be coated by various film-forming materials such as enteric polymers or water-swellable or water-soluble polymers, or they may be combined with other excipients or vehicles to aid in dosing to patients. 64
[0219] In some embodiments, the solid dispersion can be prepared by dissolving and / orsuspending BVD-523 and the polymer in a pharmaceutically acceptable solvent, and removing the solvent. Pharmaceutically acceptable additives can be added to the solvent which dissolved and / or suspended BVD-523. The pharmaceutically acceptable solvent is not particularly limited, so long as BVD-523 can be an amorphous state in the presence of the polymer. Examples of the pharmaceutically acceptable solvent include ketones such as acetone, alcohols such as methanol, ethanol, or propanol, a mixture thereof, and a mixed solvent of water with one or more of these solvents. These pharmaceutically acceptable solvents may be used alone or as an appropriate combination of two or more thereof.
[0220] In some embodiments, the amount of the pharmaceutically acceptable solvent isnot particularly limited, so long as BVD-523 can be dissolved and / or suspended. A 1- to 100-fold amount (w / w) of the pharmaceutically acceptable solvent, or a 5- to 35-fold amount (w / w) of the pharmaceutically acceptable solvent in other embodiments may be contained, with respect to the total weight of BVD-523 and the polymer.
[0221] In some embodiments, the method of removing the pharmaceutically acceptablesolvent is not particularly limited, so long as the solvent can be removed from the liquid in which BVD-523 and the polymer are dissolved and / or suspended. Examples of the method include spray drying, drying under reduced pressure, forced-air drying, and the like, and spray drying may be used in other embodiments.
[0222] The process of manufacturing the pharmaceutical composition or itspharmaceutical formulation is not particularly limited, so long as it can produce the desired pharmaceutical formulation by using an appropriate combination of the above methods or known methods per se. Specifically, for example, the solid dispersion is mixed with one additive, or two 65or more additives, and known methods per se are carried out to obtain tablets, powders, fine granules, granules, dry syrups, or capsules.
[0223] The process of manufacturing the pharmaceutical composition or itspharmaceutical formulation is not particularly limited, so long as it can produce the desired pharmaceutical formulation by using an appropriate combination of the above methods or known methods per se. The pharmaceutical composition can be produced, for example, by any known process including the steps of blending, granulation, specific size controlling, tableting, film coating and the like. For example, the solid pharmaceutical composition in the form of powders, fine granules, granules or dry syrups can be produced by a process including the steps of (1) mixing the solid dispersion with one additive or two or more additives using blender, and (2) granulating the resulting mixture by dry granulation using a roller compactor. In a case where the above various pharmaceutical additives are used as needed, these pharmaceutical additives may be added at any stage, e.g., during step (1), between steps (1) and (2), or during step (2).
[0224] The granules may each be adjusted to any suitable size by being subjected to amilling step prior to the mixing step. In the grinding step, any apparatus or means may be used as long as it generally allows pharmaceutical grinding of the drug and / or the pharmaceutical additive(s). In the mixing step of the individual components, which is subsequent to milling, any apparatus or means may be used as long as it generally allows pharmaceutical mixing of the individual components into a uniform state.
[0225] In some embodiments, the granulated product is then compressed to producetablets. Any tableting technique may be used for this purpose as long as it generally allows pharmaceutical production of compression molded products. Examples include techniques in which a granulated product is tabulated in admixture with one additive, or two or more additives. 66Any type of tablet machine may be used for this purpose as long as it generally allows pharmaceutical production of compression molded products. Examples include a rotary tablet machine, a single-shot tablet machine and the like. The tablet hardness is set to, for example, 50 to 300 N, or alternatively, 80 to 250 N, taking into consideration handling in production, distribution, and the like of medicaments.
[0226] After tableting, the tablet surface may be coated with a film coating agent. Anytechnique may be used for this purpose as long as it generally allows pharmaceutical tablet coating. Examples include pan coating processes and the like. Any type of film coating agent may be used for this purpose as long as it is generally used as a pharmaceutical additive for pharmaceutical tablet coating. Film coating agents may be added alone or in combination as appropriate in suitable amounts. Tablet Formulations
[0227] In some embodiments, for manufacture of a tablet dosage form of an BVD-523 / polymer dispersion, an BVD-523 / polymer dispersion containing 70:29:1 BVD- 523:HPMCAS-M:SLS spray dried intermediate comprising 42.86% of the dosage form in addition to the intragranular and extragranular components listed below in Table 1: Table 1 Formulation Intragranular Components Unit CompositionCroscarmellose Sodium (Ac-Di-Sol) 1.00 5.0Magnesium Stearate #2257 0.30 1.5
[0228] In some embodiments, a tablet contains approximately 30-50% of its total weightas BVD-523:HPMCAS-M dispersion, with the remainder inactive excipients. In some embodiments, the inactive components include one or more of Avicel PH 102, Microcystalline cellulose (MCC); Partek M100 (Mannitol); Ac-Di-Sol, Croscarmellose sodium (CCS); Cab-o-sil M-5P (Colloidal silica); and Magnesium Stearate #2257.
[0229] Tablets comprising BVD-523 / polymer dispersions may be prepared using wetgranulation, dry granulation, or direct compression. In some embodiments, dry granulation or direct compression is used.
[0230] In some embodiments, for manufacture of a tablet dosage form of an BVD-523 / polymer dispersion, an BVD-523 / polymer dispersion containing 70:29:1 BVD- 523:HPMCAS-M:SLS spray dried intermediate comprising 42.86% of the dosage form in addition to the intragranular and extragranular components listed below in Table 2: Table 2 Formulation Intragranular Components Unit Composition / F l / bl
[0231] In some embodiments, a tablet contains approximately 30-50% of its total weight as BVD-523:HPMCAS-M dispersion, with the remainder inactive excipients. In some embodiments, the inactive components include one or more of Avicel PH 102, Microcystalline cellulose (MCC); Fast Flo 316 (Lactose); Ac-Di-Sol, Croscarmellose sodium (CCS); Cab-o-sil M-5P (Colloidal silica); and Magnesium Stearate #2257.
[0232] Compositions disclosed herein may be used to treat any condition which is subjectto treatment by administering BVD-523. Accordingly, compositions can be used to treat hyperproliferative disorders, such as cancer, by administering to a mammal in need of such treatment a therapeutically effective amount of a composition disclosed herein.
[0233] To avoid large BVD-523 particulates, test solutions are either filtered orcentrifuged. “Dissolved BVD-523” is typically taken as that material that either passes a 0.45- micron syringe filter or, alternatively, the material that remains in the supernatant following centrifugation. Filtration can be conducted using a 13 mm, 0.45-micron polyvinylidine difluoride syringe filter, such as the filter sold by Scientific Resources under the trademark TITAN™. Centrifugation is typically carried out in a polypropylene microcentrifuge tube by centrifuging at 13,000 G for 60 seconds. Other similar filtration or centrifugation methods can be employed and useful results obtained. For example, using other types of microfilters may yield values somewhat higher or lower (+ / −10-40%) than that obtained with the filter specified above but will still allow identification of dispersions. It is recognized that this definition of “dissolved BVD-523” encompasses not only monomeric solvated BVD-523 molecules but also a wide range of species such as polymer / BVD-523 assemblies that have submicron dimensions such as BVD-523 aggregates, aggregates of mixtures of polymer and BVD-523, micelles, polymeric micelles, 69colloidal particles, polymer / BVD-523 complexes, and other such BVD-523-containing species that are present in the filtrate or supernatant in the specified dissolution test. Methods of Treatment
[0234] According to some aspects, the present disclosure provides a method of treating orameliorating the effects of a cancer in a subject in need thereof. The method comprises administering to the subject an effective amount of one or more of the compositions disclosed herein to treat or ameliorate the effects of the cancer.
[0235] As used herein, the terms “treat,” “treating,” “treatment” and grammaticalvariations thereof mean subjecting an individual subject to a protocol, regimen, process or remedy, in which it is desired to obtain a physiologic response or outcome in that subject, e.g., a patient. In particular, the methods and compositions of the present invention may be used to slow the development of disease symptoms or delay the onset of the disease or condition, or halt the progression of disease development. However, because every treated subject may not respond to a particular treatment protocol, regimen, process, or remedy, treating does not require that the desired physiologic response or outcome be achieved in each and every subject or subject population, e.g., patient population. Accordingly, a given subject or subject population, e.g., patient population, may fail to respond or respond inadequately to treatment.
[0236] As used herein, the terms “ameliorate”, “ameliorating” and grammatical variationsthereof mean to decrease the severity of the symptoms of a disease in a subject.
[0237] As used herein, a “subject” is a mammal, preferably, a human. In addition tohumans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include 70cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.
[0238] Cancers include both solid and hematologic cancers. Non-limiting examples ofsolid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumor, gestational trophoblastic tumor, head and neck cancer, glioma, medullary thyroid cancer, myeloproliferative neoplasms, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, large intestine cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer), lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasm, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell cancer, transitional cell cancer of the renal pelvis and ureter, salivary gland cancer, Sezary syndrome, skin cancers (such as cutaneous t-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.
[0239] Examples of hematologic cancers include, but are not limited to, leukemias, suchas adult / childhood acute lymphoblastic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia, 71lymphomas, such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin lymphoma, mycosis fungoides, adult / childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sezary syndrome, cutaneous T-cell lymphoma, and Waldenstrom macroglobulinemia, as well as other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasma cell neoplasm, myelodysplastic syndromes, and myelodysplastic / myeloproliferative neoplasms. A preferred set of cancers that may be treated according to the present invention include neuroblastoma, leukemia, lymphoma, liver cancer, lung cancer, skin cancer, testicular cancer, and thyroid cancer. Combination Therapy
[0240] In some embodiments, the solid form dispersions of BVD-523 disclosed herein arecombined with one or more therapies.
[0241] In some embodiments, the solid from dispersions of BVD-523 as disclosed hereinare combined with one or more RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors.
[0242] As used herein, a “RAF inhibitor” means those substances that (i) directly interactwith RAF, e.g., by binding to RAF and (ii) decrease the expression or the activity of RAF, such as, e.g., A-RAF, B-RAF, and C-RAF (Raf-1). Non-limiting exemplary RAF inhibitors include: 72
[0243] compound ,,73,
[0249] compound ,74,
[0255] compound ,,,
[0259] compound ,76,
[0263] compound ,
[0264] compound ,
[0265] compound ,
[0266] compound ,78,,,
[0272] AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761(ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), LXH254, Encorafenib, vinblastine, pharmaceutically acceptable salts thereof, and combinations thereof.
[0273] As used herein, a “MEK inhibitor” means those substances that (i) directly interactwith MEK, e.g., by binding to MEK and (ii) decrease the expression or the activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro- phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-carboxylic acid (2-hydroxy-ethoxy)- amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), AS- 703988 (Merck KgaA), bentamapimod (Merck KgaA), BI-847325 (Boehringer Ingelheim), E- 6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), 80L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2’-amino-3’-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), RO092210 (Roche), RO4987655 (Hoffmann-La Roche), RO5126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), Binimetinib, pharmaceutically acceptable salts thereof, and combinations thereof.
[0274] As used herein, an “ERK1 / 2 inhibitor” means those substances that (i) directlyinteract with ERK1 and / or ERK2, e.g., by binding to ERK1 / 2 and (ii) decrease the expression or the activity of ERK1 and / or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1 / 2, such as MEK inhibitors and RAF inhibitors, are not ERK1 / 2 inhibitors according to the present invention. Non-limiting examples of an ERK1 / 2 inhibitor include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.
[0275] As used herein, a “JAK inhibitor” means those substances that (i) directly interactwith a Janus kinase (JAK), e.g., by binding to the JAK and (ii) decrease expression or activity of the JAK. JAK inhibitors include ruxolitinib, fedratinib, tofacitinib, baricitinib, lestaurtinib, pacritinib, decernotinib, Oclacitinib, Peficitinib, Upadacitinib (Rinvoq), Delgocitinib, Filgotinib, Abrocitinib, Deucravacitinib, Ritlecitinib, Momelotinib, Cerdulatinib, Gandotinib, Lestaurtinib, Momelotinib, Cucurbitacin I, CHZ868, XL019, AZD1480, INCB039110, LY2784544, 81BMS911543, NS018, GLPG0634, GLPG0788, or N-(cyanomethyl)-4-[2-(4- morpholinoanilino)pyrimidin-4-yl]benzamide; or a pharmaceutically acceptable salt thereof.
[0276] As used herein, a “KRAS inhibitor” means those substances that (i) directly interactwith a KRAS, e.g., by binding to the KRAS and (ii) decrease expression or activity of the KRAS. KRAS inhibitors include Hydroxycloroquine, Sotorasib, Adagrasib, ARS-853, ARS-1620, MRTX-EX185, MRTX-1133, ASP2453, RMC-6291, RMC-6236, RMC-036, RMC-037, BBO- 8520, ERAS-3490, ERAS-007, JDQ443, IBI351, JAB-21822, GDC-6036, HBI-2438, ELI-002, BPI-421286, DCC-3116, BDTX-4933, RMC-4630, BI-0474, BI-2865, BI-1701963, D-1553, TEB-17231, JDQ-443, GH35, BEBT-607, and JAB-21000.
[0277] As used herein, a “CDK inhibitor” means those substances that (i) directly interactwith a family member of the CDK protein kinase family, e.g., by binding to the CDK family member, and (ii) decrease expression or activity of the CDK family member. CDK family members include cdk1, cdk2, ckd3, ckd4, cdk5, cdk6, cdk7, cdk8, cdk9, cdk10, and cdk11. Non- limiting examples of CDK inhibitors according to the present invention include Abemaciclib, 2- Hydroxybohemine, 3-ATA, 5-lodo-lndirubin-3’-monoxime, 9-Cyanopaullone, Aloisine A, Alsterpaullone 2-Cyanoethyl, alvocidib (Sanofi), AM-5992 (Amgen), Aminopurvalanol A, Arcyriaflavin A, AT-7519 (Astex Pharmaceuticals), AZD 5438 (CAS # 602306-29-6), BMS- 265246 (CAS # 582315-72-8), BS-181 (CAS # 1092443-52-1 ), Butyrolactone I (CAS # 87414- 49-1), Cdk / Crk Inhibitor (CAS # 784211-09-2), Cdk1 / 5 Inhibitor (CAS # 40254-90-8), Cdk2 Inhibitor II (CAS # 222035-13-4), Cdk2 Inhibitor IV, NU6140 (CAS # 444723-13-1), Cdk4 Inhibitor (CAS # 546102-60-7), Cdk4 Inhibitor III (CAS # 265312-55-8), Cdk4 / 6 Inhibitor IV (CAS # 359886-84-3), Cdk9 Inhibitor II (CAS # 140651-18-9), CGP 74514A, CR8, CYC-065 (Cyclacel), dinaciclib (Ligand), I-DRF053 dihydrochloride (CAS # 1056016-06-8), Fascaplysin, 82Flavopiridol, Hygrolidin, Indirubin, LEE-011 (Astex Pharmaceuticals), LY-2835219 (Eli Lilly), milciclib maleate (Nerviano Medical Sciences), MM-D37K (Maxwell Biotech), N9-lsopropyl- olomoucine, NSC 625987 (CAS # 141992-47-4), NU2058 (CAS # 161058-83-9), NU6102 (CAS # 444722-95-6), Olomoucine, ON-108600 (Onconova), ON-123300 (Onconova), Oxindole I, P- 1446-05 (Piramal), P-276-00 (Piramal), palbociclib (Pfizer), PHA-767491 (CAS # 845714-00-3), PHA-793887 (CAS # 718630-59-2), PHA-848125 (CAS # 802539-81-7), Purvalanol A, Purvalanol B, R547 (CAS # 741713-40-6), RO-3306 (CAS # 872573-93-8), Roscovitine, SB-1317 (SBIO), SCH 900776 (CAS # 891494-63-6), SEL-120 (Selvita), seliciclib (Cyclacel), SNS-032 (CAS # 345627-80-7), SU9516 (CAS # 377090-84-1 ), WHI-P180 (CAS # 211555-08-7), pharmaceutically acceptable salts thereof, and combinations thereof. In some embodiments, the CDK inhibitor is selected from the group consisting of dinaciclib, palbociclib, pharmaceutically acceptable salts thereof, and combinations thereof.
[0278] As used herein, “RET inhibitors” means those substances that (i) directly interactwith a RET, e.g., by binding to the RET, and (ii) decrease expression or activity of the RET. Non- limiting examples of RET inhibitors include cabozantinib, lenvatinib, sunitinib, alectinib, selpercatinib (LOXO-292), pralsetinib (BLU-667), BOS172738, TPX-0046, HM06 (Vepafestinib), LOX-18228, LOX-19260, LOXO-260, RXDX-105, SY5007, KL590586 (A400, EP0031), EP0031 (A400, KL590586), HS-10365, APS03118, TY-1091, HA121-28, HS269, HEC169096, pharmaceutically acceptable salts thereof, and combinations thereof.
[0279] As used herein, “MDM2 inhibitors” means those substances that (i) directly interactwith a MDM2, e.g., by binding to the MDM2, and (ii) decrease expression or activity of the MDM2. Non-limiting examples of MDM2 inhibitors include RG7112, Idasanutlin, SAR405838, Milademetan, APG-115, AMG 232 (Navtemadlin), NVP-CGM097, Siremadlin, MK-8242, 83Idasanutlin, ALRN-6924, BI 907828, pharmaceutically acceptable salts thereof, and combinations thereof.
[0280] As used herein, “STAT3 inhibitors” means those substances that (i) directly interactwith STAT3, e.g., by binding to the STAT3, and (ii) decrease expression or activity of the STAT3. Non-limiting examples of STAT3 inhibitors include IMX-110, AZD9150, Napabucasin, Bazedoxifene, Siltuximab, CNTO 328, Ruxolitinib, Itacitinib, Ponatinib, Sunitinib, PY*LKTK, Y*LPQTV, SS 610, S3I-M2001, STA-21, S3I-201, Stattic, IS3 295, CPA-1, CPA-7, Galiellalactone, pharmaceutically acceptable salts thereof, and combinations thereof.
[0281] As used herein, “SHP2 inhibitors” means those substances that (i) directly interactwith SHP2, e.g., by binding to the SHP2, and (ii) decrease expression or activity of the SHP2. Non-limiting examples of SHP2 inhibitors include JAB-3068, JAB-3312, TNO-155, RLY-1971, RMC-4630, SHP099, Batoprotafib, Ellagic acid, RMC-4550, Vociprotafib (RMC-4630), PB17- 026-01, SHP2-IN-22, NSC-87877, PHPS1, IACS-13909, Migoprotafib (GDC-1971), SPI-112, JAB-3068 (SHP2-IN-6), SHP394, PF-07284892 (ARRY-558), SHP2-D26, IACS-15414, SHP836, SHP2-IN-1, NSC-87877 disodium, SHP389, GS-493, YF704, SHP2-IN-23, JC-010a, SHP2-IN-14, SHP2-IN-16, SHP2-IN-8, SHP2-IN-5, SHP2-IN-26, Suchilactone (Jatrophan), BPDA2, RMC-3943, SHP2-IN-13, SHP2-IN-24, II-B08, SHP099 hydrochloride, TNO155, RMC- 4630, JAB-3068, RLY-1971, ERAS-601, BBP-398, pharmaceutically acceptable salts thereof, and combinations thereof.
[0282] As used herein, “BCL2 inhibitors” means those substances that (i) directly interactwith BCL2, e.g., by binding to the BCL2, and (ii) decrease expression or activity of the BCL2. Non-limiting examples of BCL2 inhibitors include venetoclax (ABT-199), navitoclax (ABT-263), obatoclax (GX15-070), oblimersen sodium (G3139), Palcitoclax (APG-1252), T-101 (R-(-)- 84gossypol acetic acid), LP-118, pharmaceutically acceptable salts thereof, and combinations thereof.
[0283] As used herein, an “EGFR inhibitor” means those substances that (i) directlyinteract with EGFR, e.g. by binding to EGFR and (ii) decrease the expression or the activity of EGFR. Non-limiting examples of EGFR inhibitors include (+)-Aeroplysinin-1 (CAS # 28656-91 -9), 3-(4-lsopropylbenzylidenyl)-indolin-2-one, ABT-806 (Life Science Pharmaceuticals), AC- 480 (Bristol-Myers Squibb), afatinib (Boehringer Ingelheim), AG 1478 (CAS # 153436-53-4), AG 494 (CAS # 133550-35-3), AG 555 (CAS # 133550-34-2), AG 556 (CAS # 133550-41 -1 ), AG 825 (CAS # 149092-50-2), AG-490 (CAS # 134036-52-5), antroquinonol (Golden Biotechnology), AP-26113 (Ariad), ARRY334543 (CAS # 845272-21 -1 ), AST 1306 (CAS # 897383-62-9), AVL-301 (Celgene), AZD8931 (CAS # 848942-61 -0), BIBU 1361 (CAS # 793726-84-8), BIBX 1382 (CAS # 196612-93-8), BMS-690514 (Bristol-Myers Squibb), BPIQ-I (CAS # 174709-30-9), Canertinib (Pfizer), cetuximab (Actavis), cipatinib (Jiangsu Hengrui Medicine), CL-387,785 (Santa Cruz Biotech), compound 56 (CAS # 171745-13-4), CTX-023 (CytomX Therapeutics), CUDC-101 (Curis), dacomitinib (Pfizer), DAPH (CAS # 145915-58-8), daphnetin (Santa Cruz Biotech), dovitinib lactate (Novartis), EGFR Inhibitor (CAS # 879127-07- 8), epitinib (Hutchison China MediTech), erbstatin Analog (CAS # 63177-57-1 ), erlotinib (Astellas), gefitinib (AstraZeneca), GT-MAB 5.2-GEX (Glycotope), GW 583340 (CAS # 388082- 81 -3), GW2974 (CAS # 202272-68-2), HDS 029 (CAS # 881001 -19-0), Hypericin (Santa Cruz Biotech), icotinib hydrochloride (Betapharma), JNJ-26483327 (Johnson & Johnson), JNJ- 28871063 (Johnson & Johnson), KD-020 (Kadmon Pharmaceuticals), lapatinib ditosylate (GlaxoSmithKline), Lavendustin A (Sigma), Lavendustin C (Sigma), LY-3016859 (Eli Lilly), MEHD-7945A (Hoffmann-La Roche), MM-151 (Merrimack), MT-062 (Medisyn Technologies), 85necitumumab (Eli Lilly), neratinib (Pfizer), nimotuzumab (Center of Molecular Immunology), NT-004 (NewGen Therapeutics), pantiumumab (Amgen), PD 153035 (CAS # 153436-54-5), PD 161570 (CAS # 192705-80-9), PD 168393, PD 174265 (CAS # 216163-53-0), pirotinib (Sihuan Pharmaceutical), poziotinib (Hanmi), PP 3 (CAS # 5334-30-5), PR-610 (Proacta), pyrotinib (Jiangsu Hengrui Medicine), RG-13022 (CAS # 136831 -48-6), rindopepimut (Celldex Therapeutics), RPI-1 (CAS # 269730-03-2), S-222611 (Shionogi), TAK 285 (CAS # 871026-44- 7), TAS-2913 (Taiho), theliatinib (Hutchison China MediTech), Tyrphostin 47 (RG-50864, AG- 213) (CAS # 118409-60-2), Tyrphostin 51 (CAS # 122520-90-5), Tyrphostin AG 1478 (CAS # 175178-82-2), Tyrphostin AG 183 (CAS # 126433-07-6), Tyrphostin AG 528 (CAS # 133550-49- 9), Tyrphostin AG 99 (CAS # 118409-59-9), Tyrphostin B42 (Santa Cruz Biotech), Tyrphostin B44 (Santa Cruz Biotech), Tyrphostin RG 14620 (CAS # 136831 -49-7), vandetanib (AstraZeneca), varlitinib (Array BioPharma), vatalanib (Novartis), WZ 3146 (CAS # 1214265-56- 1 ), WZ 4002 (CAS # 1213269-23-8), WZ8040 (CAS # 1214265-57-2), XL-647 (Exelixis), Z-650 (HEC Pharm), ZM 323881 (CAS # 324077-30-7), pharmaceutically acceptable salts thereof, and combinations thereof.
[0284] In another aspect of this embodiment, the method further comprises administeringto the subject at least one additional therapeutic agent effective for treating or ameliorating the effects of the cancer. The additional therapeutic agent may be selected from the group consisting of an antibody or fragment thereof, a toxin, a radionuclide, an immunomodulator, a photoactive therapeutic agent, a radiosensitizing agent, a hormone, an anti-angiogenesis agent, and combinations thereof.
[0285] As used herein, an "antibody" encompasses naturally occurring immunoglobulinsas well as non-naturally occurring immunoglobulins, including, for example, single chain 86antibodies, chimeric antibodies (e.g., humanized murine antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Fragments of antibodies include those that bind antigen, (e.g., Fab', F(ab')2, Fab, Fv, and rlgG). See also, e.g., Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, III.); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term "antibody" further includes both polyclonal and monoclonal antibodies.
[0286] Examples of therapeutic antibodies that may be used in the present inventioninclude rituximab (Rituxan), Cetuximab (Erbitux), bevacizumab (Avastin), and Ibritumomab (Zevalin).
[0287] Cytotoxic agents include DNA damaging agents, antimetabolites, anti-microtubuleagents, antibiotic agents, etc. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inhibitors of DNA replication include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists such 87as methotrexate and premetrexed, purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Anti-microtubule agents include without limitation vinca alkaloids, paclitaxel (Taxol®), docetaxel (Taxotere®), and ixabepilone (Ixempra®). Antibiotic agents include without limitation actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0288] Cytotoxic agents also include an inhibitor of the P13K / Akt pathway. Non-limitingexamples of an inhibitor of the P13K / Akt pathway include A-674563 (CAS # 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene- thiazolidine-2,4-dione), AS-604850 (5-(2,2-Difluoro-benzo[1,3]dioxol-5-ylmethylene)- thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS # 857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS # 32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS # 612847-09-3, CAS # 681281-88-9, CAS # 75747-14-7, CAS # 925681- 41-0, CAS # 98510-80-6, CCT128930 (CAS # 885499-61-6), CH5132799 (CAS # 1007207-67- 1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS # 902779-59-3), GS- 1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS # 937174-76-0), H-89 (CAS # 127243- 85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS # 108068-98-0), Miltefosine, MK-2206 dihydrochloride (CAS # 1032350-13-2), ML- 9 (CAS # 105637-50-1), Naltrindole Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), 88perifosine, PHT-427 (CAS # 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitors, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitors, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitors-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitors, Roche (Roche Holdings Inc.), PI3 kinase inhibitors, Roche-5 (Roche Holdings Inc.), P13-alpha / delta inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitors, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitors, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitors, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitors, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors, Cellzome (Cellzome AG), PI3- delta / gamma inhibitors, Cellzome (Cellzome AG), PI3-delta / gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitors, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3- gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitors, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitors, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitors, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS # 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, Tetrahydro Curcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0289] In the present invention, the term "toxin" means an antigenic poison or venom ofplant or animal origin. An example is diphtheria toxin or portions thereof. 89
[0290] In the present invention, the term "radionuclide" means a radioactive substanceadministered to the patient, e.g., intravenously, or orally, after which it penetrates via the patient's normal metabolism into the target organ or tissue, where it delivers local radiation for a short time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.
[0291] In the present invention, the term "immunomodulator" means a substance that altersthe immune response by augmenting or reducing the ability of the immune system to produce antibodies or sensitized cells that recognize and react with the antigen that initiated their production. Immunomodulators may be recombinant, synthetic, or natural preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunomodulators are naturally present in the body, and certain of these are available in pharmacologic preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferons, imiquimod and cellular membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).
[0292] In the present invention, the term "photoactive therapeutic agent" meanscompounds and compositions that become active upon exposure to light. Certain examples of photoactive therapeutic agents are disclosed, e.g., in U.S. Patent Application Serial No. 2011 / 0152230 A1, "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy."
[0293] In the present invention, the term "radiosensitizing agent" means a compound thatmakes tumor cells more sensitive to radiation therapy. Examples of radiosensitizing agents include misonidazole, metronidazole, tirapazamine, and trans sodium crocetinate. 90
[0294] In the present invention, the term "hormone" means a substance released by cellsin one part of a body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, antimullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin- releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, liptropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.
[0295] Some compounds interfere with the activity of certain hormones or stop theproduction of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in the present invention.
[0296] As used herein, an "anti-angiogenesis" agent means a substance that reduces orinhibits the growth of new blood vessels, such as, e.g., an inhibitor of vascular endothelial growth factor (VEGF) and an inhibitor of endothelial cell migration. Anti-angiogenesis agents include without limitation 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-a, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, 91thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0297] In an additional aspect of this embodiment, administration of the first and secondanti-cancer agents provides a synergistic effect compared to administration of either anti-cancer agent alone. As used herein, "synergistic" means more than additive. Synergistic effects may be measured by various assays known in the art, including but not limited to those disclosed herein, such as the excess over bliss assay.
[0298] Also disclosed herein is a method of treating or ameliorating the effects of a cancerin a subject in need thereof. In one embodiment of the present invention, an effective amount of (i) BVD-523 or a pharmaceutically acceptable salt thereof and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof, is used for treating or ameliorating the effects of the cancer in the subject.
[0299] Suitable and preferred subjects are as disclosed herein. In this embodiment, theagents may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified above.
[0300] In one aspect of this embodiment, the BVD-523 or a pharmaceutically acceptablesalt thereof is administered in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent.
[0301] In a further aspect of this embodiment, the dabrafenib or a pharmaceuticallyacceptable salt thereof is administered in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent. 92
[0302] In a further aspect of this embodiment, at least one additional therapeutic agent,preferably an inhibitor of the PI3K / Akt pathway, is to be administered as disclosed herein.
[0303] In an additional aspect of this embodiment, administration of the first and secondanti-cancer agents provides a synergistic effect compared to administration of either anti-cancer agent alone.
[0304] Another embodiment of the present invention is an in vitro method of effectingcancer cell death. This method comprises contacting the cancer cell with an effective amount of (i) a first anti-cancer agent, which is BVD-523 or a pharmaceutically acceptable salt thereof and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof.
[0305] Suitable and preferred RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFRinhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors are as disclosed herein. In this embodiment, effecting cancer cell death may be accomplished in cancer cells having various mutational backgrounds and / or that are characterized as disclosed above.
[0306] In an aspect of this embodiment, the methods may be carried out in vitro, and maybe used to effect cancer cell death, by e.g., killing cancer cells, in cells of the types of cancer disclosed herein.
[0307] In another aspect of this embodiment, the cancer cell is a mammalian cancer cell.Preferably, the mammalian cancer cell is obtained from a mammal selected from the group 93consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammalian cancer cell is a human cancer cell.
[0308] In a further aspect of this embodiment, contacting the cancer cell with the first andsecond anti-cancer agents provides a synergistic effect compared to contacting the cancer cell with either anti-cancer agent alone.
[0309] In another aspect of this embodiment, the method further comprises contacting thecancer cell with at least one additional therapeutic agent, preferably an inhibitor of the P13K / Akt pathway, as disclosed herein.
[0310] In a further aspect of this embodiment, contacting the cancer cell with the first andsecond anti-cancer agents provides a synergistic effect compared to contacting the cancer cell with either anti-cancer agent alone. In this embodiment, "contacting" means bringing BVD-523 and the RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors, and optionally one or more additional therapeutic agents into close proximity to the cancer cells. This may be accomplished using conventional techniques of drug delivery to mammals or in the in vitro situation by, e.g., providing BVD-523 and the type 1 RAF inhibitors, and optionally other therapeutic agents to a culture media in which the cancer cells are located.
[0311] A further embodiment of the present invention is a kit for use in treating orameliorating the effects of a cancer in a subject in need thereof. This kit comprises an effective amount of (i) a first anti-cancer agent, which is BVD-523 or a pharmaceutically acceptable salt thereof dispersion as disclosed herein and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, 94and CDK inhibitors or a pharmaceutically acceptable salt thereof, packaged together with instructions for their use.
[0312] The kits may also include suitable storage containers, e.g., ampules, vials, tubes,etc., for each anti-cancer agent of the present invention (which may e.g., may be in the form of pharmaceutical compositions) and other reagents, e.g., buffers, balanced salt solutions, etc., for use in administering the anti-cancer agents to subjects. The anti-cancer agents of the invention and other reagents may be present in the kits in any convenient form, such as, e.g., in a solution or in a powder form. The kits may further include a packaging container, optionally having one or more partitions for housing the pharmaceutical composition and other optional reagents.
[0313] Suitable and preferred subjects and RAF inhibitors, MEK inhibitors, ERK1 / 2inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors are as disclosed herein. In this embodiment, the kit may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified herein.
[0314] In a further aspect of this embodiment, the kit further comprises at least oneadditional therapeutic agent, preferably an inhibitor of the P13K / Akt pathway, as disclosed herein.
[0315] In an additional aspect of this embodiment, administration of the first and secondanti-cancer agents provides a synergistic effect compared to administration of either anti-cancer agent alone.
[0316] Another embodiment of the present invention is a pharmaceutical composition foruse in treating or ameliorating the effects of a cancer in a subject in need thereof. This pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier and an effective amount of (i) a first anti-cancer agent, which is BVD-523 or a pharmaceutically 95acceptable salt thereof and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof, wherein administration of the first and second anti-cancer agents provides a synergistic effect compared to administration of either anti- cancer agent alone. This pharmaceutical composition may further comprise a pharmaceutically acceptable diluent or carrier.
[0317] Suitable and preferred subjects and RAF inhibitors, MEK inhibitors, ERK1 / 2inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors are as disclosed herein. The pharmaceutical compositions of the invention may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified herein.
[0318] In a further aspect of this embodiment, the pharmaceutical composition furthercomprises at least one additional therapeutic agent, preferably an inhibitor of the P13K / Akt pathway, as disclosed herein.
[0319] Further disclosed is a method of treating or ameliorating the effects of a cancer ina subject in need thereof. In one embodiment of the present invention, an effective amount of (i) a first anti-cancer agent, which is an amorphous solid dispersion comprising BVD-523 or a pharmaceutically acceptable salt thereof as disclosed herein and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof is to be administered to the subject for use in treating or ameliorating the effects of the cancer. 96
[0320] In this embodiment, suitable and preferred subjects are as disclosed herein. In thisembodiment, the agents may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified above. Methods of identifying such mutations are also as set forth above.
[0321] In a further aspect of this embodiment, at least one additional therapeutic agent,preferably an inhibitor of the P13K / Akt pathway, is further to be administered as disclosed herein.
[0322] In another aspect of this embodiment, administration of the first and second anti-cancer agents provides a synergistic effect compared to administration of either anti-cancer agent alone.
[0323] An additional embodiment of the present invention is an in vitro method ofeffecting cancer cell death. This method comprises contacting the cancer cell with an effective amount of (i) a first anti-cancer agent, which is BVD-523 or a pharmaceutically acceptable salt thereof and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof.
[0324] Suitable and preferred cancer cells are as disclosed herein. In this embodiment,effecting cancer cell death may be accomplished in cancer cells having various mutational backgrounds and / or that are characterized as disclosed above. Methods of identifying such mutations are also as set forth above.
[0325] The methods of this embodiment, which may be carried out in vitro, may be usedto effect cancer cell death, by e.g., killing cancer cells, in cells of the types of cancer disclosed herein. 97
[0326] In one aspect of this embodiment, the cancer cell is a mammalian cancer cell.Preferably, the mammalian cancer cell is obtained from a mammal selected from the group consisting of humans, primates, farm animals, and domestic animals. More preferably, the mammalian cancer cell is a human cancer cell.
[0327] Another embodiment of the present invention is a pharmaceutical composition foruse in treating or ameliorating the effects of a cancer in a subject in need thereof. This pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier and an effective amount of (i) a first anti-cancer agent, which is BVD-523 or a pharmaceutically acceptable salt thereof and (ii) a second anti-cancer agent, which is one or more of RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, EGFR inhibitors, RET inhibitors, MDM2 inhibitors, STAT3 inhibitors, SHP2 inhibitors, BCL2 inhibitors, JAK inhibitors, KRAS inhibitors, and CDK inhibitors or a pharmaceutically acceptable salt thereof, wherein administration of the first and second anti-cancer agents provides a synergistic effect compared to administration of either anti- cancer agent alone.
[0328] In this embodiment, suitable and preferred subjects are as disclosed herein. Thepharmaceutical compositions of the invention may be used to treat the cancers disclosed above, including those cancers with the mutational backgrounds identified herein. Methods of identifying such mutations are also as set forth above.
[0329] In a further aspect of this embodiment, the pharmaceutical composition furthercomprises at least one additional therapeutic agent, preferably an inhibitor of the P13K / Akt pathway, as disclosed herein.
[0330] The pharmaceutical compositions according to the present invention may be in aunit dosage form comprising both anti-cancer agents. In another aspect of this embodiment, the 98first anti-cancer agent is in a first unit dosage form and the second anti-cancer agent is in a second unit dosage form, separate from the first.
[0331] The first and second anti-cancer agents may be co-administered to the subject,either simultaneously or at different times, as deemed most appropriate by a physician. If the first and second anti-cancer agents are administered at different times, for example, by serial administration, the first anti-cancer agent may be administered to the subject before the second anti-cancer agent. Alternatively, the second anti-cancer agent may be administered to the subject before the first anti-cancer agent.
[0332] The pharmaceutical compositions of the invention comprise one or more activeingredients, e.g. anti-cancer agents, in admixture with one or more pharmaceutically acceptable diluents or carriers and, optionally, one or more other compounds, drugs, ingredients and / or materials. Regardless of the route of administration selected, the agents / compounds of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. See, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.).
[0333] Pharmaceutically acceptable diluents or carriers are well known in the art(see, e.g., Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, PA.) and The National Formulary (American Pharmaceutical Association, Washington, D.C.)) and include sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starches, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl 99alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and tryglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and groundnut), cocoa butter, waxes (e.g., suppository waxes), paraffins, silicones, talc, silicylate, etc. Each pharmaceutically acceptable diluent or carrier used in a pharmaceutical composition of the invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a chosen dosage form and method of administration can be determined using ordinary skill in the art.
[0334] The pharmaceutical compositions of the invention may, optionally, containadditional ingredients and / or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, hydroxypropylmethyl cellulose, sucrose and acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethyl cellulose and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, 100aluminum metahydroxide, bentonite, agar-agar and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugars, polyethylene glycols, animal and vegetable fats, oils, waxes, paraffins, cocoa butter, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonites, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicates, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surface-active agents; (16) dispersing agents; (17) control-release or absorption-delaying agents, such as hydroxypropylmethyl cellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents; (21) emulsifying and suspending agents; (22), solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents which render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweetening, flavoring, coloring, perfuming and preservative agents. Each such ingredient or material must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a chosen dosage form and method of administration may be determined using ordinary skill in the art. 101
[0335] The pharmaceutical compositions of the present invention suitable for oraladministration may be in the form of capsules, cachets, pills, tablets, powders, granules, a solution or a suspension in an aqueous or non-aqueous liquid, an oil-in-water or water-in-oil liquid emulsion, an elixir or syrup, a pastille, a bolus, an electuary or a paste. These formulations may be prepared by methods known in the art, e.g., by means of conventional pan-coating, mixing, granulation or lyophilization processes.
[0336] Solid dosage forms for oral administration (capsules, tablets, pills, dragees,powders, granules and the like) may be prepared, e.g., by mixing the active ingredient(s) with one or more pharmaceutically acceptable diluents or carriers and, optionally, one or more fillers, extenders, binders, humectants, disintegrating agents, solution retarding agents, absorption accelerators, wetting agents, absorbents, lubricants, and / or coloring agents. Solid compositions of a similar type may be employed as fillers in soft and hard-filled gelatin capsules using a suitable excipient. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using a suitable binder, lubricant, inert diluent, preservative, disintegrant, surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine. The tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein. They may be sterilized by, for example, filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of a composition such that they release the active ingredient only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. The active ingredient can also be in microencapsulated form. 102
[0337] Liquid dosage forms for oral administration include pharmaceutically acceptableemulsions, microemulsions, solutions, suspensions, syrups and elixirs. The liquid dosage forms may contain suitable inert diluents commonly used in the art. Besides inert diluents, the oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents. Suspensions may contain suspending agents.
[0338] The pharmaceutical compositions of the present invention for rectal or vaginaladministration may be presented as a suppository, which may be prepared by mixing one or more active ingredient(s) with one or more suitable nonirritating diluents or carriers which are solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active compound. The pharmaceutical compositions of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such pharmaceutically acceptable diluents or carriers as are known in the art to be appropriate.
[0339] Dosage forms for the topical or transdermal administration include powders,sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent(s) / compound(s) may be mixed under sterile conditions with a suitable pharmaceutically acceptable diluent or carrier. The ointments, pastes, creams and gels may contain excipients. Powders and sprays may contain excipients and propellants.
[0340] The pharmaceutical compositions of the present invention suitable for parenteraladministrations may comprise one or more agent(s) / compound(s) in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable 103solutions or dispersions just prior to use, which may contain suitable antioxidants, buffers, solutes which render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants, such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption.
[0341] In some cases, in order to prolong the effect of a drug (e.g., pharmaceuticalformulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility.
[0342] The rate of absorption of the active agent / drug then depends upon its rate ofdissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered agent / drug may be accomplished by dissolving or suspending the active agent / drug in an oil vehicle. Injectable depot forms may be made by forming microencapsule matrices of the active ingredient in biodegradable polymers. Depending on the ratio of the active ingredient to polymer, and the nature of the particular polymer employed, the rate of active ingredient release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue. The injectable materials can be sterilized for example, by filtration through a bacterial- retaining filter. 104
[0343] The formulations may be presented in unit-dose or multi-dose sealed containers,for example, ampules and vials, and may be stored in a lyophilized condition requiring only the addition of the sterile liquid diluent or carrier, for example water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above. EXAMPLES
[0344] The following examples are provided to further illustrate the compositions andmethods of the present disclosure. These examples are illustrative only and are not intended to limit the scope of the disclosure in any way. EXAMPLE 1: Solid Dispersion Screen of BVD-523
[0345] A screen was conducted to identify a solid dispersion with acceptable physicalstability using a variety of polymers and polymer concentrations with BVD-523.. A summary of the results from the work performed is provided below.
[0346] Solid Dispersion Screen: Experimental attempts to prepare amorphous dispersions wereconducted by flash evaporation under vacuum from a 3:1 acetone / ethanol mixture usingpolymers including Eudragit® L100, HPMC-AS grade MG, HPMC-P grade 55, PVP grade K-90, PVP-co-VA, Soluplus®, and PEG with average Mn 10,000. Dispersions were made atcompositions of 90:10 and 50:50 (w / w) of BVD-523 free base to polymer (only a 50:50 (w / w)composition was prepared for the PEG dispersion). Samples generated were observed underpolarized light microscope (PLM) and characterized by XRPD. Based on XRPD, x-ray amorphous(i.e. without sharp peaks and consistent with non-crystalline materials) dispersions were obtained105for all attempts except for the dispersion prepared with PEG. The results are included in Table3 below. Table 3. BVD-523 Dispersion Attempts from 3:1 (v / v) Acetone / Ethanol by Flash Evaporation Polymer Composition (a) Analysis Results PLM solids white, unk, some B / E
[0347] Based on XRPD, x-ray amorphous (i.e., without sharp peaks and consistent withnon-crystalline materials) dispersions were obtained for all samples generated except for thedispersion prepared with PEG, as shown in Figure 2 through Figure 7.106
[0348] All materials determined to be x-ray amorphous were further characterized bymDSC (Figure 8 though Figure 19) where the appearance of a single glass transition temperature(Tg) provides support for a non-crystalline miscible dispersion. Most of the dispersions display asingle Tg except samples of 50:50 (w / w) BVD-523 / Eudragit (Figure 8) and 90:10 (w / w) BVD-523 / PVP-co-VA (Figure 17), where two step changes are observed from the reversing heatflow in mDSC, indicating phase separated materials.
[0349] For most of the BVD-523 / polymer dispersions with a 90:10 (w / w) composition(Figure 11, Figure 15, Figure 17, and Figure 19), an exotherm at approximately 161 °C-168 °C(peak) is observed from the mDSC total heat flow signal, followed by a sharp endotherm atapproximately 181 °C (peak), which are likely due to the recrystallization and subsequent meltingof BVD-523 upon heating. Such a recrystallization event is not observed with 90:10 (w / w)dispersions prepared with Eudragit (Figure 9) and HPMC-P (Figure 13).
[0350] Physical Stability Assessment: An assessment of physical stability wasperformed on BVD-523 / polymer dispersions that are x-ray amorphous and display a single Tg,which include 90:10 (w / w) BVD-523 / Eudragit, 50:50 and 90:10 (w / w) BVD-523 / HPMC-ASMG, 50:50 and 90:10 (w / w) BVD-523 / HPMC-P, 50:50 and 90:10 (w / w) BVD-523 / PVP K-90, 50:50 (w / w) BVD-523 / PVP-co-VA, and 50:50 and 90:10 (w / w) BVD-523 / Soluplus. Theassessment was conducted under conditions of elevated temperature / relative humidity (40ºC / 75% RH), aqueous solutions at different biorelevant conditions, including a pH 2.0 HClsolution at 37 ºC and pH 6.5 FaSSIF buffer at 37 ºC, and a dosing vehicle of 1 wt%methylcellulose in water at ambient temperature. Post study samples were characterized byXRPD if exposed to 40 ºC / 75% RH condition, or PLM if exposed to aqueous solutions. 107
[0351] Stress at 40 ºC / 75% RH condition: BVD-523 / polymer dispersions that were x-rayamorphous and displayed a single Tg were exposed to 40 °C / 75% RH for 5 days, and then assessed for evidence of crystallization based on XRPD analysis after exposure. Results from the study are summarized in Table 4. Table 4. Physical Stability Assessment for BVD-523 Dispersions at 40 ºC / 75 % RH / 5 days Dispersion (a) Analysis Results 90:10 Eudragit L100 XRPD x-ray amorphousy , y y ofthe stressed dispersions over the course of 5 days (Figure 20 through Figure 24). Peaks around 31.7° 2Ɵ is observed from the XRPD pattern of 50:50 BVD-523 / HPMC-AS MG dispersion, which is likely due to the salt (NaCl) that was used to generate the 75% RH condition (Figure 21).
[0353] Stress in pH 2.0 HCl solution at 37 ºC: BVD-523 / polymer dispersions wereexposed to a pH 2.0 HCl solution at 37 ºC for up to 24 hrs, and images were acquired using polarized light microscopy at different time points including 0, 3, 6, and 24 hrs (Figure 25). Experimental results are summarized in Table 5. Table 5. Physical Stability Assessment for BVD-523 Dispersions in pH 2 Medium at 37 ºC Dispersion (a) Time Analysis Results e;1080isotropic flakes, some B / E from edge+ agg, unk, no B50:501 hrPLMsame as t = 0e;eee
[0354] The initial time point, t = 0, is the moment when the medium was chargedto the solids. Birefringence / extinction (B / E) was observed in samples, which is likely due to strain effects or edge refraction / reflection from the isotropic flakes. For dispersions at a 90:10(w / w) composition, birefringent particles with extinction were observed at t = 1 hr for samples109prepared with PVP K-90 and Soluplus, and at t = 3 hr for samples prepared with HPMC-ASMG and HPMC-P. The appearance of B / E particles likely indicates the occurrence ofcrystallization of BVD-523. For dispersions at a 50:50 (w / w) composition, evidence ofcrystallization was observed at t = 3 hr for samples prepared with Soluplus and HPMC-ASMG and at t = 6 hr for samples prepared with HPMC-P, PVP K-90 and PVP-co-VA.
[0355] Stress in pH 6.5 FaSSIF buffer at 37 ºC: An assessment of physical stability ofBVD-523 / polymer dispersions was also performed in pH 6.5 FaSSIF at 37 ºC for up to 24 hrs. Samples were observed under PLM at different time points, and PLM images were acquired at the end point for representative samples (Figure 26). Experimental results are included in Table 6. Table 6. Physical Stability Assessment for BVD-523 Dispersions in pH 6.5 FaSSIF at 37 ºC Dispersion (a) Time Analysis Results isotropic flakes, B / E from edge + agg,&eg,g,&ee6 hr same as t = 024 hr same as t = 0isotropic flakes B / E from edge + agg,&eeeg,&e
[0356] Crystalline particles were observed in samples prepared with Soluplus at the t = 24hr time point for both the 50:50 and 90:10 (w / w) compositions. For other dispersions, no change was observed in samples with a 50:50 (w / w) composition at t = 24 hr while tiny B / E particles appeared in some, but not all of the flakes, for the 90:10 (w / w) dispersions, as shown in Figure 26, for example, which is the PLM image for the dispersion with PVP K- 90. 111
[0357] Stress in 1 wt% methylcellulose solution at ambient temperature: BVD-523 / polymer dispersions were exposed to a dosing vehicle (1 wt% methylcellulose in water) at ambient temperature for up to 24 hrs. Observations using PLM were made at different time points including 0, 1, 3, 6, and 24 hrs, and PLM images were acquired at the end point for selected samples (Figure 27). Experimental results are summarized in Table 7. Table 7. Physical Stability Assessment for BVD-523 Dispersions in Dosing Vehicle at Ambient Temperature Dispersion (a) Time Analysis Results 0isotropic flakes, some B / E from edgesesesesese1120isotropic flakes, some B / E from edge+ agg, unk, no B1 hr same as t = 0sfinesfinesfinesfin
[0358] At the 6 hr time point, B / E particles started to appear in the flakes for all samplesand at t = 24 hr, B / E particles were observed in many flakes for all dispersions with a 50:50 (w / w) composition. Among them, dispersions prepared with PVP K-90, PVP-co-VA and Soluplus appeared to have more flakes containing B / E particles than those prepared with HPMC-AS MG and HPMC-P. For dispersions at the 90:10 (w / w) composition, B / E particles were observed in most of the flakes at t = 24 hr, and in solution for the sample prepared with Soluplus. B / E particles were observed in most of the flakes but not in solution for the sample prepared with PVP K-90, while for dispersions prepared with HPMC-AS MG and HPMC-P, B / E particles were only 113observed in some of the flakes. It is noticed that dispersions prepared with HPMC-AS and HPMC- P seem to have a larger amount of flakes that were containing B / E particles at 50:50 than at 90:10 (w / w).
[0359] Summary of Physical Stability Data: All BVD-523 / polymer dispersions atcompositions of 50:50 and 90:10 (w / w) appeared to be physically stable when exposed to 40 ºC / 75% RH for 5 days. Recrystallization of the API was observed within the first 6 hr for all the dispersions when exposed to the pH 2.0 HCl solution. Upon exposure to FaSSIF, all of the 50:50 (w / w) dispersions and the 90:10 (w / w) dispersion prepared with Soluplus resulted in recrystallization by 24 hr whereas the 90:10 (w / w) dispersions prepared with HPMC-AS MG, HPMC-P and PVP K-90 appeared to be physically stable after 24 hr of exposure to FaSSIF. In 1% methylcellulose solution, B / E particles started to appear in all samples by 6 hr. Dispersions prepared with HPMC-P and HPMC-AS MG appeared to be more stable than the dispersions generated with other polymers, particularly at the 90:10 (w / w) concentration, while dispersions prepared with Soluplus appeared to be the least stable of all at both BVD-523 / polymer ratios, 50:50 (w / w) and 90:10 (w / w).
[0360] Scale-up of BVD-523 Solid Dispersions by Spray Drying: Based on theexperimental results of the polymer screen and the initial physical assessment of the solid dispersions, BVD-523 / HPMC-AS MG, BVD-523 / HPMC-P and BVD- 523 / PVP K-90 dispersions at the 50:50 (w / w) concentration were selected for scale up and further characterization. Additional quantities of the solid dispersions at gram scale -were prepared by spray drying from a 3:1 (v / v) mixture of acetone and ethanol. The operating parameters used in the spray drying process are presented in Table 8, and characterization results of the materials produced are summarized in Table 9. 114Table 8. Spray Drying Parameters for BVD-523 Dispersion Samples Inlet temp. Inlet t sion (set, ºC)Aspemp. Outlet temp. Disperirator% Pump%(measured, ºC) (measured, ºC) 5050Table 9. Characterization of BVD-523 Solid Dispersion from Scale-up Attempts Polymer Observation Analysis Results XRPD x-ray amorphous
[0361] Characterization of 50:50 (w / w) BVD-523 / HPMC-AS MG dispersion: Based onvisual inspection the material of 50:50 (w / w) BVD-523 / HPMC-AS MG was x-ray amorphous by XRPD, which is consistent with the observations under PLM that the material did not exhibit any birefringence (Figure 28). A single Tg at approximately 94 ºC was observed from the apparent 115step change in the reversing heat flow signal in mDSC with the change of heat capacity 0.4 J / g ºC (Figure 29). A broad, non-reversible endotherm is observed from the total heat flow at approximately 48 °C, which is likely due to the volatilization of the residual solvent from the material. TG-IR analysis was conducted to determine volatile content on heating. The material displayed a total weight loss of approximately 0.4 wt% from ambient to 100 °C, with a dramatic change in the slope above approximately 208 °C (Figure 30). The Gram-Schmidt plot shown in Figure 31 (left) corresponds to the overall IR intensity associated with volatiles released by the solids upon heating. The Gram-Schmidt plot shows a dramatic increase in intensity starting at ~ 9 minutes with a maximum at ~ 11.8 minutes. The waterfall plot (Figure 31, right) and the linked IR spectrum at different time points (Figure 32) are indicative of the loss of unknown volatiles after ~ 9 minutes. This is consistent with the dramatic change in the slope in the TGA and may indicate decomposition of material.
[0362] Characterization of 50:50 (w / w) BVD-523 / HPMC-P dispersion: The 50:50 (w / w)BVD-523 / HPMC-P solids were x-ray amorphous, consistent with the PLM observations of the material not exhibiting any birefringence (Figure 33). A single Tg at approximately 120 ºC is observed from the apparent step change in the reversing heat flow signal in mDSC with the change of heat capacity 0.4 J / g ºC (Figure 34). A broad, non-reversible endotherm is observed from the total heat flow at approximately 60 °C, likely due to the volatilization of the residual solvent upon heating. An endotherm at approximately 182 ºC is also observed in this dispersion. Although the material is x-ray amorphous by XRPD, the presence of the endotherm at approximately 182 ºC (corresponding to the melting of BVD-523 free base) may indicate the existence of some crystalline BVD-523 in the material. In order to assess the risk of recrystallization, the dispersion was stressed in pH 2.0 buffer at 37 ºC for 6 hr and the resulting material was examined by XRPD 116to evaluate the stability. The post stress material remained x-ray amorphous (Figure 35). By TG- IR, the material displayed a total weight loss of approximately 0.7 wt% from ambient to 100 °C, with a dramatic change in the slope above approximately 174 °C (Figure 36). The Gram-Schmidt plot shows an increase in intensity upon heating with a small maximum at ~ 6.5 minutes, followed by a dramatic increase in intensity with the maximum at ~ 11.5 minutes (Figure 37, top). Based on the waterfall plot (Figure 37, bottom) and the linked IR spectra (Figure 38), the released volatiles are residual ethanol and acetone at ~ 6.5 minutes and some unknown volatiles after ~ 9 minutes.
[0363] Characterization of 50:50 (w / w) BVD-523 / PVP K-90 dispersion: The sample of50:50 (w / w) BVD-523 / PVP K-90 solids were x-ray amorphous, consistent with the PLM observations of the material not exhibiting any birefringence (Figure 39). By mDSC, there is a single Tg at approximately 142 ºC from the apparent step change in the reversing heat flow signal with the change of heat capacity 0.3 J / g ºC (Figure 40). A broad, non-reversible endotherm is observed from the total heat flow at approximately 62 °C, likely due to the volatilization of the residual solvent from the material. TG-IR analysis of the material displays a total weight loss of approximately 1.7 wt% from ambient to 100 °C, and an additional weight loss of approximately 0.4% wt% from 100 °C to 190 °C (Figure 41). The Gram-Schmidt plot displays an increase in intensity upon heating with the maximum at ~ 7.5 minutes (Figure 42, top). Based on the waterfall plot (Figure 42, bottom) and the linked IR spectra (Figure 43), the released volatiles are acetone and ethanol, which are the solvents used in the spray drying process.
[0364] Dissolution studies were performed on the scaled-up dispersions in two biologicallyrelevant media: pH 1.6 FaSSGF and pH 6.5 FaSSIF.
[0365] Each sample was prepared at a concentration of 1.2 mg / mL (API equivalence).Solids were charged into a conical centrifuge vial and shaken on an orbital shaker at ambient 117temperature. The medium added into each sample was pH 1.6 FaSSGF, which was replaced by pH 6.5 FaSSIF after 30 min. In FaSSIF, all the samples were shaken for 5 hrs.
[0366] In pH 1.6 FaSSGF, samples were centrifuged and an aliquot of the supernatant wasremoved from each sample at 5, 15, and 30 min, and diluted with FaSSGF for analysis. After the final aliquot was taken at 30 min, the remaining FaSSGF solution was removed and pH 6.5 FaSSIF was added into each sample. Samples were centrifuged and an aliquot of the supernatant was removed from each sample at 10, 30, 60, 90, 120, 180, 270 and 300 min, and diluted with FaSSIF for analysis. All samples were analyzed by HPLC to determine the solubility of BVD-523 in solutions using a 1 µg / mL standard as a reference.
[0367] The solubilities of the BVD-523 / polymer dispersions, BVD-523 malonate salt andBVD-523 HCl salt were determined by HPLC analysis.
[0368] In FaSSGF, the concentrations of BVD-523 in all three dispersions and the BVD-523 HCl salt increased gradually over time. The dispersion prepared with HPMC-P displayed the highest concentration after 30 min compared to the other two dispersions. The BVD-523 HCl salt displayed the lowest solubility overall, whereas the BVD-523 malonate salt displayed the highest concentration and remained constant throughout the 30 min (Figure 44).
[0369] In FaSSIF (Figure 45), dispersions prepared with HPMC-AS MG and HPMC-Pdisplayed a constant concentration over 5 hrs. The 50:50 (w / w) BVD-523 / PVP K-90 dispersion gradually increased in concentration over time. Following an initial increase in concentration at 30 min, the BVD-523 malonate salt displayed a constant concentration. For the BVD-523 HCl salt, a sharp increase in concentration was observed at 90 min, and then the concentration decreased until 180 min. A summary of each solubility profile for the dispersions and BVD-523 salt forms is provided in Table 10 through Table 14. 118Table 10. Solubility of 50:50 (w / w) BVD-523 / HPMC-AS M at Ambient Temperature Time Concentration of BVD-523 Media (min) (µg / mL) 517677Table 11. Solubility of 50:50 (w / w) BVD-523 / HPMC-P at Ambient Temperature Time Concentration of BVD-523 Media (min) (µg / mL)Table 12. Solubility of 50:50 (w / w) BVD-523 / PVP K-90 at Ambient Temperature Time Concentration of BVD-523 Media (min) ( / mL)119Table 13. Solubility of the potential BVD-523 Malonate Salt at Ambient Temperature Time Concentration of BVD-523 Media (min) (µg / mL) 538063Table 14. Solubility of BVD-523 HCl Salt at Ambient Temperature Time Concentration of BVD-523 Media (min) (µg / mL)
[0370] XRPD analysis was performed on the dispersions and pH values were measured onall five samples after each step in dissolution testing; i.e., after being exposed to pH 1.6 FaSSGF for 30 min and after being exposed to pH 6.5 FaSSIF for 5 hrs. The results are summarized in Table 15. Table 15. XRPD Analysis of Post-Dissolution Samples and pH Measurement Media Material pH measured XRPD result050:50 (w / w) BVD-523 / HPMC-AS M1.78 x-ray amorphous50:50 (w / w) rll
[0371] All three dispersions remained x-ray amorphous throughout dissolution testing(Figure 46, Figure 47). Peaks around 27.0 ° and 31.7 ° 2Ɵ were observed from the XRPD patterns of the 50:50 (w / w) BVD-523 / HPMC-AS MG and BVD-523 / PVP K-90 dispersions after they were exposed to FaSSIF, which are likely due to the presence of sodium chloride in the medium. For the BVD-523 malonate salt, the post-dissolution solids from both FaSSGF and FaSSIF are a mixture of BVD-523 HCl salt Form A and the malonate salt (Figure 48).
[0372] For the BVD-523 HCl salt, the solids after being exposed to FaSSGF for 30 mindisplayed an XRPD pattern (Figure 49) of a mixture of Forms C and minor Form A, with extra peaks at 5.9, 8.1 and 10.8 ° 2Ɵ, designated as Material F. After such material was further exposed to FaSSIF buffer for 5 hrs, the isolated solids displayed an XRPD pattern consistent with a mixture of Form C and Material F, as shown in Figure 50. These two samples were exposed to ambient RH and kept uncapped at ambient conditions for 3 days. The samples were then analyzed by 121XPRD. No form conversion was noted in both samples and Material F appeared to persist (Figure 50).
[0373] Physical stability in 1% carboxymethylcellulose solution at ambient temperature:The scaled-up dispersions were exposed to a dosing vehicle (1 wt% carboxymethylcellulose in water) at ambient temperature for up to 24 hrs. PLM observations were made at different time points including 0, 1, 3, 6, and 24 hrs, and PLM images were acquired at the end point for selected samples (Figure 51). Experimental results are summarized in Table 16. Table 16. Physical Stability Assessment for BVD-523 Dispersions in Dosing Vehicle at Ambient Temperature Dispersion (a) Analysis Time Results 0agg, unknown, no Bss
[0374] A few crystalline particles were observed in the samples prepared with HPMC-ASMG and HPMCP at 24 hrs. No change was observed in the solid sample prepared with PVP K-90 122at 24 hrs. All three dispersions appear to be physically stable for up to 24 hrs in 1 wt% carboxymethylcellulose in water. EXAMPLE 2: Determination of the Pharmacokinetics of BVD-523 After a Single Oral Dose to Dogs
[0375] The purpose of the study was to collect samples for the determination of thepharmacokinetics of BVD-523 after administration of a single oral dose of the 50:50 (w / w) BVD- 523 / HPMC-AS MG, BVD-523 / HPMC-P and BVD- 523 / PVP K-90 dispersions to dogs.
[0376] Eight male non-naïve (but BVD-523-naïve) purebred beagles were transferred tothe study from stock colony. The animals were acclimated under the stock colony. At the time of dose administration, animals were young adults and weighed 9.2 to 13.5 kg.
[0377] For each formulation and phase, the formulations were prepared by mixing aweighed amount of BVD-523 test article in a 1% Carboxymethylcellulose in purified water vehicle. The formulations were homogenized with a probe-type homogenizer and magnetically stirred throughout the period of use. All formulations were visually uniform suspensions and were protected from light.
[0378] For each phase, animals were fasted overnight through approximately 4 hours postdose. Individual doses were calculated based on body weights recorded on each day of dose administration. The oral dose was administered by oral gavage at a volume of 5 mL / kg. Prior to withdrawing the gavage tube, the tube was flushed with approximately 10 mL of water. Each formulation was magnetically stirred throughout the period of use.
[0379] Blood was collected from a jugular vein into tubes containing sodium heparinanticoagulant pre-dose and at 0.5, 1, 2, 4, 6, 8, 12, and 24 hours post dose. 123
[0380] LC-MS / MS analysis was used to determine the concentration of BVD-523 in thedog plasma samples. The results are shown in Table 17 below. Table 17: Pharmacokinetics of BVD-523 (ng / mL) in plasma after administration of a single oral dose to male dogs (5 mg / kg) Tmax Cmax AUC0-24 ID (hr) (ng / mL) (ng*hr / mL)114126 1 185 1102.9114220 2 590 2999.7114027 2 308 2159.4EXAMPLE 3: Solid Dispersion Screening of BVD-523
[0381] Preparation of binary and ternary amorphous dispersions of BVD-523 wasconducted to investigate a potential for an increase of the API loading in the formulation. The preparation was carried out using a spray drying technique.
[0382] Preparation of BVD-523 Solid Dispersions
[0383] All dispersions were generated by spray drying from acetone:ethanol (3:1, v / v)solutions. The solution concentration at the feed was selected from the previous study and was approximately 10 mg / mL based on the total weight of solids. The spray dried samples were subjected to secondary drying in a vacuum oven at 40 – 45 °C for approximately 24 – 48 hours. The BVD-523 loadings and the polymers used in the binary dispersions were selected based on the previous study; HPMC-AS grade MG was utilized as the binary component, and Poloxamer 407 and SLS were employed as the tertiary components.
[0384] Binary Dispersions
[0385] Three binary dispersions of BVD-523 were prepared with HPMC-AS MG(Table18). To investigate the viability of increasing the loading of BVD-523, dispersions were prepared at 60:40, 70:30, and 80:20 (w / w) ratios of BVD-523 to the polymer. Each dispersion was characterized by XRPD, thermogravimetry (TGA), and modulated differential scanning calorimetry (mDSC) to determine the glass transition temperatures (Tg) (Table 19). 125
[0386] 60:40 BVD-523:HPMC-AS
[0387] By XRPD, the dispersion is X-ray amorphous; the XRPD pattern displays diffusescattering and no evidence of sharp peaks (Figure 52). The modulated DSC thermogram shows a step change in the reversing heat flow indicating a single glass transition temperature (Tg) at approximately 93 °C (Figure 53). A small endotherm is observed at 174 °C (peak max on the total heat flow). TGA analysis shows a 1.2 wt% loss between 24 °C and 139 °C due to the presence of volatiles (Figure 54). The sharp weight loss observed at 230 °C (onset) is typical of decomposition.
[0388] 70:30 BVD-523:HPMC-AS
[0389] By XRPD, the dispersion is X-ray amorphous. The XRPD pattern displays diffusescattering and no evidence of sharp peaks (Figure 52). The modulated DSC thermogram shows a step change in the reversing heat flow indicating a single Tg at ~93 °C (Figure 53). An exotherm followed by an endotherm observed at 159 °C and 178 °C (both peak max in the total heat flow) are likely due to crystallization followed by melting of the crystalline material. TGA analysis shows a 1.2 wt% loss between 28 °C and 139 °C due to volatiles (Figure 54) and the sharp weight loss observed at 230 °C (onset) is typical of decomposition.
[0390] 80:20 BVD-523:HPMC-AS
[0391] The dispersion is X-ray amorphous based on XRPD data. The XRPD patterndisplays diffuse scattering and no evidence of sharp peaks (Figure 52). The modulated DSC shows a single Tg at ~92 °C as a step change in the reversing heat flow (Figure 53). An exotherm and an endotherm observed at 155 °C and 179 °C (both peak max in the total heat flow) are likely due to crystallization followed by melting of the crystalline material. TGA analysis shows a weight loss of 1 wt% between 28 °C and 152 °C, likely due to volatiles (Figure 54) and the sharp weight loss observed at 233 °C (onset) is typical of decomposition. 126
[0392] Tables 18 and 19 below show the spray drying parameters and physicalcharacterization of BVD-523 dispersions. Table 18. Spray Drying Parameters Inlet temp. Outlet temp. Dispersion Inlet temp. Aspirator% Pump% (measured, ºC) (measured, ºC)Table 19. Physical Characterization of BVD-523 Binary Dispersions Dispersion Composition Analysis Results p CppXRPD X-ray amorphousReversing heat flow: 92.2 °C (midpoint, Tg); 8020 BVD 523 HPMC AS mDSC °
[0394] Physical stability testing was performed by stressing the three BVD-523:HPMC-AS MG dispersions at 75% RH / 40 °C conditions and in pH 2 HCl, pH 6.5 FaSSIF, and 0.5% methyl cellulose aqueous solution, all at 37 °C. The stressed samples were observed for signs of crystallization using polarized light microscopy immediately after addition of the media (t=0), and at t=1, 3, 6, and 24 hours, and after 3 to 4 days. Simultaneously, the dispersions were slurried in pH 2 HCl solution at 37 °C for up to 24 hours and solids were recovered for XRPD analysis.
[0395] Based on visual observations, none of the dispersions were observed to deliquesceafter 5 days at 75% RH / 40 °C (Table 20). Table 20. Stress of BVD-523 Binary Dispersions, 75% RH / 40 ºC / 5 Days Dispersion Composition Analysis Results
[0396] When analyzed by PLM, the three dispersions behaved similarly and showed nosigns of crystallization when stressed in pH 2 HCl, pH 6.5 FaSSIF, and 0.5% methyl cellulose solution for 24 hours. However, by XRPD, crystallization of the 70:30 and 80:20 dispersions was observed after a 24hour slurry in pH 2 media. The XRPD analysis of solids recovered after the slurry indicated crystallization to the free base (Figure 55). The crystallization of the 60:40 dispersion was noticed by PLM after the sample was in pH 2 HCl solution for 4 days. 128
[0397] To investigate the difference between the XRPD results and the PLM observationsand to bracket the optimal BVD-523 loading for ternary dispersions, the 60:40 and 80:20 dispersions were slurried in pH 2 HCl / 37 °C for 2 hours and solids were analyzed by XRPD at 30 minutes, 1, and 2 hours. Both dispersions remained X-ray amorphous during the two-hour period (Figure 56 and Figure 57).
[0398] The results of the bracketing experiments and physical stability assessment indicatethat the amorphous BVD-523:HPMC-AS MG dispersions with API loadings of 60%, 70%, and 80% provide a potential of producing a physically stable ternary dispersion. Table 21. Stress of BVD-523 Binary Dispersions, pH 6.5 FaSSIF, 37 ºC Dispersion Analysis Time Results Af fi B EkTable 22. Stress of BVD-523 Binary Dispersions, 0.5% Methyl Cellulose, 37 ºC Dispersion Analysis Time Results6 hr Thick solution; no B / E24 hr Thick solution; no B / E4 days Thick solution; no B / EoTable 23. Stress of BVD-523 Binary Dispersions, pH 2 HCl, 37 ºC Dispersion Analysis Time Results Al i fi i B E, E
[0399] Ternary Dispersions130
[0400] Based on the results of the physical stability testing for the binary dispersions, theternary dispersions were prepared at 80:20 (w / w) of BVD-523 to HPMC-AS MG. Poloxamer 407 and SLS were included as the tertiary components.
[0401] Dispersions with Poloxamer 407
[0402] Ternary dispersions of 80:20 BVD-523:HPMC-AS were prepared with 1, 5, and10% of Poloxamer 407 (Table 24). All three dispersions were X-ray amorphous by XRPD (Figure 58). Based on modulated DSC data, the dispersions had a single Tg at 91 °C, 78 °C, and 67 °C for Poloxamer 407 content of 1, 5, and 10%, respectively (Figure 59). The data indicated that the increase of the Poloxamer content resulted in a substantial drop in the glass transition temperatures of the dispersions.
[0403] Dispersions with SLS
[0404] Ternary dispersions of 80:20 BVD-523:HPMC-AS were prepared with 1, 5, and10% SLS (Table 24). The dispersions were X-ray amorphous based on XRPD (Figure 60). Modulated DSC data indicated a single glass transition temperature (Tg) of 91 °C for the dispersions with 1% and 5% SLS content. A single Tg of 88 °C is observed for the 10% SLS dispersion (Figure 61). Physical characterization results are shown below in Table 24. Table 24. Physical Characterization of 80:20 BVD-523:HPMC-AS M Ternary Dispersions Tertiary Component(a) Observations Analysis Results p131pieces; no Reversing heat flow: 77.6 °C (midpoint, Tg), ΔCp apparent B / E 0.5 J / (g °C) Total heat flow: weak endos at 49.4 mDSC °C and 76.6 °C exo at 146.2 °C endo at 178.0 °C )
[0405] Physical Stability Assessment
[0406] Physical stability of the ternary dispersions was evaluated using the sameconditions and techniques applied to the binary dispersions. Specifically, the dispersions were stressed at 75% RH / 40 °C and in pH 2 HCl, pH 6.5 FaSSIF, and 0.5% methyl cellulose aqueous solution at 37 °C.
[0407] Based on visual observations made by PLM, none of the dispersions containingPoloxamer 407 showed signs of crystallization after a 24-hour stress in the media tested. However, all three dispersions crystallized after a 2-hour slurry in pH 2 HCl media, based on XRPD data (Figure 62). 132
[0408] For ternary dispersions containing SLS, the dispersion with 1% SLS was physicallystable at all conditions tested. By XRPD, solids remained X-ray amorphous after they were slurried in pH 2 HCl for 2 hours (Figure 63). By PLM, the solids showed no visual signs of crystallization in HCl (pH 2), FaSSIF (pH 6.5), or 0.5% methyl cellulose when stressed for 24 hours; they also did not show evidence of crystallization at 75% RH / 40 °C for 5 days. Results of stress testing of BVD-523 Ternary Dispersions are shown below in Tables 25-28. Table 25. Stress of BVD-523 Ternary Dispersions, 75% RH / 40 °C / 5days Tertiary Component (a) Analysis Results Unknown mor holo some fibers;)s te l oTable 26. Stress of BVD-523 Ternary Dispersions, pH 2 HCl, 37 °C Tertiary Content (a) Analysis Time Results o1332 hr Thick solution + agglomerates; no B / E4 hr Thick solution + 1 large piece; no B / E6 hr Thick solution; no B / E; ll s,Table 27. Stress BVD-523 Ternary Dispersions, pH 6.5 FaSSIF, 37 °CTertiary Content (a) Analysis Time Results ; s;Thick solution with small particles, small aggregates; 4 hr no B / E Thick solution with small particles 1 small ; s;Table 28. Stress BVD-523 Ternary Dispersions, 0.5% Methyl Cellulose, 37 °C
[0409] TertiaryAnalysis Time Results Content (a) y s; E24 hr Thick solution + aggregates; no B / E0 Aggregates; no B / E2 hr Thick solution; no B / E;
[0410] The 5% and 10% SLS dispersions showed crystallization at various conditions. ByXRPD, the 5% SLS dispersion displayed crystalline peaks after it was slurried in pH 2 HCl media for 2 hours (Figure 63). By PLM, crystallization was observed after 4 hours in pH 2 HCl (Table 26). The 10% SLS dispersion crystallized after 4 hours in pH 2 HCl media (Table 11), after 24 hours in methyl cellulose (Table 28) and displayed one crystalline peak after a 5-day stress at 75% RH / 40 °C (Table 25). A summary of the physical stability testing for BVD-523 ternary dispersions is shown in Table 29 below. Table 29. Summary of Physical Stability Assessment for BVD-523 Ternary Dispersions 0.5% Methyl 75% RH / 40 Dispersion TpH 2 pH 2 FaSSIF Cellulose °C n n n136Crystallization; Disordered, broad Crystallization No No No 5% SLS 90.9 °Cpeaks are consistent (visual) after 4 crystallization crystallization crystallization 1 °
[0411] Dissolution of 80:20 BVD-523:HPMC-AS Ternary Dispersion with 1% SLS
[0412] Dissolution testing of the ternary dispersion was conducted in two biologicallyrelevant media: pH 1.6 FaSSGF and pH 6.5 FaSSIF. Experiments were also performed with BVD- 523 HCl crystalline Form C to provide data for comparison.
[0413] Each sample was prepared at a concentration of 1.2 mg / mL (API equivalence).Solids were charged into a conical centrifuge vial and shaken on an orbital shaker at ambient temperature. FaSSGF (pH 1.6) was added to each sample, and after 30 minutes, replaced by pH 6.5 FaSSIF. In FaSSIF, all the samples were shaken for 6 hours. In pH 1.6 FaSSGF, samples were centrifuged at t=5, 15, and 30 minutes, and an aliquot of the supernatant was removed and diluted with FaSSGF for analysis.
[0414] After 30 min, the FaSSGF solution was removed and pH 6.5 FaSSIF was addedinto each sample. Samples were centrifuged at t=10, 30, 60, 120, 180, 240, 300, and 360 minutes, and an aliquot of the supernatant was removed from each sample and diluted with FaSSIF for analysis. All samples were analyzed by HPLC to determine the concentration of BVD-523 in solutions using a 10 ug / mL standard. Solids remaining after the final pull in each media were isolated and analyzed by XRPD. The concentration profiles in FaSSGF and FaSSIF are provided in Figure 64 and Figure 65. 137
[0415] In FaSSGF (Figure 64), at each time point, the BVD-523 concentration from theternary dispersion was observed to be significantly higher compared to the concentration from the crystalline HCl salt. In addition, the BVD-523 concentration from the ternary dispersion increased gradually over time, and no concentration decrease, an indication of crystallization, was detected by HPLC over 30 minutes. However, signs of crystallization, i.e. weak peaks consistent with BVD- 523 HCl Form A, were observed by XRPD for solids recovered at the end of the 30-minute dissolution in FaSSGF (Figure 66). This could be due to volatiles (if present) possibly inducing crystallization prior to the XRPD analysis. The concentration of BVD-523 from the HCl salt was observed to increase slightly over time. After 30 min in FaSSGF, the HCl salt Form C converted to HCl salt Form A with unidentified peaks (Figure 67).
[0416] In FaSSIF (Figure 65), no significant differences were observed between theternary dispersion and the HCl salt, and the concentrations of BVD-523 from both samples increased gradually over time. Based on XRPD data, the ternary dispersion remained X-ray amorphous after 6 hours in the FaSSIF. The patterns exhibits diffuse scattering, indicative of X-ray amorphous material and a sharp peak at ~31.8° 2θ, which is attributable to the presence ofsodium chloride in the medium (Figure 68). A decrease in concentration with the HCl salt was observed at 6 hours, which likely indicates crystallization. XRPD analysis for solids recovered after 6 hours indicated a mixture of HCl salt Forms A and C (Figure 69). EXAMPLE 4: BVD-523 Solid Dispersion Composition and Procedures
[0417] BVD-523 Ternary Dispersion Ingredients:
[0418] BVD-523 ternary dispersions (70:29:1 and 80:129:1 BVD-523:HPMCAS-MG:SLS) were prepared from a 9:1 acetone:water mixture on the Büchi B-290 lab scale spray 138dryer to enable processing of the organic-water solvent mixture in a closed loop. The components of the BVD-523 ternary dispersion are listed below in Table 30. Table 30. Components of BVD-523 Ternary Solid Dispersions Component Function BVD-523 / Ulixertinib active pharmaceutical ingredients
[0419] Spray Drying Procedures:
[0420] BVD-523 ternary dispersions were prepared by spray drying in both small scale (1– 9 g API) and large scale (245 – 1000 g API in a single batch). SLS was charged to a flask containing water and the mixture was stirred for approximately 15 minutes at room temperature until the SLS was dissolved. The SLS solution in water was transferred at room temperature to a vessel containing acetone. The acetone:water mixture was stirred for 10 minutes at room temperature and then BVD-523 was added to the vessel and the mixture was stirred at room temperature for 30 minutes until the solids were no longer visible. A yellow solution was obtained. The HPMC-AS MG polymer was added to the BVD-523 solution under stirring at room temperature. The mixture was stirred for 20 minutes at this temperature to dissolve the solids and the resulting solution was gently agitated throughout the spray drying process. During the spray drying process, both the small and large scale BVD-523 ternary solutions were kept at room temperature. Solids recovered after spray drying were dried at 40 °C under vacuum for 24 hours and then stored at room temperature over desiccant. The conditions used for processing are presented in Table 31. Table 31. Operating Parameters Used for Processing BVD-523 Solid Dispersion 139SDD API Quantity / Flow Rate Aspirator Inlet Temp. Outlet Temp. Rate Wet SDD Dry SDD Formulation Batch Size (g / min) (measured, (measured, (%) °C) °C) Yield (%) Yield (%)
[0421] Dissolution Performance of BVD-523 Ternary Dispersions (SDD)
[0422] In-vitro drug dissolution performance for each ternary dispersion was evaluated bya two stage gastric transfer non-sink dissolution test which simulates pH and bile salt concentrations for both gastric and intestinal exposures respectively at 37 °C. The test is initiated in simulated gastric fluid (SGF) where the drug products are stirred in 0.1N HCl(aq) for 30 minutes at which point an equal volume of concentrated fasted-state simulated intestinal fluid (FaSSIF) is added to the SGF, resulting in a final pH of 6.8 in FaSSIF (0.1 M PBS, 2.24 mg / mL bile salts) and measured for an additional 3 hours by HPLC.
[0423] From the dissolution profiles (Figure 70), quantifiable values were obtained, whichincluded the maximum concentration of BVD-523 in SGF (CmaxGB) and SIF (CmaxFaSSIF), and the area under the curve following gastric transfer (AUC FaSSIF). As shown in Table 32 both solid dispersions provided an enhancement greater than 2.5-fold compared to crystalline BVD-523. Table 32: Drug Concentrations of BVD-523 from Two-Stage Gastric Non-Sink Dissolution Test 140BVD-523 Concentration (µg / mL) Cmax Cmax AUC AUC Formulation GB FaSSIF FaSSIF Enhancement BVD 523 r t llin 245 84 8700
[0424] Solid State Characterization of BVD-523 Ternary Dispersions
[0425] Thermal analysis by mDSC demonstrated that both ternary dispersions contained asingle Tg (Figure 71) of approximately 93 °C indicating an intimately mixed, homogenous amorphous solid dispersion, while the 80% API dispersion had a melt (Tm) at 176 °C (Figure 71, Table 33).
[0426] Table 33: Thermal Events Measured by MDSC of the BVD-523 Ternary DispersionsDispersion Tg (°C) Tm (°C)
[0427] Characterization of the ternary dispersions by XRD indicated that the dispersionsare amorphous with no crystalline peaks being observed in their diffractograms (Figure 72).
[0428] Accelerated Stability Testing
[0429] The BVD-523 ternary dispersions were aged for 4 weeks at 25°C / 60%RH in anopen packaging configuration and at 40°C / 75% RH in both an open and closed container with desiccant. The solid dispersions were evaluated for changes in amorphous physical state by XRD and thermal analysis by mDSC.
[0430] XRD analysis of the aged samples of the ternary dispersions shows that each BVD-523 ternary dispersion remains amorphous with no detectable crystalline material following four weeks of storage at accelerated conditions (40 °C / 75% RH) in both open and closed container 141closure systems (Figures 73) and a single Tg at approximately 94 ºC was observed for the 4 week stability samples stored at accelerated conditions (40 °C / 75% RH), which is consistent with the t=0 time point (Figures 74 and 75). EXAMPLE 5: Formulations for Crystalline API Capsules and Solid Dispersions Tablets
[0431] Exemplary formulations for crystalline API capsules and solid dispersions tabletsare presented below in Table 34. The capsule and tablet formulations were used in the dog PK study of Example 11. Table 34. Capsule and Tablet Formulation Compositions Ingredients Solid Dispersion Tablets Formulated Blend Capsules API in Capsules (Capsule A) (Capsule B) le
[0432] BVD-523 Solid Dispersion Tablet Procedure:
[0433] The process to produce immediate release tablets containing the spray drieddispersion intermediate consisted of three main steps: 1. Blending, de-lumping, and roller compaction of intragranular components; 2. Blending and de-lumping of extragranular components with the granules; 3. Tablet compression of the final blend. Description of the 142manufacturing process and process controls is shown in Figures 76 and 77. Figure 76 describes the manufacture of the BVD-523 solid dispersion microgranules. The manufacturing process for BVD-523 solid dispersion tablets is given in Figure 77. EXAMPLE 6: Characterization of BVD-523 Solid Dispersion Tablets
[0434] Disclosed herein are data characterizing the friability, disintegration time anddissolution performance of the BVD-523 solid dispersion tablets (Table 35, Figure 78). Table 35. Friability and Disintegration Time for BVD-523 Solid Dispersion Tablets, 150 mg Parameter Value
[0435] Dissolution Study
[0436] Dissolution testing was performed on the BVD-523 solid dispersion tablets.Tablets were added to each vessel (6 total) containing 900 mL of dissolution media at 37 °C with paddle stirrer set to 75 rpm. At designated time points of 5, 10, 15, 30, 45, and 60 minutes, aliquots were removed from each of the vessels and analyzed by HPLC (Figure 78).
[0437] Also disclosed herein are data characterizing the stability of the BVD-523 soliddispersion tablets. Thirty solid dispersion tablets manufactured according to Example 5 were placed into HDPE bottles (75 cc) with a 0.5g silica gel desiccant, capped, and heat-induction sealed. The closed packaging comprising the BVD-523 solid dispersion tablets was stored at 25±2ºC / 60±5%RH or 40±2ºC / 75±5%RH for various amounts of time. Tablets were evaluated for appearance, potency, impurities and related substances, dissolution, and water content at 0 months 143(i.e., immediately after packaging), 1 month, 3 months, 6 months, and 9 months. Results from stability testing of the BVD-523 solid dispersion tablets are shown in Tables 36 to 39 below. Table 36. Stability Study Data Summary, BVD-523 Tablets, 150 mg, Closed Packing Configuration t=0 and t=1 Month t=1 month t=1 month Test t=0 (25±2ºC / 60±5%RH) (40±2ºC / 75±5%RH) ts DTable 37. Stability Study Data Summary, BVD-523 Tablets, 150 mg, Closed Packing Configuration t=3 Months Test t=3 months (25±2ºC / 60±5%RH) t=3 months (40±2ºC / 75±5%RH)30 94% 1% 30 93% 1%45 98% 2% 45 99% 1%60 99% 2% 60 100% 1%Table 38. Stability Study Data Summary, BVD-523 Tablets, 150 mg, Closed Packing Configuration t=6 Months Test t=6 months (25±2ºC / 60±5%RH) t=6 months (40±2ºC / 75±5%RH) Appearance (Visual) Round, Off-White Tablets Round, Off-White TabletsTable 39. Stability Study Data Summary, BVD-523 Tablets, 150 mg, Closed Packing Configuration t=9 Months Test t=9 months (25±2ºC / 60±5%RH) t=9 months (40±2ºC / 75±5%RH)Water Content (KF) 2.42% 2.97%Measurement of assay / potency and individual and total related substances by HPLC for tablet stability study
[0438] Ten SDD tablets were weighed and ground to form a homogeneous compositesample. A quantity of sample corresponding to the average tablet weight was added to a 500 mL volumetric flask. The flask was filled to approximately 60% of volume with diluent and sonicated for 15 minutes. The flask was then shaken at 300 RPM for 30 minutes. The contents of the flask were cooled to room temperature, diluted to volume with diluent, and mixed. The sample was filtered, and the filtrate was collected in a vial for HPLC analysis. Assay quantitation used external standardization; impurities and related substances were quantitated on a percent peak area basis. Individual impurities and related substances were identified by their relative retention time (RRT) to BVD-523. Total impurities and related substances were reported as the sum of all individual impurities ≥ 0.05%. EXAMPLE 7: Solubility Analysis of BVD-523 with Polymer Excipients
[0439] Described herein are the kinetic solubility measurements of BVD-523 in thepresence of various polymer excipients (Figures 79 and 80) at different ratios that might serve as suitable dispersion polymers in an amorphous solid dispersion. The measured concentrations are compared as ratios to amorphous solubility (drug dosed without any polymer present in FaSSIF) after 30 minutes. Dissolution experiments were performed by dissolving BVD-523 in DMSO at 50 mg / mL. Each polymer was dissolved at 0.5 mg / mL and 2 mg / mL in FaSSIF (pH 6.5), which was prepared per the manufacturer’s directions.500 µL of the API in DMSO stock solution was introduced into 10 mL of polymer FaSSIF solution while stirring with a magnetic stir bar at 300 146rpm (dilution of BVD-523 to 0.5 mg / mL).0.5 mL aliquots were taken at the following time points: 1, 10, and 30 minutes. Aliquots were transferred to a 1.5 mL centrifuge tube and spun down at 13,000 rpm for 5 min. 100 µL of supernatant was sampled and diluted with 500 µL diluent for HPLC analysis EXAMPLE 8: Determination of the Pharmacokinetics of BVD 523 after Single Oral Capsule and Tablet Doses to Dogs in the Fed and Fasted States
[0440] Study Design
[0441] The test articles were administered in capsule and tablet form (See Table 34).Individual capsule and tablet doses for all phases were administered orally at a fixed dose of 50 mg. All animals were fasted from their regular feed ration overnight prior to each dose administration through approximately 4 hours post-dose. For animals in the fed state, approximately 100 g of blended and homogenized Food and Drug Administration (FDA) high-fat human diet was provided to each animal approximately 30 minutes prior to dosing. Immediately following capsule or tablet administration, each animal was administered approximately 20 mL of water by oral gavage. To stimulate gastric secretion in the fasted state, each animal received a single 6-µg / kg intramuscular injection of pentagastrin (60 µg / mL, 0.1 mL / kg) approximately 30 minutes prior to test article administration.
[0442] Blood (approximately 2 mL) was collected from a jugular vein pre-dose and atapproximately 0.5, 1, 2, 4, 6, 8, 12, and 24 hours post-dose. Plasma samples were analyzed for concentrations of BVD-523 using an established liquid chromatography / mass spectrometry (LC- MS / MS) method. Noncompartmental analysis was applied to the individual BVD-523 concentration data. 147
[0443] A summary of the mean pharmacokinetic parameters is presented in Table 40.Table 40. Mean Pharmacokinetic Parameters in Plasma Collected from Dogs Following Single Oral Doses of BVD-523 in the Fed and Fasted States Cmax Tmax AUC0-t AUC0-inf t½ Formulation Feed State n / mL hr n ∙hr / mL n ∙hr / mL hr
[0444] Following administration of Capsule A to dogs in the fed state, peak concentrationsof BVD-523 in plasma averaged 419 ± 158 ng / mL and occurred at 4.00 ± 0.00 hours post-dose. BVD-523 was eliminated from plasma with an apparent terminal half-life of 3.47 ± 2.50 hours. When Capsule A was administered to dogs in the fasted state, peak concentrations of BVD-523 in plasma averaged 258 ± 135 ng / mL and occurred at 3.00 ± 1.10 hours (range 2.00 to 4.00 hours) post-dose. BVD-523 was eliminated from plasma with an apparent terminal half-life of 2.18 ± 0.325 hours.
[0445] Dogs dosed Capsule B in the fed state had peak concentrations of BVD-523 inplasma that averaged 951 ± 270 ng / mL and occurred at 3.33 ± 1.03 hours (range 2.00 to 4.00 hours) post-dose. BVD-523 was eliminated from plasma with an apparent terminal half-life of 3.20 ± 0.964 hours. 148
[0446] When Capsule B was administered to dogs in the fasted state, peak concentrationsof BVD-523 in plasma averaged 493 ± 208 ng / mL and occurred at 3.67 ± 0.816 hours (range 2.00 to 4.00 hours) post-dose. BVD-523 was eliminated from plasma with an apparent terminal half- life of 2.67 ± 0.694 h.
[0447] Peak concentrations of BVD-523 in plasma averaged 910 ± 196 ng / mL andoccurred at 3.67 ± 0.816 hours (range 2.00 to 4.00 hours) following administration of tablets in the fed state. BVD-523 was eliminated from plasma with an apparent terminal half-life of 2.45 ± 0.571 hours. When the tablets were administered to dogs in the fasted state, peak concentrations of BVD- 523 in plasma averaged 453 ± 218 ng / mL and occurred at 3.67 ± 1.51 hours (range 2.00 to 6.00 hours) post-dose. BVD-523 was eliminated from plasma with an apparent terminal half-life of 2.22 ± 1.02 hours.
[0448] For each of the tested 50-mg capsule and tablet formulations, the systemic exposureof dogs to BVD-523 was approximately 2-fold higher in the fed state than in the fasted state. Based on the group mean plasma Cmax and AUC, the highest exposure to BVD-523 was achieved with the Capsule B and the tablet formulations. EXAMPLE 9: Characterization of BVD-523 Solid Dispersions at Various API Loadings
[0449] Twelve BVD-523 polymers dispersion formulations were chosen for feasibilityscreening. These formulations were spray dried from a solution of 90:10 Acetone:water that contained a BVD-523:polymer ratio ranging from 25% to 75%. A summary of spray drying parameters (Table 41) and isolated dry yields of the spray dried dispersions can be found in Table 42. Table 41: Spray Drying Parameters for the Manufacturing of the Solid Dispersion Formulations 149Parameter Setpoint Sprayer Dryer Buchi B290Table 42: Spray Drying Yields of BVD-523 Binary Dispersions at Various API Loadings SDD Formulations Yield (%)
[0450] Spray dried dispersion formulations were characterized by powder X-raydiffraction (XRPD) and in vitro dissolutions tests. Based on dissolution results and manufacturability, a subset of the initial solid dispersions prepared were further characterized by scanning electron microscopy (SEM), modulated differential scanning calorimetry (mDSC), and dynamic vapor sorption (DVS). Characterization by XRPD indicates that the solid dispersions are 150amorphous with the presence of crystalline peaks not observed in the diffractograms (Figures 81- 83).
[0451] The dissolution performance of the amorphous solid dispersion formulations wastested in a fed-fasted non-sink dissolution test. The dissolution test measures the supersaturation of drug and compares the solubility of BVD-523 between fed and fasted conditions in biorelevant intestinal media. During the test, samples were transferred from FaSSGF / FeSSGF [theoretical Cmax = 556 µA / mL] to FaSSIF / FeSSIF [theoretical Cmax = 278µA / mL]. The dissolution profiles are presented in Figures 84-85. The concentration of BVD-523 at specific time points following transfer to FaSSIF and the area under the curve following gastric transfer from 35 to 390 minutes (AUC35-390 FaSSIF) are reported in Tables 43-44. Table 43. Fasted State Non-Sink Dissolution Test for BVD-523 Amorphous Solid Dispersion Formulations ulation Cmax FaSSIFaC30bAUcSolid Dispersion Form C35-390 FaSSIF(µg / mL) (µg / mL) (min∙µg / mL)c. AUC35-390 FaSSIF = area under curve after transfer to FaSSIF from 35 to 390 minutesTable 44. Fed State Non-Sink Dissolution Test for BVD-523 Amorphous Solid Dispersion Formulations 151sion Formulation Cmax FeSSIFaC450bAUC9cSolid Disper5-450 FeSSIF(µg / mL) (µg / mL) (min∙µg / mL)d. ND = not determined
[0452] Results from the comparison of the amorphous solid dispersion formulations tocrystalline BVD-523 free base in the fed-fasted dissolution test are summarized in Figures 86-87 and Tables 45-46. Table 45. Fasted State Non-Sink Dissolution of BVD-523 Amorphous Solid Dispersion Formulations and Crystalline BVD-523 Free Base ation CmaCbAUCcSolid Dispersion Formul ax FaSSIF 390 35-390 FaSSIF ( / mL) ( / mL) (min∙ / mL)c. AUC35-390 FaSSIF = area under curve after transfer to FaSSIF from 35 to 390 minutesTable 46. Fed State Non-Sink Dissolution of BVD-523 Amorphous Solid Dispersion Formulations and Crystalline BVD-523 Free Base Solid Dispersion Formulation Cmax FeSSIFaC450bAUC95-450 FeSSIFc(µg / mL) (µg / mL) (min∙µg / mL) BVD-523 (crystalline) 22.2 22.2 4700d. ND = not determined
[0453] Thermal analysis by mDSC demonstrated that all dispersions have a single Tg(Figure 88) indicating an intimately mixed, homogeneous amorphous solid dispersion (Table 47). Table 47: mDSC Data for BVD-523 Amorphous Solid Dispersions (50:50 BVD- 523:Polymer) Solid Dispersion Formulation Measured Tg(°C) 50:50 BVD-523:HPMCP HP-55 121
[0454] Surface morphology of the amorphous solid dispersion particles was characterizedusing scanning electron microscopy. The SEM images in Figure 89 represent images of the BVD- 523 amorphous solid dispersion particles at 5,000x magnification. The morphology of the particles consists of whole and collapsed spheres with smooth surfaces. Crystalline material was not observed in any samples.
[0455] The water adsorption profile of the 50:50 BVD-523:Polymer solid dispersions wasanalyzed by DVS to measure the percent weight gain in response to changes in humidity (Figure 90). The amorphous solid dispersions adsorb up to 4.7 weight percent of water at 95% RH due to contribution of the polymer components. Sorption hysteresis is observed as the water desorption process in the dispersion is slightly slower than the adsorption phase. 153
[0456] The embodiments described in this disclosure can be combined in various ways.Any aspect or feature that is described for one embodiment can be incorporated into any other embodiment mentioned in this disclosure. While various novel features of the inventive principles have been shown, described and pointed out as applied to particular embodiments thereof, it should be understood that various omissions and substitutions and changes can be made by those skilled in the art without departing from the spirit of this disclosure. Those skilled in the art will appreciate that the inventive principles can be practiced in other than the described embodiments, which are presented for purposes of illustration and not limitation. VARIOUS EMBODIMENTS Embodiment 1. A solid dispersion form of ulixertinib. Embodiment 2. The form according to any preceding embodiment, wherein from about 25% to about 100% by weight of the ulixertinib is amorphous according to Differential Scanning Calorimetry (DSC) or powder X-ray diffraction (XRPD). Embodiment 3. The form according to any preceding embodiment, wherein the solid dispersion form of ulixertinib is characterized by an XRPD substantially similar to one or more of the XRPDs of Figures 2-7, 20-24, 28, 33, 35, 39, 46-52, 55-58, 60, 62-63, 66-69, 72-73, and 81-83. Embodiment 4. The form according to any preceding embodiment, wherein the solid dispersion form of ulixertinib is characterized by a Thermogram substantially similar to Figures 8-19, 29, 34, 40, 53, 59, 61, 71, 74-75, and 88. 154Embodiment 5. The form according to any preceding embodiment, wherein the form has the appearance of a single glass transition temperature (Tg). Embodiment 6. The form according to any preceding embodiment, wherein a Tg of a form increases with an increased ulixertinib concentration. Embodiment 7. The form according to any preceding embodiment, wherein the form when stressed at 40°C / 75% RH for at least 1 week, at least 4 weeks, or at least 6 weeks, is x-ray amorphous according to XRPD. Embodiment 8. The form according to any preceding embodiment, wherein the form when stressed at 40°C / 75% RH for 3 months is x-ray amorphous according to XRPD. Embodiment 9. The form according to any preceding embodiment, wherein the form when stressed at 40°C / 75% RH for 6 months is x-ray amorphous according to XRPD. Embodiment 10. The form according to any preceding embodiment, wherein the form when stressed at 40°C / 75% RH for greater than 6 months is x-ray amorphous according to XRPD. Embodiment 11. A microgranule comprising the solid dispersion form of ulixertinib as described in any preceding embodiment. Embodiment 12. The microgranule of any preceding embodiment, further comprising a polymer. Embodiment 13. The microgranule of any preceding embodiment, wherein the polymer comprises one or more of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1551000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcellulose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Poly(methacrylic acid-co-methyl methacrylate) (1:1), Soluplus (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer) and combinations thereof. Embodiment 14. The microgranule of any preceding embodiment, wherein the microgranule comprises 15-75 wt% of at least one polymer. Embodiment 15. The microgranule of any preceding embodiment, wherein the microgranule comprises 40-60 wt% of at least one polymer. Embodiment 16. The microgranule of any preceding embodiment, wherein the microgranule comprises 19-30 wt% of at least one polymer. Embodiment 17. The microgranule of any preceding embodiment, wherein the microgranule comprises 42-44 wt% of at least one polymer. Embodiment 18. The microgranule of any preceding embodiment, wherein the microgranule comprises equal amounts of ulixertinib and polymer. Embodiment 19. The microgranule of any preceding embodiment, further comprising an intragranular release controlling agent. 156Embodiment 20. The microgranule of any preceding embodiment, wherein the intragranular release controlling agent comprises between about 1 wt% to about 40 wt% of the microgranule. Embodiment 21. The microgranule of any preceding embodiment, wherein the intragranular release controlling agent comprises between about 2 wt% to about 30 wt% of the microgranule. Embodiment 22. The microgranule of any preceding embodiment, wherein the intragranular release controlling agent comprises about 4 wt% to about 22 wt% of the microgranule. Embodiment 23. The microgranule of any preceding embodiment, wherein the intragranular release controlling agent comprises one or more pharmaceutically acceptable excipients. Embodiment 24. The microgranule of any preceding embodiment, wherein the one or more of a pharmaceutically acceptable excipients is selected from the group consisting of disintegrants, crospovidone, sodium starch glycolate, corn starch, microcrystalline cellulose, cellulosic derivatives, sodium bicarbonate, and sodium alginate and combinations thereof. Embodiment 25. The microgranule of any preceding embodiment, further comprising a surfactant. Embodiment 26. The microgranule of any preceding embodiment, wherein the surfactant is a non- ionic or anionic surfactant. Embodiment 27. The microgranule of any preceding embodiment, wherein the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 10 wt% of the microgranule. Embodiment 28. The microgranule of any preceding embodiment, wherein the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 1.5 wt% of the microgranule. 157Embodiment 29. The microgranule of any preceding embodiment, wherein the non-ionic or anionic surfactant comprises about 1.0 wt% of the microgranule. Embodiment 30. The microgranule of any preceding embodiment, wherein the non-ionic surfactant comprises a poloxamer. Embodiment 31. The microgranule of any preceding embodiment, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS). Embodiment 32. The microgranule of any preceding embodiment, further comprising an antioxidant. Embodiment 33. The microgranule of any preceding embodiment, wherein the antioxidant is selected from the group consisting of butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT) and propyl gallate (PG). Embodiment 34. The microgranule of any preceding embodiment, wherein the antioxidant comprises between about 0.1 wt% to about 3 wt% of the microgranule. Embodiment 35. The microgranule of any preceding embodiment, wherein the antioxidant comprises between about 0.5 wt% to about 1 wt% of the microgranule. 158Embodiment 36. A pharmaceutical composition comprising the microgranule of any preceding embodiment. Embodiment 37. The pharmaceutical composition of any preceding embodiment, further comprising one or more pharmaceutically acceptable excipients. Embodiment 38. The pharmaceutical composition of any preceding embodiment, wherein the composition comprises a tablet, pill, capsule, caplet, gelcap, geltab, or sachet. Embodiment 39. The pharmaceutical composition of any preceding embodiment, wherein the pharmaceutical composition comprises a disintegrant. Embodiment 40. A pharmaceutical composition comprising solid dispersion (SD) ulixertinib, a polymer, a surfactant, and a release controlling agent. Embodiment 41. The pharmaceutical composition of any preceding embodiment, comprising SD ulixertinib, HPMC-AS, SLS, and croscarmellose Na (CS). Embodiment 42. The pharmaceutical composition of any preceding embodiment, wherein the pharmaceutical composition is a tablet, pill, capsule, caplet, gelcap, geltab, or sachet. Embodiment 43. The pharmaceutical composition of any preceding embodiment, further comprising fillers, glidants and / or lubricants. Embodiment 44. The pharmaceutical composition of any preceding embodiment, wherein the composition comprises one of the formulations set forth in Table 34. 159Embodiment 45. The pharmaceutical composition of any preceding embodiment, wherein the composition comprises the following formulation: Ingredients Solid Dispersion TabletsIntragranular Components % Formula mg / tabletEmbodiment 46. A process for producing a solid dispersion of ulixertinib comprising: a. obtaining a slurry or a solution of a solvent, ulixertinib, a polymer and a surfactant, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water; and b. spray drying the slurry or solution. Embodiment 47. The process of any preceding embodiment, wherein the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol. Embodiment 48. A process for producing a solid dispersion of ulixertinib comprising: a. obtaining a slurry or a solution of a solvent, ulixertinib, HPMC-AS and poloxamer 407, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water; and 160b. spray drying the slurry or solution. Embodiment 49. A process for producing a solid dispersion of ulixertinib comprising spray drying a slurry or a solution of a solvent, ulixertinib, HPMC-AS and poloxamer 407, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water. Embodiment 50. The process of any preceding embodiment, wherein the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol. Embodiment 51. A process for producing a solid dispersion form of ulixertinib comprising the steps listed in Figures 76 and 77. Embodiment 52. A solubility-enhanced composition comprising: an active agent which is 4- (5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3- chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) and pharmaceutically acceptable salts thereof, and a water soluble, biologically compatible polymer, wherein the solubility-enhanced composition is resistant to an undesirable form change. Embodiment 53. The composition according to any preceding embodiment further comprising a surfactant. Embodiment 54. The composition according to any preceding embodiment, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), 161Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof. Embodiment 55. The composition according to any preceding embodiment, wherein the surfactant is SLS. Embodiment 56. The composition according to any preceding embodiment, wherein the water soluble, biologically compatible polymer is selected from the group consisting of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcelluolose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Soluplus (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer), Poly(methacrylic acid-co-methyl methacrylate) (1:1) and combinations thereof. Embodiment 57. The composition according to any preceding embodiment, wherein the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate. Embodiment 58. The composition according to any preceding embodiment, which is selected from the group consisting of a solid amorphous dispersion, a lipid vehicle comprising said 162ulixertinib, a solid adsorbate comprising ulixertinib adsorbed onto a substrate, nanoparticles, adsorbates of ulixertinib in a crosslinked polymer, a nanosuspension, a supercooled form, an ulixertinib / cyclodextrin drug form, a softgel form, a self-emulsifying form, a three-phase ulixertinib form, a crystalline highly soluble form, a high-energy crystalline form, a hydrate or solvate crystalline form, an amorphous form, a mixture of ulixertinib and a solubilizing agent, and a solution of said ulixertinib dissolved in a liquid. Embodiment 59. The composition according to any preceding embodiment, which is a spray- dried dispersion. Embodiment 60. The composition according to any preceding embodiment, which is an amorphous solid dispersion and the active agent is 4-(5-chloro-2-isopropylaminopyridin-4-y1)- 1H-pyrrole29-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide and pharmaceutically acceptable salts thereof. Embodiment 61. The composition according to any preceding embodiment, wherein the undesirable form change is a conversion to Form A. Embodiment 62. The composition according to any preceding embodiment, which comprises about 60% to about 90% by weight of the free base of ulixertinib. Embodiment 63. The composition according to any preceding embodiment, which comprises about 70% to about 80% by weight of the free base of ulixertinib. Embodiment 64. The composition according to any preceding embodiment, which comprises about 70% by weight of the free base of ulixertinib. 163Embodiment 65. The composition according to any preceding embodiment, which comprises about 10% to about 40% by weight hydroxypropyl methylcellulose acetate succinate. Embodiment 66. The composition according to any preceding embodiment, which comprises about 17.5% to about 22.5% by weight hydroxypropyl methylcellulose acetate succinate. Embodiment 67. The composition according to any preceding embodiment, which comprises about 19% by weight hydroxypropyl methylcellulose acetate succinate. Embodiment 68. The composition according to any preceding embodiment, which comprises about 29% by weight hydroxypropyl methylcellulose acetate succinate. Embodiment 69. The composition according to any preceding embodiment, which comprises about 0.1% to about 5% by weight SLS. Embodiment 70. The composition according to any preceding embodiment, which comprises about 0.5% to about 2% by weight SLS. Embodiment 71. The composition according to any preceding embodiment, which comprises about 1% by weight SLS. Embodiment 72. A solid dispersion composition comprising: (a) from about 50% to about 90% by weight of 4-(5-chloro-2- isopropylaminopyridin- 4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base; (b) a water soluble, biologically compatible polymer; and a 164(c) surfactant, wherein from about 25% to about 100% by weight of the ulixertinib free base is non-crystalline, and wherein the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate. Embodiment 73. A solid dispersion composition comprising: (a) about 70%-80% by weight of 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H- pyrrole-2-carboxylic acid (S)- [1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base; (b) about 19%-29% by weight of hydroxypropyl methylcellulose acetate succinate; and (c) about 1% by weight of a surfactant. Embodiment 74. The composition according to any preceding embodiment, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof. Embodiment 75. The composition according to any preceding embodiment, wherein the surfactant is SLS. 165Embodiment 76. The composition according to any preceding embodiment, which is an amorphous solid dispersion. Embodiment 77. The composition according to any preceding embodiment, which is a spray dried dispersion. Embodiment 78. A method of forming a solubility-enhanced pharmaceutical dosage form comprising the steps of: (a) providing a spray-dried amorphous dispersion comprising particles, the particles comprising 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1- (3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base, a water soluble, biologically compatible polymer, and a surfactant, the dispersion having an average particle diameter of less than 100 µm; (b) performing one or more of blending, milling, de-lumping, and roller compacting of the particles; and (c) forming the pharmaceutical dosage form by compressing the product of step (b) to form a tablet or encapsulating the product of step (b) to form a capsule. Embodiment 79. A method of manufacturing a solubility-enhanced pharmaceutical dosage form, the method comprising the steps of: (a) providing a mixture of 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2- carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base, hydroxypropyl methylcellulose acetate succinate, and sodium lauryl sulfate (SLS), in a solvent or mixture of solvents; (b) spraying the mixture of step (a) to form a dispersion of droplets; 166(c) drying the solvent from the dispersion to form an amorphous solid dispersion, which substantially does not convert to Form A when in contact with an environment with a low pH and an elevated chloride concentration; and (d) forming the pharmaceutical dosage form by at least one of compressing the amorphous solid dispersion of step (c) to form a tablet or encapsulating the product from step (c) to form a capsule. Embodiment 80. The method according to any preceding embodiment, wherein the solvent is an organic solvent. Embodiment 81. The method according to any preceding embodiment, wherein the solvent is about 75% (vol) to about 100% (vol) acetone. Embodiment 82. The method according to any preceding embodiment, wherein the solvent is about 90% (vol) acetone. Embodiment 83. The method according to any preceding embodiment, wherein the solvent is about a 90:10 mixture of acetone and water (vol:vol). Embodiment 84. A pharmaceutical composition comprising the composition according to any preceding embodiment and optionally an agent selected from the group consisting of a binding agent, a diluent, a glidant, a disintegrant, a lubricant and combinations thereof. Embodiment 85. The pharmaceutical composition according to any preceding embodiment, which is formulated as a tablet, capsule, caplet, gelcap, geltab, or sachet. 167Embodiment 86. A method of treating a cancer in a subject in need thereof comprising administering to the subject an effective amount of a form according to any preceding embodiment, a microgranule according to any preceding embodiment, a pharmaceutical composition according to any preceding embodiment, or a composition according to any preceding embodiment. Embodiment 87. The method according to any preceding embodiment, wherein the subject is a mammal. Embodiment 88. The method according to any preceding embodiment, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals. Embodiment 89. The method according to any preceding embodiment, wherein the mammal is a human. Embodiment 90. The method according to any preceding embodiment, further comprising administering to the subject at least one additional anti-cancer agent. Embodiment 91. The method according to any preceding embodiment, wherein the at least one additional anti-cancer agent is selected from the group consisting of cabozantinib, lenvatinib, nivolumab, atezolizumab, venetoclax, alectinib, cobimetinib, daratumumab, elotuzumab, panobinostat, palbociclib, talimogene laherparepvec, pembrolizumab, lenvatinib, trifluridine, tipiracil, ixazomib, sonidegib, irinotecan, nivolumab, necitumumab, osimertinib, dinutuximab, rolapitant, uridine triacetate, trabectedin, netupitant, palonosetron, belinostat, blinatumomab, ramucirumab, ibrutinib, pembrolizumab, olaparib, idelalisib, ceritinib, obinutuzumab, afatinib, ibrutinib, ado-trastuzumab emtansine, trametinib, pomalidomide, lenalidomide, regorafenib, dabrafenib, mechlorethamine, denosumab, radium Ra 223 dichloride, paclitaxel, everolimus, 168everolimus, bosutinib, cabozantinib, vismodegib, ponatinib, axitinib, carfilzomib, vincristine sulfate, tbo-filgrastim, ingenol mebutate, regorafenib, fentanyl, omacetaxine mepesuccinate, pertuzumab, pazopanib, enzalutamide, ziv-aflibercept, brentuximab vedotin, everolimus, asparaginase Erwinia chrysanthemi, sunitinib, peginterferon alfa-2b, vandetanib, crizotinib, ipilimumab, vemurafenib, abiraterone, eribulin, trastuzumab, cabazitaxel, sipuleucel-T, denosumab, ondansetron, everolimus, ofatumumab, bevacizumab, Human Papillomavirus Bivalent (Types 16 and 18) Vaccine, rasburicase, pralatrexate, romidepsin, pazopanib, degarelix, levoleucovorin, plerixa, granisetron, bendamustine, raloxifene, topotecan, ixabepilone, nilotinib, temsirolimus, lapatinib, quadrivalent human papillomavirus (types 6, 11, 16, 18) vaccine, dasatinib, sunitinib, panitumumab, nelarabine, sorafenib, pemetrexed, bevacizumab, clofarabine, cetuximab, cinacalcet, erlotinib, OSI 774, palonosetron, bexxar, aprepitant, gefitinib, abarelix, conjugated estrogen, alfuzosin, bortezomib, oxaliplatin, leuprolide, 5- fluorouracil, leucovorin, fulvestrant, imatinib, neulasta, secretin, ibritumomab tiuxetan, zoledronic acid, campath, letrozole, imatinib, granisetron, triptorelin pamoate, xeloda, gemtuzumab ozogamicin, triptorelin pamoate, arsenic trioxide, leuprolide, aromasin, busulflex, doxorubicin, ellence, temodar, uvadex, zofran, amifostine, actiq, anzemet, camptosar, gemcitabine, herceptin, neupogen, nolvadex, photofrin, proleukin, sclerosol, valstar, xeloda, bromfenac, letrozole, polifeprosan 20, carmustine, interferon alfa-2b, granisetron, leuprolide, neumega, samarium Sm 153 lexidronam, rituxan, taxol, anexsia, pamidronate, anastrozole, campostar, flutamide, gemcitabine, topotecan, sargramostim, leuprolide, docetaxel, goserelin, amifostine, sargramostim, chloroquine, hydroxychloroquine, encorafenib, ruxolitinib, lonsurf, sotorasib, adagrasib, pharmaceutically acceptable salts thereof and combinations thereof. 169Embodiment 92. The method according to any preceding embodiment, wherein the at least one additional anti-cancer agent is a BRAF inhibitor. Embodiment 93. The method according to any preceding embodiment, wherein the BRAF inhibitor is selected from the group consisting of compound 7 ,,,, , ,compound ,compound ,compound ,174, ,, , ,AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. Embodiment 94. The method according to any preceding embodiment, wherein the BRAF inhibitor is vemurafenib or encorafenib. Embodiment 95. The method according to any preceding embodiment, wherein the BRAF inhibitor is provided as a solid dispersion. Embodiment 96. A process for producing a solid dispersion form of ulixertinib comprising the steps of: (a) providing a spray solution preparation comprising ulixertinib, HPMCAS-M polymer, and SLS surfactant; and (b) spray drying the solution of step (a). 177Embodiment 97. The process of any preceding embodiment, wherein the spray solution preparation further comprises one or more of acetone and water. Embodiment 98. The process of any preceding embodiment, wherein the spray drying of step (b) comprises one or more of: a spray solution flow rate of 28 (±5) mL / minute or 25 (±5) g / minute; a spray solution atomization pressure of 28 (±5) psi; an inlet drying gas temperature of 103 (±20) ºC; an outlet drying gas temperature of 47 (±5) ºC; a drying gas flow rate of about 35 kg / h; and a condenser outlet temperature of -20 (±5) ºC. Embodiment 99. The process of any preceding embodiment, further comprising the step of: (c) performing a secondary drying. Embodiment 100. The process of any preceding embodiment, wherein the secondary drying comprises a drying temperature set point of 40 ºC. Embodiment 101. A process for producing a solid dispersion form of ulixertinib comprising the steps of: (a) blending a composition of 70:29:1 ulixertinib:HPMCAS-M:SLS (SDI) with one or more of Avicel PH 102 (MCC), Partek M100 (Mannitol), Cab-o-sil M-5P (Colloidal silica), and Ac-Di-Sol (CCS). 178Embodiment 102. The process of any preceding embodiment, further comprising the step of (b) milling the blend of step (a) effective to deagglomerate the blended composition. Embodiment 103. The process of any preceding embodiment, further comprising the step of (c) blending the product of step (b). Embodiment 104. The process of any preceding embodiment, further comprising the step of (d) blending the product of step (c) to lubricate the product of step (c). Embodiment 105. The process of any preceding embodiment, further comprising the step of (e) compressing the blended product of step (d) to produce a tablet. 179
Claims
What is claimed is:
1. A solid dispersion form of ulixertinib.
2. The form according to claim 1, wherein from about 25% to about 100% by weight of the ulixertinib is amorphous according to Differential Scanning Calorimetry (DSC) or powder X-ray diffraction (XRPD).
3. The form according to claim 1, wherein the solid dispersion form of ulixertinib is characterized by an XRPD substantially similar to one or more of the XRPDs of Figures 2-7, 20-24, 28, 33, 35, 39, 46-52, 55-58, 60, 62-63, 66-69, 72-73, and 81-83.
4. The form according to claim 1, wherein the solid dispersion form of ulixertinib is characterized by a Thermogram substantially similar to Figures 8-19, 29, 34, 40, 53, 59, 61, 71, 74-75, and 88.
5. The form according to claim 1, wherein the form has the appearance of a single glass transition temperature (Tg).
6. The form according to of claim 1, wherein a Tg of a form increases with an increased ulixertinib concentration.
7. The form according to claim 1, wherein the form when stressed at 40°C / 75% RH for at least 1 week, at least 4 weeks, or at least 6 weeks, is x-ray amorphous according to XRPD.
8. The form according to claim 1, wherein the form when stressed at 40°C / 75% RH for 3 months is x-ray amorphous according to XRPD. 1809. The form according to claim 1, wherein the form when stressed at 40°C / 75% RH for 6 months is x-ray amorphous according to XRPD.
10. The form according to claim 1, wherein the form when stressed at 40°C / 75% RH for greater than 6 months is x-ray amorphous according to XRPD.
11. A microgranule comprising the solid dispersion form of ulixertinib as described in any one of claims 1-10.
12. The microgranule of claim 11, further comprising a polymer.
13. The microgranule of claim 12, wherein the polymer comprises one or more of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone- vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcellulose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene– polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, , Poly(methacrylic acid-co-methyl methacrylate) (1:1), Soluplus (polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol graft copolymer) and combinations thereof.
14. The microgranule of claim 13, wherein the microgranule comprises 15-75 wt% of at least one polymer. 18115. The microgranule of claim 14, wherein the microgranule comprises 40-60 wt% of at least one polymer.
16. The microgranule of claim 14, wherein the microgranule comprises 19-30 wt% of at least one polymer.
17. The microgranule of claim 14, wherein the microgranule comprises 42-44 wt% of at least one polymer.
18. The microgranule of claim 12, wherein the microgranule comprises equal amounts of ulixertinib and polymer.
19. The microgranule of claim 11, further comprising an intragranular release controlling agent.
20. The microgranule of claim 19, wherein the intragranular release controlling agent comprises between about 1 wt% to about 40 wt% of the microgranule.
21. The microgranule of claim 20, wherein the intragranular release controlling agent comprises between about 2 wt% to about 30 wt% of the microgranule.
22. The microgranule of claim 21, wherein the intragranular release controlling agent comprises about 4 wt% to about 22 wt% of the microgranule.
23. The microgranule of claim 19, wherein the intragranular release controlling agent comprises one or more pharmaceutically acceptable excipients.
24. The microgranule of claim 23, wherein the one or more of a pharmaceutically acceptable excipients is selected from the group consisting of disintegrants, crospovidone, sodium starch 182glycolate, corn starch, microcrystalline cellulose, cellulosic derivatives, sodium bicarbonate, and sodium alginate and combinations thereof.
25. The microgranule of claim 11, further comprising a surfactant.
26. The microgranule of claim 25, wherein the surfactant is a non-ionic or anionic surfactant.
27. The microgranule of claim 26, wherein the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 10 wt% of the microgranule.
28. The microgranule of claim 27, wherein the non-ionic or anionic surfactant comprises between about 0.5 wt% to about 1.5 wt% of the microgranule.
29. The microgranule of claim 28, wherein the non-ionic or anionic surfactant comprises about 1.0 wt% of the microgranule.
30. The microgranule of claim 26, wherein the non-ionic surfactant comprises a poloxamer.
31. The microgranule of claim 25, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS).
32. The microgranule of claim 11, further comprising an antioxidant.
33. The microgranule of claim 32, wherein the antioxidant is selected from the group consisting of butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT) and propyl gallate (PG). 18334. The microgranule of claim 32, wherein the antioxidant comprises between about 0.1 wt% to about 3 wt% of the microgranule.
35. The microgranule of claim 32, wherein the antioxidant comprises between about 0.5 wt% to about 1 wt% of the microgranule.
36. A pharmaceutical composition comprising the microgranule of any one of claims 11-35.
37. The pharmaceutical composition of claim 36, further comprising one or more pharmaceutically acceptable excipients.
38. The pharmaceutical composition of claim 36, wherein the composition comprises a tablet, capsule, caplet, gelcap, geltab, or sachet.
39. The pharmaceutical composition of claim 36, wherein the pharmaceutical composition comprises a disintegrant.
40. A pharmaceutical composition comprising solid dispersion (SD) ulixertinib, a polymer, a surfactant, and a release controlling agent.
41. The pharmaceutical composition of claim 40, comprising SD ulixertinib, HPMC-AS, SLS, and croscarmellose Na (CS).
42. The pharmaceutical composition of claim 40, wherein the pharmaceutical composition is a tablet, pill, capsule, caplet, gelcap, geltab, or sachet.
43. The pharmaceutical composition of claim 40, further comprising fillers, glidants and / or lubricants. 18444. The pharmaceutical composition of any one of claims 40-43, wherein the composition comprises one of the formulations set forth in Table 34.
45. The pharmaceutical composition of any one of claims 40-43, wherein the composition comprises the following formulation: Ingredients Solid Dispersion TabletsIntragranular Components % Formula mg / tablet46. A process for producing a solid dispersion of ulixertinib comprising: a. obtaining a slurry or a solution of a solvent, ulixertinib, a polymer and a surfactant, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water; and b. spray drying the slurry or solution.
47. The process of claim 46, wherein the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol.
48. A process for producing a solid dispersion of ulixertinib comprising: 185a. obtaining a slurry or a solution of a solvent, ulixertinib, HPMC-AS and poloxamer 407, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water; and b. spray drying the slurry or solution.
49. A process for producing a solid dispersion of ulixertinib comprising spray drying a slurry or a solution of a solvent, ulixertinib, HPMC-AS and poloxamer 407, wherein the solvent comprises one or more of acetone, ethanol, methanol, and water.
50. The process of claim 49, wherein the solvent is a binary solvent selected from acetone / water, acetone / ethanol, and acetone / methanol.
51. A process for producing a solid dispersion form of ulixertinib comprising the steps listed in Figures 76 and 77.
52. A solubility-enhanced composition comprising: an active agent which is 4-(5-chloro-2- isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2- hydroxyethyl]amide (ulixertinib) and pharmaceutically acceptable salts thereof, and a water soluble, biologically compatible polymer, wherein the solubility-enhanced composition is resistant to an undesirable form change.
53. The composition according to claim 52 further comprising a surfactant.
54. The composition according to claim 53, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide 186(CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof.
55. The composition according to claim 53, wherein the surfactant is SLS.
56. The composition according to claim 52, wherein the water soluble, biologically compatible polymer is selected from the group consisting of hydroxypropyl methylcellulose acetate succinate, hydroxypropyl methylcellulose phthalate, vinylpyrrolidone-vinyl acetate copolymer, polyvinyl pyrrolidone, carboxymethylethylcellulose, cellulose acetate phthalate, D-alpha-tocopheryl polyethylene glycol 1000 succinate, ethyl cellulose, gelucire 44 / 14, hydroxyethyl cellulose HEC, hydroxypropyl cellulose SL, hydroxypropyl methylcellulose, methacrylic acid copolymer, methylcellulose, pluronic F-68, poloxamer 188 P188, polyethylene glycol, polyethylene glycol monomethyl ether, polyoxyethylene (40) stearate, polyoxyethylene–polyoxypropylene copolymer, polysorbate 80, polyvinyl acetate phthalate, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone vinylacetate, Soluplus (polyvinyl caprolactam-polyvinyl acetate- polyethylene glycol graft copolymer), Poly(methacrylic acid-co-methyl methacrylate) (1:1) and combinations thereof.
57. The composition according to claim 52, wherein the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate.
58. The composition according to claim 52, which is selected from the group consisting of a solid amorphous dispersion, a lipid vehicle comprising said ulixertinib, a solid adsorbate comprising ulixertinib adsorbed onto a substrate, nanoparticles, adsorbates of ulixertinib in a crosslinked polymer, a nanosuspension, a supercooled form, an ulixertinib / cyclodextrin drug form, 187a softgel form, a self-emulsifying form, a three-phase ulixertinib form, a crystalline highly soluble form, a high-energy crystalline form, a hydrate or solvate crystalline form, an amorphous form, a mixture of ulixertinib and a solubilizing agent, and a solution of said ulixertinib dissolved in a liquid.
59. The composition according to claim 52, which is a spray-dried dispersion.
60. The composition according to claim 59, which is an amorphous solid dispersion and the active agent is 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole--2-carboxylic acid (S)-[1- (3-chlorophenyI)-2-hydroxyethyl]amide and pharmaceutically acceptable salts thereof.
61. The composition according to claim 59, wherein the undesirable form change is a conversion to Form A.
62. The composition according to claim 59, which comprises about 60% to about 90% by weight of the free base of ulixertinib.
63. The composition according to claim 59, which comprises about 70% to about 80% by weight of the free base of ulixertinib.
64. The composition according to claim 59, which comprises about 70% by weight of the free base of ulixertinib.
65. The composition according to claim 57, which comprises about 10% to about 40% by weight hydroxypropyl methylcellulose acetate succinate.
66. The composition according to claim 57, which comprises about 17.5% to about 22.5% by weight hydroxypropyl methylcellulose acetate succinate. 18867. The composition according to claim 57, which comprises about 19% by weight hydroxypropyl methylcellulose acetate succinate.
68. The composition according to claim 57, which comprises about 29% by weight hydroxypropyl methylcellulose acetate succinate.
69. The composition according to claim 55, which comprises about 0.1% to about 5% by weight SLS.
70. The composition according to claim 55, which comprises about 0.5% to about 2% by weight SLS.
71. The composition according to claim 55, which comprises about 1% by weight SLS.
72. A solid dispersion composition comprising: (a) from about 50% to about 90% by weight of 4-(5-chloro-2- isopropylaminopyridin- 4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base; (b) a water soluble, biologically compatible polymer; and a (c) surfactant, wherein from about 25% to about 100% by weight of the ulixertinib free base is non-crystalline, and wherein the water soluble, biologically compatible polymer is hydroxypropyl methylcellulose acetate succinate. 18973. A solid dispersion composition comprising: (a) about 70%-80% by weight of 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H- pyrrole-2-carboxylic acid (S)- [1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base; (b) about 19%-29% by weight of hydroxypropyl methylcellulose acetate succinate; and (c) about 1% by weight of a surfactant.
74. The composition according to claim 73, wherein the surfactant is selected from the group consisting of sodium lauryl sulfate (SLS), a sorbitan ester, a polyoxyethylene sorbitan fatty acid ester, cetylpyridinium chloride, calcium stearate, magnesium stearate, polyethylene glycol, Poloxamers (ethylene oxide propylene oxide copolymer), Cetyltrimethylammonium bromide (CTAB), Dodecyltrimethylammonium bromide (DTAB), Sodium taurocholate (STC), Triton and Tocopheryl polyethylene glycol succinate (TPGS) and combinations thereof.
75. The composition according to claim 74, wherein the surfactant is SLS.
76. The composition according to any one of claims 73-75, which is an amorphous solid dispersion.
77. The composition according to claim 76, which is a spray dried dispersion.
78. A method of forming a solubility-enhanced pharmaceutical dosage form comprising the steps of: (a) providing a spray-dried amorphous dispersion comprising particles, the particles comprising 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2-carboxylic acid (S)-[1- 190(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base, a water soluble, biologically compatible polymer, and a surfactant, the dispersion having an average particle diameter of less than 100 µm; (b) performing one or more of blending, milling, de-lumping, and roller compacting of the particles; and (c) forming the pharmaceutical dosage form by at least one of compressing the product of step (b) to form a tablet and encapsulating the product of step (b) to form a capsule.
79. A method of manufacturing a solubility-enhanced pharmaceutical dosage form, the method comprising the steps of: (a) providing a mixture of 4-(5-chloro-2-isopropylaminopyridin-4-y1)-1H-pyrrole-2- carboxylic acid (S)-[1-(3-chlorophenyI)-2-hydroxyethyl]amide (ulixertinib) free base, hydroxypropyl methylcellulose acetate succinate, and sodium lauryl sulfate (SLS), in a solvent or mixture of solvents; (b) spraying the mixture of step (a) to form a dispersion of droplets; (c) drying the solvent from the dispersion to form an amorphous solid dispersion, which substantially does not convert to Form A when in contact with an environment with a low pH and an elevated chloride concentration; and (d) forming the pharmaceutical dosage form by at least one of compressing the amorphous solid dispersion of step (c) to form a tablet and further encapsulating the tablet to form a capsule.
80. The method according to claim 79, wherein the solvent is an organic solvent. 19181. The method according to claim 79, wherein the solvent is about 75% (vol) to about 100% (vol) acetone.
82. The method according to claim 79, wherein the solvent is about 90% (vol) acetone.
83. The method according to claim 79, wherein the solvent is about a 90:10 mixture of acetone and water (vol:vol).
84. A pharmaceutical composition comprising the composition according to any one of claims 52-77 and optionally an agent selected from the group consisting of a binding agent, a diluent, a glidant, a disintegrant, a lubricant and combinations thereof.
85. The pharmaceutical composition according to claim 84, which is formulated as a tablet, capsule, caplet, gelcap, geltab, or sachet.
86. A method of treating a cancer in a subject in need thereof comprising administering to the subject an effective amount of a form according to any one of claims 1-10, a microgranule according to any one of claims 11-35, a pharmaceutical composition according to any one of claims 36-45, or a composition according to any one of claims 52-77.
87. The method according to claim 86, wherein the subject is a mammal.
88. The method according to claim 87, wherein the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.
89. The method according to claim 87, wherein the mammal is a human. 19290. The method according to claim 86, further comprising administering to the subject at least one additional anti-cancer agent.
91. The method according to claim 90, wherein the at least one additional anti-cancer agent is selected from the group consisting of cabozantinib, lenvatinib, nivolumab, atezolizumab, venetoclax, alectinib, cobimetinib, daratumumab, elotuzumab, panobinostat, palbociclib, talimogene laherparepvec, pembrolizumab, lenvatinib, trifluridine, tipiracil, ixazomib, sonidegib, irinotecan, nivolumab, necitumumab, osimertinib, dinutuximab, rolapitant, uridine triacetate, trabectedin, netupitant, palonosetron, belinostat, blinatumomab, ramucirumab, ibrutinib, pembrolizumab, olaparib, idelalisib, ceritinib, obinutuzumab, afatinib, ibrutinib, ado-trastuzumab emtansine, trametinib, pomalidomide, lenalidomide, regorafenib, dabrafenib, mechlorethamine, denosumab, radium Ra 223 dichloride, paclitaxel, everolimus, everolimus, bosutinib, cabozantinib, vismodegib, ponatinib, axitinib, carfilzomib, vincristine sulfate, tbo-filgrastim, ingenol mebutate, regorafenib, fentanyl, omacetaxine mepesuccinate, pertuzumab, pazopanib, enzalutamide, ziv-aflibercept, brentuximab vedotin, everolimus, asparaginase Erwinia chrysanthemi, sunitinib, peginterferon alfa-2b, vandetanib, crizotinib, ipilimumab, vemurafenib, abiraterone, eribulin, trastuzumab, cabazitaxel, sipuleucel-T, denosumab, ondansetron, everolimus, ofatumumab, bevacizumab, Human Papillomavirus Bivalent (Types 16 and 18) Vaccine, rasburicase, pralatrexate, romidepsin, pazopanib, degarelix, levoleucovorin, plerixa, granisetron, bendamustine, raloxifene, topotecan, ixabepilone, nilotinib, temsirolimus, lapatinib, quadrivalent human papillomavirus (types 6, 11, 16, 18) vaccine, dasatinib, sunitinib, panitumumab, nelarabine, sorafenib, pemetrexed, bevacizumab, clofarabine, cetuximab, cinacalcet, erlotinib, OSI 774, palonosetron, bexxar, aprepitant, gefitinib, abarelix, conjugated estrogen, alfuzosin, bortezomib, oxaliplatin, leuprolide, 5- fluorouracil, leucovorin, fulvestrant, 193imatinib, neulasta, secretin, ibritumomab tiuxetan, zoledronic acid, campath, letrozole, imatinib, granisetron, triptorelin pamoate, xeloda, gemtuzumab ozogamicin, triptorelin pamoate, arsenic trioxide, leuprolide, aromasin, busulflex, doxorubicin, ellence, temodar, uvadex, zofran, amifostine, actiq, anzemet, camptosar, gemcitabine, herceptin, neupogen, nolvadex, photofrin, proleukin, sclerosol, valstar, xeloda, bromfenac, letrozole, polifeprosan 20, carmustine, interferon alfa-2b, granisetron, leuprolide, neumega, samarium Sm 153 lexidronam, rituxan, taxol, anexsia, pamidronate, anastrozole, campostar, flutamide, gemcitabine, topotecan, sargramostim, leuprolide, docetaxel, goserelin, amifostine, sargramostim, chloroquine, hydroxychloroquine, encorafenib, ruxolitinib, lonsurf, sotorasib, adagrasib, pharmaceutically acceptable salts thereof and combinations thereof.
92. The method according to claim 90, wherein the at least one additional anti-cancer agent is a BRAF inhibitor.
93. The method according to claim 92, wherein the BRAF inhibitor is selected from the group consisting of compound ,194,,N ,, ,compound 28 ,198,199, ,, , ,( ovarts); - ( m t oscences), Q- ( rQue), RQ-761 (ArQule), AZ628 (Axon Medchem BV), BeiGene-283 (BeiGene), BIIB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CTT239065 201(Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
94. The method according to claim 92, wherein the BRAF inhibitor is vemurafenib or encorafenib.
95. The method according to claim 92, wherein the BRAF inhibitor is provided as a solid dispersion.
96. A process for producing a solid dispersion form of ulixertinib comprising the steps of: (a) providing a spray solution preparation comprising ulixertinib, HPMCAS-M polymer, and SLS surfactant; and (b) spray drying the solution of step (a).
97. The process of claim 96, wherein the spray solution preparation further comprises one or more of acetone and water.
98. The process of claim 96, wherein the spray drying of step (b) comprises one or more of: a spray solution flow rate of 28 (±5) mL / minute or 25 (±5) g / minute; 202a spray solution atomization pressure of 28 (±5) psi; an inlet drying gas temperature of 103 (±20) ºC; an outlet drying gas temperature of 47 (±5) ºC; a drying gas flow rate of about 35 kg / h; and a condenser outlet temperature of -20 (±5) ºC.
99. The process of claim 96, further comprising the step of: (c) performing a secondary drying.
100. The process of claim 99, wherein the secondary drying comprises a drying temperature set point of 40 ºC.
101. A process for producing a solid dispersion form of ulixertinib comprising the steps of: (a) blending a composition of 70:29:1 ulixertinib:HPMCAS-M:SLS (SDI) with one or more of Avicel PH 102 (MCC), Partek M100 (Mannitol), Cab-o-sil M-5P (Colloidal silica), and Ac-Di-Sol (CCS).
102. The process of claim 101, further comprising the step of (b) milling the blend of step (a) effective to deagglomerate the blended composition.
103. The process of claim 102, further comprising the step of (c) blending the product of step (b).
104. The process of claim 103, further comprising the step of (d) blending the product of step (c) to lubricate the product of step (c). 203105. The process of claim 104, further comprising the step of (e) compressing the blended product of step (d) to produce a tablet. 204
Citation Information
Patent Citations
Phenylaminopyrimidine amide autophagy inhibitors and methods of use thereof
US11530206B2
Treatment of cancers having driving oncogenic mutations
US20210030758A1
Methods for treating map3k8 positive cancers
US20220313700A1
Pharmaceutical combination of PRMT5 inhibitors
US20220395508A1
Spray-dried dispersions and formulations of (s)-5-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1-(1,1,1-trifluoro propan-2-YL)-1h-pyrazole-4-carboxamide
WO2020028258A1